Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell...

10
Supplemental Figure 1. Fine structure of the functional core of potato Cen6. The top track in each panel shows the sequence coordinates on the respective potato chromosome. The “annotated genes” track illustrates the positions of annotated genes. The green line in the middle track shows the number of sequence reads derived from ChIP with CENH3 antibodies in 100 bp windows. The vertical red bars represent the percentage of the 32 tissues in which the corresponding gene is expressed (FPKM >0) (1 representing expression in all 32 tissues). The bottom track shows the density of reads in 100 bp windows, adjusted by the length of mappable regions. The horizontal green bars in this track mark the sequencing gap/non-mappable regions. Each green bar region is assigned to an adjacent CENH3 subdomain. All CENH3 subdomains are shaded in yellow. Supplemental Data. Gong et al. (2012). Plant Cell 10.1105/tpc.111.100511

Transcript of Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell...

Page 1: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Figure 1. Fine structure of the functional core of potato Cen6. The top track in each panel shows the sequence coordinates on the respective potato chromosome. The “annotated genes” track illustrates the positions of annotated genes. The green line in the middle track shows the number of sequence reads derived from ChIP with CENH3 antibodies in 100 bp windows. The vertical red bars represent the percentage of the 32 tissues in which the corresponding gene is expressed (FPKM >0) (1 representing expression in all 32 tissues). The bottom track shows the density of reads in 100 bp windows, adjusted by the length of mappable regions. The horizontal green bars in this track mark the sequencing gap/non-mappable regions. Each green bar region is assigned to an adjacent CENH3 subdomain. All CENH3 subdomains are shaded in yellow.

Supplemental Data. Gong et al. (2012). Plant Cell 10.1105/tpc.111.100511

Page 2: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Figure 2. Fine structure of the functional core of potato Cen11. The top track in each panel shows the sequence coordinates on the respective potato chromosome. The “annotated genes” track illustrates the positions of annotated genes. The green line in the middle track shows the number of sequence reads derived from ChIP with CENH3 antibodies in 100 bp windows. The vertical red bars represent the percentage of the 32 tissues in which the corresponding gene is expressed (FPKM >0) (1 representing expression in all 32 tissues). The bottom track shows the density of reads in 100 bp windows, adjusted by the length of mappable regions. The horizontal green bars in this track mark the sequencing gap/non-mappable regions. Each green bar region is assigned to an adjacent CENH3 subdomain. All CENH3 subdomains are shaded in yellow.

Page 3: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Figure 3. Fine structure of the functional core of potato Cen12. The top track in each panel shows the sequence coordinates on the respective potato chromosome. The “annotated genes” track illustrates the positions of annotated genes. The green line in the middle track shows the number of sequence reads derived from ChIP with CENH3 antibodies in 100 bp windows. The vertical red bars represent the percentage of the 32 tissues in which the corresponding gene is expressed (FPKM >0) (1 representing expression in all 32 tissues). The bottom track shows the density of reads in 100 bp windows, adjusted by the length of mappable regions. The horizontal green bars in this track mark the sequencing gap/non-mappable regions. Each green bar region is assigned to an adjacent CENH3 subdomain. All CENH3 subdomains are shaded in yellow.

Page 4: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Figure 4. ChIP-qPCR confirmation of potato genes associated with CENH3 nucleosomes. Primers designed from two expressed genes, PGSC0003DMG400012074 (2074) and PGSC0003DMG400039086 (9086), and three silenced genes, PGSC0003DMG400012078 (2078), PGSC0003DMG400045728 (5728), and PGSC0003DMG400008748 (8748), were used in qPCR analysis. The actin-97 gene (PGSC0003DMG400027746), which is located outside of the centromeres, was used as a negative control. The actin-97 sequence showed no enrichment in both computer-based mapping and qPCR analysis. All five genes were mapped to centromeres and were highly enriched with CENH3 in computer-based analysis. Relative fold enrichment (RFE) is normalized with the actin-97 control, then calculated as 2-ΔCT (see Methods) and indicated by the height of the color-coded columns with standard error. ChIP-qPCR confirmed the significant enrichment of all five genes in ChIPed DNA sample as compared to the negative control. The “-1, -2, -3, -5, -6” suffixes on X-axis represent different primer pairs for the same gene.

Page 5: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Figure 5. Proportion of repeat families in WGS-454 and CENH3 ChIP-seq data. Red dots represent 454 clusters.

Page 6: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Figure 6. Representative fiber-FISH images from six centromere-specific satellite repeats. The fiber-FISH signals were digitally straightened. Each bar represents 50 µm, which spans approximately 150 kb of DNA .

