Mapping Genetic Resistance to Reniform Nematode ...

Clemson University Clemson University

TigerPrints TigerPrints

All Dissertations Dissertations

December 2020

Mapping Genetic Resistance to Reniform Nematode Mapping Genetic Resistance to Reniform Nematode

((Rotylenchulus reniformisRotylenchulus reniformis) in Soybean ) in Soybean

Juliet Elizabeth Fultz Wilkes Clemson University, [email protected]

Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations

Recommended Citation Recommended Citation Wilkes, Juliet Elizabeth Fultz, "Mapping Genetic Resistance to Reniform Nematode (Rotylenchulus reniformis) in Soybean" (2020). All Dissertations. 2740. https://tigerprints.clemson.edu/all_dissertations/2740

This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact [email protected].

https://tigerprints.clemson.edu/

https://tigerprints.clemson.edu/all_dissertations

https://tigerprints.clemson.edu/dissertations

https://tigerprints.clemson.edu/all_dissertations?utm_source=tigerprints.clemson.edu%2Fall_dissertations%2F2740&utm_medium=PDF&utm_campaign=PDFCoverPages

https://tigerprints.clemson.edu/all_dissertations/2740?utm_source=tigerprints.clemson.edu%2Fall_dissertations%2F2740&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

MAPPING GENETIC RESISTANCE TO RENIFORM NEMATODE (Rotylenchulus reniformis) IN SOYBEAN

A Dissertation Presented to

the Graduate School of Clemson University

In Partial Fulfillment of the Requirements for the Degree

Doctor of Philosophy Plant and Environmental Sciences

by Juliet Elizabeth Fultz Wilkes

December 2020

Accepted by: Dr. Paula Agudelo, Committee Chair

Dr. Christopher Saski, Co-chair Dr. Benjamin Fallen

Dr. John Mueller

ii

Abstract Soybean is an important legume crop worldwide. Plant-pathogenic

nematodes are common pests that often rob the plant of optimal performance and,

therefore, reduce yield potential. Reniform nematode (Rotylenchulus reniformis) is a

soil-borne, plant-parasitic nematode found in a wide range of soil textures in

tropical to subtropical environments and is capable of infecting soybean. The

objectives of this research were to 1) identify quantitative trait loci (QTL) associated

with soybean host suitability to reniform nematode using a breeding population

carrying genetic resistance from the soybean genotype Forrest, 2) develop and

validate molecular markers for use in identifying reniform nematode resistance in

soybean germplasm, and 3) map the transcriptome of two reniform nematode-

resistant soybean genotypes 24 hours after inoculation with high levels of reniform

nematode. Three QTL regions were identified within the soybean genome

associated with host suitability to reniform nematode. Single Nucleotide

Polymorphisms (SNPs) were chosen within each of the three regions and a

Kompetative Allele-Specific PCR assay (KASP) was designed to test their correlation

with the phenotype in 84 soybean genotypes. Results indicate use of these markers

provide a 76% rate of accurately calling a resistant/susceptible phenotype in

soybean germplasm. The transcriptome study confirms that soybeans can detect

reniform nematodes at least 24 hours after exposure. A number of defense-related

genes were found differentially expressed in the root tissue, particularly

cytochrome P450 genes, which may prove to be useful candidates for gene knock-

iii

out treatment to identify their importance in conferring resistance to the host plant.

This study identifies several novel regions in the soybean genome that correlate to a

host defense response to reniform nematode and are potential targets for use in the

development of resistant cultivars.

iv

Acknowledgments

I would like to recognize the following people for their contribution to this

dissertation, whether it was tangible or non-tangible assistance.

I would like to first thank my committee chair and manager, Dr. Paula

Agudelo. She offered me this opportunity and has been the most instrumental

mentor. I have learned the most from her in my time here.

I would like to thank each of my committee members for their unique

contribution to my work. Dr. Saski for his patience in teaching and guiding me in

learning bioinformatics and plant breeding. Dr. Fallen for giving me the opportunity

to see and participate in hands-on breeding projects. I truly enjoyed getting my

boots dirty and seeing plant genetics in action. And Dr. Mueller for the practical

nematology skills and always being there for the random questions and advice.

I would like to thank the countless colleagues who have been with me

through the challenges and celebrations. Specifically, Rooksana Noorai, Tatyana

Zhebentyayev, Michael Atkins, Melissa Munoz, and Stephen Parris, to name a few.

And my lab members: Nathan Redding, Max Ma, Wei Lei, and Samara Oliveira, and

David Harshman and Jeanice Troutman.

Lastly, I was to thank my parents for their constant support and nagging. And

most importantly, my husband, Kail, for everything he did for me to allow me to

focus. And my daughter, for showing me what it means to be motivated.

v

Table of Contents

Page

Title Page ........................................................................................................................................................ i Abstract .......................................................................................................................................................... ii Acknowledgments.................................................................................................................................... iv Table of Contents ....................................................................................................................................... v CHAPTER ONE: Quantitative Trait Loci associated with Rotylenchulus reniformis host suitability in soybean .................................................................................................................... 1 Abstract .................................................................................................................................................... 1 Introduction ........................................................................................................................................... 2 Materials and Methods ...................................................................................................................... 6 Results .................................................................................................................................................... 14 Discussion ............................................................................................................................................. 20 Conclusion ............................................................................................................................................ 25 References ............................................................................................................................................ 26 Figures.................................................................................................................................................... 32 CHAPTER TWO: Molecular marker validation for resistance to reniform nematode in soybean using KASP genotyping ......................................................................... 42 Abstract ................................................................................................................................................. 42 Introduction ........................................................................................................................................ 43 Materials and Methods ................................................................................................................... 45 Results .................................................................................................................................................... 48 Discussion ............................................................................................................................................. 50 Figures.................................................................................................................................................... 56 CHAPTER THREE: Differential gene expression of two reniform nematode resistant soybean genotypes 24 hours after inoculation .................................................... 61 Abstract ................................................................................................................................................. 61 Introduction ........................................................................................................................................ 62 Materials and Methods ................................................................................................................... 64 Results .................................................................................................................................................... 68 Discussion ............................................................................................................................................. 73 Figures.................................................................................................................................................... 82

vi

List of figures CHAPTER 1: Figure 1.1 Distribution of reniform nematode reproduction indices (RIs) in a

recombinant inbred line (RIL) population of ‘Forrest’ x ‘Williams 82’: ............................ 32 Figure 1.2 An unsupervised optimal univariate cluster analysis on (a) normalized reproduction indices (RIs) and (b) log10(x) transformed normalized RIs from 250 recombinant inbred lines screened with reniform nematode ......................................... 33 Figure 1.3 Linkage map constructed with SNP markers associated with reniform nematode host suitability ................................................................................................................... 34 Figure 1.4 Quantitative trait loci (QTL) for reniform nematode resistance mapped to Chromosomes 11 and 18 using normalized reproduction indices (nRI, in blue) and transformed reproduction indices [log10(nRI), in red] ........................................................ 36 Figure 1.5 Phenotypic effects of alleles in all recombinant inbred lines at each of the three identified QTL regions ............................................................................................................. 38 CHAPTER 2: Figure 2.1 Reproduction Indices (RI) of 44 soybean accessions with reniform nematode resistance reported by the Germplasm Resources Information Network (GRIN, USDA-ARS). ................................................................................................................................ 56 Figure 2.2 Optimized univariate k-means cluster analysis of Reproductive Indices (RI) of 44 soybean accessions with reniform nematode resistance and a susceptible control (cv. Braxton) ............................................................................................................................. 57 Figure 2.3 Endpoint fluorescence plots generated by KASP genotyping to predict reniform nematode resistance in 44 resistant soybean accessions at genomic regions (a) GlyREN18_46 and (b) GlyREN11_190 ................................................................. 59 Figure 2.4 Endpoint fluorescence plots generated by KASP genotyping to predict reniform nematode resistance in 40 susceptible soybeans accessions at genomic regions (a) GlyREN18_46 and (b) GlyREN11_190 ................................................................. 60

vii

CHAPTER 3: Figure 3.1 A principal component analysis (PCA) of three replicates (A) and reduced replicates (B) on a random subset of 500 raw transcript counts from reniform nematode-inoculated and control soybean genotypes ........................................................ 82 Figure 3.2 Number of differentially expressed (DE) genes in each observed soybean genotype in response to reniform nematode ........................................................................... 83 Figure 3.3 Gene expression profile clustering of differentially expressed transcripts in reniform nematode-susceptible genotype, Williams 82, and two resistant genotypes, Forrest and PI 437654, 24 hours after inoculation. ...................................... 89 Figure 3.4 Ten differentially expressed soybean genes shared in reniform nematode resistant soybean lines (Forrest and PI 437654) 24 hours after inoculation........... 90 Figure 3.5 Six differentially expressed genes in reniform nematode-inoculated resistant soybean, Forrest, 24 hours after inoculation ........................................................ 91 Figure 3.6 Ten differentially expressed genes in reniform nematode-inoculated resistant soybean genotype, PI 437654, 24 hours after inoculation. Gene annotations were assigned using the Pfam database ...................................................................................... 92 Figure 3.7 Annotation of differentially expressed genes in reniform nematode-resistant soybean lines Forrest and PI 437654 24 hours after inoculation. Annotation categories of each gene sequence provided by BlastKOALA (KEGG) .. 93

viii

Appendix Appendix 1.1 Gel image of normalized soybean DNA samples. Lanes 1-6 is 50ng of undigested DNA and lanes 7-12 are 100ng of individual DNA samples digested with PstI and MseI for 3 hours. Fragment sizes for digested DNA ranged from 200-1000 bp.................................................................................................................................................................... 94 Appendix 1.2 List of gene candidates within QTLs rrn-1, rrn-2, and rrn-3 associated with resistant to reniform nematode in soybean ................................................................... 95 Appendix 1.3 Comparison of the SNP positions in linkage groups to the Wm82.a2.v1. The genetic reference map is located on the right or in the center of the corresponding linkage maps. Blue lines connect homologous markers ..................... 99 Appendix 3.1 Thirteen-day-old soybean plants, Forrest and PI 437654, 24 hours after inoculation with reniform nematode ............................................................................. 103

1

CHAPTER 1

ABSTRACT

Reniform nematode (Rotylenchulus reniformis Linford and Oliveira) is a yield-

limiting pathogen of soybean (Glycine max (L.) Merrill) in the southeastern region of

the United States. A population of 250 recombinant inbred lines (RIL)(F7:8)

developed from a cross between reniform nematode resistant soybean cultivar

Forrest and susceptible cultivar Williams 82 was utilized to identify regions

associated with host suitability. A genetic linkage map was constructed using single-

nucleotide polymorphism markers generated by genotyping-by-sequencing. The

phenotype was measured in the RIL population and resistance was characterized

using normalized and transformed nematode reproduction indices in an optimal

univariate cluster analysis. Quantitative Trait Loci (QTL) analysis using normalized

phenotype scores identified two QTLs on each arm of chromosome 18 (rrn-1 and

rrn-2). The same QTL analysis performed with log10(x) transformed phenotype data

also identified two QTLs: one on chromosome 18 overlapping the same region in the

other analysis (rrn-1), and one on chromosome 11 (rrn-3). While rrn-1 and rrn-3

have been reported associated with reduced reproduction of reniform nematode,

this is the first report of the rrn-2 region associated with host suitability to reniform

nematode. The resistant parent allele at rrn-2 showed an inverse relationship with

the resistance phenotype, correlating with an increase in nematode reproduction or

host suitability. Several candidate genes within these regions corresponded with

2

host plant defense systems. Interestingly, a characteristic pathogen resistance gene

with a leucine-rich repeat was discovered within rrn-2. These genetic markers can

be used by soybean breeders in marker-assisted selection to develop lines with

resistance to reniform nematode.

INTRODUCTION

Soybeans (Glycine max L. Merrill) are an important commodity crop in the

southeastern region of the United States in both production acres and economic

value (soystats.com). Reniform nematode (Rotylenchulus reniformis Linford and

Oliveira) is a sedentary, root-feeding plant parasitic nematode known to infect over

300 species of plant species worldwide and a known pathogen of many row crops in

the southeast, including soybean (McGawley et al. 2011; Robinson et al. 1997).

Reniform is a prolific pathogen that is associated with a wide variety of soil textures

and has a life cycle reported to be less than 20 days in optimal conditions, producing

an average of 60 eggs per female (Rebois 1973). Annual surveys have revealed the

impact of reniform nematode on the production of soybean in southern states,

estimating a yield loss of 0.21% in each state in 2018 which equates to a total

average loss of 1.73 million bushels of soybean (Allen et al. 2018). Currently, the

most sustainable and cost-effective management practice for controlling high

reniform nematode pressure is to employ resistant cultivars. Planting resistant

soybean cultivars not only prevent major yield loss but also decreases reniform

nematode populations in the soil, which is important for fields rotated with cotton

3

(Gossypium hirsutum L.) or another susceptible crop. There are a number of

resistant soybean germplasm in both plant introductions (PIs) and released

cultivars (Robbins and Rakes 1996; Robbins et al. 1999, 2002). However, more

studies are required to fully understand and characterize the diversity and sources

of genetic resistance to reniform nematode in soybean.

Initial studies in the 1980’s suggested resistance to reniform nematode in

soybean was controlled by one (Williams et al. 1981) or two (Harville et al. 1985)

recessive loci. Recent genotyping technologies has given insight to specific regions

in the soybean genome associated with reniform nematode resistance. In 2007,

three QTL regions were identified on chromosome (Chrs.) 19, 18, and 11. The latter

two regions on Chrs. 11 and 18 were confirmed using restriction fragment length

polymorphism (RFLP) and single sequence repeat (SSR) markers in a recombinant

inbred line (RIL) population from a cross between reniform nematode susceptible

‘BSR101’ and resistant PI 437654 (Ha et al. 2007). Another study also identified two

regions in Chrs. 18 and 11 using both SSR and single nucleotide polymorphism

(SNP) markers in PI 567516C (Jiao et al. 2015). Three SSR markers on Chr. 18 and

one on Chr. 11 have also been linked to reniform resistance in a RIL population of

‘Flyer’ x ‘Hartwig’ (Lee et al. 2016). Klepadlo and colleagues (2020, unpublished

data) identified two QTL controlling reniform nematode resistance in PI 438489B

on Chrs. 11 and 18 using the Universal Soybean Linkage Panel (USLP 1.0) and next-

generation whole-genome re-sequencing (WGRS) technology. All four QTL

identification studies were phenotypically screened using a reniform nematode

4

culture derived from the state of Arkansas. Although different races or genotypes of

reniform nematode have not been characterized to date, studies have shown genetic

distinction between R. reniformis populations across the U. S. (Khanal et al. 2018). It

should not be assumed that resistant host genotypes will uniformly respond to

every population of reniform nematode. No study investigating genomics regions in

soybean associated with reniform nematode resistance have utilized a U.S. reniform

population outside of the state of Arkansas. Additionally, the soybean ‘Forrest’ has

historically been used as the resistance check in reniform nematode resistance

screenings, but no study has investigated the genetics in Forrest that harbor this

resistant trait.

