articulo cientifico

[CANCER RESEARCH 59, 37303740, August 1, 1999]

Concurrent DNA Hypermethylation of Multiple Genes in Acute Myeloid Leukemia

John R. Melki,1 Paul C. Vincent, and Susan J. Clark2

Kanematsu Laboratories, Royal Prince Alfred Hospital, Camperdown, New South Wales 2050, Australia [J. R. M., P. C. V., S. J. C.]; Faculty of Medicine, University of Sydney,New South Wales 2006, Australia [J. R. M., P. C. V., S. J. C.]; and CSIRO, Molecular Science, Sydney Laboratory, P. O. Box 184, North Ryde, New South Wales 1670, Australia[S. J. C.]

ABSTRACT

Hypermethylation in cancer often occurs in CpG islands that span thepromoter regions of tumor suppressor genes. However, it is not clear ifhypermethylation is limited to single target genes or if multiple genes aresimultaneously methylated. To understand the extent of aberrantde novomethylation, we have analyzed the methylation pattern of a number oftumor-related genes in leukemia from the same cohort of patients. Weused bisulfite genomic sequencing to characterize the methylation patternof the CpG islands associated with thecalcitonin, estrogen receptor, E-cadherin,p15,p16,Rb,GST-Pi,and HIC1 genes in the bone marrow from9 normal and 20 patients with acute myeloid leukaemia (AML). All of thenormal control samples were essentially unmethylated for each of theeight tumor-related genes studied. In contrast, 19 of 20 (95%) of the AMLpatients had an abnormal methylation pattern in at least one gene, and 15of 20 (75%) had abnormal methylation patterns in two or more of thetarget genes. We conclude that there is a general deregulation of CpGisland methylation in leukemia and that hypermethylation is not limited tosingle genes, but a number of genes are methylated concurrently. More-over, the subset of genes that are commonly methylated in leukemiaappear to be cancer type specific.

INTRODUCTION

Methylation patterns are established in a tissue-specific mannerearly in mammalian development, mediated by a combination ofdemethylation andde novomethylation of cytosine residues primarilyat CpG dinucleotides (reviewed in Ref. 1). The methylation pattern ismaintained through subsequent cell divisions by the action of a DNAMTase3 enzyme (2). DNA methylation patterns are often altered incancer cells, with associated increases in the level of the DNA MTaseenzyme (36), widespread genomic hypomethylation, and simultane-ous regional increases in DNA methylation patterns (7, 8) having beenreported. Aberrant hypermethylation in cancer cells often occurs inthe CpG-rich promoter regions (CpG islands) of many tumor suppres-sor genes and is associated with gene inactivation (reviewed in Ref.9). Approximately half of the mammalian genes have CpG-rich pro-moter regions, and although most CpG dinucleotides are methylatedin the normal cell, the CpG dinucleotides of CpG islands are essen-tially unmethylated in all tissues (10). What protects CpG islands frommethylation, or moreover, what triggers hypermethylation in the can-cer cell is unknown.

To understand further the process of aberrant hypermethylation incancer, we have chosen to study DNA methylation patterns in leuke-mia. We have demonstrated previously that the levels of DNA MTasein leukemia are elevated 45-fold (6). In addition, DNA methylationpatterns are known to be altered in leukemia; a generalized hypo-methylation has been reported for B-cell chronic lymphocytic leuke-

mia (11), as well as specific regions of hypomethylation such as in theBcl-2oncogene (12), andtumor necrosis factora andb genes (13). Incontrast, hypermethylation of thecalcitoningene has been observed inacute and chronic leukemias and lymphomas (14, 15) and in patientswith myelodysplastic syndrome (16, 17). Hypermethylation is alsoseen in the cyclin-dependent kinase inhibitor genep15in patients withacute leukemias (18, 19). TheER gene is hypermethylated in acuteand chronic leukaemias, as well as in lymphomas (20). TheHIC1gene also has been reported to be frequently methylated in acutelymphoblastic leukemia but infrequently methylated in AMLs. There-fore, there is mounting evidence that a number of individual genes canbe abnormally methylated in leukemia. However, most of the previousstudies were performed in separate patient groups by restriction en-zyme analysis, and consequently, the methylation data are limited toa few CpG sites in individual genes. Hence, the extent of hyper-methylation measured previously in leukemia may not have beenrepresentative.

The mechanism responsible for abnormal methylation in cancer isunclear. In this study, we address whether aberrant methylation islimited to single target genes that provide the cell with a growthadvantage, similar to a random mutation, or whether multiple genesare susceptible to hypermethylation in the same cell, thereby implyinga general deregulation of CpG island methylation in cancer. We haveused sodium bisulfite genomic sequencing (2123) to re-examine inmore detail the patterns of aberrantde novomethylation in leukemiafrom the same patient cohort. In comparison to Southern analysis orMSP (24), bisulfite sequencing permits analysis of every cytosine inthe CpG-rich promoter regions of each target gene. In particular, weaddress whether critical CpG sites are commonly hypermethylatedand whether CpG island methylation is confined to a single locus ormultiple loci in the one cohort of patients.

MATERIALS AND METHODS

Tissue Samples.Bone marrow samples were aspirated from 20 patientspresenting with AML. The patients (11 males and 9 females) were between 22and 88 years of age, with a median age of 53 years. The proportion of marrowblasts was.70% in all cases. The bone marrow used as a normal control wasaspirated from the sternal cavity from nine patients who were undergoingcardiac surgery and who had given prior informed consent. The patients (sevenmales and two females) were between 19 and 74 years of age, with a medianage of 61 years, and no evidence of leukemia. The study was approved bythe Ethics Committee of Royal Prince Alfred Hospital (protocol numberX93-0073).

Methylation Analysis. DNA was isolated using TriZOL Reagent (LifeTechnologies, Inc.) from bone marrow cells that had been lysed in hypotoniclysis buffer. Bisulfite genomic sequencing was used to analyze the methylationpatterns. The bisulfite reaction was carried out for 16 h at 55C on 12mg ofHindIII-digested patient DNA, under conditions described by Clarket al. (22).After bisulfite conversion, the DNA was ethanol precipitated, dried, resus-pended in 100ml of TE buffer [10 mM Tris-HCl (pH 8) and 1 mM EDTA] andstored at220C. The primers used for amplification of sodium bisulfite-converted DNA are summarized in Table 1. Where direct sequencing was to beperformed, the (221)M13 universal primer sequence was incorporated into the59 end of inner primer 2. Nested PCR amplifications were performed on 13ml of bisulfite-treated genomic DNA in a reaction mix containing 200mM ofeach of the four deoxynucleotide triphosphates and 2 units of AmpliTaq DNA

Received 1/25/99; accepted 6/2/99.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby markedadvertisementin accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1 J. R. M. is the recipient of the Anthony Rothe Memorial Trust postgraduate schol-arship.

