Novel regulatory mechanisms underlying the expression of the carbohydrate

response element binding protein (ChREBP): the roles of insulin and the POU

protein Oct-1

by

Adam Sebastian Sirek

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Department of Physiology

University of Toronto

© Copyright by Adam Sebastian Sirek (2009)

ii

Novel regulatory mechanisms underlying the expression of the carbohydrate response element binding protein (ChREBP): the roles of insulin and the POU protein Oct-1

Master of Science, 2009 Adam Sebastian Sirek

Department of Physiology University of Toronto

ABSTRACT

ChREBP has emerged as one of the key controllers of hepatic lipogenesis. While the

function of ChREBP has been extensively investigated, mechanisms underlying its

transcriptional regulation remain largely unknown. We located a conserved POU-binding

site within mammalian ChREBP promoters, and demonstrated that the POU homeodomain

protein Oct-1 binds to this site in the human HepG2 cell line. Oct-1 transfection significantly

repressed ChREBP promoter activity 50-75%. Conversely, knockdown of Oct-1 expression

with shRNA significantly increased ChREBP expression levels. Furthermore, insulin

treatment resulted in a two-fold activation of ChREBP promoter activity, and stimulated

endogenous ChREBP expression. We found that the stimulatory effect of insulin on the

ChREBP promoter is at least partially dependent on the presence of the POU-binding site,

and that insulin treatment reduced Oct-1 expression. Our observations identify Oct-1 as a

transcriptional repressor of ChREBP, and suggest that insulin stimulates ChREBP expression

via attenuating the repressive effect of Oct-1.

iii

ACKNOWLEDGMENTS

I would like to thank my two supervisors, Dr. Dominic Ng and Dr. Tianru Jin, whose

knowledge and suggestions made possible the inception, execution, and completion of this

project. My committee members, Dr. Khosrow Adeli and Dr. Allen Volchuk have been

equally helpful and provided me with a solid basis on which to critically review and reassess

my work. For all of this, I should like to express my deepest gratitude.

I would also like to thank all of my colleagues and the members of the Jin and Ng labs. In

particular, I would like to mention Dr. Ling Liu for her preliminary work on the project. In

addition, I would like to thank Janie Sun and Sarah Khalid for the countless ideas and

guidance, and of course, humour and companionship, throughout my entire project. Were

it not for them, the time spent would have been considerably more dull and difficult.

During my undergraduate years, my grandmother, Dr. Anna Sirek, introduced me to Dr.

Mladen Vranic, and ever since, has been the first and most patient critic of all my work. Dr.

Vranic provided me with my first opportunity to be involved in medical research and has

been an exceptionally kind and generous mentor ever since my first summer in his lab.

Without Dr. Vranic and his encouragements, I would likely have not arrived where I am

today. I find it almost impossible to express my gratitude toward him in proper words.

Finally, I would like to thank my wife, Danielle for all the understanding, support, and

encouragement she has offered.

iv

TABLE OF CONTENTS

Abstract ..................................................................................................................................... ii

Acknowledgments .................................................................................................................... iii

Table of Contents ..................................................................................................................... iv

List of Figures............................................................................................................................ ix

List of Tables ............................................................................................................................ xii

List of Abbreviations ............................................................................................................... xiii

List of Publications and Presentations ...................................................................................... xv

Chapter 1. Introduction ................................................................................................1

1.01 Regulation of Gene Expression ....................................................................1

1.02 General Overview of Hepatic Carbohydrate Metabolism .............................4

1.02.1 Metabolism of Dietary Carbohydrates .........................................................6

1.02.2 Insulin Signalling ..........................................................................................6

1.02.3 Pathophysiology of Metabolic Disorders .....................................................9

1.03 The Carbohydrate Response Element Binding Protein (ChREBP)................12

1.03.1 Overview ...................................................................................................12

1.03.2 Regulation of ChREBP activity by post-translational modifications:

Phosphorylation and De-phosphorylation .................................................14

1.03.3 Role of ChREBP in Glucose Metabolism .....................................................16

v

1.03.4 Transcriptional Regulation of ChREBP ........................................................18

1.04 The POU Homeodomain Protein Oct-1 ......................................................20

1.04.1 POU Domain Superfamily ..........................................................................20

1.04.2 The Octamer Binding Proteins ...................................................................22

1.04.3 The Function of Oct-1 ................................................................................24

1.04.4 Oct-1 and Metabolic Stress........................................................................25

Chapter 2. Rationale and Hypothesis ..........................................................................27

2.01 Whether Oct-1 Functions as a Repressor of ChREBP Expression ................28

2.02 Whether Insulin Treatment Stimulates ChREBP Expression .......................29

2.03 Whether Insulin Stimulates ChREBP Expression via Attenuating the Effect of

Oct-1 on the ChREBP Promoter .................................................................29

Chapter 3. Materials and Methods .............................................................................32

3.01 Chemicals ..................................................................................................32

3.02 Plasmid Construction ................................................................................32

3.03 Cell Culture................................................................................................33

3.04 DNA Transfection and Luciferase Reporters ..............................................34

3.05 Lentiviral shRNA Knockdown .....................................................................34

3.06 RNA Extraction and Real Time RT-PCR .......................................................35

3.07 Chromatin Immunoprecipitation ...............................................................35

vi

3.08 Nuclear Protein Extraction ........................................................................37

3.09 Immunoblotting ........................................................................................37

3.10 Electrophoretic Mobility Gel Shift Assay (EMSA)........................................38

3.11 Statistical Analysis .....................................................................................39

Chapter 4. Results ......................................................................................................40

4.01 Oct-1 as a negative transcriptional repressor of ChREBP expression ..........40

4.01.1 Oct-1 interacts with the POU protein binding site located within the

proximal promoter region of ChREBP ........................................................40

4.01.2 Oct-1 functions as a transcriptional repressor of ChREBP ..........................43

4.01.3 Lentiviral mediated knockdown of Oct-1 results in increased ChREBP

expression .................................................................................................46

4.01.4 Oct-1 over-expression results in decreased ChREBP expression.................50

4.02 Insulin treatment leads to increased ChREBP expression ...........................52

4.02.1 Insulin stimulates ChREBP promoter activity .............................................52

4.02.2 Insulin stimulates ChREBP protein expression ...........................................55

4.02.3 The effect of insulin on ChREBP expression in HepG2 cells that express Oct-

1 shRNA.....................................................................................................55

4.02.4 The effect of insulin on ChREBP expression in HepG2 cells over-expressing

Oct-1 .........................................................................................................59

vii

4.02.5 Insulin treatment increases ChREBP expression in primary hamster

hepatocytes...............................................................................................63

4.02.6 L-PK mRNA expression can be altered by Oct-1 shRNA and insulin

treatment ..................................................................................................65

4.03 Insulin stimulation of ChREBP expression is dependent on the POU protein

binding site located in the proximal promoter region of the ChREBP

promoter ...................................................................................................65

4.03.1 The repressive effect of Oct-1 on ChREBP expression is dependent on the

POU-binding site in the ChREBP proximal promoter ..................................65

4.03.2 The stimulatory effect of insulin on ChREBP expression is at least partially

dependent on the POU-binding site in the ChREBP proximal promoter .....66

4.03.3 Insulin treatment attenuates Oct-1 nuclear expression levels ...................68

4.03.4 Insulin treatment reduces Oct-1 binding to the ChREBP promoter in intact

cells ...........................................................................................................71

4.03.5 Inhibition of PI3K or ERK affects Oct-1 binding to the ChREBP promoter

..................................................................................................................74

4.03.6 ERK, but not AKT plays a role in mediating the stimulatory effect of insulin

on ChREBP promoter activity .....................................................................77

4.03.7 MEK inhibition attenuates the stimulatory effect of insulin on ChREBP

mRNA expression ......................................................................................77

viii

Chapter 5. Discussion .................................................................................................81

5.01 Oct-1 represses ChREBP expression, and this repression relies on the POU-

binding site conserved within the ChREBP promoter .................................81

5.02 Insulin treatment stimulates ChREBP expression .......................................83

5.03 Insulin stimulates ChREBP expression via attenuating the repressive effect

of Oct-1 on the ChREBP promoter .............................................................85

Chapter 6. Summary and Conclusions.........................................................................89

Chapter 7. Future Directions.......................................................................................92

7.01 Whether Oct-1 is phosphorylated in response to the activation of insulin

signalling? .................................................................................................92

7.02 Whether, after insulin, Oct-1 is excluded from the nucleus, degraded, or

both? ........................................................................................................92

7.03 What is the effect of Oct-1 on the ChREBP promoter in vivo? ....................93

Chapter 8. References ................................................................................................95

ix

LIST OF FIGURES

Figure 1: An illustration of the interactions of ChREBP and SREBP-1c with lipogenic enzyme gene

promoters. ......................................................................................................................7

Figure 2: An illustration of the Insulin Signalling Pathway ............................................................8

Figure 3: An illustration of the major domains in ChREBP ..........................................................13

Figure 4: Mechanisms underlying ChREBP activation/inactivation .............................................15

Figure 5: The role of ChREBP in metabolic regulation ................................................................17

Figure 6: The overall domain structure of Oct-1 ........................................................................21

Figure 7: An illustration of the hypotheses of this study ............................................................31

Figure 8: The POU-binding site is highly conserved within ChREBP promoters...........................41

Figure 9: Oct-1 binds to the POU-binding site located within the ChREBP promoter..................42