Resistance to a nematode pathogen is measured by quantifying the

nematode’s reproduction on a host plant over an allotted time (Starr et al. 2002;

Trudgill 1991). This method indirectly measures the host plant’s ability to inhibit

the nematode from infecting or completing its life cycle. Nematologists have used

the term ‘host suitability’ to more accurately define the degree of resistance or

susceptibility (Sasser et al. 1984) The values of this measurement are usually given

as a reproduction factor or index (RI) and have been reported in several formats:

non-transformed or transformed by log10(x) or log10(x+1) (Ha et al. 2007; Klepadlo

et al. 2018; Robbins et al. 2017). Resistant or unsuitable hosts are determined by

comparing the RI of a test plant with the RI of a susceptible or resistant check or

against a standardized index with specific ranges for resistance and susceptibility

5

(Sasser et al. 1984). These methods may not provide an accurate depiction of the

inheritance of resistance genes in a host plant mapping population.

Both soybean cyst (Heterodera glycines Ichinohe) and reniform nematode

species create a similar feeding structure inside the host plant, indicating a

potentially similar genetic source of resistance (Rebois et al. 1968). Several studies

have linked the ‘Peking’-derived soybean cyst nematode resistance to reniform

nematode resistance in soybean cultivars (Klepadlo et al. 2018; Rebois et al. 1970;

Robbins and Rakes 1996). Peking-type resistance to soybean cyst nematode

corresponds to a combination of two genes: rhg1 on Chr. 18 and Rhg4 on Chr. 8. One

such cultivar, Forrest maturity group (MG) V, was released in the early 1970s as a

resistant cultivar to combat soybean cyst nematode (Hartwig and Epps, 1973),

carrying the Peking-derived rhg1 and Rhg4 resistance genes. Historically, Forrest

has been used as the reniform nematode resistant check in several studies. Both

Forrest and Williams 82, MG III have been utilized in several studies that provide

major contributions to Glycine max genomics research (Lightfoot 2008). There has

been extensive research identifying the genes associated with resistance to soybean

cyst nematode (Concibido et al. 2004; Cook et al. 2014; Yu and Diers 2017), but

there remains a lack of depth in genetic studies for reniform nematode resistance to

identify markers linked to resistance, genes responsible for resistance and a better

understanding of the genetics underlying the distinction between soybean cyst

resistance.

6

Marker-assisted selection is a useful tool for plant breeders, particularly for

traits that cost a lot of time and money to phenotype. Advancements in genetic

screening pipelines to characterize pathogen resistance has significantly reduced

costs and made genotype discovery and validation a more efficient means of

identifying phenotypes. Reduced representation sequencing techniques, such as

genotyping-by-sequencing (GBS), have allowed for high-resolution markers to be

identified without the cost of more extensive techniques, such as whole-genome

sequencing (Sonah et al. 2013). SNPs are most commonly used markers in marker-

assisted selection techniques due to their abundance in genomes and easy

evaluation in assays (Guo et al. 2018, Shi et al. 2015).

To associate SNP markers to reniform nematode resistance, a RIL developed

from a cross between soybean cultivars Forrest and Williams 82 was genotyped and

phenotyped for host suitability to a reniform nematode population collected from

South Carolina. Sequences were generated using genotyping-by-sequencing (GBS)

and a linkage map was constructed from SNP markers within the population. The

objective of this study was to identify SNP markers linked to host suitability to

reniform nematode as conferred by the soybean cultivar, Forrest.

MATERIALS AND METHODS

Reniform nematode resistance phenotyping of RIL population

7

A set of 250 F2:8 recombinant inbred lines (RIL) from Forrest x Williams 82

developed by the University of Missouri (Wu et al. 2011) was used in this study. For

phenotype screening and nematode quantification, the 250 RILs were divided into

15 rounds, each round consisting of 16 lines, performing three replicates of each

line (26 lines in the final round). For each RIL, six eight-ounce Styrofoam cups were

filled with 225 cm3 of sterilized soil (Wagram loamy sand texture, collected from the

Edisto REC soybean field, South Carolina) and one seed was planted in each cup

(Robbins et al. 2017). Six days after planting, three of the most uniform seedlings

were selected for screening and the other three were discarded. The population

parents, Williams 82 and Forrest, were included in each round as the susceptible

and resistant check, respectively. The plants were grown in a growth room with 12

hours of daylight, an average temperature of 30°C, and watered daily using an

automated irrigation system. The water amount was adjusted throughout the

experiment to account for growing needs. Pots were arranged in randomized

complete block design within the growth room. Six days after planting, each plant

was inoculated with 2000 R. reniformis vermiform nematodes suspended in one mL

of tap water. The inoculum was a reniform nematode population originally collected

from a cotton field in St. Matthew’s county, South Carolina. The population had been

maintained on susceptible soybean cultivar, ‘Braxton’, for over 15 generations.

Nematodes were collected from soybean roots and soil in the pot and used to

inoculate test plants within 5 hours of extraction. A 1000 μL clean pipette tip was

inserted at the base of each plant near the tap root at a depth of approximately 1

8

inch. The prepared inoculum was injected in each hole below the soil surface using a

micropipette. The plants were fertilized once with water-soluble 15-15-15 (N-P-K)

25 days after inoculation.

At 60 days after inoculation, the stems of each plant were cut above the soil

line and discarded. The soil and roots from the cups were emptied into a 1 L pitcher

and the roots were gently rinsed of soil, bagged and set aside. The soil remaining in

the pitcher was mixed with high pressured water and then poured over no. 80

(180μm) and no. 500 (20μm) stacked sieves. This step was repeated twice more.

The material collected on the no. 500 sieve was then processed using the sugar

centrifugation process (Jenkins 1964) to separate the nematodes from the soil. The

collected extraction was saved for counting. The roots from each pot were then

placed individually in a beaker with enough 0.5% NaOCl solution to cover the roots

and vigorously agitated for 3 minutes to dislodge egg masses from roots (Hussey

and Barker 1973). The solution was then rinse over no. 80 and no. 500 stacked

sieves and eggs from the bottom sieve were collected for counting. The total count

of reniform vermiform and eggs from extracted soil and roots from each three

replicate were totaled and an average of the three replicates were used to calculate

the reproduction index (RI = total egg and vermiform count / initial inoculation

count) for each of the 250 lines.

To combine data from all 250 RILs, the RI of each line was normalized to the

RI of the susceptible check, Williams 82, in the respective screening round. The

9

distribution of RI values was tested for normality using the Shapiro-Wilk goodness

of fit statistic in JMP® 14.1 (SAS Institute Inc, Cary, NC, 2019/R program). Broad-

sense heritability was calculated as described in Wu et al. (2009).

The normalized RI for each line was further transformed by log10(x) in

attempt to normalize. Transformed RI values were analyzed using an unsupervised,

optimal univariate cluster analysis provided in the R software package

Ckmeans.1d.dp (Wang and Song 2011). The optimal number of clusters, k, was

determined by calculating Bayesian information criterion and minimizing the

differences in k-means of each cluster. Graphics were produced using custom R

scripts (Klepadlo et al., 2020 under review).

DNA extraction

Soybean DNA was extracted from approximately 100mg of newly developing

leaf tissue collected from each RIL and the parents from the same plant used in the

phenotype screening. Tissue was placed in deep 96 well plates and lyophilized at

-40°C for 24 hours. The tissue in each well was finely ground by adding one metal

grinding ball (OPS Diagnostics, size 5/32”) to each well and placed on a 2010

Geno/Grinder® for at 1500 RPM for 45 seconds.

The DNA extraction protocol was modified from a protocol developed by

Washington State University (Edge-Garza et al. 2014) and is as follows: DNA

extraction buffer was made using 10mL 1M TRIS, 10 mL 0.5M EDTA, 20mL 5M NaCl,

10

10 mL 0.05% SDS, and 50 mL of DEPC water. For each 96 well tray, 60mL of the

DNA extraction buffer was combined with 0.6g 1% PVP4O, 0.078g 0.13% dieca,

0.06g 0.1% DTT, and 0.06g 0.1% ascorbic acid. The solution was kept in a 65°C

water bath. After removing the grinding ball, 500μL of the prepared extraction

buffer was added to each sample and gently inverted. The samples were incubated

at 65°C and gently agitated on a shaker for 30 minutes. The trays were then moved

to -20°C for 15 minutes. Afterwards, 250μL of 4°C 6M ammonium acetate was added

to each sample. The trays were then returned to -20°C for 15 additional minutes.

The samples were centrifuged at 4200 rpm for 30 minutes at 4°C. The supernatant

in each well was then transferred to a new receiver plate and filter 96-well plate

(PALL® filter #830) and centrifuged (3200 rpm) for 7 minutes at 4°C. The filter was

removed and all samples were checked for uniform volume. DNA was precipitated

by adding 1.5 μL of glycogen (10mg/mL) and 240 μL of isopropanol to each sample

and incubated for 30 minutes at -20°C. Following incubation, plates were

centrifuged at 4200 rpm and the isopropanol was decanted out. The DNA pellet was

washed twice, decanting after each wash, with 500 μL of 70% ethanol and then air-

dried for 15 minutes to remove residual ethanol. Samples were resuspended in 40

μL of ddH2O.

DNA quality and quantity were assessed on a Thermo Scientific (Wilmington,

DE) Nanodrop 8000 spectrophotometer and a Quibit®. DNA concentrations were

normalized to 10 ng/μL for use in Genotyping-by-Sequencing (GBS) library

preparation.

11

GBS library preparation

Reduced representation next-generation sequencing techniques were

employed to achieve high-density genetic screening through GBS. Five independent

samples were run for each parent line and one sample for each RIL. The GBS library

preparation protocol was performed using a modified protocol (Elshire et al. 2011).

Restriction enzymes PstI and MseI were chosen to use in this experiment based on a

trial digestion with sample DNA resulting in fragments ranging 200-1000 bp

(Appendix 1.1).

In short, a digestion mixture was made (2.0 μL NEB CutSmart buffer 10X,

1.0μL PstI, 0.5 μL MseI, 0.2μL RNase, 16.3μL H2O) and 20 μL was added to each

sample. The plates were placed on a shaker for 30 minutes, briefly spun down in

centrifuge, and placed in the thermocycler for digestion (37°C for 3 hours, 80°C for

20 minutes, 4°C for storing). Unique adaptors and barcodes designed for Illumina

sequencing were added to the fragments along with 30 μL of ligation solution (5.0

μL Promega T4 ligase buffer, 0.8 μL T4 Ligase, and 24.2 μL of ddH2O per sample)

and agitated for 20 minutes. Samples were then briefly spun down and placed in the

thermocycler for 16 hours at 16°C, followed by 20 minutes at 65°C to deactivate

ligase. Plates were put on a shaker for 12 minutes and then spun down in a

centrifuge briefly. Samples were pooled by taking 10 μL of each sample from one

plate and combining it in a 15 mL tube with 5.0 mL of PB buffer (Qiagen QIAquick

PCR purification kit Cat No./ID: 28106). The sample solution was passed through

12

the Qiagen filter column and DNA was eluted in 50 μL EB buffer. Pooled samples

were optimally amplified for 18 cycles for generation of desired fragment size (200-

700 bp) using primers complement to adaptor sequence. Products were cleaned

using Mag-bind PCR clean-up 96 kit (OMEGA bio-tek #M1382). Quality and quantity

of the DNA samples were confirmed using a Qubit® and Aligent 2100

BioanalyzerTM. Libraries were paired-end sequenced using an Illumina HiSeq2500.

SNP calling and linkage map construction

Raw sequence files were demultiplex using scripts as described in Catchen et

al. (2013). Sequences were aligned to the reference genome of Williams 82,

Wm82.a2.v1 (Schmutz et al. 2010) using GSNAP pipeline (Wu et al. 2016). Binary

Alignment Map (BAM) files were sorted, ordered, and organized by Chr. as indicated

by the reference genome alignment. Variants were called using GATK 3.8 and

combined into master VCF file (Auwera et al. 2013). Variant datum was filtered to

remove indel markers, multiallelic sites, sites with >80% missing, and sites with a

depth less the 6 and mapping quality of 30. Further filtering was performed using

TASSEL 5.0 to adjust the minimum allele frequency (MAF) > 0.05, remove markers

with >65% missing data and removal of individuals with 10% or greater sites

missing (Bradbury et al. 2007). Marker datum was imputed using FSFHap

Imputation in TASSEL using default settings. A final marker dataset was imported

into JoinMap 4.0 to generate linkage maps (Van Ooijen, 2006). Non-polymorphic

13

markers were removed and linkage was defined using Kosambi’s mapping function

and independence logarithm of odds (LOD) scores of to 2.0 and greater.

Comparison of linkage map with the soybean reference genome

The SNP marker genetic position (cM) in each linkage group was aligned to

the physical positions of the reference genome, Wm82.a2.v1, (Schmutz et al. 2010)

using MapChart 2.3 (Voorips 2002) as described by de la Silva (2018).

Identification of associated QTLs

QTL analysis was performed using MapQTL 6.0 with both normalized and

log10(x) transformed phenotype data (Van Ooigen 2009). Because neither format

was normally distributed, both data sets were used in the analysis. Initial analysis

was performed using the nonparametric Kruskal-Wallis (KW) rank sum test to

identify genetic regions associated with the quantitative trait. The significance

threshold for the KW test was set to P = 0.005 for QTL detection. Significantly

associated QTL regions were verified using Interval Mapping (IM) and Multiple QTL

Mapping (MQM) analyses which also estimates percent phenotypic variation (Van

Ooigen 2009). Genome-wide LOD thresholds were determined using permutation

tests at 10,000 iterations at a P-value of <0.05. Linkage maps along with

corresponding LOD-score graphs were generated using MapChart 2.3 (Voorips

2002).

14

All SNP markers were run in a student’s t-test for further verification of QTL

significance. For each SNP site, the RI and genotype (A/B; Williams 82/Forrest) for

each individual was extracted and analyzed with a student’s t-test to determine if

the mean phenotype for the two genotypes were statistically different (P<0.001),

assuming unequal variances.

Candidate genes within QTL intervals

A list of candidate genes within the three detected QTL confidence intervals

was generated based on gene annotations of the reference genome, Williams 82,

Wm82.a2.v1 (Schmutz et al. 2010). The list was cross-validated by submitting and

aligning the protein sequences to known sequencing in databases; KOALA, NCBI-CD,

pFAM, and BLASTp (Supplemental Figure 2). The overall effect of the SNP markers

was determined using SnpEff, ver. 4.3 with the Glycine max reference genome

available in the database (Cingolani et al. 2012).