Page 7: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Table 1. Measurements of fiber-FISH signals from six centromeric repeats[A conversion rate of 3.21 kb/µm (Cheng et al. 2002) was used to convert the measurements]

Repeat and Fibers Fiber Length (µm) Fiber Length (kb)St3-58 fibers1 502.2376 1612.1832 477.3534 1532.3043 459.043 1473.5284 439.6233 1411.1915 415.8535 1334.896 402.0071 1290.443

Average 449.353 µm 1442.423 kb

St49 fibers1 736.0371 2362.6792 660.5066 2120.2263 621.0397 1993.5374 591.6801 1899.2935 591.6314 1899.1376 578.5979 1857.299

Average 629.92 µm 2011.029 kb

St24 fibers1 1275.562 4094.5552 1546.391 4963.9153 1216.949 3906.4084 1364.087 4378.7195 1293.657 4152.638

Average 1339.329 4299.247

St3-238 fibers*1 1319.578 4235.8452 1275.946 4095.7873 837.6238 2688.7724 807.0844 2590.7415 763.9987 2452.4366 531.4964 1706.103

St18 fibers*1 2397.52 7696.032 2177.56 6989.963 1275.07 4092.964 1218.61 3911.75

Page 8: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

5 1073.97 3447.466 1064 3415.447 821.89 2638.268 821.15 2635.919 733.13 2353.35

St57 fibers1 245.071 786.6792 326.843 1049.1673 250.240 803.2704 291.661 936.2315 252.279 809.8166 240.468 771.9037 330.391 1060.5558 284.689 913.8509 288.463 925.96510 236.066 757.77311 314.576 1009.79012 313.159 1005.24213 242.147 777.29114 334.550 1073.90515 250.101 802.82316 272.400 874.40317 277.511 890.81118 236.165 758.08819 236.637 759.60320 372.428 1195.49521 331.761 1064.95422 276.954 889.02323 237.591 762.66724 359.391 1153.646

Average 283.398 µm 909.706 kb*Lengths of the fibers are high variable, the short fibers most likely represent broken fibers.

Page 9: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Table 2. PCR primers used for cloning potato satellite repeats Repeat Primer Sequence [5'->3'] St3-58 CL3c58-R1 GTACATAAACATGCTCACCAAGTAAG

CL3c58-F2 TGTTGGTTGGGATATAAATTATGC

St3-238 CL3c238-R1 AGGCTTAACCGACATAGACCATAC

CL3c238-F2 ATGGGATGTGCACTCTAGTATGGTC

St3-294 CL3c294-F2 TTAGGACAATCTCTCACCTTGTG

CL3c294-R1 ATTTACAAAAATTGTGGATGCTATG

St18 CL18c4-F3 ACTTGGGAACATTCGTCCTC

CL18c4-R3 CCCTCAAAATGAATTAGGATGAAC

St24 CL24c27-F3 CGAGCTGACTTCCACATCG

CL24c27-R3 TGAAGCACACCTTCAGTTGC

St49 CL49c3-F3 AACTAACTAGAGATGCTGGGACAAG

CL49c3-R3 GTTACCCGCTTGACGTAACAC

St57 CL57c12-F3 CCTCATATGTATGCCCTCATTG

CL57c12-R3 TGTATTGGTTCCTACGCTCTACC

Page 10: Supplemental Data. Gong et al. (2012). Plant Cell 10.1105 ... · 9/11/2012  · Plant Cell 10.1105/tpc.111.100511 . Supplemental Figure 2. Fine structure of the functional core of

Supplemental Table 3. Primer set used to analyze putative active genes located in the CENH3 domain

Expected amplicon length Primer Primer sequence Target gene

cDNA gDNA

Function of the target gene

2074 F ACGTGGTGGAGACTGAACCT PGSC0003DMG400012074 165 165 Hypothetical protein

2074 R CTCCAACCTCACCCTTTCCT

9086_1 F AAATTGGTGCTGATGGGGTA PGSC0003DMG400039086 207 1661 TRNA-dihydrouridine synthase

9086_1 R CGCACGTATGCGTCAGTAGT

9086_2 F CGAACTGTTGAATGGGGATT 185 1638

9086_2 R TGACCTGGAAGCTGAGAACC

3879 F ACACCAATGACCCAACAACA PGSC0003DMG400043879 352 1008 Hypothetical protein

3879 R GAAACAGCAGCAAAGGAACC

actin-97 F AGTATGACGAATCTGGTCCTTCTATTG St-actin 97 203 203 Actin

actin-97 R ACCCAACAATCAACTCTGCCCTCTC

urease F TTGGACATTGACGGATCAGA PGSC0003DMG400001246 196 1388 Urease

urease R TTACGCCTCCTTTGATCACC


Supplemental Data. Adachi et al. (2015). Plant Cell …...2015/09/02  · Supplemental Data. Adachi et al. (2015). Plant Cell 10.1105/tpc.15.00213 Supplemental Figure 1. Promoter Activity