Figure 10: Oct-1 acts as a repressor of the human ChREBP promoter constructs in Cos-7

fibroblasts .....................................................................................................................44

Figure 11: Oct-1 acts as a repressor of ChREBP promoter activity in the HepG2 cell line ...........45

Figure 12: Transient transfection of Oct-1 represses ChREBP protein expression ......................47

Figure 13: Generation of HepG2 cells stably expressing Oct-1 shRNA ........................................48

Figure 14: Oct-1 shRNA expressing cells demonstrate increased ChREBP expression ................49

Figure 15: Oct-1 over-expressing cells demonstrate decreased ChREBP expression ..................51

Figure 16: Insulin treatment increases ChREBP promoter activity .............................................53

Figure 17: Insulin treatment increases ChREBP protein expression ...........................................54

Figure 18: Insulin treatment (10nM) increases ChREBP promoter activity in HepG2 cells

expressing Oct-1 shRNA .................................................................................................56

x

Figure 19: Insulin treatment (100nM) increases ChREBP promoter activity in HepG2 cells

expressing Oct-1 shRNA .................................................................................................57

Figure 20: Insulin treatment (10nM) increases ChREBP mRNA and protein levels in HepG2 cells

expressing Oct-1 shRNA .................................................................................................58

Figure 21: Insulin treatment (10nM) increases ChREBP promoter activity in HepG2 cells over-

expressing Oct-1 ............................................................................................................60

Figure 22: Insulin treatment (100nM) increases ChREBP promoter activity in HepG2 cells over-

expressing Oct-1 ............................................................................................................61

Figure 23: Insulin treatment (10nM) increases ChREBP mRNA and protein levels in the HepG2

cells over-expressing Oct-1 ............................................................................................62

Figure 24: Insulin treatment increases ChREBP and lipogenic target expression levels ..............64

Figure 25: The repression of ChREBP promoter activity by Oct-1 is dependent on the POU

binding site ....................................................................................................................67

Figure 26: Insulin stimulation of HepG2 cells treated with Oct-1 shRNA is dependent on the POU

binding site ....................................................................................................................69

Figure 27: Insulin stimulation of HepG2 cells over-expressing Oct-1 is dependent on the POU-

binding site ....................................................................................................................70

Figure 28: Insulin treatment reduces Oct-1 nuclear content ......................................................72

Figure 29: Insulin treatment reduces Oct-1 binding to the ChREBP Promoter in vivo .................73

Figure 30: Insulin stimulation leads to reduced Oct-1 content ...................................................75

Figure 31: Reduced binding of Oct-1 to the ChREBP promoter following insulin treatment can be

blocked with ERK inhibition ...........................................................................................76

xi

Figure 32: Insulin stimulation of ChREBP promoter activity can be blocked with MEK/ERK

inhibition .......................................................................................................................78

Figure 33: The stimulatory effect of insulin on ChREBP mRNA expression can be blocked with

MEK/ERK inhibition........................................................................................................79

Figure 34: Proposed mechanisms underlying the stimulation of insulin on ChREBP expression .91

xii

LIST OF TABLES

Table 1: An overview of the various identified forms of POU homeodomain proteins ...23

xiii

LIST OF ABBREVIATIONS

ACC Acetyl-Co A Carboxylase ACL ATP-Citrate Lysase AKT Serine/Threonine Specific Protein Kinase B AMP Adenosine Monophosphate AMPK AMP-Activated Protein Kinase bHLH Basic Helix-Loop-Helix Domain bHLH/ZIP Basic Helix-Loop-Helix Leucine-Zipper Domain BSA Bovine Serum Albumin bp Base Pairs C/EBP CAAT Enhancer-Binding Protein cAMP Cyclic Adenosine Monophosphate CBP CREB Binding Protein ChIP Chromatin Immunoprecipitation ChoRE Carbohydrate Response Element ChREBP Carbohydrate Response Element Binding Protein CoA Coenzyme A DNA Deoxyribunucleic Acid EMSA Electrophoretic Mobility Shift Assay ERK Extracellular Signalling Regulated Kinase FA Fatty Acid FAS Fatty Acid Synthase FBS Fetal Bovine Serum Fru-6-P Fructose 6 Phosphate GAP Glyceraldehyde 3 Phosphate GFP Green Flourescence Protein Glu-6-P Glucose 6 Phosphate GSK3 Glycogen Synthase Kinase 3 GWA Genome-Wide Association H2B Histone H2B HD Homeodomain HDAC Histone Deacetylase 1 HDL High Density Lipoprotein HSV Herpes Simplex Virus HSV IE Herpes Simplex Virus Immediately Expressed Genes HTG Hypertriglyceridemia IR Insulin Receptor IRS Insulin Receptor Substrate kb Kilobase Pairs kDa Kilodalton LDL Low Density Lipoprotein L-PK L-Type Pyruvate Kinase LUC Luciferase LXR Liver X Receptor MAPK Mitogen Activated Protein Kinase ME Malic Enzyme MEK MAPK/ERK Kinase

xiv

Mlx Max-Like Protein X MLXIPL Max-Like Protein X Interacting Protein MUFA Mono-Unsaturated Fatty Acid NAFLD Non-Alcoholic Fatty Liver Disease NES Nuclear Entry Signal NF-Y Nuclear Transcription Factor Y NLS Nuclear Localization Signal Oct Octamer Binding Transcription Factor Oct-1 Octamer Binding Transcription Factor 1 Oct-2 Octamer Binding Transcription Factor 2 oxLDL Oxidized Low Density Lipoprotein PAK-1 Protein Activated Kinase 1 PCR Polymerase Chain Reaction PEP Phosphoenolpyruvate PI3K Phosphoinositide Kinase 3 Pit-1 Pituitary Specific Transcription Factor 1 PKA Protein Kinase A pol RNA Polymerase POU Super family of transcription factors containing a bipartite DNA binding domain POU domain A bipartite DNA binding domain characteristic of members of the POU family POU2F1 Oct-1 synonym PP Protein Phosphatase PP2a Protein Phosphatase 2a PPARγ Peroxisome Proliferator-Activated Receptor Isoform Gamma Pro-Rich Proline Rich Region PUFA Polyunsaturated Fatty Acid RNA Ribonucleic Acid SCD-1 Sterol Co-Enzyme Desaturase 1 SDS Sodium Dodecyl Sulphate shRNA Small Hairpin RNA SMRT Silencing Mediator of Retanoic Acid and Thyroid Hormone Receptor snRNA Small Nuclear RNA Sp1 A Human Transcription Factor Involved in Early Development SRE Sterol Response Element SREBP-1c Sterol Response Element Binding Protein Isoform 1-c T2DM Type 2 Diabetes Mellitus TBP TATA Box Binding Protein TCA Citric Acid Cycle Tg Triglyceride Unc-86 Neural Transcription Factor 86 (C. elegans) Xu-5-P Xylulose-5-Phosphate ZIP-Like A Zip-like domain

xv

LIST OF PUBLICATIONS AND PRESENTATIONS

(i) Project Specific Publications

Sirek, AS., Liu, L., Naples, M., Adeli, K., Ng, DS., Jin, T. Insulin stimulates the expression of Carbohydrate Response Element Binding Protein (ChREBP) by attenuating the repressive effect of POU homeodomain protein Oct-1. EPub ahead of print, Endocrinology, April 9th, 2009.

(ii) Project Specific Oral Presentations

Sirek, AS., Ng, DS., and Jin, T. Insulin stimulates the expression of the Carbohydrate Response Element Binding Protein (ChREBP) by attenuating the effect of the POU homeodomain protein Oct-1. Banting and Best Diabetes Centre and Samuel Lunenfeld Research Institute Diabetes Seminar Series, University Health Network, Toronto, ON, March 2009.

Sirek, AS., Ng, DS., and Jin, T. Transcriptional Regulation of ChREBP: Controlling a Key Player in Lipogenesis. Canadian Diabetes Association Professional Conference and Annual Meetings, Montreal, QC, October 2008.

Sirek, AS., Ng, DS., and Jin, T. Transcriptional Regulation of the Carbohydrate Response Element Binding Protein (ChREBP): A New Look at a Lipogenic Control. Diabetes in Motion Speaker Series, Waterloo, ON, October, 2008.

Sirek, AS., Ng, DS., and Jin, T. The POU homeodomain protein Oct-1 as a potential transcriptional repressor of ChREBP, a key regulator of lipogenesis. Diabetes Discovery Research Group, University Health Network, Toronto, ON, May 2008

(iii) Project Specific Poster Presentations

Sirek, AS., Liu, L., Ng, DS., Jin, T. A novel mechanism in controlling the expression of ChREBP: The involvement of insulin and the POU homeodomain protein Oct-1. American Diabetes Association 69th Scientific Sessions, New Orleans, LA, U.S.A., June 2009.

Sirek, AS., Liu, L., Ng, DS., Jin, T. Mechanisms controlling the expression of of the Carbohydrate Response Element Binding Protein (ChREBP): Insulin, and Oct-1. Banting and Best Diabetes Centre Annual Research Day, Toronto, ON, May 2009.

Sirek, AS., Liu, L., Ng, DS., Jin, T. A novel mechanism in controlling the expression of ChREBP. Endocrinology and Diabetes Research Group 2nd Annual Research Day, University of Toronto, Toronto, ON, May 2009.

Sirek, AS., Ng, DS., and Jin, T. Transcriptional Control of the Carbohydrate Response Element Binding Protein (ChREBP). Endocrinology and Diabetes Research Group 1st Annual Research Day, Toronto, ON, May 2008.