RESULTS

Phenotype distribution, transformation, and clustering

The two parents of the population, which also represent the susceptible and

resistant checks (Williams 82 and Forrest, respectively) in the phenotype screening

had an average RI of 53.9 and 8.4, respectively. After normalization the RI to the

susceptible check and combining the data for all 250 RILs, phenotype scores ranged

from 0.0335 to 7.41 with a median value of 1.64, (Table 1.1). The distribution of the

15

RI data was not normally distributed as indicated by the Shapiro-Wilk (w) statistic

normality test (w = 0.930058, P<0.001, JMP Software) (Figure 1.1). The phenotype

data was transformed by log10(x) and both transformed and non-transformed

datum formats were analyzed with an optimal univariate cluster analysis to identify

a data-driven, distinct group of resistant RILs in the population (Klepadlo et al. 2020

unpublished data). The best fit k-means value for the non-transformed phenotype

was 4, identifying the lowest RI cluster with 36 RILs (Figure 1.2). In the analysis

using log10(x) transformation of the phenotype, the best fit k-means value was 2,

which divides the data into two distinct groups. The lower cluster consists of 30

lines, characterized as resistant, and the second cluster of 220 lines with higher RIs

are deemed susceptible (Figure 1.2). Broad-sense heritability of the RI phenotype

was H2 = 0.81 (Wu et al. 2009), suggesting the trait is a suitable candidate to identify

genotypes associated with the phenotype.

Linkage map construction

Sequence reads totaled to 676,924,743. After demultiplexing and filtering, an

average of 4.6 million aligned reads were retained per sample with an average

coverage of 0.59% of the total genome size.

SNP calling using GATK identified an initial 75,788 SNP markers in the 250

RILs, including 5 copies of each parent line. After filtering for quality, there were a

total of 6253 polymorphic markers and 155 individuals used in linkage map

construction. Twenty-three linkage groups were constructed from 1672 unique

markers with an average of 75 markers per linkage group (Figure 1.3). The total

16

genetic distance of the linkage maps spanned 2857.46 cM with an average distance

of 2.19 cM between adjacent markers. The physical distance covered by the linkage

map estimated to 746 Mb with an average genetic distance ratio of 261 Kb/cM.

Alignment of linkage map to reference genome

Comparison of the genetic positions of SNP markers within the linkage

groups to the physical positions on the reference genome estimated an overall

alignment in 80% agreement (Appendix 1.3). The Chr. with the lowest alignment

score (50%) was Chr. 13, which also had the most number of markers within a

linkage group. Additionally, linkage groups corresponding to Chrs. 3, 4, 6, 8, and 9

contained at least one and as many as six markers physically mapped to a different

Chr. based on the reference genome. An important note is that Chrs. 12, 14, and 15

are each represented by two linkage groups and all markers from Chr. 19 were

removed during quality control.

QTL mapping

The LOD significance threshold for QTL detection was established at 3.4

based on permutation analyses using both phenotype data formats. Consensus of

the KW, IM, and MQM analyses identified three QTL regions associated with host

suitability to reniform nematode in the RIL population (Figure 1.4). A 95%

confidence interval was determined by calculating the two-LOD support interval to

determine the size of each QTL region (Van Ooigen 2009). A QTL region on Chr. 18,

here referred to as rrn-1, was significant in analyses using both normal and log10(x)

transformed phenotype with the highest LOD score of 3.47 and 8.28, respectively.

17

Using non-transformed phenotype, the QTL region measured 17.677 cM in length,

covering a physical distance of 2,815,897 base pairs (bp) (2,815 Kbp). This same

region from the analysis using log10(x) transformed phenotype was much smaller

with a genetic length of 19.02 cM, spanning a physical distance of 3,337,828 bp

(3,337 Kbp). The SNP, Chr18_46 (physical position of Glyma.18g1684449), had the

highest significant LOD value and a K-value of 17.513 (P =0.0001) and was

consistent in both analyses within this QTL region. The SNP marker accounted for

an estimate phenotypic variance of 15.7% and additive effect of -0.383 in the non-

transformed phenotype data analysis compared to a phenotypic variance of 21.9%

and additive effect of -0.235 from the analysis using log10(x) transformed data

(Table 1.2).

A second QTL, here labeled rrn-2, was identified using KW and non-

transformed phenotype in IM and MQM analysis. The QTL region was 12.098 cM,

equal to 1,336,280 bp (1,335 Kbp) in length. The highest LOD score of 5.69 was at

SNP marker Chr18_553 (physical position of Glyma.18g54068524) with a K-value of

30.618 (P = 0.0001). The most significant SNP in rrn-2 was associated with 9.9% of

the phenotypic variance with an additive effect estimated to be 0.475.

The third QTL region was identified with KW and log10(x) transformed

phenotype in IM and MQM analyses. The QTL, rrn-3, was identified on Chr. 11,

covering 29.5 cM and 593,369 bps. The SNP marker with the highest LOD value

within this region was Chr11_190 (physical position of Glyma.11g32986440) with a

K-score of 14.118, LOD score of 8.35, and attributed to 22.1% of the phenotypic

18

variance (Table 1.2). The additive effect was estimated to be -0.235 of the

normalized RI value.

Genotype association with phenotype

Of the 250 RILs, 70 carried the homozygous resistance allele for the major

SNP marker in the rrn-1 locus and 95 individuals had the resistance allele for the

major SNP marker in rrn-3, with 25 RILs with both resistant alleles. The 70 RILs

with Forrest allele at the rrn-1 had an average RI of 1.29 (vs 2.05) and those with

Forrest allele at rrn-3 had an average RI of 1.4 (vs 2.2). The average RI for the 25

individuals with homozygous resistant alleles at both loci was 0.33, in contrast to an

average of 2.23 for those individuals homozygous for the Williams 82 alleles at both

loci. Of the 30 RILs characterized as “resistant” based on the univariate cluster

analysis performed with log10(x) transformed phenotype, 23 carried both resistance

alleles at the two loci, 3 individuals had only one of the two resistance alleles, and 4

were not genotyped. In contrast, for rrn-2, the average RI values of the 71

individuals with the Forrest allele had an average RI of 2.29, as compared to the

reference allele average phenotype of 1.3.

The student’s t-test showed significant differences (P <0.001) in the mean

phenotype for different parental alleles at each marker within the three QTLs. This

data also illustrates the alleles contributed from Forrest in rrn-1 and rrn-3 result in a

statistically significant reduction in reniform nematode reproduction (RI).

Individuals with both resistant alleles at rrn-1 and rrn-3 had a lower average RI than

individuals with only the allele at rrn-1 or rrn-3 (Figure 1.5). However, the Forrest

19

genotype at rrn-2 resulted in an increase in RI values. Only one RIL carried the

alternative (Forrest) alleles at all three QTLs, therefore the additive effect of the

three resistant genotypes could not be illustrated (Figure 1.5).

Candidate gene analysis

A total of 65 candidate genes were identified within the three confidence

intervals. A full list of predicted gene annotations was provided in the supplemental

figures (Appendix 1.2). Most of the SNP markers (37 out of the 46) within the three

identified QTL regions were mapped within a predicted functional gene based on

the their physical position within the reference genome annotation, Wm82.v1.a2.

SNP markers were mapped to twenty-three genes in rrn-1, eight genes in rrn-2, and

four genes in rrn-3.

It is likely that one or more of the listed annotated genes within each of the

three QTL regions play a role in pathogen response or host defense. Using the SNP

effect predicting algorithm, 4 of the total 36 markers within rrn-1 were predicted to

cause a moderate impact on the gene variant. Moderate impact variants are

potential changes in protein effectiveness but are still not considered highly

disruptive. The majority (57%) of the gene variants in the three QTL regions were

classified as modifier, indicating gene variations in non-coding genes with an

unknown level of impact (Cingolani et al. 2012). A few of the well-supported genes

within rrn-1 with identified SNPs include rubisco activase, nuclear pore complex

protein Nup214, and a leucine-rich repeat protein domain (LRR) (Appendix 1.2).

20

Additionally, the known soybean cyst nematode resistance gene, rhg-1, was located

27 Kbp from the SNP marker with the highest LOD value within rrn-1.

In rrn-2, the SNP with the highest LOD score was within the soybean gene,

Glyma.18G254300, a predicted leucine-rich repeat region. A second gene within this

region with a detected SNP was also a predicted LRR region (Glyma.18G254600),

along with a phosphopantetheine attachment site (Glyma.18g245900) and a

Histidine Phosphatase superfamily (Glyma.18G255000). Of the 13 SNPs in rrn-2, 6

were classified as a modifier variant, creating upstream and downstream gene

variants and one marker caused a synonymous variant (Table 1.3).

In rrn-3, the SNP with the highest LOD score was within a predicted ARM

repeat superfamily protein. Two other genes were predicted in this region, one a

Phosphoinositide-specific phospholipase C family protein (Glyma.11G230000), and

the other a P-loop containing nucleoside triphosphate hydrolases superfamily

protein (Glyma.11g232900), both confirmed in Arabidopsis orthologs (Table 1.3;

Appendix 1.2).

DISCUSSION

This is the first study to utilize a reniform nematode population collected

from outside the state of Arkansas. Recent studies have shown different virulence in

geographic population isolates of R. reniformis in the United States (Khanal et al.

2018; McGawley et al. 2011), indicating a need to test multiple population sources

to authenticate genetic regions associated with a resistance trait for a more

21

universal utility. Additionally, this study is the first to investigate genetic markers in

the soybean cultivar Forrest that relates to reniform nematode reproduction.

Resistance and susceptibility are relative, inverse terms that are on a

continuum. Performing an unsupervised univariate cluster analysis on a

quantitative trait in a population of genetically related hosts captures a

representative and unbiased division within the distribution. In a biparental

population, this analysis allows the distribution of the data to determine the

breaking point between resistance and susceptibility, which should provide better

insight on which progeny carry the resistant gene or genes. Based on our study, a

cluster analysis using log10(x) transformed RI provided a clearly defined separation

between low and high nematode reproduction on host roots and was more

conservative, identifying 30 [log10(x)] versus 36 resistant RILs using non-

transformed data. The 30 resistant RILs were consistent with the genotype data

seen in the three detected QTL regions

The soybean genome is a paleopolypoid, having homologous regions across

the genome (Schlueter et al. 2007) which can complicate alignment of reads and

map construction. This was evident during assembly of the linkage map when

markers did not divide into the 20 expected linkage groups corresponding to the 20

physical Chrs.. Furthermore, this might have also contributed to the several markers

that mapped physically to different Chrs. than their neighboring markers in the

linkage map (Appendix 1.3). It is possible that some of these markers were not

22

accurately aligned to the reference due to the vast gene duplication across the

genome. Two mapped regions, rrn-1 and rrn-3, belong to a large inverted

supplicated segments containing 23 conserved duplicated genes or anchors

(Lakhssassi et al. 2017).

In one of the first studies to identify QTL regions related to reniform

nematode in soybean, Ha (2007) identified regions on Chrs. 11, 18, and 19 with the

largest contributing region from Chr. 19. Raw sequence data from this study

contained SNPs mapped to soybean Chr. 19 but filtration of low-quality markers and

individuals removed all Chr. 19 markers from the final map used in QTL analyses.

Therefore, this study does not provide enough evidence to disprove nor confirm the

region on Chr.19 that was identified by Ha et al. (2007). However, exclusion of

markers from Chr. 19 in the analysis may provide higher resolution of other

genomic regions related to the phenotype that could have been masked otherwise.

Heritability score of 0.81 indicates the quantitative trait is highly heritable

with strong genetic basis. Based on the distribution of the phenotype data, there is

evidence of transgressive segregation of reniform nematode resistance trait in

soybean. The transgressive index was 8.7, indicating the RIL population phenotype

range exceeded that of the parental phenotype variation (Koide et al. 2019). In this

case, transgressive segregation could be caused by complementary gene action

(Rieseberg et al. 1999), which can be explained by epistatic interactions of different

alleles at the three identified QTL regions rrn-1, rrn-2, and rrn-3.

23

Neither format of the phenotype data, normalized RIs and log10(x)

transformed, were normally distributed. Therefore, QTL regions were initially

identified using the non-parametric KW analysis and the results were verified using

IM, MQM analysis, and a t-test. All four analyses supported the three QTL regions

identified to be associated with reniform nematode host suitability. Two regions,

rrn-1 and rrn-3, were associated with reduced reniform nematode reproduction and

one, rrn-2, was associated with increased reproduction on the host. An important

note is that although Forrest is considered resistant to reniform nematode, it is only

one source of resistance with at least 10 other lines reported statistically higher

level of resistance than Forrest (Robbins and Rakes 1996). Based on this

information, it is possible to suspect that genetic regions within Forrest might

contribute some level of susceptibility. The use of this cultivar in a linkage analysis

may have allowed for the identification of a QTL associated with reniform nematode

susceptibility.

There have been previous reports of QTL regions associated with reniform

nematode resistance in soybean. Four different studies which used different

soybean genotypes and a reniform nematode population collected from Arkansas

previously reported QTL regions that overlap rrn-1 on Chr. 18 and rrn-3 on Chr. 11

(Ha et al. 2007; Jiao et al. 2015; Lee et al. 2016; Klepadlo unpublished data). Both

these regions were identified using the log10(x) transformed phenotype data and

rrn-1 was also confirmed using normal phenotype data. This study is the first to

report a region, rrn-2 on the opposite arm of Chr. 18 in association with increased

24

susceptibility to reniform nematode. This region was identified using the

normalized phenotype data which offers a different method to analyze data to

identify associated genetic regions.

Over 76% of the RILs with the two Forrest genotypes at rrn-1 and rrn-3 were

classified to be resistant as indicated by the cluster analysis. This number may be as

high as 90%, since 4 individuals were missing genotype information. The high

correlation justifies the phenotype classification methodology while confirming

quality markers. The combination of both resistant genotypes at rrn-1 and rrn-3

account for a maximum of 44% of the phenotypic variance. Data indicates a greater

level of resistance when individuals have resistance genotypes at both rrn-1 and

rrn-3 (Figure 1.5). Even after adding the nearly 10% the variance explained by rrn-2,

there remains a significant amount of phenotypic variance that was not genetically

mapped. The small percentage of full genome sequence coverage that is common of

GBS techniques may contribute to the incomplete account for phenotype variation.

SNP markers pinpoint genomic neighborhoods in which certain genes might

play a role on the investigated phenotype. The list of candidate genes within the

mapped regions are initial steps to identify specific genes and their impact on

soybean host suitability to reniform nematode development and reproduction. It is

important to mention that the soybean cyst nematode resistance gene, rhg1, was

located within the mapped rrn-1 interval and Rhg4, a paralogous gene of rhg1, was

located within mapped rrn-3 interval (Patil et al. 2019). Leucine-rich repeat regions

25

were located within both rrn-1 and rrn-2 and have been reported to be linked to

plant development and in some cases, plant stress tolerance (Yang et al. 2014; Zhou

et al. 2016) A recent study of Arabidopsis identified a highly conserved gene related

to a leucine-rich repeat receptor-like kinase (LLR-RLK) upregulated upon detection

of parasitic nematodes (Mendy et al. 2017). It is highly possible that this gene within

rrn-2 has some function in plant defense to reniform nematode.