2 To whom requests for reprints should be addressed, at CSIRO, Molecular Science,Sydney Laboratory, P. O. Box 184, North Ryde, New South Wales 1670, Australia.Phone: (612) 94905148; Fax: (612) 94905005; E-mail: [email protected].

3 The abbreviations used are: MTase, methyltransferase; ER, estrogen receptor; AML,acute myeloblastic leukemia; MSP, methylation-specific PCR.

3730

Research. on February 22, 2015. 1999 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

polymerase (Perkin-Elmer). The reactions were performed in either 25ml ofreaction mixtures containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), and 100ng of each primer or in 50-ml reactions containing 67 mM Tris, 16.6 mMammonium sulfate, 1.7 mg/ml BSA, and 10 mM b-mercaptoethanol in TEbuffer and 300 ng of each primer. The volume of the PCR for each gene is asnoted in Table 1. Reactions were cycled in a Hybaid DNA Thermal Cyclerwith variable MgCl2 concentrations as detailed in Table 1. The standard PCRreaction was performed by the following cycling conditions: 96C/3 min for 1cycle; 95C/1 min,a1C/2 min, 72C/3 min, for 5 cycles; 95C/1 min,a2C/2min, 72C/2 min, for 23 cycles; and 72C/4 min for 1 cycle, wherea1 anda2are annealing temperatures 1 and 2, respectively, described in Table 1. All ofthe primers used were shown to amplify methylated and unmethylated DNAwithout major bias under these PCR conditions (25).

Direct Sequencing.For automated direct sequencing, the PCR productswere amplified using the internal forward primer that included the (221)M13universal primer sequence. Direct PCR sequencing reactions were performedusing a PRISM Dye Primer Cycle sequencing kit (221 M13 Fwd) withAmpliTaq FS (Perkin-Elmer) on an automated 373A DNA Sequencer (ABI).Sequencing reactions were performed as recommended by the manufacturer.The amount of methylcytosine of each CpG dinucleotide was quantitated bycomparing the peak height of the cytosine signal with the peak height of thecytosine plus thymine signal. When using direct sequencing, it is often difficultto assess methylation levels,15% due to the variable sequencing backgroundsignal.

RESULTS

We have used bisulfite genomic sequencing to characterize theoverall methylation profile of the CpG islands associated withcalci-tonin, ER,E-cadherin, p15,p16, Rb, GST-pi,andHIC1 in the bonemarrow of patients with AML. We have shown previously that theexpression of DNA MTase was increased in a number of the AML

patients analyzed in this study (6). Twenty patients withde novoAML, spanning ages 2288 years, and nine normal controls, spanningages 1974 years, were assayed. The bone marrow from the AMLpatients contained.70% blast cells. Therefore, due to the low amountof normal cell contamination, the methylation levels that are presentedrepresent minimal values. The genes that we sequenced were selectedon the basis of being hypermethylated either in leukemia or othercancers or on the basis on our preliminary Southern analysis data thatindicated the genes were hypermethylated in the AML samples (datanot shown). We chose to analyze the methylation data by direct PCRsequencing because this provides a semiquantitative estimate of themethylation levels in the sample, and individual CpG sites could beassessed in the one reaction. A summary of the genomic sequencingresults for each of the eight individual genes analyzed is presentedbelow, followed by an overall summary of the methylation state of thegenes for each patient.

Calcitonin Gene. It has been well established that thecalcitoningene, which lies on chromosome 11p15.2, is a hot spot for methy-lation in leukemia. The CpG rich 59 region of thecalcitoningene wasfound previously to be methylated in 7895% of acute leukemias bySouthern analysis (16, 26) or genomic sequencing (27). To correlatethe methylation profile of thecalcitonin gene in AML with themethylation profile of the other target genes, we used bisulfitegenomic sequencing. Fig. 1 shows the sequence map of the 19 CpGsites in the central CpG rich island close to the transcription start sitethat were sequenced. There was a low level (,25%) of methylation atone to two CpG sites in approximately half the normal bone marrowsamples, and these methylated sites were localized downstream to thestart of transcription. In contrast, 12 of 17 (71%) of the AML patients

Table 1 Summary of PCR amplification conditions

Gene(acc. no.)a Primer (coordinates) Sequence MgCl2 (mM) a1/a2

b (C) Volume (ml)

Calcitonin Outer1 (18401860) GGTATTAGAGATATTGTTTAGTTTAAGTGT(X15943) Outer2 (21972219) ATCCCTAAAAAACCTAAATATCC 1.5 50/50 25

Inner1M13 (18691879) TGTAAAACGACGGCCAGTTTTTTATAGGGTTTTGGTTGInner2 (21692194) AAACTAACCTAAACCTATATACAATA 1.5 50/50 25

ER Outer1 (30123036) GATTTTTTATATTAAAGTATTTGGG(X62462) Outer2 (32813308) CTATTAAATAAAAAAAAACCCCCCAAAC 1.5 50/50 25

Inner1M13 (30413063) TGTAAAACGACGGCCAGTTTTATTGTATTAGATTTAAGGGInner2 (32813308) CTATTAAATAAAAAAAAACCCCCCAAAC 1.5 50/50 25

E-Cadherin Outer1 (791820) ATTTAGTGGAATTAGAATAGTGTAGGTTTT(L34545) Outer2 (11391165) CTACAACTCCAAAAACCCATAACTAAC 2.0 55/55 25