1

Chapter 1. INTRODUCTION

1.01 Regulation of Gene Expression

Eukaryotic gene expression can be regulated at multiple steps, ultimately affecting the

conversion of information stored in DNA into functional proteins. The differences in cell

types depend on the particular genes that are expressed. Additionally, as demonstrated in

various cancers, superfluous expression of genes at incorrect times may lead to devastating

pathophysiological conditions. Therefore, control mechanisms in gene expression are

important to understand. The major steps in gene expression where control mechanisms

are often found include:

1. Transcriptional Control – controlling when and how often a given gene is

transcribed,

2. RNA Processing Control – controlling how the mRNA transcript is spliced or

otherwise processed,

3. RNA Transport and Localization Control – controlling which completed

mRNAs in the cell nucleus are exported into the cytosol and determining

where in the cytosol they are localized,

4. Translational Control – controlling which mRNAs in the cytoplasm are

translated by ribosomes,

5. mRNA Degradation Control – controlling destabilization of certain mRNA

molecules in the cytoplasm,

2

6. Post Translational Modification – the chemical and enzymatic modification of

proteins following their translation, and

7. Protein Activity Control – controlling the selective activation, inactivation,

degradation, or compartmentalization of specific protein molecules after

they have been made.

These mechanisms controlling gene expression are important in the determination of

cell fate. There is only one mechanism, transcriptional control, which ensures that the cell

will not synthesize superfluous intermediates. This is the mechanism of regulation which we

chose to study in detail, in order to identify mechanisms underlying ChREBP gene

expression.

Gene transcription is controlled by a regulatory region of DNA close to the site in which

transcription begins, termed the “promoter”. There are many variations on this regulatory

region, some are simple switches, which turn on or off gene expression; while others are

more complex, and act to integrate various signals present in the nucleus in order to

determine whether a gene should be expressed at a certain time. Both forms of promoters,

simple and complex, contain two fundamental components: Short stretches of DNA which

contain defined and conserved sequences; and gene regulatory proteins which recognize

and bind to these defined sequences.

Typically, nucleotide sequences shorter than 20 bp function as the fundamental

components for specific gene regulatory protein binding. Studies have identified thousands

of these sequences and their interacting proteins. Generally, molecular recognition requires

3

an exact fit between the surfaces of two molecules in order to allow their interaction (1).

This same principle applies in DNA-protein interactions. Gene regulatory proteins, or

transcription factors, recognize a specific DNA sequence because the surface of the protein

is complementary to the special surface features present in the DNA double-helix.

Generally, these proteins make interactions which include hydrogen-bonds, ionic bonds,

and hydrophobic interactions (2). While individually, these interactions may be weak,

upwards of 20 of these interactions may act together to allow stronger affinity (2, 3).

Interestingly, studies of DNA-protein recognition often fall into various categories of

interaction based upon the motifs found in the protein. These motifs often use α-helices or

β-sheets to bind to the major groove of DNA, as this groove often contains sufficient

information to distinguish various DNA sequences.

Eukaryotes use gene regulatory proteins to activate or repress the expression of genes.

These proteins bind to the promoter or regulatory element such as enhancers of the gene,

which may be thousands of nucleotides distant from the gene itself. Since this region is so

large, it has been termed the gene control region. It is generally accepted to be made up of

a promoter (where the general transcription factors and polymerase assemble), and

regulatory sequences (to which regulatory proteins bind to control the rate of assembly at

the promoter). The distance between these regions may be considered flexible space

needed for communication, and interactions between DNA-bound proteins.

There are a small number of “general transcription factors” which are abundant

proteins required to initiate the assembly of a complex which recruits RNA polymerase II to

4

a gene promoter. The gene regulatory transcription factors are considerably more

numerous and allow for great specificity in control mechanisms. Different selections of gene

regulatory proteins are present in different cell types and thus different patterns of gene

expression are generated which give that cell its particular characteristics. Due to this, the

understanding of transcription factors expressed in a particular cell type can divulge a great

deal of information regarding processes specific to that tissue and any pathologies which

may arise therein.

1.02 General Overview of Hepatic Carbohydrate Metabolism

The liver is the main site at which nutrients, which have been absorbed from the gut and

then transferred into the blood, are processed for use by other cells in the body. The liver is

a large organ which develops at a site in the body where a major vein runs close to the wall

of the primitive gut. Thus, the adult organ retains a close relationship with the circulatory

system. In fact, the majority of the liver’s blood is supplied directly from the intestinal tract

via the portal vein. Cells in the liver that derive from primitive gut epithelium (hepatocytes)

are arranged in interconnected sheets and chords with blood-filled spaces running in

between them. The single layer of flattened endothelial cells that covers the exposed

surfaces of the hepatocytes allows for one of the chief functions of the liver: the exchange

of metabolites between hepatocytes and the blood.

Hepatocytes are required for the synthesis, degradation, and storage of a large variety

of substances. They also play a large role in the carbohydrate and lipid metabolism of the

entire body, and secrete a large quantity of the protein found in blood plasma. In fact, the

5

primary site for the conversion of excess dietary carbohydrates into triglycerides (Tg) is

within the liver. An increase in dietary carbohydrates leads to increased expression of

several key regulatory enzymes that are involved in lipogenesis, including L-Type Pyruvate

Kinase (L-PK), Acetyl Co-A Carboxylase (ACC), Malic Enzyme (ME), ATP-Citrate Lysase (ACL),

and Fatty Acid Synthase (FAS).

Until recently, insulin was believed to be the main inducer of lipogenic gene expression,

mediated via the Sterol Regulatory Element Binding Protein 1-c (SREBP-1c) (4). This

transcription factor, a member of the basic helix-loop-helix-leucine-zipper (bHLH/ZIP)

family, induces lipogenic gene expression through binding to the sterol regulator element

(SRE) within the promoter sequence of its target genes (5-7). SREBP-1c is also potently

regulated by liver X receptors (LXR) which heterodimerize with retinoid X receptors (RXR)

(8-10) and bind to a sequence known as the LXR response element. Studies in SREBP-1c-/-

mice, however, demonstrated that there is only about 50% reduction in fatty acid synthesis

(11). Thus, SREBP-1c alone cannot account for all lipogenic activity in response to glucose

and insulin signalling.

In 2001, the carbohydrate response element binding protein (ChREBP) was purified and

identified as the long-sought carbohydrate response element of the cell (12). This

transcription factor, which responds to glucose, up-regulates a similar panel of downstream

target genes as SREBP-1c, including L-PK, ACC, ME, ACL, and FAS. The involvement of SREBP-

1c and ChREBP in controlling the activation of lipogenic target genes is illustrated in Figure

1.

6

1.02.1 Metabolism of Dietary Carbohydrates

The dietary carbohydrates which we ingest must be broken down into simple sugars for

use by the cells as energy sources or as building blocks for synthesizing a variety of

molecules. Though predominantly active in the liver, additional sites of lipogenesis include

adipose tissue, and the mammary glands. Lipogenesis involves the conversion of

carbohydrates such as glucose, into fatty acids. Fatty acids are then used for synthesis of

phospholipids, esterified cholesterol, and triglycerides. Fatty acids from lipogenesis and the

circulating pool both contribute significantly to the triglyceride pool that are destined for

packaging into lipoproteins such as the very-low density lipoprotein (VLDL) and secreted

from the liver. Synthesis of fatty acids occurs in the cytosol of the cell and generally begins

with the molecule Acetyl-CoA. The oxidation and breakdown of fatty acids occurs within the

mitochondria. Many of the enzymes involved in lipogenesis are grouped into a multienzyme

complex termed “Fatty Acid Synthase” (FAS).

1.02.2 Insulin Signalling

Important in activating and regulating some of the metabolic pathways involved in

hepatic lipogenesis is the insulin signalling pathway. Insulin, discovered in 1921, provided

some of the first evidence for the activity of endocrine secretions. Insulin was demonstrated

to be the key hormone which allowed the entry of glucose from the bloodstream into the

cell, thus lowering glycemia, and in many cases, providing effective therapy for diabetes.

Extensive studies on this important hormone have demonstrated that it activates a

complicated signalling pathway with a large number of targets.

7

Figure 1: An illustration of the interactions of ChREBP and SREBP-1c with lipogenic enzyme gene promoters.

The expression of genes involved in lipogenesis may be controlled via two important transcription factors,

ChREBP (purple) and SREBP-1c (green). SREBP-1c has been well characterized as an insulin-driven pathway,

while the more recent ChREBP has been linked to a carbohydrate-induced lipogenic enzyme activation

pathway. Both transcription factors bind to specific sites in the promoter region of the target gene (ChREBP to

ChoRE and SREBP-1c to SRE) to modulate gene expression. Negative regulatory partners are indicated in red.

(Adapted from Towle, PNAS, 2001)

ChoRE SRE

ChREBP SREBP-1c

InsulinGlucose

Glucagon (cAMP)

PUFAs

Lipogenic Enzyme Expression

8

Figure 2: An illustration of the Insulin Signalling Pathway

Insulin, binds to IR. IRS activates signalling cascade of events. Insulin signalling is known to act through

two major pathways, via GSK3 and MEK/ERK. IR: Insulin Receptor; IRS: Insulin Receptor Substrate; PI3K:

Phosphoinositide Kinase 3; AKT: Protein Kinase B; GLUT4; Insulin Regulated Glucose Transporter 4; GSK3;

Glycogen Synthase Kinase 3; MEK: MAP Kinase/ ERK Kinase; ERK: Extracellular Signalling Regulated Kinase.