In rrn-3, the most significant SNP was found within an ARM repeat

superfamily protein, with a predicted modifier variant from the alternative allele.

This protein family is known to be involved in binding ubiquitin ligase activity.

Other genes of interest within the regions include the cytochrome p450 superfamily

protein which have many different functions, some site-specifically expressed

during stress response and nodulation formation (Guttikonda et al. 2010). Also

within rrn-1 and associated with nodulation formation was a myb-like DNA-binding

domain (Du et al. 2012). A phosphoinositide-specific phospholipase C family protein

found within rrn-3 has also been associated with increased expression as a response

to abiotic stress (Wang et al. 2015). More investigation is required to characterize

the SNP markers and candidate genes identified within these QTLs and understand

their role with host plant response to reniform nematode.

CONCLUSION

Utilization of marker-assisted selection tools are of great benefit to breeders,

particularly when the markers can be easily tested and are proven to highly

26

correlate with the phenotype of interest. This study highlights the significance of

three markers from three different genomic regions associated with host suitability

to reniform nematode as conveyed by the soybean cultivar, Forrest. Several gene

candidates within QTL boundaries were characterized for their potential role in

plant host defense. However, more research is needed to narrow the region and

confirm the role of specific genes in soybean response to reniform nematode

infection.

REFERENCES

Allen, T.W., Bissonnette, K., Bradley, C.A., Damicone, J.P., Dufault, N.S., Faske, T.R., Isakeit, T., Kemerait, R.C., Koehler, A., Mehl, H.L., et al. 2018. Southern United States soybean disease loss esimates for 2018. Proc. 46th Annu. Meet. South. Soybean Dis. Work. Pensacola FL.

Auwera, G.A.V. der, Carneiro, M.O., Hartl, C., Poplin, R., Angel, G. del, Levy‐Moonshine, A., Jordan, T., Shakir, K., Roazen, D., Thibault, J., et al. 2013. From fastQ data to high-confidence variant calls: The genome analysis toolkit best practices pipeline. Curr. Protoc. Bioinforma. 11(1110):11.10.1-11.10.33.

Bradbury, P.J., Zhang, Z., Kroon, D.E., Casstevens, T.M., Ramdoss, Y., and Buckler, E.S. 2007. TASSEL 5.0: Software for association mapping of complex traits in diverse samples. Bioinformatics 23:2633–2635.

Catchen, J.M., Hohenlohe, P.A., Bassham, S., Amores, A., and Cresko, W.A. 2013. Stacks: an analysis tool set for population genomics. Mol. Ecol. 22:3124–3140.

Cingolani, P., Platts, A., Wang, L.L., Coon, M., Nguyen, T., Wang, L., Land, S.J., Lu, X., and Ruden, D.M. 2012. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w 1118 ; iso-2; iso-3. Fly (Austin) 6:80–92.

Concibido, V.C., Diers, B.W., and Arelli, P.R. 2004. A decade of QTL mapping for cyst nematode resistance in soybean. Crop Sci. 44:1121.

Cook, D.E., Bayless, A.M., Wang, K., Guo, X., Song, Q., Jiang, J., and Bent, A.F. 2014. Distinct copy number, coding sequence, and locus methylation patterns underlie

27

rhg1-mediated soybean resistance to soybean cyst nematode. Plant Physiol. 165:630–647.

Du, H., Yang, S.-S., Liang, Z., Feng, B.-R., Liu, L., Huang, Y.-B., and Tang, Y.-X. 2012. Genome-wide analysis of the MYB transcription factor superfamily in soybean. BMC Plant Biol. 12:106.

Edge-Garza, D.A., Rowland Jr, T.J., Haendiges, S., and Peace, C. 2014. A high-throughput and cost-effective DNA extraction protocol for the tree fruit crops of apple, sweet cherry, and peach relying on silica beads during tissue sampling. Mol. Breed. 34:2225–2228.

Elshire, R.J., Glaubitz, J.C., Sun, Q., Poland, J.A., Kawamoto, K., Buckler, E.S., and Mitchell, S.E. 2011. A robust, simple Genotyping-by-Sequencing (GBS) approach for high diversity species. PLOS ONE 6:e19379.

Guo, Y., Su, B., Tang, J., Zhou, F., and Qiu, L.J. 2018. Gene-based SNP identification and validation in soybean using next-generation transcriptome sequencing. Mol. Gene. Genom. 293(3): 623-633.

Guttikonda, S.K., Trupti, J., Bisht, N.C., Chen, H., An, Y.-Q.C., Pandey, S., Xu, D., and Yu, O. (2010). Whole genome co-expression analysis of soybean cytochrome P450 genes identifies nodulation-specific P450 monooxygenases. BMC Plant Biol. 10, 243.

Ha, B.-K., Robbins, R.T., Han, F., Hussey, R.S., Soper, J.F., and Boerma, H.R. 2007. SSR mapping and confirmation of soybean QTL from PI 437654 conditioning resistance to reniform nematode. Crop Sci. 4:1336–1343.

Hartwig, E.E. and Epps, J.M. Registration of 'Forrest' soybeans (Reg. No. 96). Crop Sci. 13(2): 287.

Harville, B.G., Green, A., and Birchfield, W. 1985. Genetic resistance to reniform nematodes in soybeans. Plant Dis. 69:587–589.

Hussey, R.S., and Barker, K.R. 1973. Comparison of methods of collecting inocula for Meloidogyne spp., including a new technique. Plant Dis. Report. 57:1025–1028.

Jenkins, W.R. 1964. A rapid centrifugal-flotation technique for separating nematodes from soil. Plant Dis. Report. 48:692.

Jiao, Y., Vuong, T.D., Liu, Y., Li, Z., Noe, J., Robbins, R.T., Joshi, T., Xu, D., Shannon, J.G., and Nguyen, H.T. 2015. Identification of quantitative trait loci underlying resistance to southern root-knot and reniform nematodes in soybean accession PI 567516C. Mol. Breed. 35:131.

28

Khanal, C., McGawley, E.C., Overstreet, C., Stetina, S.R., Myers, G.O., Kularathna, M.T., McInnes, B., and Godoy, F.M.C. 2018. Reproduction and pathogenicity of endemic populations of Rotylenchulus reniformis on cotton. Nematropica 48:68–81.

Klepadlo, M., Meinhardt, C.G., Vuong, T.D., Patil, G., Bachleda, N., Ye, H., Robbins, R.T., Li, Z., Shannon, J.G., Chen, P., et al. 2018. Evaluation of soybean germplasm for resistance to multiple nematode species: Heterodera glycines, Meloidogyne incognita, and Rotylenchulus reniformis. Crop Sci. 58:2511–2522.

Koide, Y., Sakaguchi, S., Uchiyama, T., Ota, Y., Tezuka, A., Nagano, A.J., Ishiguro, S., Takamure, I., and Kishima, Y. 2019. Genetic properties responsible for the transgressive segregation of days to heading in rice. G3 Genes Genomes Genet. 9:1655–1662.

Lakhssassi, N., Liu, S., Bekal, S., Zhou, Z., Colantonio, V., Lambert, K., Barakat, A., and Meksem, K. 2017. Characterization of the soluble NSF attachment protein gene family identifies two members involved in additive resistance to a plant pathogen. Sci. Rep. 7:1–11.

Lee, Y.-C., Lightfoot, D.A., Anderson, J., Robbins, R.T., and Kantartzi, S.K. 2016. QTL underlying reniform nematode resistance in soybean cultiar Hartwig. Atlas J. Biol. 308–312.

Lightfoot, D.A. 2008. Soybean genomics: Developments through the use of cultivar “Forrest.” Int. J. Plant Genomics. e793158.

McGawley, E.C., Pontif, M.J., and Overstreet, C. 2011. Variation in reproduction and pathogenicity of geographic isolates of Rotylenchulus reniformis on soybean. Nematropica 41.

Mendy, B., Wang’ombe, M.W., Radakovic, Z.S., Holbein, J., Ilyas, M., Chopra, D., Holton, N., Zipfel, C., Grundler, F.M.W., and Siddique, S. 2017. Arabidopsis leucine-rich repeat receptor–like kinase NILR1 is required for induction of innate immunity to parasitic nematodes. PLOS Pathog. 13:e1006284.

Patil, G.B., Lakhssassi, N., Wan, J., Song, L., Zhou, Z., Klepadlo, M., Vuong, T.D., Stec, A.O., Kahil, S.S., Colantonio, V., et al. 2019. Whole‐genome re‐sequencing reveals the impact of the interaction of copy number variants of the rhg1 and Rhg4 genes on broad‐based resistance to soybean cyst nematode. Plant Biotechnol. J. 17:1595–1611.

Rebois, R.V. 1973. Effect of soil temperature on infectivity and development of Rotylenchulus reniformis on resistant and susceptible soybeans, Glycine max. J. Nematol. 5:10–13.

29

Rebois, R.V., Epps, J.M., and Hartwig, E.E. 1970. Correlation of resistance in soybeans to Heterodera glycines and Rotylenchulus reniformis. Phytopathology 60:695–700.

Rebois, R.V., Johnson W.C., and Cairns, E. J. 1968. Resistance in soybeans, Glycine Max L. Merr., to the reniform nematode. Crop Sci. 8(3): 394-396.

Rieseberg, L.H., Archer, M.A., and Wayne, R.K. 1999. Transgressive segregation, adaptation and speciation. Heredity 83:363.

Robbins, R.T., and Rakes, L. 1996. Resistance to the reniform nematode in selected soybean cultivars and germplasm lines. J. Nematol. 28:612–615.

Robbins, R.T., Rakes, L., Jackson, L.E., and Dombek, D.G. 1999. Reniform Nematode resistance in selected soybean cultivars. J. Nematol. 31:667–677.

Robbins, R.T., Shipe, E.R., Rakes, L., JACKSON, L.E., Gbur, E.E., and Dombek, D.G. 2002. Host suitability of soybean cultivars and breeding lines to reniform nematode in tests conducted in 2001. J. Nematol. 34:378–383.

Robbins, R.T., Arelli, P., Chen, P., Shannon, G., Kantartzi, S., Fallen, B., Li, Z., Faske, T., Velie, J., Gbur, E., et al. 2017. Reniform nematode reproduction on soybean cultivars and breeding lines in 2016. Proc 2016 Beltwide Cotton Conf. January 4-6 2017 Dallas TX USA 184–214.

Robinson, A.F., Inserra, R.N., Caswell-Chen, E.P., Vovlas, N., and Troccoli, A. 1997. Review: Rotylenchulus species: Identification, distribution, host ranges, and crop plant resistance. Nematropica 27:127–180.

Sasser, J.N., Carter, C.C., and Hartman, K.M. Standardization of host suitability studies and reporting resistance to root-knot nematodes. Department of Plant Pathology, North Carolina State University and United States Agency for International Development, Raleigh, NC.

Schlueter, J.A., Lin, J.-Y., Schlueter, S.D., Vasylenko-Sanders, I.F., Deshpande, S., Yi, J., O’Bleness, M., Roe, B.A., Nelson, R.T., Scheffler, B.E., Jackson, S.A., and Shoemaker, R.C. 2007. Gene duplication and paleopolyploidy in soybean and the implications for whole genome sequencing. BMC Genomics 8:330.

Schmutz, J., Cannon, S.B., Schlueter, J., Ma, J., Mitros, T., Nelson, W., Hyten, D.L., Song, Q., Thelen, J.J., Cheng, J., 2010. Genome sequence of the palaeopolyploid soybean. Nature 463:178–183.

Shi, Z., Liu, S., Noe, J., Arelli, P., Meksem, K., and Li, Z. 2015. SNP identification and marker assay development for high-throughput selection of soybean cyst nematode resistance. BMC Genomics. 16:314.

30

da Silva Linge, C., Antanaviciute, L., Abdelghafar, A., Arús, P., Bassi, D., Rossini, L., Ficklin, S., and Gasic, K. 2018. High-density multi-population consensus genetic linkage map for peach. PLOS ONE 13:e0207724.

Sonah, H., Bastien, M., Iquira, E., Tardivel, A., Legare, G., Boyle, B., Normandeau, E., Laroche, J., Larose, S., Jean, M., and Belzile, F. 2013. An improved Genotyping by Sequencing (GBS) approach offering increased versatility and efficiency of SNP discovery and genotyping. PLOS ONE 8(1): e54603.

Starr, J.L., Cook, R., and Bridge, J. 2002. Plant Resistance to parasitic nematodes (CABI Publishing).

Trudgill, D.L. 1991. Resistance to and tolerance of plant parasitic nematodes in plants. Annu. Rev. Phytopathol. 29:167–192.

Van Ooigen 2009. MapQTL 5, Software for the mapping of quantitative trait loci in experimental populations (Wageningen, Netherlands: Kyazma B. V.).

Van Ooijen 2006. JoinMap 4, Software for the calculation of genetic linkage maps in experimental populations (Wageningen, Netherlands: Kyazma B. V.).

Voorips, R.E. 2002. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 93:77–78.

Wang, H., and Song, M. 2011. Ckmeans.1d.dp: Optimal k-means clustering in one dimension by dynamic programming. R J. 3:29–33.

Wang, F., Deng, Y., Zhou, Y., Dong, J., Chen, H., Dong, Y., Wang, N., Li, X., and Li, H. 2015. Genome-wide analysis and expression profiling of the Phospholipase C gene family in soybean (Glycine max). PLOS ONE 10:e0138467.

Williams, C., Gilman, D.F., Fontenot, D.S., and Birchfield, W. 1981. Inheritance of reaction to the reniform nematode in soybean. Crop Sci. 21:93–94.

Wu, T.D., Reeder, J., Lawrence, M., Becker, G., and Brauer, M.J. 2016. GMAP and GSNAP for genomic sequence alignment: enhancements to speed, accuracy, and functionality. Methods Mol. Biol. Clifton NJ 1418:283–334.

Wu, X., Blake, S., Sleper, D.A., Shannon, J.G., Cregan, P., and Nguyen, H.T. 2009. QTL, additive and epistatic effects for SCN resistance in PI 437654. Theor. Appl. Genet. 118:1093–1105.

Wu, X., Vuong, T.D., Leroy, J.A., Shannon, J.G., Sleper, D.A., and Nguyen, H.T. 2011. Selection of a core set of RILs from Forrest x Williams 82 to develop a framework map in soybean. Theor. Appl. Genet. 112(6):1179-1187.