Inner1M13 (841858) TGTAAAACGACGGCCAGTTTAGTAATTTTAGGTTAGAGGGInner2 (11391165) CTACAACTCCAAAAACCCATAACTAAC 2.0 55/55 25

p15 Outer1 (5992) GTTTTTTGGTTTAGTTGAAAAGGGAATTTTTTGT(S75756) Outer2 (633607) AACCCTAAAACCCCAACTACCTAAATC 1.5 50/50 50

Inner1M13 (87105) TGTAAAACGACGGCCAGTTTTTGTGGGTTGGTTTTTTInner2 (564533) ACTTCCAAAAACTATCCCACCTTCTCCACTAA 1.5 50/50 50

p16 Outer1 (833) GAGGAGGGGTTGGTTGGTTATTAGAG(U12818) Outer2 (311336) TACCTAATTCCAATTCCCCTACAAAC 1.0 50/55 50

Inner1M13 (1433) TGTAAAACGACGGCCAGTGGGTTGGTTGGTTATTAGAGInner2 (250273) CTACAAACCCTCTACCCACCTAAA 1.0 55/60 50

Rb Outer1 (16491677) TGTATTTAGGTTTGGAGGGGGTGGTTTTG(L11910) Outer2 (20572078) AAAAATTTTAAACCACATAAC 1.5 45/50 25

Inner1 (17441774) TTAGGTTTTTTAGTTTAATTTTTTATGATInner2 (20072033) AACTATAAAAAAACCCCAAAAAAAAC 1.5 50/50 25

GST-pi Outer1 (967993) TTTGTTGTTTGTTTATTTTTTAGGTTT(M24485) Outer2 (13071332) AACCTAATACTACCAATTAACCCCAT 1.5 45/50 25

Inner1 (9991027) GGGATTTGGGAAAGAGGGAAAGGTTTTTTInner2 (12811306) ACTAAAAACTCTAAAAACCCCATCCC 1.5 45/50 25

HIC-1 Outer1 (12911319) TTTTTTGTGGTTTGGATTTGTTTAAGAAGCentral region Outer2 (19071935) CAACTACTCAAAACTAAAAAAACCCTTAC 1.5 50/55 25(L41919) Inner1M13 (14551477) TGTAAAACGACGGCCAGTTTTTTTAGAAGTTGGAGGAGGT

Inner2 (17601786) ATCTCCTCACTACTACTCTTATAATCA 1.5 50/55 25HIC-1 Outer1 (163187) TATTTTTTTTAATTGGGGTAATTTT59 region Outer2 (663693) ATTAAACTACAACAACAACTACCTAAAATAA 1.5 45/50 50(L41919) Inner1M13 (237260) TGTAAAACGACGGCCAGTAAAGTTTTTTGTTTTGAATGAT

Inner2 (663693) ATTAAACTACAACAACAACTACCTAAAATAA 1.5 50/55 50a acc. no., accession number of each gene.b a1 anda2, annealing temperatures used in the PCR.

3731

DNA METHYLATION IN LEUKEMIA



had substantial methylation across the entire CpG-rich region. How-ever, the methylation patterns in the AML samples was heterogene-ous, varying from extensive methylation at high levels (e.g.,R76 andR86) to low level methylation at four to six CpG sites (e.g.,R94 andR125). The remaining AML patients (5 of 17, 29%) displayed meth-ylation profiles similar to the normal patterns (e.g., R63 and R79).There does not appear to be any critical sites that are exclusivelymethylated in each patient; however, the region encompassing CpGsites 16, which are the sites closest to the transcription start site,were found to be the most heavily methylated (50100%). Of the 19CpG sites studied, only one site (CpG 15) encompassed an informa-tive site for Southern analysis (HpaII site). However, this site wasonly methylated in 5 of 17 (29%) of the samples, 1 of which (R63) hada normal methylation profile. Therefore, using bisulfite sequencingenabled a more detailed and informative description of the methyla-tion profile of thecalcitonin gene.

ER Gene. TheERgene, located on chromosome 6q25.1, has beenshown by Southern blot analysis to be methylated in 5090% of acuteand chronic leukemias (20). This study assayed the methylation stateof a singleNotI site within the first exon of the gene. To determine theextent of hypermethylation at other CpG sites, we have used bisulfitegenomic sequencing to measure the methylation status of 22 CpGsites in the CpG-rich promoter region (Fig. 2). We found no evidence

of methylation in this region of theER in any of the normal bonemarrow samples analyzed. In comparison, we found a low level ofmethylation spanning the 22 CpG sites in the bone marrow cells of 6of 11 (54%) patients with AML. The methylation profile was heter-ogeneous, but CpG sites from 15 to 20 were most commonly meth-ylated. The methylation state of CpG sites 14 and 15, which incor-porate theNotI site used for Southern analysis, therefore, is indicativeof the methylation profile across the region. Interestingly, in compar-ison to thecalcitonin methylation profile, the methylation level foreach CpG in theER gene was,50%, possibly indicating hyper-methylation of only one allele.

E-Cadherin Gene. The E-cadheringene, located on chromosome16q22.1, has not previously had its methylation status determined inleukemia. However, hypermethylation has been reported in carcinomacell lines, including prostate and breast, by Southern analysis (28, 29)and MSP (30). Moreover, hypermethylation of this region was shownto correlate with lack of expression (28, 30). In this study, wesequenced 29 CpG sites that are located in the CpG-rich promoter andpart of exon 1 (Fig. 3). All of the normal bone marrow samples, exceptfor N34, displayed no methylation in this region. N34 had 5 of 29CpG sites methylated at a low level (,25%). In contrast, 9 of 13(69%) bone marrow samples from patients with AML displayedextensive methylation of theE-cadherinpromoter region (Fig. 3).

Fig. 1. Methylation map of thecalcitonin gene.A, CpG plot across thecalcitonin gene. Theblack boxesshow coding regions within the gene. Thearrow shows the start oftranscription.B, DNA sequence analyzed by bisulfite genomic sequencing from bases 18912168 (accession number X15943). CpG dinucleotides are inboldand numbered below eachsite. TheHpaII site isunderlined.C, methylation maps derived from direct PCR sequence analysis for normal and leukemic samples. The sample number is in the left column, andthe CpG sites are numbered across the top row., up to 25% methylation;o, 2650% methylation;s, 5175% methylation;f, 76100% methylation;M, no methylation; , themethylation at that site was not determined due to enzyme stoppage in the sequence.

3732




Again, the methylation patterns were found to be heterogeneous,ranging from no detectable methylation (R74 and R75) to patientsmethylated in each determinable CpG site (R76 and R99). Althoughthe methylation patterns are heterogeneous, the degree of methylationis higher in the 39 region (50100%).

p15 and p16. p15 andp16 are cyclin-dependent kinase inhibitorsproximate to each other on chromosome 9p21. Southern blot analysisand MSP have foundp15 to be inactivated through hypermethylationof its associated CpG island in 5080% of patients with acute leu-kaemia (18). Interestingly, this aberrant hypermethylation was foundto be limited top15 and was found not to extend top16.