Supplemental Data. Adachi et al. (2015). Plant Cell …...2015/09/02  · Supplemental Data. Adachi et al. (2015). Plant Cell 10.1105/tpc.15.00213 Supplemental Figure 1. Promoter Activity

Supplemental Data. Mara et al. Plant Cell. (2010). … · 2010-03-15 · Supplemental Data. Mara et al. Plant Cell. (2010). 10.1105/tpc.109.0659463 2

Supplemental Data. Mara et al. Plant Cell. (2010). … · 2010-03-15 · Supplemental Data. Mara et al. Plant Cell. (2010). 10.1105/tpc.109.0659463 2

Supplemental Data. Yang et al. (2016). Plant Cell …...2016/03/02  · Supplemental Data. Yang et al. (2016). Plant Cell 10.1105/tpc.15.01027 8 WT lir1 WT lir1 LIR1 5’UTR T-DNA

Supplemental Data. Yang et al. (2016). Plant Cell …...2016/03/02  · Supplemental Data. Yang et al. (2016). Plant Cell 10.1105/tpc.15.01027 8 WT lir1 WT lir1 LIR1 5’UTR T-DNA

Supplemental Data. Hsu et al. Plant Cell. (2013). 10.1105 ...€¦ · Supplemental Data. Hsu et al. Plant Cell. (2013). 10.1105/tpc.113.114447 1 . Supplemental Figure 1. Induction

Supplemental Data. Hsu et al. Plant Cell. (2013). 10.1105 ...€¦ · Supplemental Data. Hsu et al. Plant Cell. (2013). 10.1105/tpc.113.114447 1 . Supplemental Figure 1. Induction

A B {FAFA} ncc1-ncc2 - The Plant Cell · Supplemental Data. Boulouis et al. (2015). Plant Cell 10.1105/tpc.15.00010 1 Supplemental Figure 1: Phenotype of the double mutant ncc1 ncc2

A B {FAFA} ncc1-ncc2 - The Plant Cell · Supplemental Data. Boulouis et al. (2015). Plant Cell 10.1105/tpc.15.00010 1 Supplemental Figure 1: Phenotype of the double mutant ncc1 ncc2

Supplemental Data. Josse et al. (2011). Plant Cell … · 22-03-2011  · Josse et al. (2011). Plant Cell 10.1105/tpc.110.082594. WT spt-11 spt-12 0 1,000 2,000 3,000 4,000 5,000

Supplemental Data. Josse et al. (2011). Plant Cell … · 22-03-2011  · Josse et al. (2011). Plant Cell 10.1105/tpc.110.082594. WT spt-11 spt-12 0 1,000 2,000 3,000 4,000 5,000

Supplemental Data. Geng et al. (2013). Plant Cell 10.1105 ... · Supplemental Data. Geng et al. (2013). Plant Cell 10.1105/tpc.113.112896 9" " Supplemental Figure 9. The ProRAB18:GFP

Supplemental Data. Geng et al. (2013). Plant Cell 10.1105 ... · Supplemental Data. Geng et al. (2013). Plant Cell 10.1105/tpc.113.112896 9" " Supplemental Figure 9. The ProRAB18:GFP

Data. Bedewitz et al. Cell (2014) 10.1105/tpc.114.130534...Supplemental Data. Bedewitz et al. Plant Cell (2014) 10.1105/tpc.114.130534 Supplemental Figure 5. The Impact of Silencing

Data. Bedewitz et al. Cell (2014) 10.1105/tpc.114.130534...Supplemental Data. Bedewitz et al. Plant Cell (2014) 10.1105/tpc.114.130534 Supplemental Figure 5. The Impact of Silencing

Supplemental Data. Seo et al. (2014). Plant Cell 10.1105 ......Feb 07, 2014  · Seo et al. (2014). Plant Cell 10.1105/tpc.11.1199743 Supplemental Figure 1. Protein alignment of ABD1

Supplemental Data. Seo et al. (2014). Plant Cell 10.1105 ......Feb 07, 2014  · Seo et al. (2014). Plant Cell 10.1105/tpc.11.1199743 Supplemental Figure 1. Protein alignment of ABD1

20121027 Supplemental Data Final - Plant Cell · Supplemental Data. Ren et al. (2012). Plant Cell 10.1105/tpc.111.107144 2 Supplemental figure 1. Functional analysis of BP12 lines