31

Yang, L., Wu, K., Gao, P., Liu, X., Li, G., and Wu, Z. 2014. GsLRPK, a novel cold-activated leucine-rich repeat receptor-like protein kinase from Glycine soja, is a positive regulator to cold stress tolerance. Plant Sci. 215-216:19–28.

Yu, N., and Diers, B.W. 2017. Fine mapping of the SCN resistance QTL cqSCN-006 and cqSCN-007 from Glycine soja PI 468916. Euphytica 213:54.

Zhou, F., Guo, Y., and Qiu, L.J. 2016. Genome-wide identification and evolutionary analysis of leucine-rich repeat receptor-like protein kinase genes in soybean. BMC Plant Biol. 16:58.

32

Figure 1.1. Distribution of reniform nematode reproduction indices (RIs) in recombinant inbred line (RIL) population of ‘Forrest’ x ‘Williams 82’

33

Table 1.1. Summary of normalized Reproductive Index (RI) distribution of 250 recombinant inbred lines (‘Forrest’ x ‘Williams 82’)

Mean Median Min Max StDv Variance Skewness Kurtosis Heritability

1.76 1.64 0.0335 7.41 1.07 1.14 0.687 0.953 0.81

34

Figure 1.2. An unsupervised optimal univariate cluster analysis on (a) normalized reproduction indices (RIs) and (b) log10(x) transformed normalized RIs from 250 recombinant inbred lines screened with reniform nematode

35

Figure 1.3. Linkage map constructed with SNP markers associated with reniform nematode host suitability

36

Figure 1.4. Quantitative trait loci (QTL) for reniform nematode resistance mapped

to Chromosomes 11 and 18 using normalized reproduction indices (nRI, in blue)

and transformed reproduction indices [log10(nRI), in red]

37

Table 1.2. Summary of quantitative trait loci (QTL) associated with soybean host suitability to reniform nematode using two formats of quantitative trait data

Phenotyping Methoda

QTL Chr. Confidence Interval Physical Positionb LOD R2

[%]

nRI rrn-1 18 Chr18_1 – Chr18_68 42,464 – 2,858,361 3.47 15.7

rrn-2 18 Chr18_492 – Chr18_557 52,813,203 – 54,091,721 5.69 9.9

log10(nRI) rrn-1 18 Chr18_29 - Chr18_68 1,176,342 – 2,858,361 8.28 21.9

rrn-3 11 Chr11_181 - Chr11_195 32,531,257 – 34,034,293 8.35 22.1 a Phenotype data format in normalized reproduction indices (nRI) or log10 transformed [log10(nRI)] b Physical position in base pairs based on Williams 82 reference genome (Wm82.a2.v1)

38

Figure 1.5. Phenotypic effects of alleles in all recombinant inbred lines at each of

the three identified QTL region

39

Table 1.3. Predicted effects of SNP alleles in soybean associated with host suitability to reniform nematode

Chr POS Marker ID G. max gene ID (Wm82.a1.v1)

Annotation impact

Variant annotation Gene Name (Arabidopsis ortholog)

rrn-1

18 344254 Chr18_3 Glyma.18G004200 LOW synonymous MAC/Perforin domain-containing protein

18 498760 Chr18_4 Glyma.18G006700 MODIFIER upstream gene Rubber elongation factor protein (REF)



18 513772 Chr18_10 Glyma.18G006900 MODIFIER upstream gene SCP1-like small phosphatase 5

18 525921 Chr18_14 Glyma.18G007300 MODIFIER 5 prime UTR Nuclear pore complex protein

18 540263 Chr18_18 Glyma.18G007300 MODIFIER intron Nuclear pore complex protein

18 570484 Chr18_19 Glyma.18G007800 MODIFIER upstream gene -

18 753527 Chr18_21 Glyma.18G010600 LOW synonymous TPX2 (targeting protein for Xklp2) protein family

18 893096 Chr18_24 Glyma.18G012600 MODIFIER upstream gene terminal EAR1-like 1

18 931887 Chr18_25 Glyma.18G013200 LOW synonymous mitogen-activated protein kinase phosphatase 1

18 1176342 Chr18_29 Glyma.18G016400 MODIFIER 3 prime UTR leucine-rich repeat transmembrane protein kinase family protein

18 1266358 Chr18_36 Glyma.18G017700 LOW synonymous -


18 1361808 Chr18_39 Glyma.18G018600 MODIFIER upstr_gene myo-inositol-1-phosphate synthase 3

18 1407167 Chr18_45 Glyma.18G019000 MODIFIER downstream_gene sulfate transporter 2;1

18 1684449 Chr18_46 Glyma.18G023200 MODIFIER downstream_gene Protein of unknown function (DUF399 and DUF3411)

18 1983171 Chr18_50 Glyma.18G026600 LOW synonymous Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein

18 1983502 Chr18_51 Glyma.18G026600 MODERATE missense Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein

18 2018886 Chr18_52 Glyma.18G026800 MODIFIER upstream gene CRINKLY4 related 3

18 2020961 Chr18_53 Glyma.18G026800 MODIFIER 3 prime UTR CRINKLY4 related 3



40


18 2092161 Chr18_58 Glyma.18G027900 MODERATE misense cation/hydrogen exchanger 15

18 2126474 Chr18_60 Glyma.18G028200 MODIFIER downstream gene nuclear pore complex protein-related


18 2712464 Chr18_63 Glyma.18G034900 MODIFIER intron Nucleotidyltransferase family protein

18 2840755 Chr18_66 Glyma.18G036300 MODIFIER missense purine biosynthesis 4

18 2858361 Chr18_68 Glyma.18G036500 MODERATE downstream gene -

18 2868649 Chr18_69 Glyma.18G036600 LOW synonymous hAT transposon superfamily

18 3140962 Chr18_74 Glyma.18G039000 MODIFIER 3 prime UTR DegP protease 7

18 3148588 Chr18_76 Glyma.18G039000 MODIFIER intron DegP protease 7

18 3163213 Chr18_77 Glyma.18G039100 LOW synonymous ARM repeat superfamily protein

18 3237957 Chr18_80 Glyma.18G039800 MODERATE missense 5'-AMP-activated protein kinase-related

18 3380292 Chr18_90 Glyma.18G040700 MODIFIER 5 prime UTR myb domain protein 43

rrn-2

18 52813203 Chr18_492 Glyma.18G239300 MODIFIER upstream gene Reticulon family protein

18 53008787 Chr18_499 Glyma.18G241400 LOW synonymous Uncharacterized protein family (UPF0016)

18 53054458 Chr18_501 Glyma.18G242100 LOW synonymous Putative adipose-regulatory protein (Seipin)

18 53163458 Chr18_505 Glyma.18G243500 MODIFIER 3 prime UTR chloroplastic acetylcoenzyme A carboxylase 1

18 53266749 Chr18_519 Glyma.18G245000 MODIFIER 3 prime UTR sister chromatid cohesion 1 protein 4

18 53273014 Chr18_520 Glyma.18G245000 LOW synonymous sister chromatid cohesion 1 protein 4

18 53273819 Chr18_522 Glyma.18G245000 MODIFIER intron sister chromatid cohesion 1 protein 4

18 53353476 Chr18_523 Glyma.18G245900 MODIFIER 5 prime UTR mitochondrial acyl carrier protein 1

18 53850560 Chr18_536 Glyma.18G251800-Glyma.18G251900

MODIFIER intergenic region Protein kinase superfamily protein - Protein of unknown function (DUF630 and DUF632)

18 54068524 Chr18_553 Glyma.18G254300 MODERATE missense Leucine-rich repeat receptor-like protein kinase family protein

18 54068949 Chr18_554 Glyma.18G254300 MODERATE missense Leucine-rich repeat receptor-like protein kinase family protein

18 54091721 Chr18_557 Glyma.18G254600 LOW synonymous Leucine-rich repeat receptor-like protein kinase family protein

18 54149483 Chr18_560 Glyma.18G255000 LOW synonymous Phosphoglycerate mutase-like family protein

41

rrn-3

11 32235891 Chr11_171 Glyma.11G227400 MODIFIER upstream gene Mitochondrial substrate carrier family protein

11 32377256 Chr11_174 Glyma.11G228400 MODERATE missense -

11 32531257 Chr11_181 Glyma.11G230000 LOW synonymous Phosphoinositide-specific phospholipase C family protein

11 32531669 Chr11_182 Glyma.11G230100 MODIFIER upstream gene phospholipase C 2

11 32696992 Chr11_183 Glyma.11G231300 MODIFIER downstream gene basic helix-loop-helix (bHLH) DNA-binding superfamily protein

11 32829260 Chr11_187 Glyma.11G232900 MODERATE missense P-loop containing nucleoside triphosphate hydrolases superfamily protein

11 32986440 Chr11_190 Glyma.11G234700 LOW synonymous ARM repeat superfamily protein

42

CHAPTER TWO

ABSTRACT

Reniform nematode (Rotylenchulus reniformis, Linford and Oliveira) is a

sedentary, semi-endoparasite that infects a wide range of plant hosts and is one of

the top three nematode pathogens affecting soybean in the southeastern United

States. Previous studies have linked resistance to reniform nematode in soybean to

two quantitative trait loci on chromosomes (Chr.) 11 and 18. A Kompetitive Allele-

Specific PCR (KASP) assay was designed using SNP markers within these two

regions that distinguishes reniform nematode resistant soybean germplasm based

on genotype. A collection of 44 soybean Plant Introductions (PIs) with resistant

phenotype to reniform nematode and 40 susceptible soybean lines were genotyped

at the two target loci to validate the KASP assay design. Of the 44 observed resistant

lines, two carried the susceptible allele; PI 438489B at the locus on Chr. 18 and PI

495017C on Chr. 11. Of the observed susceptible soybean lines, only 25 and 13 of

the 40 germplasm had the expected susceptible allele at the loci on Chr. 18 and 11,

respectively. Our KASP assay was 68% accurate in predicting the phenotype of 84

soybean germplasm based on their genotype at the SNP marker on Chr. 18 and 83%

accurate at Chr. 11. These results indicate a moderate correlation of soybean

markers GlyREN18_46 and GlyREN11_190 with reniform nematode resistance.

However, further research is required to improve the accuracy of KASP assays to

predict soybean response to reniform nematode, particularly host susceptibility.

43

INTRODUCTION

Reniform nematode (RN) is a major yield-limiting pathogen of soybean

throughout most of the southeastern United States, responsible for 11 to 33% yield

loss (Allen et al. 2018; Rebois and Johnson 1973; Robbins et al. 1994a). The use of

resistant cultivars is the best management practice to prevent yield loss and reduce

nematode populations in the soil if nematode populations are above recommended

thresholds (Westphal and Scott 2005). Current nematode resistant cultivars of

soybean are tailored to protect against soybean cyst nematode (SCN) which is

controlled in part by the major soybean loci rhg1 and Rhg4 on chromosomes 18 and

8, respectively (Liu et al. 2017). A combination of both rhg1-a and Rhg4 alleles have

been shown to carry resistance to RN and SCN, but some SCN-resistant genotypes

contain only the rhg1-b allele (Cook et al. 2012; Klepadlo et al. 2018). Unfortunately,

many of the SCN-resistant soybean cultivars available for commercial production

are derived from either PI 88788 or Peking, which do not carry the resistant allele at

Rhg4 and are therefore susceptible to reniform nematode.

Studies over the last 20 years have investigated the performance of hundreds

of released cultivars and breeding lines of soybean against reniform nematode (Lee

et al. 2015; Robbins and Rakes 1996; Robbins et al. 1994b, 1999, 2001, 2002, 2017;

Stetina et al. 2014). These studies highlight the wide spectrum of host responses to

RN in plant introduction (PI) lines and developed cultivars and identify lines that

carry genetic resistance to this nematode pathogen. Manual screening for resistance

such as quantifying the reproductive index (RI) in large populations of breeding

44

lines requires a high cost, large space, and months of labor (Jenkins 1964; Robbins

and Rakes 1996). With the advent of molecular tools, breeders have the ability to

test for desired genetic characteristics, such as disease resistance, within their

breeding populations within a fraction of the time and cost compared to manual

screening.

Several rapid molecular screening techniques have been developed to assist

breeders in predicting desired phenotypes using genomic markers (Broccanello et

al. 2018; Semagn et al. 2014). A KASP (Kompetitive Allele Specific PCR) assay is one

of these marker detection assays that is rapid, reliable, and has a low cost per

sample. This PCR-based assay targets single nucleotide polymorphisms (SNPs)

through oligo extension and uses fluorescence resonance energy transfer (FRET) for

signal generation (Kumpatla et al. 2012). KASP assays are best suited for studies

targeting between one and 10 SNP markers in hundreds of plant germplasm, which

is often the case when screening for markers linked to desired traits in large

breeding populations. Although inheritance of quality traits such as pathogen

resistance is complex in nature, assays designed for marker-assisted selection have

improved efforts to pyramid desired traits and increase the efficiency of breeding

programs (Semagn et al. 2014). A KASP assay designed to target 3 SNP markers has

proven highly effective in differentiating SCN resistance (Shi et al. 2015).

Recent studies have linked two QTL regions to reniform nematode resistance

on soybean chromosomes 18 and 11. One study identified a region on chromosome

19, yet no subsequent study has associated the resistance phenotype to a genomic

45

region on this chromosome (Ha et al. 2007; Jiao et al. 2015; Lee et al. 2016). A recent

study by Klepadlo et al (2018) screened 76 SCN-resistant soybean accessions for

reniform nematode resistance using both phenotypic observations and genotypic

screening using a KASP assay. There was a 90% association with a KASP marker

from the QTL on chromosome 18, but high variability in the markers developed for

QTL regions on chromosomes 11 and 19. Further research is needed to expand the

use of a molecular assay to accurately assess soybean germplasm that may not carry

resistance to SCN. Surveying a broader genetic pool will better our understanding of

genetic features involved in reniform nematode resistance.

The objective of this study is to develop a KASP assay to assist in marker-

assisted selection of reniform nematode resistance in soybean. SNP markers

identified within two QTL regions detected in a previous study were used to design

the assay (Wilkes et al. 2020). Forty-four reniform nematode resistant soybean

germplasms and 40 susceptible lines (84 total) were genotyped using the assay to

test accuracy. Additionally, the phenotypic responses of the 44 resistant soybean

lines was assessed.


Manual reniform nematode resistance screening

All soybean germplasm reported to be resistant to Rotylenchulus reniformis

by the Germplasm Resources Information Network (GRIN, USDA-ARS) was acquired

and screened for resistance to a reniform nematode population collected in South

Carolina. These 44 distinct soybean varieties were planted in 20-ounce Styrofoam

46

cups in 3 replicates and grown in a temperature-controlled growth room. The room

was maintained at 38°C and pots were watered using an automated irrigation

system that watered roughly 50 mL once a day. Three positive controls (RN-

susceptible soybean cultivar, Braxton) was planted in conjunction with each

replicate trial. Once the first trifoliate emerged, six days after planting, each plant

was individually inoculated with 2000 reniform vermiform. Inoculum was taken

from a reniform nematode population originally collected from St. Matthews, South

Carolina and cultured for +30 life cycles on Braxton in a controlled environment.