To enable a more complete analysis of these genes, we determinedthe methylation status of 47 CpG sites that encompass the transcrip-tion start site and exon 1 ofp15 (Fig. 4). This sequence also includesthe region where hypermethylation has been associated with transcrip-tional silencing (31). We found in some of the normal bone marrowsamples a low level of methylation (,25%) at one to five CpG sitesdownstream to the start of transcription. In comparison, we foundhypermethylation of thep15gene in 13 of 19 (68%) of AML patientsstudied. Again, the methylation patterns are heterogeneous, rangingfrom no methylation (R79 and R94) to sparse methylation (R59 andR60) and to methylation encompassing the entire region (R38 andR102). In general, methylation spanned the entire region analyzed butwas highly mosaic in the individual patients. A similar finding of

variegation in the methylation profile ofp15was also found in AMLby Dodgeet al. (19). As forcalcitonin, the level of methylation wasoften high (75100%) at individual CpG sites, indicating that eitherboth alleles were methylated or that one allele was heavily methylatedand the other lost.

For thep16 gene, we analyzed 28 CpG sites in a region spanningthe promoter and exon 1 (Fig. 5). Methylation in this region has beencorrelated to transcriptional silencing (3234). We found a low level(,25%) of methylation at one to five CpG sites in three normalsamples. In comparison, we found 6 of 20 (30%) patients with AMLhad an equally low level of methylation (,25,50%) at individualCpG sites, but methylation was found to be more extensive, spanning714 CpG sites across the region analyzed. Methylation was hetero-geneous, and there were no particular CpG sites that were morecommonly methylated. Methylation of thep16 gene has not beenreported before in leukemia. However, it should be noted that South-ern analysis would not have detected the low number of individualsites that are methylated, and MSP analysis may not have detectedmethylation because the methylation profile was quite heterogeneous.It is not clear whether this small amount ofp16promoter methylationis linked to transcriptional silencing, but the methylation pattern isclearly different in the leukemic cellsversusthe normal bone marrowcells.

Fig. 2. Methylation map of theERgene.A, CpG plot of the 59 flanking region. Theblack boxshows the start of the coding region, and thearrow shows the start of transcription.B, sequence of the CpG island that was analyzed from bases 30663250 (accession number X62462). CpG dinucleotides are inbold and numbered below each site. TheHpaII siteis underlinedin bold,and theNotI site is shown by adotted lineabove the sequence.C,methylation maps derived from direct PCR sequencing analysis for normal and leukemic samples.Symbols are the same as Fig. 1.

3733




HIC1 Gene. The HIC1 gene located on chromosome 17p13.3 isunusual in that the entire gene is contained in a CpG-rich region.Previous methylation studies have shown that hypermethylation ofthe five NotI sites spanning the gene are linked withHIC1 genesilencing in neoplastic cells (35). A number of leukemia subtypeshave also been shown to displayHIC1 hypermethylation, including10% of patients with AML at presentation (36). To determinewhether theHIC1 gene was in fact more extensively methylatedin AML, which is not assessable byNotI digestion, we measuredthe methylation pattern of 45 CpG sites by bisulfite genomicsequencing in a region within the central CpG-rich region of thegene spanning intron 2 and exon 3 (Fig. 6). The region sequencedwas chosen because it contained noNotI sites and was central tothe HIC1 CpG island. We found significant methylation of theHIC1 gene in all of the normal and AML DNA samples sequenced.Heterogeneity in the methylation patterns was found in all samples;however, in contrast to the AML methylation profile, we foundthat methylation in the normal cells was limited to exon 3 and wasnot detected in intron 2. Interestingly, hypermethylation wasobserved in 10 of 12 (83%) AML samples in both intron 2 andexon 3. Therefore, methylation of intron 2 appears to be specific tothe leukemic cells. As with the methylation profile of the othergenes analyzed, we found that the methylation patterns in theintron 2 sequence varied significantly among AML patients, withsome patients having no detectable methylation (R99) and some

patients being methylated in each determinable methylation site(R36).

Rb and GST-Pi Genes.The Rb gene is located on chromosome13q14 and is commonly hypermethylated in retinoblastoma tumors(37, 38), and theGST-Pi gene located on chromosome 11q13 iscommonly methylated in prostate and breast tumors (3941). Themethylation pattern for both of these genes has not been studied indetail before in leukemia. To determine whether eitherRbor GST-Piis methylated in our set of AML samples, we assayed for methylationof the promoter region using bisulfite analysis. The 59 region of theRbgene containing 27 CpG sites (38) was amplified after sodium bisul-fite conversion and sequenced by direct PCR sequencing. No meth-ylation was detected at any of the 27 CpG sites for the normal or thebone marrow samples from the 13 AML patients tested (data notshown). The 59region of theGST-Pigene, containing 38 CpG sites(39), was amplified following sodium bisulfite conversion and meth-ylation tested byBstU I digestion. There was no methylation evidentat any of the 6BstUI sites within the promoter sequence in the normalor in the bone marrow samples from 12 AML patients tested (data notshown). Lack of methylation of the 59 CpG region ofGST-Piwas alsoconfirmed by methylation-sensitive PCR (data not shown). Therefore,unlike the other target genes we studied that we found were frequentlymethylated in AML, the CpG islands spanningRbandGST-Piappearto be protected from hypermethylation in AML, although they arepredominantly methylated in other specific cancer types.

Fig. 3. Methylation map of theE-cadheringene.A, CpG plot of the 59 flanking region. Theblack boxshows exon 1.B, sequence of the CpG island that was analyzed from bases863-1138 (accession number L34545). CpG dinucleotides are inbold and numbered below each site. TheHpaII sites areunderlined.C, methylation maps derived from direct PCRsequencing analysis for normal and leukemic samples. Symbols are the same as Fig. 1.