(Image courtesy of Jane Sun)

IR

Insulin

Ras

IRSPI3K

Raf

MEK

ERK

Akt

PPP

P

GSK-3

Glycogen

Synthesis

Transcriptional Activation

PP2A

GLUT4 vesicle

GLUT4

Glucose

Apoptosis

Cytoplasm

Nucleus

Translation

9

Insulin binds to the cell surface via the aptly named insulin receptor. This in turn

activates a cascade of signalling events (13). Figure 2 summarizes some relevant elements

of this cascade for this study. These events include the phosphorylation of both the

receptor and a number of members of the insulin receptor substrate (IRS) family (14).

Tyrosine phosphorylation on IRS caused by insulin is a critical event in mediating insulin

action and is generally impaired in cases of insulin resistance (15, 16). Various pathways

may be activated in response to IRS phosphorylation including:

1. The MAPK Pathway – which mediates various cellular effects such as growth

and mitogenesis, and

2. The PI3K-Akt Pathway – which mediates gluconeogenesis, glycogen and

protein synthesis in addition to being involved in GLUT4 translocation.

In insulin resistant states, the insulin signalling pathway is dysregulated resulting in

inhibited glucose uptake.

1.02.3 Pathophysiology of Metabolic Disorders

Dysregulation of lipogenesis plays an important role in the pathophysiology of many

metabolic diseases, including obesity, type 2 diabetes mellitus (T2DM), and the metabolic

syndrome (17-19). Subjects with these disorders are known to be at risk for a variety of

complications, including non-alcoholic fatty liver disease (NAFLD), atherosclerosis, and

many cardiovascular complications (17, 20-23). Additionally, subjects with T2DM and its

cardiovascular complications are often accompanied with hyperinsulinemia,

10

hypertriglyceridemia (HTG), obesity, and insulin resistance. Hence, there is increased

mortality in T2DM patients as a result of liver, cardiovascular, and other complications (21,

24).

Diabetes mellitus is known to have two major forms, type 1 (T1DM), which is caused by

an autoimmune destruction of insulin producing β-cells of the pancreas , and type 2, which

is caused by defects in insulin signalling and insulin secretion. Over nutrition is commonly

accepted as a promoting factor for T2DM (25-27). As insulin resistance progresses to

hyperglycemia, homeostatic mechanisms are activated to transform these sugars into fats.

Thus, enhanced lipogenesis, development of obesity, and hyperlipidemia frequently

precede the onset of type 2 diabetes.

Closely associated with T2DM is non-alcoholic fatty liver disease (NAFLD). This condition

is emerging as one of the most common chronic liver diseases in the Western hemisphere

(28), and contains a large spectrum of liver pathologies, including steatosis, steatohepatitis,

cirrhosis, and hepatocellular carcinoma (5, 29-32). NAFLD has been associated with obesity,

and insulin resistance (33-36), and this insulin resistance has recently been identified as a

crucial patho-physiological factor in the development and progression of NAFLD (37).

With the role of ChREBP elucidated in controlling lipogenic gene expression, the

question of its role in the pathophysiology of hepatic steatosis was raised. Triglycerides

(Tgs), synthesized from fatty acids, may derive their bioconstituents from either plasma

nonesterified fatty acids, or fatty acids generated via de novo lipogenesis. Excessive

accumulation of Tgs is one of the primary characteristics of hepatic steatosis (38, 39).

11

Additionally, it is highly likely that ChREBP plays a large role in the development of obesity

in cases of T2DM as the increased carbohydrates will lead to ChREBP activation and

ultimately fat production. Interestingly, leptin-deficient (ob/ob) mice show increased

hepatic lipogenesis and hepatic steatosis (40, 41). This had previously been attributed to

SREBP-1c and PPARγ (42-44). However studies in SREBP-1c-/- and PPARγ-/- mice showed only

partial improvement in the development of hepatic steatosis (23, 43). Recent studies have

implicated the involvement of ChREBP-mediated lipogenesis in the development of fatty

liver (17, 40, 41).

It is well known that the number of patients displaying obesity and elements of the

metabolic syndrome has reached epidemic proportions in both Western (45-47) and

developing (48-52) countries. Due to these statistics, it has become ever more important to

study the underlying metabolic control pathways which may underlie these conditions.

Though SREBP-1c was first identified as an important transcription factor in the control of

hepatic lipogenesis, it was not until later that ChREBP was recognized as the carbohydrate

response element of the cell (23). The involvement of ChREBP in a great number of

pathologies, including T2DM, obesity, NAFLD, and other elements of the metabolic

syndrome, makes this transcription factor an important target for future studies in order to

understand the underlying transcriptional control of hepatic lipogenesis.

12

1.03 The Carbohydrate Response Element Binding Protein (ChREBP)

1.03.1 Overview

Studies in recent years have identified the Carbohydrate Response Element Binding

Protein (ChREBP, also known as Mlx Interacting Protein Like, MLXIPL) as another important

activator of lipogenic gene expression (12, 53-59). Due to this, ChREBP is now understood to

be a key determinant of lipid synthesis in vivo, and as such, has been intensively

investigated due to the possible implications for a variety of metabolic disorders.

ChREBP was first identified in 2001 using affinity chromatography and mass

spectrometry (53). The human gene that encodes ChREBP is located on Chromosome 7. The

protein that was purified contained 852 amino acids and a molecular weight of

approximately 95 kDa. This protein contains several regulatory domains, including a nuclear

localization signal, a nuclear entry signal, a basic helix-loop-helix-leucine-zipper (b/HLH/Zip),

and a leucine-zipper like (Zip-Like) domain (Figure 3). ChREBP imparts transcriptional control

via binding to the carbohydrate response element (ChoRE) of its lipogenic target gene

promoters (54, 60-65).

In primary cultures of hepatocytes, ChREBP was shown to induce the activation of L-PK

following glucose treatment (12). The activation of L-PK and other lipogenic enzymes lead to

the realization that this was the elusive “glucose-responsive element” of the cell. ChREBP

does not homodimerize or bind to the ChoRE as a homodimer (54, 65). An analysis of

ChREBP using the yeast-two-hybrid system identified an additional bHLH/ZIP protein, Mlx,

13

Figure 3: An illustration of the major domains in ChREBP

ChREBP is a member of the bHLH/ZIP Leu-ZIP family of transcription factors. It has been primarily linked to

the carbohydrate-induced activation of lipogenic gene expression. Various regulatory phosphorylation sites

which have been well characterized in ChREBP cellular localization and activation are denoted. Additionally, a

putative nuclear entry and nuclear localization site have been identified near the N-terminus. (Adapted from

Kawaguchi et al., PNAS, 2001)

Glucose Sensing Module

N - - C

1 864

Ser196 Ser568 Ser626 Thr666

NLSNES Pro-Rich Pro bHLH ZIP ZIP-Like

14

which interacts with the bHLH/ZIP domain of ChREBP (65). Mlx is a member of the

Myc/Max/Mad family of transcription factors. This family serves as a common interaction

partner within a transcription factor network (66). Evidence for the interaction between Mlx

and ChREBP was provided through the use of a dominant-negative form of Mlx (54).

According to the model proposed by the Towle group, two ChREBP-Mlx heterodimers bind

to the two E boxes of the ChoRE in order to provide a transcriptional complex necessary for

glucose regulation (54, 62, 63, 65). Interestingly, it appears that the Mlx loop region, but not

the loop region of ChREBP, is the determinant for the regulation of the glucose response, in

which ChREBP binds to the ChoRE found in lipogenic target genes (63).

1.03.2 Regulation of ChREBP activity by post-translational modifications:

Phosphorylation and De-phosphorylation

ChREBP has been shown to undergo post-translational modifications which modulate its

subcellular localization and transcriptional activity. ChREBP has also been demonstrated to

shuttle from the cytoplasm to the nucleus following stimulation with high glucose (>25 mM)

(12). Later, it was shown that in primary culture, and in livers from high-carbohydrate fed

mice, ChREBP is indeed concentrated in the nucleus when activated (67). Based upon the

current model (Figure 4), ChREBP is located within the cytosol under basal conditions.

Following a stimulatory event, such as high glucose concentrations (>25 mM), xylulose-5-

phosphoate (Xu-5-P) selectively activates protein phosphatase 2a (PP2A). PP2A then acts to

dephosphorylate ChREBP at the serine 196 (Ser-196) site, allowing its nuclear translocation.

Upon entry into the nucleus, ChREBP is further dephosphorylated by PP2A at the threonine

666 (Thr-666)

15

Figure 4: Mechanisms underlying ChREBP activation/inactivation

ChREBP is activated by an offshoot of the glycolytic pathway Xu-5-P (derived from G-6-P). Xu-5-P up-

regulates the activity of PP2A which in turn dephoshorylates ChREBP at the Ser196 site. This action allows

ChREBP to enter the nucleus where PP2A further dephosphorylates the peptide at the Thr666 site, allowing

binding to the DNA with its partner Mlx. Fatty acids and hormones have been shown to reverse this process

through PKA and AMPK as indicated on the right side of the figure.

Transcriptional Activation of

Lipogenic targets

Cytoplasm

Nucleus

Xu-5-P Ser196Thr666

Ser196Thr666

Fatty Acids Hormones

cAMP

PP2A

PKA

ACS

AMP

AMPK

Glucose

PP2A

16

residue. This event allows the binding of ChREBP to the ChoRE and thus results in the

activation of target gene expression.