After 30 days post-inoculation, all soybean plants were harvested by removing the

top vegetative growth and extracting nematodes from the soil in each pot (Jenkins

1964). The reproduction index (RI) was calculated to estimate the nematode

reproduction on each soybean germplasm (Perry et al. 2018).

DNA extraction

All 40 reniform nematode-susceptible soybean lines were randomly selected

from previous reniform nematode screening projects with an emphasis to sample

lines with no overlapping pedigrees (Lee et al. 2015; Robbins et al. 2017). Each

germplasm was planted in the same growth room with the resistant germplasm. A

penny-sized amount of newly emerging plant leaf material was collected for DNA

extraction from each examined soybean germplasm using a sodium dodecyl sulfate

(SDS) protocol published by King et al (2014). Each sample of extracted DNA was

normalized to a concentration of 50 ng/μL for use in the KASP assay.

Primer design

47

Two primer sets were designed to target SNPs within QTL regions previously

identified in Wilkes et al. (2020) (Table 2.1). The first target SNP, hereafter referred

to as GlyREN18_46, was on Chr. 18, bp 1684449. The resistant allele was C and the

susceptible allele was A. The second target SNP was on Chr. 11, bp 32986440,

referred to as GlyREN11_190. The resistant allele for GlyREN11_190 was C and the

susceptible allele was T. The 5’ end of each forward primer was appended with a

complementary sequence to the FAM fluorophore for the alleles from Williams 82

(susceptible) and HEX fluorophore quenchers for Forrest (resistant) alleles. Quality

of the primer design was reviewed using the OligoAnalyzer Tool from IDT

(idtdna.com).

KASP assay

The KASP assay protocol was modified from (Patterson et al. 2017). Stock

primers were resuspended in ddH2O at a concentration of 100 μM. A primer master

mix was formulated based on with the following: 18 μL of forward primer with FAM

sequence, 18μL of forward primer with HEX sequence, 45 μL of the reverse primer,

and 69 μL of 1M Tris-HCl, pH 8.3. A mastermix for each target SNP was made at a

ratio of 514 μL of the KASP V4.0 2X MasterMix (LGC GenomicsTM) combined with 14

μL of the primer master mix.

A 96-well plate was prepared by pipetting 4 μL KASP and primer mix

followed by 4 μL of DNA sample or ddH2O for the non-template control (NTC).

Standard controls for each genotype were replicated at least 3 times and each

unknown sample had at least two replicates per run. Soybean cultivar, Forrest, was

48

the resistant control and Williams 82 was the susceptible. Heterozygous standards

were selected from a set of recombinant inbred lines developed from a cross

between these two cultivars (Wilkes et al. 2020). Plates were sealed with optically

clear adhesive plate seals (Thermo Scientific Cat. No. AB1170). The assay was

performed using a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad

Laboratories, Inc., Hercules, CA) using a modified LGC qPCR program: 10 cycles of

94°C for 15 minutes, 94°C for 20 seconds, 61-55°C for 60 seconds, dropping 0.6°C

per cycle followed by 30 cycles of DNA separation at 94°C for 20 seconds, annealing

at 55°C for 1 minute, and elongation at 23°C for 30 seconds. HEX and FAM

fluorescence strength was measured at the end of each of the final 30 DNA

amplification cycles.

Data analysis FAM and HEX fluorescence values were normalized by transforming each

value to a percentage of the maximum fluorescence for each fluorophore in each

individual assay (Patterson et al. 2017). A discriminate analysis was performed to

identify statistically distinct clusters of similar HEX and FAM fluorescence at each

target site to call genotype (JMP® 2020, SAS institute).

RESULTS

Manual reniform nematode resistance screening

All 44 GRIN-labeled RN resistant soybean lines had lower reproduction

indices (RI) compared to the susceptible control, Braxton. However, 6 of the 44 lines

had a slightly higher RI as compared to the other 38 tested lines (Figure 2.1). These

49

genotypes were PI 438489 B, PI 495017 C, PI 467332, PI467312, PI 458520, and PI

416762. An optimal univariate cluster analysis was performed on the RI of all

phenotyped soybeans to clearly illustrate the distinct grouping of these 6

individuals apart from the other germplasm (Figure 2.2).

KASP assay

The KASP assay designed to target SNP alleles at GlyREN18_46 and

GlyREN11_190 successfully distinguished the genotypes between the susceptible

and resistant standard controls in all the trials. However, the homozygous

susceptible standard had higher FAM fluorescence than expected and was

indistinguishable from the heterozygous standard in the amplification of

GlyREN11_190. The resistant controls remained distinct from the susceptible and

heterozygous standards.

Of the 44 resistant soybean lines, one (PI 438489 B) at GlyREN18_46 and one

(PI 495017 C) at the GlyREN11_190 had a genotype call consistent with the

susceptible standard (Figure 2.3). The probability of an accurate phenotype

prediction at GlyREN18_46 was estimated at 97.7% in the observed resistant

germplasm. However, the susceptible germplasm assay results at the two loci were

less accurately correlated with the known phenotype (Figure 2.4). For marker

GlyREN18_46, 14 reniform nematode-susceptible soybean lines had HEX signals

consistent with the susceptible standard and 25 had FAM signals consistent with the

resistant standard. For GlyREN11_190, 26 susceptible soybean germplasm had

predominantly HEX fluorescence, 13 had predominantly FAM fluorescence, and one

50

germplasm (SC06-306) with FAM and HEX fluorescence distinct from all other data

points. Results from genotyping the susceptible soybean germplasm show a 36%

and 66.7% phenotype prediction accuracy for SNP alleles at GlyREN18_46 and

GlyREN11_190, respectively. Overall, genotyping at GlyREN18_46 and

GlyREN_11_190 was 68% and 83% accurate, respectively, in predicting reniform

nematode response in soybean.

DISCUSSION

The 44 GRIN-labeled RN resistant soybean germplasm had reduced RN

reproduction compared to a susceptible control, as expected. However, six of the 44

screened resistant soybean lines had consistently higher RI compared to the other

38 resistant lines (Figure 2.2). Three (PI 467312, PI 458520, PI 416762) of those six

were once reported susceptible to reniform nematode (Lee et al. 2016). Similarly,

two of the same lines (PI 458520, PI 416762) were labeled susceptible in a separate

study (Klepadlo et al. 2018; Lee et al. 2016). Conversely, PI 437725 had low RI,

consistent with the highly resistant germplasm but was classified as susceptible in

the Lee (2016) report. This discrepancy in resistance labeling could be an indication

of small-effect QTLs that are part of the overall phenotype, which may also account

for the six resistant soybean lines with slightly higher RN reproduction (Figure 2).

KASP assay results show that two of the genotyped RN resistant soybean

lines carried the susceptible genotype; PI 438489B at GlyREN18_46 and PI 495017C

at GlyREN11_190. These soybean lines were two of the six germplasm with slightly

higher RI than the other 38 RN-resistant germplasm. It is possible that PI 438489B

51

and 495017C may have a different combination of resistant alleles that accounts for

the susceptible genotypes at the two loci and may even allow for a slightly higher

nematode reproduction than other resistant germplasm. It would be interesting to

investigate these six soybean lines, in particular the two with different genotypes, to

identify novel QTLs with smaller phenotype effect.

Measuring phenotypic resistance to a nematode pathogen is not a

straightforward process. Resistance is most often represented by the reproductive

index (RI), a relative measurement of a host’s suitability to the pathogen. These

values are on a continuous spectrum which makes classifying resistance a challenge.

Additionally, the RI of an individual plant can be affected by environmental

conditions, such as temperature and soil texture, which is the reason many studies

use a standardized control for relative comparison (Perry et al. 2018). However,

comparisons to a control can lead to inconsistent host suitability calls since it is not

uncommon for the RI distribution in a population to fall outside the range of the

controls. This further justifies the need for a reliable genotyping method to define

and classify nematode resistance.

The KASP assay designed to target GlyREN18_46 gave clear distinct clusters

between all three genotypes (Figures 2.3 & 2.4). However, the assay design targeting

GlyREN11_190 did not provide fluorescence measurements as expected. The

resistant standard gave the expected result of a high FAM fluorescent signal and low

HEX signal, indicating a genotype of TT. The heterozygous standard also gave

expected results of equal signals of both FAM and HEX indicating a genotype of CT.

52

However, the susceptible control aligned with the heterozygous standard, with

higher than expected FAM signal. Likewise, several tested susceptible soybean lines

gave calls that aligned with the heterozygous and homozygous controls.

Interestingly, one susceptible line, SC06-306, had unique fluorescence signals apart

from the other genotypes (Figure 2.4b). The reason for this anomaly is unclear. In-

depth research, such as amplicon sequencing of each genotype, would provide a

clear understanding of the alleles this locus.

The KASP assay designed for GlyREN11_190 did not yield the expected three

genotype clusters for homozygous resistant, susceptible and heterozygous.

However, the assay made clear distinction between resistant and susceptible

standard controls and conclusions can be made regarding the genotyped soybean

lines. The accuracy rate for predicting the phenotypically resistant soybean

germplasm was higher than the rate for the susceptible germplasm. It is possible

that RN susceptible germplasm have greater genetic diversity compared to resistant

germplasm. The resistant germplasm may come from similar pedigrees, particularly

if there was one source of resistance, and therefore have more similar haplotypes.

Additionally, being a quantitative trait, there are multiple loci that are involved in

the resistance phenotype. Testing for one or two known RN resistance loci may not

be sufficient to predict the phenotype and therefore lead to a lower prediction

accuracy.

Klepadlo et al (2018) developed three KASP markers to test for reniform

nematode resistance and found an overall correlation of 67.2% linking the genotype

53

with the phenotypic variation in 76 soybean germplasm. Our study tests 84 soybean

germplasm and shows a comparable rate of 76% accurately correlating genotype to

phenotype with just two markers. Specifically, the accuracy of GlyREN11_190 was

83% compared to Klepadlo’s 63%. However, the marker at GlyREN18_46 was much

lower in accuracy compared to their reported 89%. GlyREN18_46 was 666 kb

downstream on Chr. 18 of the KASP marker developed by Klepadlo and

GlyREN11_190 was 27 kb downstream from their marker on Chr. 11. A combination

of the KASP-designed marker on Chr. 18 in the Klepadlo study and GlyREN11_190

would provide an even greater accuracy phenotype prediction.

Our study contributes to the ongoing efforts to design and implement a fast

molecular assay targeting known loci associated with resistance to reniform

nematode. Development of a quick and reliable genetic screening for reniform

nematode resistance in soybean can assist breeders in rapid selection of germplasm

with known nematode resistance.

REFERENCES Allen, T.W., Bissonnette, K., Bradley, C.A., Damicone, J.P., Dufault, N.S., Faske, T.R., Isakeit, T., Kemerait, R.C., Koehler, A., Mehl, H.L., et al. 2018. Southern United States soybean disease loss esimates for 2018. Proc. 46th Annu. Meet. South. Soybean Dis. Work. Pensacola FL.

Broccanello, C., Chiodi, C., Funk, A., McGrath, J.M., Panella, L., Stevanato, P. 2018. Comparison of three PCR-based assays for SNP genotyping in plants. Plant Methods 14, 28.

Cook, D.E., Lee, T.G., Guo, X., Melito, S., Wang, K., Bayless, A.M., Wang, J., Hughes, T.J., Willis, D.K., Clemente, T.E., et al. 2012. Copy number variation of multiple genes at Rhg1 mediates nematode resistance in soybean. Science 338, 1206–1209.

54

Ha, B-K, Robbins, R.T., Han, F., Hussey, R.S., Soper, J.F., Boerma, H.R. 2007. SSR mapping and confirmation of soybean QTL from PI 437654 conditioning resistance to reniform nematode. Crop Sci. 47, 1336–1343.

Jenkins, W.R. 1964. A rapid centrifugal-flotation technique for separating nematodes from soil. Plant Dis. Report. 48, 692.

Jiao, Y., Vuong, T.D., Liu, Y., Li, Z., Noe, J., Robbins, R.T., Joshi, T., Xu, D., Shannon, J.G., Nguyen, H.T. 2015. Identification of quantitative trait loci underlying resistance to southern root-knot and reniform nematodes in soybean accession PI 567516C. Mol. Breed. 35, 131.

King Z., Serrano J., Boerma H.R., Li Z. 2014. Non-toxic and efficient DNA extractions for soybean leaf and seed chips for high-throughput and large-scale genotyping. Biotechnol. Lett. 36, 1875–1879.

Klepadlo, M., Meinhardt, C.G., Vuong, T.D., Patil, G., Bachleda, N., Ye, H., Robbins, R.T., Li, Z., Shannon, J.G., Chen, P., et al. 2018. Evaluation of soybean germplasm for resistance to multiple nematode species: Heterodera glycines, Meloidogyne incognita, and Rotylenchulus reniformis. Crop Sci. 58, 2511–2522.

Kumpatla, S.P., Buyyarapu, R., Abdurakhmonov, I.Y., Mammadov, J.A. 2012. Genomics-assisted plant breeding in the 21st century: technological advances and progress. Plant Breed.

Lee, J-D, Kim, H.J., Robbins, R.T., Wrather, J.A., Bond, J., Nguyen, H.T., Shannon, J.G. 2015. Reaction of soybean cyst nematode resistant plant introductions to root-knot and reniform nematodes. Plant Breed. Biotechnol. 3, 346–354.

Lee, Y-C, Lightfoot, D.A., Anderson, J., Robbins, R.T., Kantartzi, S.K. 2016. QTL underlying reniform nematode resistance in soybean cultiar Hartwig. Atlas J. Biol. 308–312.

Liu, S., Kandoth, P.K., Lakhssassi, N., Kang, J., Colantonio, V., Heinz, R., Yeckel, G., Zhou, Z., Bekal, S., Dapprich, J., et al. 2017. The soybean GmSNAP18 gene underlies two types of resistance to soybean cyst nematode. Nat. Commun. 8, 14822.

Patterson, E.L., Fleming, M.B., Kessler, K.C., Nissen, S.J., Gaines, T.A. 2017. A KASP genotyping method to identify northern watermilfoil, eurasian watermilfoil, and their interspecific hybrids. Front. Plant Sci. 8.

Perry, R.N., Moens, M., Jones, J.T. 2018. Cyst nematodes (CABI).

55

Rebois, R.V., Johnson, W.C. 1973. Effect of Rotylenchulus reniformis on yield and nitrogen, potassium, phosphorus and amino acid content of seed of Glycine max. J. Nematol. 5, 1–6.