3734




Concurrent Hypermethylation. By studying the methylation pro-file of a number of target genes from the same cohort of patients, wehave been able to assess whether hypermethylation is limited to singletarget genes or whether multiple genes are susceptible to hypermeth-ylation in the one cell. Fig. 7A summarizes the methylation patternsfor the eight target genes studied in the normal and AML bonemarrow samples. To aid in the interpretation of the results, we scoredthe gene as significantly methylated only if the samples were meth-ylated at any one CpG site at levels.25% or if the samples weremethylated in at least 25% of determinable sites. It is clear that exceptfor methylation in thecalcitonin gene that was found in one normalsample (N47) andHIC1 which showed differential methylation inexon 2, the rest of the genes studied from normal bone marrowsamples were essentially unmethylated in the CpG-rich island regionsanalyzed. In contrast, the methylation profile in the AML patients wasextensive. Moreover, hypermethylation was not limited to a singletarget gene but often was found in multiple genes in each patientstudied. In fact, 15 of 20 (75%) AML patients displayed concordantmethylation in at least two genes. Interestingly, the subset of genesmethylated varied in each patient. For example, in R128, onlyp15wasmethylated; in R103,p15andERwere both methylated; and in R14,p15andcalcitoninwere both methylated. There are also patients withmultiple genes methylated; for example in R36,calcitonin, E-cad-

herin, p15, p16, and HIC1 were methylated, and in R38, all of thegenes tested were methylated except forGST-Pi and Rb. In fact,GST-Pi and Rb were not methylated in any of the AML samplestested. Fig. 7Bshows that.50% of the patients were methylated inthe calcitonin, E-cadherin,ER, p15, andHIC1 genes, and.80% ofthe patients were methylated inHIC1. However, it is of interest tonote that no single gene was always methylated.

To determine whether there is a correlation between methylationprofiles and DNA methyltransferase levels, we compared the meth-ylation patterns from eight patients to the expression of DNA MTaseas measured by competitive reverse transcription-PCR (6). We pre-viously have shown that DNA MTase is increased 2.510-fold inAML, but there appears to be no apparent correlation between DNAMTase expression and the number of target genes methylated (Fig.7A). For example, in patient, R99 DNA MTase levels were found tobe 10.1-fold higher than the average normal DNA MTase levels, andthree genes were found to be hypermethylated, whereas six geneswere hypermethylated in patient R38 that had a 5.6-fold increase inDNA MTase levels. In addition, there appears to be no apparentcorrelation between the number of genes methylated and the age orsex of the patient. Our results obtained in leukemia cells suggest thataberrant methylation in malignancy is due to a general deregulation ofthe methylation machinery in the cell rather than a specific targeting

Fig. 4. Methylation map of thep15 gene.A, CpG plot of the 59 region. Theblack boxshows the start of the coding sequence, and thearrow shows the start of transcription.B,sequence of the CpG island that was analyzed from bases 118528 (accession number S75756). CpG dinucleotides are inbold and numbered below each site. TheHpaII sites areunderlined,and theNotI site is shown by adotted lineabove the sequence.C, methylation maps derived from direct PCR sequencing analysis for normal and leukemic samples. Symbolsare the same as Fig. 1.

3735




of single genes. However, the methylation pattern of all CpG island-associated genes are not affected, because there appears to be anindividual variability in the range of genes hypermethylated in thesame cell type.

DISCUSSION

Although alterations in DNA methylation patterns are commonlyfound in essentially all cancers (9), little is known about the under-lying mechanism. In this study, we asked whether multiple genes aresimultaneously methylated in the same cancer cell and whether themethylation pattern is cancer cell type specific. We analyzed themethylation pattern across the CpG-rich promoter regions of eighttumor-related genes in the same cohort of AML patients using bisul-fite analysis. Methylation studies to date generally have been limitedto the study of the few CpG dinucleotides that lie in the restrictionenzyme recognition site and therefore provide little information aboutthe nature ofde novo methylation. Furthermore, the methylationstudies for different genes often were performed on different cohortsof patients, making it difficult to assess concurrent methylation withinthe one sample. By using bisulfite sequencing, we could addresswhether aberrantde novomethylation was targeted to specific CpGsites or was extensive across the CpG island promoter regions asso-ciated with tumor-related genes.

The main conclusion from our study is that aberrant methylation is

not confined to single target genes in AML but rather can occurconcurrently across many different genes spanning different chromo-somes in an individual patient. TheHIC1 gene (spanning intron 2)was the most commonly methylated, with.80% of the AML samplestested showing hypermethylation.Calcitonin, E-cadherin,ER, andp15 were also commonly methylated, with.50% of the AML sam-ples showing hypermethylation. In comparison,p16 was less fre-quently methylated, andRb and GST-Pi were found to be nevermethylated in the AML samples tested. Interestingly, the methylationportfolio of each AML patient was remarkably different from eachother, with quite a variation in the combination of genes selected. Inaddition, there was no obvious correlation between ages of the pa-tients with AML and the number of genes or subset of genes meth-ylated. In particular, the methylation of theER did not appear to beage specific in either the normal or cancer samples, as reported by Issaet al. (42) and Ahujaet al. (43) for colon cancer. This difference maybe due to the fact that different tissues were examined in the latterstudy, or our sample size was limited. However, we have taken careto ensure that the median ages between normal and AML sampleswere matched to differentiate AML-specific methylation from age-related methylation.

It is clear from our results that, although there is a heterogeneity inthe profile of genes methylated within the AML patients, there alsoappears to be cancer cell type-specific differences. For example,Rb

Fig. 5. Methylation map of thep16gene.A, CpG plot of the 59region. Theblack boxrepresents the start of the coding sequence.B, sequence of the CpG island that was analyzedfrom bases 41248 (accession number U12818). CpG dinucleotides are inbold and numbered below each site. TheHpaII sites areunderlined.C, methylation maps derived from directPCR sequencing analysis for normal and leukemic samples. Symbols are the same as Fig. 1.

3736




andGST-Piwere both found to be unmethylated in the AML patients,whereas these genes are frequently methylated in retinoblastomatumors and prostate tumors, respectively (38, 39, 44).p16 was alsomethylated at a low level in;30% of samples in this study, butp16is frequently methylated in lung cancer and melanoma (45). Liangetal. (46), using a genome scanning analysis of three different tumors,also reported tissue-specific variation in the methylation patternsbetween the tumors. The fact that multiple genes are frequentlymethylated in cancer suggests that the mechanism that normallyprotects CpG islands from methylation is defective in the cancer cell.The fact that different combinations of a subset of genes can bemethylated in the one cell type suggests that methylation is stochastic.The set of genes that are commonly methylated possibly reflects thegenes that, when silenced, provide the cell with a selective growthadvantage in different cell types. However, the cancer specificityobserved may reflect the different set of tissue-specific factors foundin the different cell types.