Questions have been raised as to the accuracy of this model, as mutants of ChREBP in

which one or several of the proposed phosphorylation sites have been mutated (including

Ser-196 and Thr-666), retain the ability to activate target gene expression in response to

glucose stimulation (68). It has been suggested that the post-translational control of

ChREBP is complex, and may require mechanisms other than PKA mediated

phosphorylation in order to regulate the activation of downstream targets (69).

1.03.3 Role of ChREBP in Glucose Metabolism

ChREBP has been shown to activate the transcription of a large set of targets involved in

glycolytic and lipogenic pathways, including L-PK ACC and FAS (12, 70). Binding of ChREBP to

these target promoters was confirmed with chromatin immunoprecipitation (ChIP) (55).

Knockdown of ChREBP, achieved with a siRNA approach, removed the glucostimulatory

effect on the expression of L-PK, ACC, and FAS genes (70). As illustrated in Figure 5, ChREBP

is required for both basal and carbohydrate-induced expression of several liver-enzymes for

coordinated control of glucose metabolism and fatty acid synthesis (18, 53, 55, 58, 63).

Studies using the ChREBP-/- mouse model, generated in 2004, have revealed the role of

ChREBP under physiological and pathophysiological conditions (71). As anticipated, ChREBP-

/- mice showed impaired glycolytic and lipogenic pathways in the liver. These mice also

exhibited glucose and insulin intolerance (71), reduced expression of mRNA of genes that

encode ME, ACC, FAS, and L-PK, along with decreased lipogenesis (55, 71). Additionally,

17

Figure 5: The role of ChREBP in metabolic regulation

The wide range of ChREBP target sites and the implications to cellular metabolism has caused ChREBP to

become a target of great interest in research. ChREBP, bound to the ChoRE of various target genes regulates

the expression of a variety of important enzymes in metabolic processes. Well-characterized targets are

indicated here in yellow and include: SCD-1, FAS, ACC, ACL, ME, and L-PK. (Adapted from Dentin et al.,

Biochimie, 2004).

Gly

coly

sis

Glucose

Glu-6-P

Fru-6-P

GAP

PEP

Pyruvate

Xu-5-P

Lipo

genesis

MUFA-CoA

SFA-CoA

Malonyl-CoA

Acetyl-CoA

Citrate

Acetyl-CoA

TCA Cycle

Malate Oxaloacetate

Transcriptional Activation of

Lipogenic targets

PP2A

Cytoplasm

Nucleus

18

these mice showed reduced fat pads, indicating that ChREBP may play a function in that

tissue. There is corroborating evidence for this notion as ChREBP expression was shown to

be induced during adipocyte differentiation in 3T3-L1 cells (72). Lastly, ChREBP-/- mice

demonstrate a marked intolerance to fructose-rich diets (71).

1.03.4 Transcriptional Regulation of ChREBP

The identification of ChREBP as a key hepatic glucose sensor involved in channelling

carbohydrates into lipogenic pathways explained why in vitro high ambient glucose alone

was sufficient in stimulating a panel of lipogenic genes; independent of the well

characterized SREBP-1c (12, 17, 58, 59, 73-75). Recent genome-wide association studies

have linked certain ChREBP polymorphisms with low ratios of high density lipoprotein (HDL)

/ HTG levels, characteristic of subjects at risk for liver and cardiovascular diseases (76-78). In

addition, the assessment of ChREBP-/- mice showed that despite normal SREBP-1c

activation, the expression of mRNA that encode enzymes required for lipogenesis, were

reduced (54, 55, 71).

Although the stimulatory effect of glucose on the function of ChREBP in activating

lipogenic gene expression has been extensively investigated (23, 75), we know very little

about mechanisms underlying the expression of this master controller of lipogenesis.

Several recent studies suggested that high ambient glucose, insulin, PPARγ agonist, Liver X

receptor (LXR) and polyunsaturated fatty acids (PUFAs) may also affect ChREBP mRNA

expression levels (17, 23, 70, 75, 79, 80). Whether these components affect ChREBP

expression at the gene transcriptional level, however, has not been investigated.

19

Furthermore, in the hyperinsulinemic ob/ob mouse model, ChREBP expression level is

substantially higher, indicating a potential role of insulin in stimulating ChREBP production

(61, 81).

A recent study examined the cis-regulatory elements of the rat ChREBP gene promoter

(82). Although this study revealed a few nuclear protein binding sites, including those for

the transcription factors Sp1 and NF-Y, on the rat ChREBP promoter, how transcription

factors mediated physiological and pathological signals in regulating ChREBP transcription

was not examined. Furthermore, there is almost no information regarding the mechanisms

underlying the expression of the human ChREBP (hChREBP) gene promoter. More recently,

Hashimoto et al demonstrated that the thyroid hormone is able to activate ChREBP

promoter activity (83). This activity, however, appeared to be dependent on coordination

with LXRs to regulate ChREBP transcription. As ChREBP has been identified as a labile

protein with a short half-life of 30 minutes (84), understanding the players involved in its

transcription is of great importance to better understand the role of ChREBP in human

diseases. In this study, we show the existence of an evolutionarily conserved POU protein

binding site within the proximal region of the ChREBP promoter that interacts with the

ubiquitously expressed POU protein Oct-1.

20

1.04 The POU Homeodomain Protein Oct-1

1.04.1 POU Domain Superfamily

Oct-1 is a member of the POU homeodomain superfamily of highly conserved eukaryotic

transcription factors involved in the regulation of embryonic development and other bio-

physiological functions. The POU domain was first identified in 1988 and takes its name

from the first four POU transcription factors in which it was found: Pituitary-Specific

Transcription Factor-1 (Pit-1); The Octamer-Binding Transcription Factors, Oct-1 and Oct-2;

and the Neural Unc-86 Transcription Factor (Unc-86 was derived from Caenorhabditis

Elegans) (85-88). The POU domain was distinguished from other homeodomains by a region

found N-terminal to it; which, when first identified had no known homologues. Since the

two sub-domains (POUS and POUHD) were separated by a variable linker sequence (87), it

was suggested that the POU domain was bipartite in nature. Figure 6A demonstrates the

two subdomains of the POU domain for the POU family member Oct-1. POU proteins are

characterized based upon the presence of a bipartite DNA binding domain referred to as the

POU domain. This domain consists of both a homeodomain and a helix-turn-helix structure,

joined by a flexible polypeptide “leash” or linker (Figure 6B). The entire protein is encoded

in a single gene and is synthesized as a continuous polypeptide chain. The covalent joining

of two structures in this way results in a large increase in the affinity of the protein for its

specific DNA sequence compared with the DNA affinity of either separate structure.

This structurally bipartite POU domain has an intrinsic conformational flexibility, which

appears to confer a functional diversity to this particular class of transcription factors (89).

21

Figure 6: The overall domain structure of Oct-1

Oct-1 is a member of the POU homeodomain superfamily of transcription factors. Oct-1 is the only

ubiquitously expressed member of this family, and has been implicated as a potent positive or negative

regulator of a large variety of target genes. (A) This family is characterized by the POU domain closely linked to

a homedomain which allows a great specificity to target sequences by “wrapping” around the DNA sequence.

(B) The structure shown (called a POU-domain) consists of both a homeodomain and a helix-turn-helix

structure joined by a flexible polypeptide “leash,” indicated by the broken lines (Adapted from Alberts et al,

the Molecular Biology of the Cell, 4th Edition, 2002).

0 755

POU HD

LinkerActivation

Domain

B

A

Homeodomain

POU Domain

Linker

22

POU domains are an example of a classic modular molecular construction, utilizing

ancient folds used in transcriptional control within prokaryotes and early eukaryotes and

adapting them to regulatory processes in highly specialized tissues within complex

organisms. Interestingly, this modular structure imparts a functional versatility that allows

the POU domain to participate in transcriptional regulation of a variety of target genes.

POU domain proteins have been grouped based upon the properties of the linker that

separates the two DNA-binding domains (90-92). The seven major POU domain families,

defined by their linker sequences are listed in Table 1.

1.04.2 The Octamer Binding Proteins

The ubiquitously expressed Oct-1 and its closely related, tissue-specific form Oct-2 were

identified as proteins which target the octamer regulatory element ATGCWAAT (W=A/T)

(93, 94). Oct-2 is mainly expressed in B lymphocytes and plays a much more specialized role

than Oct-1; being responsible for regulation of immunoglobulin gene expression (95, 96).

This effect, however, is to some extent redundant, as Oct-1 can act as a functional

substitute to Oct-2 to regulate B cell immunoglobulin gene expression (97-99).

Oct-1 was identified early-on to interact with a variety of other transcriptional

regulators in order to activate the transcription of a variety of genes, including snRNA (100),

and histone H2B (101). It is also used by the herpes simplex virus to activate the expression

of the viral immediate early (HSV IE) genes (102). Oct-1 activates transcription of target

genes by various means. For example, the snRNA genes, transcribed by two RNA

polymerases, pol II and pol III, are activated via Oct-1 behaving as an accessory factor to

23

Type Characteristics Examples

I Neuronally expressed Pit-proteins

II Important in development and cellular stress response Oct-1, and Oct-2

III Involved in neural development Brn 1, 2, 4 and Tst-1

IV Involved in development Brn 3.x class, Unc-86

V Involved in early embryogenesis Oct-4

VI Expressed in the central nervous system Brn 5, MPOU

VII Critical for early development stages POU-2

Table 1: An overview of the various identified forms of POU homeodomain proteins

Table adapted from references (92, 103).