Robbins, R.T., Rakes, L. 1996. Resistance to the reniform nematode in selected soybean cultivars and germplasm lines. J. Nematol. 28, 612–615.

Robbins, R.T., Rakes, L., Elkins, C.R. 1994a. Reniform nematode reproduction and soybean yield of four soybean cultivars in Arkansas. J. Nematol. 26, 656–658.

Robbins, R.T., Rakes, L., Elkins, C.R. 1994b. Reproduction of the reniform nematode on thirty soybean cultivars. J. Nematol. 26, 659–664.

Robbins, R.T., Rakes, L., Jackson, L.E., Dombek, D.G. 1999. Reniform nematode resistance in selected soybean cultivars. J. Nematol. 31, 667–677.

Robbins, R.T., Rakes, L., Jackson, L.E., Gbur, E.E., Dombek, D.G. 2001. Host suitability in soybean cultivars for the reniform nematode, 2000 tests. J. Nematol. 33, 314–317.

Robbins, R.T., Shipe, E.R., Rakes, L., Jackson, L.E., Gbur, E.E., Dombek, D.G. 2002. Host suitability of soybean cultivars and breeding lines to reniform nematode in tests conducted in 2001. J. Nematol. 34, 378–383.

Robbins, R.T., Arelli, P., Chen, P., Shannon, G., Kantartzi, S., Fallen, B., Li, Z., Faske, T., Velie, J., Gbur, E., et al. 2017. Reniform nematode reproduction on soybean cultivars and breeding lines in 2016. Proc 2016 Beltwide Cotton Conf. January 4-6 2017 Dallas TX USA 184–214.

Semagn, K., Babu, R., Hearne, S., Olsen, M. 2014. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement. Mol. Breed. 33, 1–14.

Shi, Z., Liu, S., Noe, J., Arelli, P., Meksem, K., Li, Z. 2015. SNP identification and marker assay development for high-throughput selection of soybean cyst nematode resistance. BMC Genomics 16, 314.

Stetina, S.R., Smith, J.R., Ray, J.D. 2014. Identification of Rotylenchulus reniformis resistant Glycine lines. J. Nematol. 46, 1–7.

Westphal, A.., Scott, A.W. 2005. Implementation of soybean in cotton cropping sequences for management of reniform nematode in south Texas. Crop Sci. 45, cropsci2005.0233.

56

0

5

10

15

20

25

30

35

40

45

PI 3

398

68 B

PI 4

041

66

PI 4

041

98 A

PI 9

076

3

PI 8

475

1

PI 5

074

71

PI 8

977

2

PI 4

384

97

PI 4

376

90

PI 5

336

05

Pi 5

090

95

PI 5

077

5

PI 4

376

79

PI 4

384

98

PI 4

041

98 B

PI 5

074

22

PI 5

074

76

PI 5

489

75

PI 3

036

52

PI 5

068

62

PI 4

673

27

PI 5

091

00

PI 4

376

54

PI 5

486

55

PI 5

484

02

PI 4

689

15

PI 5

437

95

PI 4

689

03

PI 5

567

43

PI 5

489

88

PI 5

310

68

PI 4

941

82

PI 4

377

25

PI 5

159

60

PI 5

074

70

PI 5

073

54

PI 5

074

43

PI 5

074

23

PI 4

384

89 B

PI 4

950

17 C

PI 4

673

32

PI 4

673

12

PI 4

585

20

PI 4

167

62

avg

Bra

xto

n

Rep

rod

uct

ion

Ind

ex (R

I)Wilkes, J., Saski, C.A., Klepadlo, M., Fallen, B., Agudelo, P. 2020. Quantitative trait loci associated with Rotylenchulus reniformis host suitability in soybean. Phytopathology.

Figure 2.1 Reproduction Indices (RI) of 44 soybean accessions with reniform nematode resistance reported by the Germplasm Resources Information Network (GRIN, USDA-ARS). Soybean cultivar, Braxton, was used as a susceptible control and an average of 3 replicates was used in each trial. Blue bar represents trial 1, red trial 2, and green trial 3.

57

Figure 2.2 Optimized univariate k-means cluster analysis of Reproductive Indices (RI) of 44 soybean accessions with reniform nematode resistance and a susceptible control (cv. Braxton). k, or optimal number of clusters, was estimated to be three

58

Table 2.1 KASP primer sequences for targeting reniform nematode resistance in soybean in two QTLs on chromosome 11 (GlyREN11_190) and 18 (GlyREN18_46)

Marker Primer Sequence GlyREN18_46

Forward-FAM

GAAGGTGACCAAGTTCATGCTCTGTTTCGTTGCATAAAATTGCAGC

Forward-HEX

GAAGGTGACCAAGTTCATGCTCTGTTTCGTTGCATAAAATTGCAGA

Reverse GCCTACAAGTTAGAAAGACAGAGCCAT GlyREN11_190

Forward-FAM

CGTCTTCAATAGCCATCCGACTTTC

Forward-HEX

CGTCTTCAATAGCCATCCGACTTTT

Reverse GATTTCCAGATGAGCTAACCATTGAGGAAG

59

Figure 2.3 Endpoint fluorescence plots generated by KASP genotyping to predict reniform nematode resistance in 44 resistant soybean accessions at genomic regions (a) GlyREN18_46 and (b) GlyREN11_190. Predicted alleles are provided near each distinct cluster based on standard controls. (a)

(b)

0

20

40

60

80

100

120

140

0 20 40 60 80 100 120

%H

EX

%FAM

S control

R control

Heterozygous

NTC

R samples

0

20

40

60

80

100

120

0 20 40 60 80 100 120

%H

EX

%FAM

S control

R control

Heterozygous

NTC

R samples

[TT]

[CT]

[CC]

[AA]

[CA]

[CC]

60

Figure 2.4 Endpoint fluorescence plots generated by KASP genotyping to predict reniform nematode resistance in 40 susceptible soybean accessions at genomic regions (a) GlyREN18_46 and (b) GlyREN11_190. Predicted alleles are provided near each distinct cluster based on standard controls. (a)

(b)

0

20

40

60

80

100

120

0 20 40 60 80 100 120

S control

R control

Heterozygous

NTC

S samples

[AA]

[CA]

[CC]

0

20

40

60

80

100

120

0 20 40 60 80 100 120

S control

R control

Heterozygous

NTC

S samples

[TT]

[C*]

61

CHAPTER THREE

ABSTRACT

Reniform nematode (Rotylenchulus reniformis, Linford and Oliveira) is a soil-

borne, sedentary nematode that can infect soybean roots, causing significant yield

loss in the southeastern region of the United States. Few studies have compared the

genetic responses to this nematode pathogen in resistant soybean cultivars,

particularly at the pre-penetration stage. A transcriptome analysis was performed

on two resistant cultivars of soybean, ‘Forrest’ and PI 437654, and a susceptible

control, ‘Williams 82’ inoculated with reniform nematode. Plants were reared in a

sterile plastic pouch and root tissue was harvested twenty-four hours after

inoculation. Forrest and PI 437654 had 94 and 68 genes, respectively, that were

differentially expressed in inoculated samples and 10 of those genes were shared.

These 10 genes were all upregulated and half of which were annotated to be related

to a cytochrome P450 protein. Other upregulated genes in each resistant line were

also related to cytochrome P450 in addition to chitin recognition, cupin activity, VQ

motifs, and secondary metabolite synthesis processes. Differential gene expression

analysis indicates the soybean host plant can detect parasitic nematode presence 24

hours after inoculation. Comparison of gene expression in the two resistant

genotypes, Forrest and PI 437654 show differences that may highlight different

mechanisms of plant defense against reniform nematode.

INTRODUCTION

62

Soybeans are one of the major economic crops grown in the southeastern

United States where several plant parasitic nematodes (PPN), such as reniform

nematode, are found (Allen et al. 2017, 2018, Heald and Robinson 1990). Reniform

nematode (Rotylenchulus reniformis, Linford and Oliveira) is a sedentary, semi-

endoparasitic nematode with a host range of over 300 plant species including

soybean (Glycine max, L.). The developmental life stages from egg to adult occur in

the soil and do not feed on host plant tissue. The adult female enters the host root

and navigates intracellularly through the cortical cell tissue to the endodermis.

There, the female inserts the stylet into an endodermal cell and secretes cell-

modulating effectors, which initiates the formation of a feeding site called a

syncytium (Mitchum et al. 2013, Robinson 2007, Robinson et al. 1997). In a

susceptible host, the nematode induces a syncytium through partial cell wall lysis

and cell reprogramming to acquire nutrients and complete its life cycle (Rebois et al.

1975). Various responses have been observed on resistant host species with reports

of irregular syncytia formation including endodermal cell collapse or lack of

pericycle cell hypertrophy. Preventing the development of a fully functional

syncytium thereby reduces nematode fecundity (Agudelo et al. 2005).

Deployment of resistant cultivars is one of the most effective and sustainable

management strategies for reniform nematode infested fields. Many studies have

reported soybean genotypes with a range of resistant responses to reniform

nematode (Lee et al. 2015, Robbins and Rakes 1996, Robbins et al. 1999, 2001,

2002, 2017). However, little work has been done to understand if these different

63

resistant genotypes harbor different defense mechanisms. Detecting distinct genetic

responses to parasitic nematodes will assist in understanding varying defense

mechanisms and modes of resistance for effective utilization of resistant cultivars.

Host plants can detect the presence of PPNs at various steps in the infection

process. These PPNs release a suite of MAMPs/PAMPs (microbial/pathogen-

associated molecular patterns) that are detected by the host plant pattern

recognition receptors. A group of molecules called ascarosides are one example of a

PAMP that are nematode-specific and have been shown to activate PAMP-triggered

immunity (PTI). Exposure to ascr#18, the most abundant ascaroside found in PPNs,

resulted in an increase in broad-spectrum plant-pathogen resistance in specimens

of both monocots and dicots (Manosalva et al. 2015). In an Arabidopsis model study,

PTI of host plants measured in the form of reactive oxygen species (ROS) burst was

activated as early as 20 minutes after exposure to two PPN species including

aqueous solutions with nematodes removed (Mendy et al, 2017). Additional studies

have shown that plants can detect pheromones secreted by a parasitizing nematode

and subsequently send chemical signals that can deter further nematode infection

(Manohar et al. 2020, Mendy et al. 2017). A Nematode-Induced Leucine-rich repeat

receptor-like kinase (NILR), a highly conserved gene, was found to be an important

component of recognition of nematode-associated molecular patterns (Mendy et al.

2017).

Resistant host plant genotypes have unique defense responses. Penetration

rate and development of mature female root-knot nematodes was significantly

64

reduced in three cultivars of resistant Cucumis genotypes (Faske 2013). This same

study reported an increase in second stage juveniles emigrating from roots 3-5 days

post inoculation in resistant cultivars compared to susceptible cultivars. In a study

on reniform nematode development on cotton, Stetina et al. (2015) observed a delay

in nematode development on a resistant cotton species, Gossypium barbadense,

relative to the susceptible species, G. hirsutum, upon initial infection. In addition to

developmental delay post-penetration, they found an overall reduction in total

number of infecting nematodes, which may indicate a mechanism of pre-penetration

defense. Lim and Castillo observed an overall delay in reniform nematode life stages

in a resistant soybean cultivar compared to a susceptible cultivar, including a delay

in penetration (Lim and Castillo 1978).

The purpose of this study is to identify and compare host gene expression in

two reniform nematode resistant soybean cultivars, Forrest and PI 437654, and a

susceptible cultivar, Williams 82, 24 hours after inoculation. Differential gene

expression of the two resistant cultivars may indicate different mechanisms of

resistance through PTI. Results will reveal, if present, pre-penetration defense

mechanisms in reniform nematode resistant soybean cultivars and highlight genes

involved in plant defense.


Plant material

65

Seed of soybean cultivar Williams 82 were acquired from the Clemson

Breeding program and cultivars Forrest and PI 437654 were obtained from the

USDA Germplasm Resource Information Network (GRIN). Seeds were surfaced

sterilized using NaOCl and ethanol (Sauer and Burroughs 1986). One seed from each

cultivar was placed in a clear germination pouch with eight replicates of each

cultivar (Atamian et al. 2012). Once a taproot was established, seven days after

planting, six of the most uniformly developed plants of each cultivar were selected

for treatment. Three pouches of each cultivar were laid horizontal and each were

inoculated with 5000 active vermiform reniform nematodes suspended in 900 μL of

tap water. The nematode suspension was evenly disbursed around the entire root

tissue using a micropipette. The remaining three replicates of each cultivar were

inoculated in the same manner with 900 μL of tap water from the same source used

in the nematode-treated samples. All treated pouches remained horizontal,

undisturbed, for 24 hours (Atamian et al. 2012).

At 24 hours after inoculation, 500 mg of each root system was removed and

placed in 5 mL of RNAlaterTM stabilization solution (ThermoFisher Cat No.

AM7023). All samples were stored at -20°C until the time of extraction. RNA was

extracted from each sample by removing the tissue from the RNAlaterTM solution

by blotting on a paper towel and grinding it in a sterilized mortar and pestle with

liquid nitrogen. Extraction protocol was followed according to SpectrumTM Plant

Total RNA Kit (Sigma-Aldrich STRN50-1KT) followed by DNAase digestion (Qiagen

Cat No. 79254). RNA quality was measured using a Qubit (Qubit® 2.0 Fluorometer,

66

InvitrogenTM) and stored at -4°C until paired-end sequenced on an Illumina HiSeq

2500.

Transcriptome assembly

Total RNA was assessed for integrity with Bioanalyzer 2100 (Agilent) and

assigned an RNA integrity number (RIN). Each sample had an RIN of at least 7.0.

Total RNA was quantified with the RNA HS Assay Kit (ThermoFisher Scientific) on a

Qubit 2.0 fluorometer (ThermoFisher Scientific) and normalized to a total RNA mass

of 1g for each sample. Strand-specific mRNA seq libraries were prepared for each

sample with the TruSeq Stranded Total RNA kit (Illumina) following the

manufacturers recommended procedures. The resulting libraries were quantified

using a Qubit 2.0 fluorometer (ThermoFisher Scientific) and quantitative PCR. Size

distribution was analyzed using an Agilent 2100 Bioanalyzer (Agilent Technologies,

Santa Clara, CA, USA). Qualified libraries were sequenced on an Illumina HiSeq2500.

Raw sequence reads were assessed for quality with the fastqc software tool

(https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Sample files were

trimmed of low-quality bases and contaminating adapter sequences with the

Trimmomatic software package (Bolger et al., 2014). Transcript quantification was

performed by first aligning read pairs to the Glycine max, Wm82.a2.v1 reference

transcript set (Schmutz et al., 2010), and abundance estimates (counts, transcript

M-means (TMM), transcripts per million (TPM), and fragments per kilobase million

(FPKM)) were determined with the RNA-Seq by Expectation-Maximization (RSEM

v.1.3.3) tool (Li and Dewey 2011).