The mechanism that protects CpG islands from methylation isunclear, and what triggers hypermethylation in cancer is still unre-solved. An increase in DNA MTase was proposed to be important inthe initiation and progression of cancer and in establishing alteredDNA methylation patterns (35, 9). However, it is clear from ourresults that simply an increase in DNA MTase is insufficient toexplain the altered methylation patterns. The AML samples screened

had DNA MTase levels 2.510-fold higher than normal bone marrow(6), but the methylation patterns of these patients were variable andbore no obvious relationship to the level of DNA MTase in the cell.It is, however, possible that other methylation enzymes, such asdnmt3a and dnmt3b (47), may play a role in abnormal methylation inleukemia.

Active transcription also has been proposed as a mechanism toprotect CpG islands from methylation (48). It is possible that in thecancer cell, a subset of CpG island promoters are silenced, permittingsubsequentde novomethylation. This is an attractive hypothesis andmay help to explain how hypermethylation appears to be stochasticbut also limited to a specific subset of genes for the different cancertypes. Unfortunately, because the samples we tested contained a lowlevel of normal cell contamination, it was not possible to accuratelyquantitate the level of expression for each gene in the sample anddemonstrate that the genes were indeed silenced. It is also unclearfrom our results whether the variable methylation patterns we ob-served influenced the level of gene transcription within the individualgenes tested. However methylation, as determined by Southern anal-ysis, has been associated with inactivation of expression in many ofthe genes we analyzed (28, 30, 3235, 42, 49). We suggested previ-ously that transient CpNpG methylation of Sp1 sites in the promoterregions of CpG islands may be one mechanism that may lead to genesilencing and subsequentde novomethylation of CpG islands (50).

Fig. 6. Methylation map of theHIC1 gene.A, CpG plot of theHIC1 gene. Theblack boxesrepresent the exons, and thearrow shows the start of transcription. TheNotI sites aremarked on the gene and represented by anN. B, sequence of the CpG island that was analyzed from bases 14781758 (accession number L41919). CpG dinucleotides are inbold andnumbered below each site. TheHpaII sites areunderlined,and theEagI site isunderlinedwith a dotted line.C, methylation maps derived from direct PCR sequencing analysis fornormal and leukemic samples. Symbols are the same as Fig. 1.

3737




However, in this analysis, we found no evidence of CpNpG methyl-ation at detectable levels. Because our data were obtained by directPCR sequencing, methylation levels,15% are difficult to assessabove background.

We chose to analyze the individual methylation patterns for each

gene by sequencing to gain an insight into the mechanism responsiblefor the specific methylation profiles. We found that for each gene, themethylation profile across the CpG island was heterogeneous, and noone CpG site appeared to be always methylated. This is similar to ourprevious findings of mosaic methylation found in both cancer and

Fig. 7. Summary of hypermethylation results in AML.A, individual genes were scored as hypermethylated if they were methylated by genomic sequencing if levels in the samplewere.25% at any one CpG site or in 25% or more of the determinable CpG sites.Black ovals,methylated;white ovals,unmethylated;no oval,not determined. Methylation statusfor p15 in patients R103 and R86 and forER in patient R103 was determined by Southern analysis only.Footnote a,chromosome loci of the genes are given below the gene name.Footnote b,hypermethylation ofHIC1 intron 2.Footnote c,MTase levels represent the fold increase of DNA MTase to the mean of the normal controls DNA MTase level (6).B:f, proportion of AML samples methylated for each target gene;M, proportion of normal samples (N) methylated for each target gene.

3738




normal cells (38, 39, 51, 52). It therefore appears that thede novomethylation process is stochastic and supports the hypothesis that it isthe density of methylation across a region that is important rather thanmethylation of individual target sites. Interestingly, for theHIC1 gene,we did note a marked boundary of methylation that occurred betweenintron 2 and exon 3 in the normal cell that was lacking in the cancercell. The existence of such a methylation boundary, which is clearlylost in the cancer cell, may provide clues in the future as to themechanism that normally protects sequences from methylation in thenormal cell (53).

The results of this study have allowed us to answer some importantquestions aboutde novoDNA methylation in cancer cells: (a) al-though a deregulation of the methylation machinery is implicated inabnormal hypermethylation, an increase in DNA MTase alone is notsufficient to mediate this hypermethylation; (b) hypermethylation inAML is not confined to a single locus but rather is a multiple locievent covering CpG-rich gene regions; and (c) the aberrantde novomethylation found in AML appears to be a stochastic process actingat individual CpG sites within different CpG islands combined with acell type selectivity. Moreover, the cancer specificity may reflect thedifferent set of factors found in different cell types. The next step isto determine what the factors are protecting CpG islands from meth-ylation in the normal cell and what triggers the breakdown of theprotective process in the malignant cell.

ACKNOWLEDGMENTS

We thank Cheryl Paul for the excellent automated sequencing and Dr. DougMillar for advice and helpful discussions.

REFERENCES

1. Turker, M. S., and Bestor, T. H. Formation of methylation patterns in the mammaliangenome. Mutat. Res.,386: 119130, 1997.

2. Holliday, R. DNA methylation and epigenetic inheritance. Philos. Trans. R. Soc.Lond. B Biol. Sci.,326: 329338, 1990.

3. el-Deiry, W. S., Nelkin, B. D., Celano, P., Yen, R. W., Falco, J. P., Hamilton, S. R.,and Baylin, S. B. High expression of the DNA methyltransferase gene characterizeshuman neoplastic cells and progression stages of colon cancer. Proc. Natl. Acad. Sci.USA, 88: 34703474, 1991.

4. Issa, J. P., Vertino, P. M., Wu, J., Sazawal, S., Celano, P., Nelkin, B. D., Hamilton,S. R., and Baylin, S. B. Increased cytosine DNA-methyltransferase activity duringcolon cancer progression. J. Natl. Cancer Inst.,85: 12351240, 1993.

5. Belinsky, S. A., Nikula, K. J., Baylin, S. B., and Issa, J. P. Increased cytosineDNA-methyltransferase activity is target-cell-specific and an early event in lungcancer. Proc. Natl. Acad. Sci. USA,93: 40454050, 1996.

6. Melki, J., Warnecke, P., Vincent, P., and Clark, S. Increased DNA methyltransferaseexpression in leukemia. Leukemia (Baltimore),12: 311316, 1998.

7. Jones, P. A., Rideout, W. M., Shen, J-C., Spruck, C. H., and Tsai, C. Methylation,mutation, and cancer. Bioessays,14: 3336, 1992.

8. Schmutte, C., Yang, A. S., Nguyen, T. T., Beart, R. W., and Jones, P. A. Mechanismsfor the involvement of DNA methylation in colon carcinogenesis. Cancer Res.,56:23752381, 1996.