24

locate the activation complex which is identical for both polymerases (104). In other

cases, Oct-1 has been shown to act in synergy with recruited factors in order to up-regulate

gene transcription.

The Oct-1 POU domain complexed with the octamer site from the H2B promoter

revealed the detailed interactions underlying the DNA recognition element (105). The two

subdomains of the POU domain make independent interactions with two half-sites on the

operator and are bound on opposite faces of the DNA. The ATGC sub-site of the octamer

element is contacted by the POUS domain with an extensive array of hydrogen bonds while

the WAAT site tends to bind by the POUHD domain. The role of the linker region in POU

proteins has been postulated to be specific for promoter recognition and co-operative

effects (106, 107). Additionally, POU proteins have increased sequence-specific DNA

recognition through their ability to homo and heterodimerize (108, 109). The net result of

this highly stringent design is a transcription factor with the potential to effectively regulate

a large series of targets with high efficiency.

1.04.3 The Function of Oct-1

Extensive examinations have shown that Oct-1 may function as a transcriptional

activator or a repressor (82, 110-129) for a large profile of genes. While Oct-1-/- mice are

embryonically lethal (130), studies on fibroblasts isolated from Oct-1-/- mice, demonstrated

that this POU protein plays an important role in regulating the expression of genes that

mediate the cellular stress responses (69, 119, 131, 132). Oct-1-/- fibroblasts were

hypersensitive to gamma radiation, doxorubicin, and hydrogen peroxide stresses (132).

25

Interestingly, these cells harboured elevated reactive oxygen species and demonstrated

altered expression of genes associated with the cellular stress response (120, 132-134).

These observations indicate that Oct-1 is an important stress sensor and a key part of the

cellular response pathway to stress.

Oct-1 and Oct-2 DNA binding site specificity has been shown to be regulated in vitro by

different kinases (135). Phosphorylation of Oct-1 by PKA activation has been shown to

inhibit its DNA binding activity in nuclear extracts of Daudi cells. It is thought that

differential binding of Oct-1 to the octamer sequences may be possible through regulation

of its phosphorylation (135). In addition, PP2A, a positive regulator in ChREBP activation,

has been implicated as a negative regulator of Oct-1 DNA binding to the H2B promoter

(135). Additionally, a recent study has identified a series of serine and threonine sites on the

Oct-1 peptide which are phosphorylated following oxidative stress (136).

1.04.4 Oct-1 and Metabolic Stress

The POU homeodomain superfamily of transcription factors are involved in an ever-

expanding variety of regulatory mechanisms. More recently, Oct-1 was shown to mediate

the effect of oxidized LDL (oxLDL) in repressing the expression of vascular cytochrome P450

(CYC) monooxygenases (119). In human coronary arterial endothelial cells, knockdown of

Oct-1 expression prevented oxLDL-mediated silencing of CYP expression (119).

Furthermore, inhibition of oxLDL receptor (LOX-1) attenuated oxLDL-mediated endothelial

DNA damage, Oct-1 DNA binding, and reversed impaired production of endothelial-derived

hyperpolarization factor (119). Therefore, Oct-1 activation in response to oxidative stress is

26

among the pathological responses in metabolic dysfunction of coronary arterial

endothelium (119). With the trends in public health towards obesity and the increasing

prevalence of many aspects of the metabolic syndrome, the stresses placed upon the

body’s cells and regulatory pathways are ever-increasing.

It is therefore likely that transcription factors such as Oct-1 play an important role for a

large number of these pathophysiologic processes. Dysregulation or altered function of Oct-

1 which has been clearly demonstrated to greatly impact its downstream targets. Our

observations presented here indicate that Oct-1 plays an important role in the molecular

control of hepatic lipogenesis through its interaction with the promoter region of ChREBP.

As a repressor of lipogenic induction, and a sensor of physiological changes to stress, Oct-1

may prove to be an important element in the control of a variety of human diseases.

27

Chapter 2. RATIONALE AND HYPOTHESIS

Studies focussing on ChREBP have demonstrated that this transcription factor plays an

important role in regulating hepatic lipogenesis. While the post-translational regulation and

function of ChREBP has been extensively investigated, very little is known about the

transcriptional regulation of this important gene. An understanding of the mechanisms

involved in the mechanistic control of lipid production would greatly aid in the development

of treatments for, and the understanding of, a variety of pathological conditions, including:

obesity, T2DM, NAFLD and the metabolic syndrome. Thus, an understanding of the basic

molecular mechanisms which underlie lipid biosynthetic process activation is most

desirable, indeed it is imperative.

Previous studies of the POU homeodomain protein Oct-1 in Dr. Jin’s laboratory indicated

that it was a transcriptional repressor of another homeodomain transcription factor, the

cdx-2 gene. We thus hypothesized that Oct-1 would act to negatively regulate ChREBP gene

expression. While ChREBP has been demonstrated to be post-translationally regulated by

various factors, few studies have investigated the transcriptional regulation of its

expression. Interestingly, studies in hyperinsulinemic mice indicated that ChREBP mRNA and

protein levels were significantly increased (40, 41). Glucose, however, has not been shown

to significantly upregulate ChREBP mRNA expression. Thus we sought to determine whether

insulin affected ChREBP gene expression. Additionally, very little is known about the effect

of insulin on ChREBP as studies have focussed on the glucose-response of this important

transcription factor. We hypothesized that insulin stimulation would increase ChREBP

28

expression, and that this increase in expression may be, at least in part, due to an

attenuation of the repressive effect of Oct-1 on gene expression.

2.01 Whether Oct-1 Functions as a Repressor of ChREBP Expression

The first aim of our study was to assess the ChREBP promoter and its interaction with

the POU homeodomain protein Oct-1. This aim was focussed to identify the first potential

transcription factor acting on the expression of the ChREBP promoter. Until recently,

lipogenesis was understood to be activated primarily through the SREBP family, and in

particular, SREBP-1c (137-139). With the discovery and characterization of ChREBP in 2001

(12, 53), the field of lipogenic regulation opened to include a carbohydrate-driven element.

When we started this line of investigation, there had been only limited studies which

attempted to examine the ChREBP promoter region and its transcriptional regulation (82).

Our project began with the identification of a highly-conserved POU binding site within

the human ChREBP proximal promoter, specific for the POU homeodomain proteins. Oct-1

has been shown to act as a potent transcriptional regulator of various genes, and has been

linked to important cellular metabolic pathways; in particular, the cell’s stress response

system. With this knowledge, we tested our first hypothesis that Oct-1 acts as a

transcriptional repressor of ChREBP gene expression. Indeed, we found through a variety of

experimental formats that Oct-1 is a negative regulator of ChREBP promoter and Oct-1

over-expression repressed ChREBP mRNA and protein expression.

29

2.02 Whether Insulin Treatment Stimulates ChREBP Expression

The second aim of our study was to examine the effect of insulin on ChREBP gene

expression. There is evidence that the expression of ChREBP, its function primarily induced

by carbohydrates, is also elevated in states of hyperinsulinemia. Studies in hyperinsulinemic

mice demonstrated that ChREBP mRNA and protein levels are increased compared to

control animals (40, 41). We therefore proposed that insulin acts to stimulate ChREBP gene

expression. Within this aim, we chose not to assess chronic insulin stimulation, but rather

the effect of acute insulin treatment on ChREBP gene expression. This allowed us to make

effective use of the protocols and cell lines utilized in the first aim, and also allowed a

standpoint from which we would approach our third aim (see below). Observations from

our second aim demonstrate that insulin acts as a stimulatory agent of the expression of

ChREBP promoter, mRNA and protein levels. When we coupled our insulin stimulation

experiments with the Oct-1 knockdown cell line, and Oct-1 over-expressing cell lines,

generated for Aim 1, we further characterized the insulin stimulation as possibly being

influenced by Oct-1 content.

2.03 Whether Insulin Stimulates ChREBP Expression via Attenuating the Effect of

Oct-1 on the ChREBP Promoter

The third aim of our study was an extension of the first elements in order to assess the

potential for interaction between Oct-1 and insulin with regard to ChREBP gene expression.

Since aim 1 sought to identify a potential negative regulator, and aim 2 sought to identify a

potential positive regulator, it was likely that there would be some interface between the

two elements in order to achieve their effect on the ChREBP promoter. The hypothesis for

30

our third aim was that insulin acted to stimulate ChREBP expression via modulating the

repressive effect of Oct-1 on the ChREBP promoter. In fact, using a variety of techniques, we

demonstrated that insulin appeared to exert its stimulatory effect, at least in part, by

decreasing the Oct-1 content, and thereby releasing the repression of Oct-1 on the ChREBP

promoter.

All three aims and hypotheses of this study are summarized in Figure 7.