20121027 Supplemental Data Final - Plant Cell · Supplemental Data. Ren et al. (2012). Plant Cell 10.1105/tpc.111.107144 2 Supplemental figure 1. Functional analysis of BP12 lines

Supplemental Data. Antoniadi et al. (2015). Plant Cell. 10 ......Jul 10, 2015  · Antoniadi et al. (2015). Plant Cell. 10.1105/tpc.15.00176 Supplemental Figure 5. Cytokinin Metabolism

Supplemental Data. Antoniadi et al. (2015). Plant Cell. 10 ......Jul 10, 2015  · Antoniadi et al. (2015). Plant Cell. 10.1105/tpc.15.00176 Supplemental Figure 5. Cytokinin Metabolism

Supplemental Data. Golczyk et al. (2014). Plant Cell …...2014/03/14  · Supplemental Data. Golczyk et al. (2014). Plant Cell 10.1105/tpc.114.122655. 6 Supplemental Figure 5. Structure

Supplemental Data. Golczyk et al. (2014). Plant Cell …...2014/03/14  · Supplemental Data. Golczyk et al. (2014). Plant Cell 10.1105/tpc.114.122655. 6 Supplemental Figure 5. Structure

Supplemental Data. Peng et al. (2011). Plant Cell 10.1105 ... · 10/31/2011  · Peng et al. (2011). Plant Cell 10.1105/tpc.111.089128 Supplemental Figure 1. The genetic map position

Supplemental Data. Peng et al. (2011). Plant Cell 10.1105 ... · 10/31/2011  · Peng et al. (2011). Plant Cell 10.1105/tpc.111.089128 Supplemental Figure 1. The genetic map position

Supplemental Data. Park et al. (2012). Plant Cell 10.1105 ......NPB Supplemental Data. Park et al. (2012). Plant Cell 10.1105/tpc.111.105429. ... 170 130 70 40 100 55 35 KDa RING Finger

Supplemental Data. Park et al. (2012). Plant Cell 10.1105 ......NPB Supplemental Data. Park et al. (2012). Plant Cell 10.1105/tpc.111.105429. ... 170 130 70 40 100 55 35 KDa RING Finger

Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was

Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was

Supplemental Data. Balcke et al. (2017). Plant Cell 10.1105/tpc.17 · Supplemental Data. Balcke et al. (2017). Plant Cell 10.1105/tpc.17.00060 Supplemental Figure 2. Total GC-MS and

Supplemental Data. Balcke et al. (2017). Plant Cell 10.1105/tpc.17 · Supplemental Data. Balcke et al. (2017). Plant Cell 10.1105/tpc.17.00060 Supplemental Figure 2. Total GC-MS and

Supplemental Figure 1. ABA responses of SWI2/SNF2 chromatin remodeling mutants… · 2012-12-03 · Supplemental Data. Han et al. Plant Cell. (2012). 10.1105/tpc.112.105114 1 Supplemental

Supplemental Figure 1. ABA responses of SWI2/SNF2 chromatin remodeling mutants… · 2012-12-03 · Supplemental Data. Han et al. Plant Cell. (2012). 10.1105/tpc.112.105114 1 Supplemental

A B - The Plant Cell · 10/06/2010  · Supplemental Data. Je et al. (2010). Plant Cell 10.1105/tpc.109.069575 . Supplemental Table 1. The list of primers used for real-time RT-PCR

A B - The Plant Cell · 10/06/2010  · Supplemental Data. Je et al. (2010). Plant Cell 10.1105/tpc.109.069575 . Supplemental Table 1. The list of primers used for real-time RT-PCR

Supplemental Data. Matsuba et al. Plant Cell. (2013). 10 ... Data. Matsuba et al. Plant Cell. (2013). 10.1105/tpc.113.111013 3 AATTCATCAACACTTGATTCTTTCACTTTAAATTTCCTTCCTTTTACATGGTGAGTTCCAATTTCTTCTG

Supplemental Data. Matsuba et al. Plant Cell. (2013). 10 ... Data. Matsuba et al. Plant Cell. (2013). 10.1105/tpc.113.111013 3 AATTCATCAACACTTGATTCTTTCACTTTAAATTTCCTTCCTTTTACATGGTGAGTTCCAATTTCTTCTG

Supplementary Figure 1. Analysis of accumulation and ......Jul 08, 2013  · Supplemental Data. Armbruster et al. (2013). Plant Cell 10.1105/tpc.113.113118. 3 Supplemental Figure 2.

Supplementary Figure 1. Analysis of accumulation and ......Jul 08, 2013  · Supplemental Data. Armbruster et al. (2013). Plant Cell 10.1105/tpc.113.113118. 3 Supplemental Figure 2.