9. Baylin, S. B., Herman, J. G., Graff, J. R., Vertino, P. M., and Issa, J. P. Alterationsin DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res.,72:141196, 1998.

10. Bird, A. P. CpG-rich islands and the function of DNA methylation. Nature (Lond.),321: 209213, 1986.

11. Wahlfors, J., Hiltunen, H., Heinonen, K., Hamalainen, E., Alhonen, L., and Janne,J. Genomic hypomethylation in human chronic lymphocytic leukemia. Blood,80:20742080, 1992.

12. Hanada, M., Delia, D., Aiello, A., Stadtmauer, E., and Reed, J. C.bcl-2 genehypomethylation and high-level expression in B-cell chronic lymphocytic leukemia.Blood, 82: 18201828, 1993.

13. Kochanek, S., Radbruch, A., Tesch, H., Renz, D., and Doerfler, W. DNA methylationprofiles in the human genes for tumor necrosis factorsa andb in subpopulations ofleukocytes and in leukemias. Proc. Natl. Acad. Sci. USA,88: 57595763, 1991.

14. Palotie, A., and Syvanen, A. C. Development of molecular genetic methods formonitoring myeloid malignancies. Scand. J. Clin. Lab. Invest. Suppl.,213: 2938,1993.

15. Nelkin, B. D., Przepiorka, D., Burke, P. J., Thomas, E. D., and Baylin, S. B.Abnormal methylation of the calcitonin gene marks progression of chronic myelog-enous leukemia. Blood,77: 24312434, 1991.

16. Ihalainen, J., Pakkala, S., Savolainen, E. R., Jansson, S. E., and Palotie, A. Hyper-methylation of the calcitonin gene in the myelodysplastic syndromes. Leukemia(Baltimore),7: 263267, 1993.

17. Dhodapkar, M., Grill, J., and Lust, J. A. Abnormal regional hypermethylation of thecalcitonin gene in myelodysplastic syndromes. Leuk. Res.,19: 719726, 1995.

18. Herman, J. G., Civin, C. I., Issa, J. P., Collector, M. I., Sharkis, S. J., and Baylin, S. B.Distinct patterns of inactivation of p15INK4B and p16INK4A characterize the majortypes of hematological malignancies. Cancer Res.,57: 837841, 1997.

19. Dodge, J. E., List, A. F., and Futscher, B. W. Selective variegated methylation of thep15 CpG island in acute myeloid leukemia. Int. J. Cancer,78: 561567, 1998.

20. Issa, J. P., Zehnbauer, B. A., Civin, C. I., Collector, M. I., Sharkis, S. J., Davidson,N. E., Kaufmann, S. H., and Baylin, S. B. The estrogen receptor CpG island ismethylated in most hematopoietic neoplasms. Cancer Res.,56: 973977, 1996.

21. Frommer, M., McDonald, L. E., Millar, D. S., Collis, C. M., Watt, F., Grigg, G. W.,Molloy, P. L., and Paul, C. L. A genomic sequencing protocol that yields a positivedisplay of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad.Sci. USA,89: 18271831, 1992.

22. Clark, S. J., Harrison, J., Paul, C. L., and Frommer, M. High sensitivity mapping ofmethylated cytosines. Nucleic Acids Res.,22: 29902997, 1994.

23. Clark, S. J., and Frommer, M. Bisulphite genomic sequencing of methylated cy-tosines.In: G. R. Taylors (ed.), Laboratory Methods for the Detection of Mutationsand Polymorphisms in DNA, pp. 151162. New York: CRC Press, 1997.

24. Herman, J. G., Graff, J. R., Myohanen, S., Nelkin, B. D., and Baylin, S. B. Meth-ylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc.Natl. Acad. Sci. USA,93: 98219826, 1996.

25. Warnecke, P. M., Stirzaker, C., Melki, J. R., Millar, D. S., Paul, C. L., and Clark, S. J.Detection and measurement of PCR bias in quantitative methylation analysis ofbisulphite-treated DNA. Nucleic Acids Res.,25: 44224426, 1997.

26. Baylin, S. B., Hoppener, J. W., de Bustros, A., Steenbergh, P. H., Lips, C. J., andNelkin, B. D. DNA methylation patterns of the calcitonin gene in human lung cancersand lymphomas. Cancer Res.,46: 29172922, 1986.

27. Leegwater, P. A., Lambooy, L. H., De Abreu, R. A., Bokkerink, J. P., and van denHeuvel, L. P. DNA methylation patterns in the calcitonin gene region at firstdiagnosis and at relapse of acute lymphoblastic leukemia (ALL). Leukemia (Balti-more),11: 971978, 1997.

28. Yoshiura, K., Kanai, Y., Ochiai, A., Shimoyama, Y., Sugimura, T., and Hirohashi, S.Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in humancarcinomas. Proc. Natl. Acad. Sci. USA,92: 74167419, 1995.

29. Graff, J. R., Herman, J. G., Lapidus, R. G., Chopra, H., Xu, R., Jarrard, D. F., Isaacs,W. B., Pitha, P. M., Davidson, N. E., and Baylin, S. B. E-Cadherin expression issilenced by DNA hypermethylation in human breast and prostate carcinomas. CancerRes.,55: 51955199, 1995.

30. Graff, J. R., Herman, J. G., Myohanen, S., Baylin, S. B., and Vertino, P. M. Mappingpatterns of CpG island methylation in normal and neoplastic cells implicates bothupstream and downstream regions inde novomethylation. J. Biol. Chem.,272:2232222329, 1997.

31. Herman, J. G., Jen, J., Merlo, A., and Baylin, S. B. Hypermethylation-associatedinactivation indicates a tumor suppressor role for p15INK4B. Cancer Res.,56:722727, 1996.

32. Costello, J. F., Berger, M. S., Huang, H. S., and Cavenee, W. K. Silencing ofp16/CDKN2 expression in human gliomas by methylation and chromatin condensa-tion. Cancer Res.,56: 24052410, 1996.

33. Merlo, A., Herman, J. G., Mao, L., Lee, D. J., Gabrielson, E., Burger, P. C., Baylin,S. B., and Sidransky, D. 59 CpG island methylation is associated with transcriptionalsilencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nat. Med.,1: 686692, 1995.

34. Otterson, G. A., Khleif, S. N., Chen, W., Coxon, A. B., and Kaye, F. J.CDKN2genesilencing in lung cancer by DNA hypermethylation and kinetics of p16INK4 proteininduction by 5-aza 29deoxycytidine. Oncogene,11: 12111216, 1995.