31

Figure 7: An illustration of the hypotheses of this study

A recapitulation of the mechanisms involved in activation of hepatic lipogenesis. A) Oct-1 binding to the

POU site located in the ChREBP promoter (human position -96 to -103 bp) results in transcriptional repression

of ChREBP. B) Insulin acts to stimulate ChREBP expression via attenuating the repression of the ChREBP

promoter by Oct-1. Insulin may cause a phosphorylation event excluding Oct-1 from the POU site present in

the ChREBP promoter. The conserved POU binding site ATGCTAAT is denoted on the double helix in orange

P P

A

B

Oct-1

ChREBP Expression

Oct-1

ChREBP Expression

32

Chapter 3. MATERIALS AND METHODS

3.01 Chemicals

The antibiotics G418 (invitrogen Life Technologies, Burlington, Ontario, Canada) and

Puromycin (Sigma-Aldrich Canada Ltd., Oakville, Ontario, Canada) were used to select cell

lines to maximal transfection or infection efficiency for the shRNA mediate gene knockdown

approach and Oct-1 over-expression approach. The MEK/ERK inhibitor PD98059, the AKT

1/2 inhibitor, and the PI3k inhibitor LY294002 were purchased from Calbiochem (EMD

Biosciences, Inc., San Diego, California, USA). Cells were starved in serum-free medium

overnight, and then pre-treated with either the MEK or AKT inhibitor for one hr prior to

experimentation. DMSO treatment was used as a control in each experiment. All other

chemicals were purchased from Sigma-Aldrich.

3.02 Plasmid Construction

A 1.4 kb human ChREBP (hChREBP) gene 5’ flanking sequence was isolated from the

human hepatocellular carcinoma cell line HepG2 by Dr. Ling Liu in Dr. Jin’s laboratory. The

sequence information has been deposited into the Genbank (Access number: FG480402).

Four human ChREBP (hChREBP)-luciferase (LUC) fusion gene constructs were generated

using a nest deletion strategy, inserting various lengths of the 5’ flanking region of hChREBP

into a pPGL2 basic (Promega/ Fischer Scientific, Nepean, Ontario, Canada) plasmid

construct. The constructs were designated as -1.4 kb hChREBP-LUC, -328 bp hChREBP-LUC, -

123 bp hChREBP-LUC (wt), and -123 bp hChREBP-LUC (mut). As illustrated in Figure 10A, all

33

fusion gene constructs contain the wild-type Oct-binding site (ATGCTAAT) with the

exception of -123 bp hChREBP-LUC (mut) in which the Oct-binding site was mutated

(ATACGGAT).

The plasmid constructs pcDNA3.1-Oct-1 and pcDNA3.1-Cdx-2 were generated by

inserting a copy of the Oct-1 or Cdx-2 coding sequence into a pcDNA3.1/Myc/HisA

expression vector (Invitrogen Life Technology).

3.03 Cell Culture

The HepG2 cell line was cultured in α-MEM (Invitrogen Life Technologies), enriched with

5% fetal bovine serum (FBS), and cultured without antibiotics for all of the experiments.

Cos-7 fibroblasts were cultured in DMEM-Low (Invitrogen Life Technologies) containing 5%

FBS. All tissue culture plates were incubated at a temperature of 37°C enriched with 5%

CO2. Primary hamster hepatocytes were isolated in collaboration with the Khosrow Adeli

Lab (Hospital for Sick Children, Toronto, ON). Methods for isolating and culturing primary

hepatocytes from Syrian Golden Hamsters have been reported previously (140, 141).

Briefly, livers from anaesthetized (isoflurane) male hamsters weighing 100-120 g (Charles

River, Montreal, QC) were perfused and digested using specialized media (Life Technologies,

Inc.) according to the manufacturer’s instructions. Hepatocytes released from digested liver

tissue were washed twice in hepatocyte wash medium, resuspended in attachment media

(Williams E containing 5% FBS, 1 ug/ml insulin, and antibiotics) and seeded in Primaria cell

culture plates (BD Biosciences) at a density of 1.1 x 106 cells/35 mm dish. Following a 4 hr

attachment period the cells were cultured in serum free α-MEM for 4 hr prior to insulin

34

treatment. All animal protocols were approved by the animal ethics committee at the

Hospital for Sick Children, Toronto, Ontario.

3.04 DNA Transfection and Luciferase Reporters

Transfection of DNA plasmids was achieved utilizing Lipofectamine 2000. Cells were

cultured in serum-free medium, one hr prior to transfection. DNA and Lipofectamine 2000

were used in a 2:1 ratio (i.e. 2µg DNA : 1µl Lipofectamine 2000). Transfection was allowed

for 16-18 hrs followed by treatment and cell harvesting. Luciferase activity was analyzed

using an EG&G Berthold Lumat LB 9507 Luminometer, and relative luciferase activity was

normalized to the protein concentration in each extract. SK-LUC and CMV-LUC were used as

positive and negative controls, respectively, in each experiment. Additionally, a pool of

HepG2 cell clones that over-express Oct-1 were generated by stably expressing pcDNA3.1-

Oct-1 with antibiotic (G418) selection.

3.05 Lentiviral shRNA Knockdown

Lentiviral knockdown of Oct-1 was achieved using the pGIPZ Lentiviral shRNAmir system

(ThermoFischer Scientific, Huntsville, Alabama, USA), in which, GFP expression serves as the

indication of infection efficiency. A helper packaging and enveloping plasmid were co-

transfected with each of the individual shRNA constructs in the HEK293T cell line. Following

72 hrs of lentiviral growth and secretion, the medium containing the virus was harvested

and the titre was determined. HepG2 cells were then infected with each of the three shRNA

constructs for Oct-1 or the shRNA construct for the scrambled control. Infection was

35

allowed for 72 hrs and then cells were selected to 100% infection efficiency with the use of

the antibiotic agent puromycin.

3.06 RNA Extraction and Real Time RT-PCR

RNA was extracted using Trizol reagent (Invitrogen Life Technology) as per

manufacturer’s instructions. cDNAs were generated using the Superscript First Strand

Synthesis System for RT-PCR (Invitrogen Life Technologies). Real-time RT-PCR was

conducted with Rotor-Gene 3000 (Corbett Research, Dorval, Quebec, Canada), utilizing the

SYBR Green PCR Master Mix (Applied Biosystems, Foster City, California, USA). DNA

sequences of the primers for real time RT-PCR in detecting hChREBP mRNA are: forward: 5’-

GGTCACTTCATGGTGTCGTC -3’, and reverse: 5’- CACATCTGTAGGCCAGGCT -3’. DNA

sequences for the primers for real time RT-PCR in detecting L-PK are: forward: 5’-

GAGTCGGAGGTGGAAATTGT -3’, and reverse: 5’- CCGCACCACTAAGGAGATGA -3’.

Expression levels of ChREBP mRNA are presented as relative copy numbers (with the

untreated samples defined as 1), normalized to the expression of β-actin mRNA.

3.07 Chromatin Immunoprecipitation

HepG2 cells (90% confluent) were treated with or without 10 nM insulin for 4 hrs.

Following the treatment, the cells were exposed to 1% formaldehyde for 10 min at room

temperature. Glycine was added to neutralize the solution to a final concentration of 0.125

M for 5 min. The samples were then washed twice with cold PBS and then harvested in PBS.

Cells were collected by centrifugation, and resuspended in lysis buffer (5 mM HEPES (pH

8.0), 80 mM KCL, 1% NP40, 100 mM PMSF, and protease inhibitors). Following 10 min of cell

36

lysis, nuclei were pelleted and resuspended in the nuclear lysis buffer (50 mM Tris-Cl (pH

8.0), 10 mM EDTA, 1% SDS, proteinase inhibitors). Chromatin in the harvested samples was

sonicated to an average length of 600 bp and separated by centrifugation. The sheared

chromatin was cleaned with blocked salmon sperm DNA/protein A agarose for 30 min at

4°C. The cleaned chromatin was separated from other products by centrifugation and

stored in a clean eppendorf. A portion of the cleaned chromatin was diluted 10 fold with

the IP dilution buffer (0.01% SDS, 1.1% Triton 100, 1.2 mM EDTA, 16.7 mM Tris-Cl (pH 8.0),

167 mM NaCl, protease inhibitors), and was incubated overnight (with rotation at 4°C) with

the Oct-1 antibody. Blocked salmon sperm DNA/protein A agarose was added to the IP

pellet and incubated for 3 hrs at 4°C with rotation. The IP product was collected by

centrifugation and washed sequentially in: low salt wash buffer (0.1% SDS, 1% Triton X-100,

2.0 mM EDTA, 20 mM Tris-Cl (pH 8.0), 150 mM NaCl, protease inhibitors), high salt was

buffer (0.2% SDS, 1% Triton X-100, 2.1 mM EDTA, 20 mM Tris-Cl (pH 8.0), 500 mM NaCl,

protease inhibitors), and a LiCl immune complex washing buffer (0.25 mM LiCl, 1% NP40, 1

mM EDTA, 10 mM Tris-Cl (pH 8.0), 1% deoxycholate, protease inhibitors). A portion of this

sample was saved for Western Blot analysis. The remaining sample was reverse cross linked

with TE/1%SDS and heated at 65°C overnight. Following incubation, proteinase K (10

mg/ml) was added and the sample was incubated at 37°C for 2 hrs. The DNA product was

then diluted with buffer PB (Qiagen PCR Purification Kit), and run through a suspension

column. The column was washed with buffer PE (Qiagen PCR Purification Kit), and finally

eluted in ddH2O. DNA sequences of the primers for the amplification of the OCT binding site

containing hChREBP promoter region are: forward: 5’- CAGGACTCCAAGGAAAGACG -3’, and

37

reverse: 5’- GTCTGTGTCCGAGTCCGAGT -3’. DNA sequences of the primers for detecting the

intron product (contains no OCT binding site, serving as the negative control) are: forward:

5’- AGGGCATCTAAGGTCCTGGT -3’, and reverse: 5’- CCCCAGCTATCTCTGACTGG -3’.

Expression levels are presented as relative copy numbers (with the untreated samples

defined as 1) and normalized to the input values.