35. Makos-Wales, M., Biel, M. A., el Deiry, W., Nelkin, B. D., Issa, J. P., Cavenee,W. K., Kuerbitz, S. J., and Baylin, S. B. p53 activates expression ofHIC-1, a newcandidate tumour suppressor gene on 17p13.3. Nat. Med.,1: 570577, 1995.

36. Issa, J. P., Zehnbauer, B. A., Kaufmann, S. H., Biel, M. A., and Baylin, S. B. HIC1hypermethylation is a late event in hematopoietic neoplasms. Cancer Res.,57:16781681, 1997.

37. Sakai, T., Toguchida, J., Ohtani, N., Yandell, D. W., Rapaport, J. M., and Dryja, T.Allele-specific hypermethylation of the retinoblastoma tumor-suppressor gene. Am. J.Hum. Genet.,48: 880888, 1991.

38. Stirzaker, C., Millar, D. S., Paul, C. L., Warnecke, P. M., Harrison, J., Vincent, P. C.,Frommer, M., and Clark, S. J. Extensive DNA methylation spanning the Rb promoterin retinoblastoma tumors. Cancer Res.,57: 22292237, 1997.

39. Millar, D. S., Ow, K. K., Paul, C. L., Russell, P. J., Molloy, P. L., and Clark, S. J.Detailed methylation analysis of the glutathioneS-transferase Pi (GSTP1) gene inprostate cancer. Oncogene,18: 13131324, 1999.

40. Lee, W. H., Morton, R. A., Epstein, J. I., Brooks, J. D., Campbell, P. A., Bova, G. S.,Hsieh, W. S., Isaacs, W. B., and Nelson, W. G. Cytidine methylation of regulatorysequences near the pi-class glutathioneS-transferase gene accompanies human pros-tatic carcinogenesis. Proc. Natl. Acad Sci. USA,91: 1173311737, 1994.

41. Jhaveri, M. S., and Morrow, C. S. Methylation-mediated regulation of the gluta-thione S-transferaseP1 gene in human breast cancer cells. Gene (Amst.),210:17, 1998.

42. Issa, J-P. J., Ottaviano, Y. L., Celano, P., Hamilton, S. R., Davidson, N. E., andBaylin, S. B. Methylation of the oestrogen receptor CpG island links ageing andneoplasia in human colon. Nat. Genet.,7: 536540, 1994.

43. Ahuja, N., Li, Q., Mohan, A. L., Baylin, S. B., and Issa, J. P. Aging and DNAmethylation in colorectal mucosa and cancer. Cancer Res.,58: 5489 5494,1998.

44. Ohtani-Fujita, N., Dryja, T. P., Rapaport, J. M., Fujita, T., Matsumura, S., Ozasa, K.,Watanabe, Y., Hayashi, K., Maeda, K., Kinoshita, S., Matsumura, T., Ohnishi, Y.,

3739




Hotta, Y., Takahashi, R., Kato, M. V., Ishizaki, K., Sasaki, M. S., Horsthemke, B.,Minoda, K., and Sakai, T. Hypermethylation in the retinoblastoma gene is associatedwith unilateral, sporadic retinoblastoma. Cancer Genet. Cytogenet.,98: 4349, 1997.

45. Belinsky, S. A., Nikula, K. J., Palmisano, W. A., Michels, R., Saccomanno, G.,Gabrielson, E., Baylin, S. B., and Herman, J. G. Aberrant methylation of p16(INK4a)is an early event in lung cancer and a potential biomarker for early diagnosis. Proc.Natl. Acad. Sci. USA,95: 1189111896, 1998.

46. Liang, G., Salem, C. E., Yu, M. C., Nguyen, H. D., Gonzales, F. A., Nguyen, T. T.,Nichols, P. W., and Jones, P. A. DNA methylation differences associated with tumortissues identified by genome scanning analysis. Genomics,53: 260268, 1998.

47. Okano, M., Xie, S., and Li, E. Cloning and characterization of a family of novelmammalian DNA (cytosine-5) methyltransferases. Nat. Genet.,19: 219220, 1998.

48. Cross, S. H., and Bird, A. P. CpG islands and genes. Curr. Opin. Genet. Dev.,5:309314, 1995.

49. Ottaviano, Y. L., Issa, J. P., Parl, F. F., Smith, H. S., Baylin, S. B., and Davidson,N. E. Methylation of the estrogen receptor gene CpG island marks loss of estrogenreceptor expression in human breast cancer cells. Cancer Res.,54: 25522555, 1994.

50. Clark, S. J., Harrison, J., and Molloy, P. L. Sp1 binding is inhibited by (m)Cp(m)CpGmethylation. Gene (Amst.),195: 6771, 1997.

51. Warnecke, P. M., Mann, J. R., Frommer, M., and Clark, S. J. Bisulfite sequencing inpreimplantation embryos: DNA methylation profile of the upstream region of themouse imprintedH19 gene. Genomics,51: 182190, 1998.

52. Warnecke, P. M., and Clark, S. J. DNA methylation profile of the mouse skeletala-actin promoter during development and differentiation. Mol. Cell. Biol.,19: 164172, 1999.

53. Melki, J. R., Vincent, P. C., and Clark, S. J. Cancer-specific region of hypermeth-ylation identified within theHIC1 putative tumour suppressor gene in acute myeloidleukaemia. Leukemia (Baltimore),13: 877883, 1999.

3740




1999;59:3730-3740. Cancer Res John R. Melki, Paul C. Vincent and Susan J. Clark Myeloid LeukemiaConcurrent DNA Hypermethylation of Multiple Genes in Acute

Updated version

http://cancerres.aacrjournals.org/content/59/15/3730

Access the most recent version of this article at:

Cited Articles

http://cancerres.aacrjournals.org/content/59/15/3730.full.html#ref-list-1

This article cites by 52 articles, 28 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/59/15/3730.full.html#related-urls

This article has been cited by 57 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications


http://cancerres.aacrjournals.org/content/59/15/3730http://cancerres.aacrjournals.org/content/59/15/3730.full.html#ref-list-1http://cancerres.aacrjournals.org/content/59/15/3730.full.html#related-urlshttp://cancerres.aacrjournals.org/cgi/alertsmailto:[email protected]:[email protected]://cancerres.aacrjournals.org/

articulo cientifico

Documents

Transcript of articulo cientifico