3.08 Nuclear Protein Extraction

The method for nuclear extraction has been described previously (142). Briefly, nuclear

extraction buffers were prepared containing: Buffer A: 10mM HEPES (pH 7.9), 10mM KCl,

0.1 mM EDTA, 0.1 mM EGTA, 1mM DTT, and 0.5 mM PMF, Buffer C: 20mM HEPES (pH7.9),

0.4 mM NaCl, 1mM EDTA, 1mM EGTA, 1mM DTT, and 1mM DTT. Cells were pelleted and

then lysed with buffer A. 25 µl NP-40 was added and cells were vigorously vortexed. Nuclei

were pelleted, and the cytosolic fragment transferred to a fresh eppendorf tube for storage.

The nuclear pellet was lysed with buffer C, and nuclear fragments pelleted. The supernatant

containing the nuclear content was transferred to a fresh eppendorf tube and stored prior

to blotting.

3.09 Immunoblotting

The cell lysis buffer contained 10% NP-40, Sodium Deoxycholate, and 10X SDS.

Immediately prior to use, a protease inhibitor tablet, (Complete Mini, EDTA-free) (Roche

Pharmaceuticals, Indianapolis, IN, USA) was added. Following lysis, the cellular fragments

were pelleted and the supernatant was transferred to a new eppendorf tube which

contained an appropriate volume of 10X SDS loading dye. For immunoblotting, equal

38

amounts of total cellular protein were separated by SDS/PAGE, transferred to immobilon,

and immunoblotted with antibodies following the protocols provided by manufacturers.

Immunocomplexes were visualized by an enhanced chemiluminescence detection kit (Super

Signal West Pico Chemiluminescent Substrate) (Thermo Scientific, Rockford, IL, USA) by

using horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotech,

California, USA). Antibodies against Oct-1, GSK-3, phospho-GSK-3, ERK, phospho-ERK, as

well as β-actin were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz Biotech). The

antibody for ChREBP was purchased from Novus Biologicals (Novus Biologicals, Littleton,

Colorado, USA).

3.10 Electrophoretic Mobility Gel Shift Assay (EMSA)

The POU-binding site containing probe (ChREBP-POU probe) was made by annealing

two complementary oligo nucleotides: ChREBP-POU-forward: 5’-

GATCTGCGTAAGGATTATGCTAATACAAGCCCCGCG -3’, and ChREBP-POU- reverse: 5’-

GATCCGCGGGGCTTGTATTAGCATAATCCTTACGCA -3’. The position of this probe in the

hChREBP promoter is indicated in Figure 9. The mutant POU-binding site containing probe

(ChREBP-POU mut) was made by annealing the following two complementary oligo

nucleotides: ChREBP-POU mut forward: 5’-

GATCTGCGTAAGGATTATACGGATACAAGCCCCGCG -3’, and ChREBP-POU reverse: 5’-

GATCCGCGGGGCTTGTATCCGTATAATCCTTACGCA- 3’. The EMSA was performed by

incubating approximately 50x103 (cpm) end-labeled DNA probe (0.25ng/reaction) with

nuclear protein in binding buffer (10 mM Tris-HCI (pH 8.0),40 mM KCl, 6% glycerol, 1 mM

39

dithiothreitol, and 0.05% NP-40) for 30 min at 30°C. Each incubation also contained 2-8 µg

poly-dI/dC and the PCR generated fragment was used as a nonspecific competitor DNA. The

reaction was then loaded onto a 5% nondenaturing polyacrylamide gel. After the

electrophoresis, the gel was dried prior to exposure to an X-Ray film for 16-24 hrs.

3.11 Statistical Analysis

Quantitative results are expressed as a mean ± the standard deviation (SD). Statistical

analyses were performed using the student’s t-test or ANOVA. Null hypotheses were

rejected at p > 0.05. All experiments were performed independently as a minimum of

triplicates.

40

Chapter 4. RESULTS

4.01 Oct-1 as a negative transcriptional repressor of ChREBP expression

4.01.1 Oct-1 interacts with the POU protein binding site located within the

proximal promoter region of ChREBP

Following the isolation and examination of the 1.4 kb human ChREBP gene 5’ flanking

sequence, we identified a typical POU protein binding site at the position between -103 bp

and -96 bp. This octamer motif (ATGCTAAT) and the flanking sequences were found to be

conserved between human and rodent (mouse and rat) species (Figure 8). Importantly, we

have also examined the human SREBP-1c gene promoter and could not locate a POU

protein binding site. Except for the ubiquitously expressed Oct-1, no other POU

homeodomain proteins are abundantly expressed in the hepatocytes.

To examine whether Oct-1 interacts with this binding site, we conducted EMSA using

nuclear proteins isolated from the human HepG2 cells against the probe designated as

ChREBP-POU. As shown in lane 2 of Figure 9A, HepG2 nuclear proteins formed two

complexes with the ChREBP-POU probe: a major complex C1 and a minor complex C2. To

investigate whether one of them represents the interaction between Oct-1 and the ChREBP-

POU probe, Oct-1 antibody and a control GATA-1 antibody were utilized in the EMSA. The

pre-incubation of nuclear proteins with the Oct-1 antibody (lane 3) but not with the control

GATA-1 antibody (lane 4) resulted in a retarded migration of C1, suggesting that the major

complex C1 contains Oct-1.

41

Figure 8: The POU-binding site is highly conserved within ChREBP promoters

An illustration of the rat, mouse, and human ChREBP proximal promoter regions. POU, the evolutionarily

conserved POU protein binding site. The sequence ATGCTAAT was found to be specific for the POU protein

Oct-1. TATA, TATA box. TSS, transcription start site. DNA sequence information was obtained from Genbank

(NM_032951, human; NM_133552, rat; and NM_021455, mouse).

Rat ----GAAAAGTAGGGACTA----AAAATTGCTCACA------GCAGACAGAAAGGTTAAG -152

Mouse ----GAAAAGTAGAGACTA----AAAAGTGCTCTCA------ACAGAAAGAAAGGCGAAG -167

Human TGGAGCAAAGTAGGGGCGGCTCTATCAGGACTCCAAGGAAAGACGGGAAGGGAGATGGGG -154

* ******* * * * * *** * * * ** ** *

Y-box POU

Rat C---------------CAGGACCAGTGGTTTCACACCAGGCTCATTGGTTATGCTAATTT -107

Mouse CA--CCGCCAAAGCTCCAGGATCAGTGGTTTCACACCACGCTCACTGGTTATGCTAATTT -109

Human CCAACCCGCCAGAGCTCCAGAGCACCGGGTTCTCACCTGGCGTAAGGATTATGCTAATAC -94

* * ** ** ** *** **** ** * * **********

SRE SP-1

Rat AAACATCACCTGCCAACCAAGA-CCACGCCCACCACAAGGACAAAT-AGTGGGGCAGAGG -48

Mouse AAACATCACCTGCCAACTAAGGGCCACGCCCACCACAAGGACCTATCAGGAGAACAGGGG -49

Human AAGCCCCGCC--CCGTCCCAGG-CCCCGCCCACCCGATCGGCCTAT----GGTGTGGGGG -41

** * * ** ** * ** ** ******** * * * ** * * **

TATA box TSS

Rat CGTGGCCATGGTAATTAGGCTCAGCTGGCAAGGATTGGCTCTCAAACTGCTAT------- +5

Mouse CGTGGCCATGGTAATTAGGCGCAGCTGGCTACGTTAAGCGCTCTCCAGAGCGC------- +4

Human CGGGGCTATGTTAATGAGGCCCGGCTGGCCAAGAGCTGTTCCCCGCGCTGCGCGGAGCAG +20

** *** *** **** **** * ****** * * * * *

42

Figure 9: Oct-1 binds to the POU-binding site located within the ChREBP promoter

EMSA shows the interaction between HepG2 nuclear proteins and the POU binding site probe. (A) EMSA

identifying C1 as the Oct-bound probe through the use of Oct-1 Ab. (B) Extended separation by un-denatured

PAGE further confirms the existence of the supershifting with the Oct-1 Ab. C1, complex 1; C2, complex 2; FP,

free probe, and NE, nuclear extract.

Supershift

C1

C2

1 2 3 4 5 6 7 8

NE - + + + + + + +

Oct-1 Ab (µl) - - 1 2 - - - -

Competitorwt

- - - - - -100

x200

x

Competitormut

- - - -100

x200

x- -

B

NE - + + +

Oct-1Ab

- - + -

GATA-1 Ab

- - - +

C1

Supershift

A

C2

FP

1 2 3 4

43

The retardation of the C1 complex in the presence of Oct-1 antibody in the un-

denatured PAGE was minimal (Figure 9A). To further verify that this does represent a

“supershifting” event, we extended the separation time of the PAGE, and observed with

two different dosages of Oct-1 antibody a clear retardation in the migration of the C1

complex (Figure 9B, comparing lanes 3 and 4 with lane 2). Furthermore, the addition of an

excess amount of unlabelled ChREBP-POU probe (lanes 7 and 8), but not the mutant one

(lanes 5 and 6), completely blocked the formation of the C1 complex, indicating that the

ATGCTAAT motif is essential for the formation of C1. We therefore conclude that Oct-1

binds to the evolutionarily conserved POU protein binding site in the human ChREBP gene

promoter.

4.01.2 Oct-1 functions as a transcriptional repressor of ChREBP

To investigate whether the binding of Oct-1 to the hChREBP promoter affects ChREBP

gene transcription, LUC reporter gene analyses