67

Expression analysis

Differentially expressed transcripts were determined with edgeR v3.14.0 in

the R statistical computing language and environment v.4.0.2 (Robinson et al. 2010).

Significant differences were based on an adjusted P < 0.01 calculated using the

Benjamini-Hochberg false discovery rate (FDR) method with an FDR of 0.05. To

visualize differential expression, genes were partitioned into expression clusters by

manually creating an expression matrix of genes whose log2 normalized and

centered FPKM+1 values were differentially expressed (logFC) ≥ 2 and P ≤ .001.

Hierarchal clustering of genes was performed with the fastcluster R software

package and cut at 60% max height of the tree with custom scripts. A venn diagram

was generated using pairwise logFC values comparing inoculated and control

treatments of each soybean genotype (bioinformatics.psb.ugent.be). Gene Ontology

(GO) enrichment analysis was performed with either the clusters produced as

described above or with individual RNA-seq datasets as input to the GoSeq R

software package (Jones et al. 2014). Heatmaps were generated in R v.4.0.2 with the

heatmap.2 software package.

Annotation

Transcripts were annotated first by aligning the sequences to the annotation

provided by the G. max reference genome (Wm82.a2.v1) (Schmutz et al., 2010). The

respective amino acid sequences of these annotated genes were then searched

against the KEGG database, the Pfam database through Interproscan, and GoSeq to

assign GO terms to each sequence (Kanehisa et al. 2016, Jones et al. 2014;, Young et

68

al. 2010) Additional gene annotations were added using the Gmax 2.0 Genome

Browser provided by soybase.org (Grant et al. 2010). Predicted role in biological

pathways was identified through KEGG pathway reconstruction associated with

each matched annotation (Kanehisa et al. 2016).

RESULTS

Extra plants of each genotype were planted concurrently with the samples

taken for RNA extraction and sequencing. These supplemental samples were

examined microscopically for locating the reniform nematodes in respect to the host

plant roots. All six samples (two of each genotype) had viable nematodes in or near

the rhizosphere but no nematodes were found penetrating the host root cortex.

A PCA plot was generated used R software, EdgeR using the raw counts of

500 random transcripts (Robinson et al. 2010). The raw sequence counts clustered

together in respect to sample genotype and treatment (Figure 3.1). The grouping of

replicates and genotypes confirms the reliability of the data and consistency

between replicates. However, there were exceptions of a few replicates that were

inconsistent (Figure 3.1A). One of each replicate per treatment was removed,

resulting in data for 2 replicates per genotype and treatment used in further data

analyses (Figure 3.1B).

A Venn diagram was constructed using log2 of the fold change for each

genotype by treatment (Figure 3.2). Only four genes were differentially expressed in

the reniform nematode-susceptible genotype, Williams 82 with no overlap

occurring with the two resistant genotypes. Forrest had a total of 94 differentially

69

expressed genes and PI 437654 had 68. Of those genes, 10 were shared between

both reniform nematode-resistant genotypes.

The shared 10 genes were all upregulated in the inoculated samples

compared to the controls. These genes did not correspond to any predicted

annotation based on the KEGG database. However, six of the 10 had matching GO

terms and these same six gene sequences also had annotations provided by Gmax

2.0 Genome Blaster. One of these 6 sequences, Glyma.17G030100, had a GO

annotation of being associated with a defense response. Three other genes were

predicted to be involved in redox activity based on the GO analysis. Results from the

Pfam labeled 5 of the annotated genes as Cytochrome P450 with high significance

(e-value<1E-92). The other gene annotated by Pfam and KEGG was labeled as a

pathogenesis-related protein, Beta v1 family and a defense response by GO analysis.

Of the 84 uniquely differentially expressed genes in Forrest, 56 were

upregulated in response to nematode exposure (Figure 3.2). Of these 56

upregulated genes, 37 had Pfam annotations associated with the predicted protein

structure with low e-values (e<1e-10), 23 different GO terms were enriched, and 26

genes were annotated using KEGG (Table 3.2 and 3.3). The associated GO terms

were molecular functions and biological processes of a wide variety including

several oxidoreductase activity and, interestingly, chitinase activity. Of the 58

uniquely differentially expressed genes in PI 437654, 43 were upregulated (Figure

3.2). Of these 43, 31 had annotations from the Pfam database with low e-values

(e<1e-10), 14 different GO terms were enriched, and 15 were annotated in KEGG

70

(Table 3.2 and 3.3). The annotation term with the highest count was cytochrome

P450 in both upregulated genes in both resistant genotypes.

In a k-means cluster analysis where k<7, four scenarios displayed interesting

trends in gene expression across each genotype and treatment (Figure 3.3). For k=2,

4, and 5, the transcript expression pattern was grouped by the genotype. The cluster

plot of five transcripts where k-means = 6 divided the data across the treatment.

These five transcripts were downregulated in the inoculated samples and did not

have any annotation from the searched databases. Four of the 5 genes are consistent

with the differentially expressed genes displayed in the Venn diagram for Forrest

and PI 437654 (Figure 3.2).

A heatmap was constructed to better visualize the 10 differentially expressed

genes shared in RN-resistant lines Forrest and PI 437654 and how their gene

expression compared to the other samples (Figure 3.4). Only six of the ten genes

were annotated. Glyma.02G156000 had a higher expression in inoculated PI with a

log2(fpkm) value of 2.64 and was consistently annotated as involved in redox

reactions. Another gene, Glyma.02G125300, had higher expression in the inoculated

resistant genotypes with slightly higher levels in Forrest compared to PI 437654.

This gene sequence did not align with any predicted annotations. Soybean gene

Glyma.15G230000 had higher expression in both resistant lines compared to the

other samples but likewise had no annotation. Based on the numerical expression

values, several highly expressed genes in the two reniform nematode resistant

genotypes of interest were not annotated and many questions remain.

71

Six genes were extracted from the 84 differentially expressed genes based on

their expression pattern in the treated versus control samples and a heatmap was

generated (Figure 3.5). Only two of these six genes were assigned annotations from

any of the searched databases. Soybean gene Glyma.13G159700 had high expression

in the two inoculated resistant genotyped with higher expression in Forrest (4.31)

than in PI 437654 (3.96) compared to the other samples (fpkm ranging 0-2.32).

Glyma.14G02270 was highly expressed in inoculated Forrest (fpkm = 4.56)

compared to any of the other samples (ranging 0-1.3). Glyma.08G124500 was highly

expressed in all the inoculated samples, including the susceptible genotype,

Williams 82, compared to the control samples. Although there was an annotation for

this gene, the description only indicates it is an uncharacterized conserved protein.

In contrast, Glyma.20G128400 was expressed at higher levels in the control samples

compared to all three of the inoculated samples. This gene could be downregulated

as part of the host plant’s response to pathogen detection.

Eleven differentially expressed genes were highlighted in the heatmap to

illustrate the comparisons in gene expression across genotypes and treatments,

eight of which were annotated based on the Pfam database (Figure 3.6) (Jones et al.

2014). There were 3 genes, Glyma.09G268600, Glyma.17G209200, and

Glyma.19G202300, that had higher levels of expression in inoculated PI 437654

than any other genotypes or treatments. The latter of the three had an annotation of

VQ motif, which has been reported to be involved in biotic and abiotic plant stress

(Jiang et al. 2018). Two genes, Glyma.10G115500 and Glyma.10G116000, were also

72

expressed in higher levels in inoculated PI respective to the other samples. Both

genes were predicted Cytochrome P450 based on the Pfam database.

One gene, Glyma.12089600, was found expressed in only the inoculated

lines. No annotation was available from any of the searched databases, but this

could be a recognition gene. In contrast, Glyma.20G147800 was highly expressed in

the control plant samples and not the inoculated. The annotation of this gene was

described as reverse transcriptase-like which appears to be downregulated in the

presence of reniform nematode. A ubiquitin-conjugating enzyme was predicted to

be another gene that was found in higher expression levels in both RN-resistant

soybean genotypes (Figure 6). Studies have reported this type of enzyme as a

critical regulator of various biological functions, including plant stress (Liu et al.

2020).

The differentially expressed genes of each genotype by treatment were

annotated using KEGG database and the number of represented gene families tallied

(Figure 7). None of the 10 shared differentially expressed genes in the two resistant

genotypes were annotated by the software. Of the 84 differentially expressed genes

in Forrest, 27 had annotations. Fifteen of those 27 were in the categories of

carbohydrate metabolism, genetic information processes, biosynthesis of secondary

metabolites, and metabolism of cofactors and vitamins. Of the 58 genes differentially

expressed in PI 437654, only 11 were annotated using the KEGG database. The gene

family category with the highest number of assigned genes was environmental

73

information processing followed by unclassified metabolism genes and metabolism

of cofactors and vitamins.

DISCUSSION

PI 437654 was reported as being highly resistant to SCN (Anand et al. 1988)

and reniform nematode (Robbins and Rakes 1996). For this reason, this genotype

was chosen together with the reniform nematode resistant control for

transcriptome analysis.

Inoculated host plant roots were physically observed in duplicate inoculated

samples from the trial. Although nematodes were not seen within the host root

tissue, this study provides evidence that the host plant is able to molecularly detect

the presence of the parasitic nematode. An interesting observation that was the

difference in root structure of PI 437654 compared to both Williams 82 and Forrest.

In the plant samples from this study, PI 437654 did not have the distinct tap root

observed in the other genotypes (Appendix 3.1). Further testing with additional

replicates and thorough root structure analysis would confirm if this is a consistent,

significant difference in root architecture between the genotypes. This alternative

root structure could aid in the plant’s ability to physically detect or alter the effects

from parasitic nematodes.

PCA plotting of a random subset of raw transcript counts provided a visual of

how the individual samples clustered together (Figure 3.1). Although there were

inconsistencies observed in the PCA plot grouping of replicates, the source of the

inconsistencies is unknown. For example, inoculated Forrest replicate 1 was closely

74

related to two Forrest control replicates. Likewise, Forrest control replicate 3 was

more closely related to the other two inoculated Forrest replicates. This

inconsistency could be the result of an error in sample labeling. However, since the

sources of error cannot be confirmed, replicates outside of expected values were

removed from downstream data analyses. Removing these variable replicates

reduced the data pool but provided more accurate information for analyses (Figure

3.1B).

Cluster plots can highlight a subset of certain genes and their expression

patterns in each genotype. For example, where k = 2, 9 transcripts had a similar

expression trend: high expression in reniform nematode-susceptible genotype,

Williams 82, and lower, near equal, expression in the two resistant genotypes

(Figure 3.3). Annotation of the genes that are clustered in Figure 3B & C can show us

how genes are upregulated uniquely in Forrest or PI 437654. Where k-means = 4, all

16 transcripts were annotated further using the Pfam database and three were

found related to redox activity. These are known pathways associated with host

defense response against stress. The last graph, where k = 6, had a small subset of 5

transcripts with matching expression patterns of higher expression in inoculated

samples compared to controls. Four of the five genes from this subset overlap with

the same genes depicted in the Venn diagram. These four genes may work

collectively for initial stages of a defense response.

Of the 10 shared differentially expressed genes in the reniform-resistant

genotypes, Forrest and PI 4327654, only six had associated annotations to the gene

75

sequences. Of those six, five had annotations of Cytochrome P450 which are known

for synthesis of secondary metabolites and oxidative and reductase as a defense

response (Xu et al. 2015). The same annotation was assigned to eight other genes

uniquely upregulated in Forrest and PI 437654 (Table 3.2). It is likely that these

genes are involved in the host plant’s initial pathogen recognition and a high copy

number of the cytochrome P450 genes are key to a resistance phenotype.

Two genes annotated as cytochrome P450 in the 10 shared resistance genes

were only 169 kbp apart. These genes could possibly be within a gene cluster that

encode for similar proteins, particularly when considering the high levels of gene

duplication in the soybean genome (Schlueter et al. 2007). The same pattern was

observed in two genes upregulated in PI 437654. Glyma.10G115500 and

Glyma.10G116000 are 87 kbp apart and had higher expression in only PI 437654

(Table 3.2, Figure 3.6). It could be possible that PI 437654 may have more copies of

cytochrome P450 than Forrest and Williams 82 which results in a higher degree of

resistance.

In addition to a high representation of cytochrome P450 genes, there were

several upregulated genes with annotations of a VQ motif (Table 3.2, Figure 3.6). VQ

(Valine-glutamine) motif containing proteins are reported to be a highly conserved

gene family and are differentially expressed in response to biotic and abiotic stress

in plants (Jiang et al. 2018). Chitinase and chitin recognition proteins were also

found upregulated in the resistant genotypes at significant levels and are known

defense genes for nematodes, fungi, or insects, which are composed of chitin (Table

76

3.2 and 3.3) (Sánchez-Vallet et al. 2015). Three genes had an annotation of cupin.

Cupin proteins are highly conserved genes across multiple kingdoms of life with

highly variable function. One possible function of cupins in this study is the

protection of oxidative stress observed in plants (Khuri et al. 2001). GO term

enrichment studies supported the Pfam annotations showing a high number of

transcripts related to oxidative and reductase activity in addition to chitin

recognition and several secondary metabolite synthesis pathways. These results

indicate a clear pathogen recognition in the host plant root tissue.

Several genes with patterns of differential expression in response to

inoculation with reniform nematode did not have a known annotation. Two such

genes had distinctly higher expression levels in both inoculated resistant lines.

Glyma.13G267300 had a higher log2fold change in all 3 inoculated genotypes

compared to the controls. Glyma.01G179600 had similar high expression in

inoculated Williams 82 and PI 437654 (Figure 3.4). Although their annotation is

currently unknown, this study may reveal their role in pathogen detection

pathways. These genes could also be candidates for gene-editing or gene-knockout

trials to determine their molecular function and role in pathogen detection.

The major mechanism of reniform nematode resistance in Forrest (and likely

PI) is not initiated until the parasitic nematode has invaded the host. Since our study

is looking at the first 24 hours after exposure to the nematode, we are only

capturing the plant’s initial detection of the parasite. If the main mechanism of

resistance is not deployed until the nematode begins to establish a feeding site, a

77

subsequent study is necessary to observe gene expression at this time frame

(Bakker et al. 2006).

CONCLUSION

Several studies have identified the early detection of pathogens in the soil,

prior to infection, yet none have examined this occurrence in reniform nematode

and soybean. There is clear evidence that the presence of parasitic nematodes near

the host plant root tissue causes a change in gene expression, likely a result of

pathogen detection and initiation of a defense response. At least six different genes

that were differentially expressed in the reniform nematode-inoculated samples had

an annotation of a cytochrome P450 which is a known plant stress response. Other

likely defense genes were up and downregulated 24 hours after exposure to the

pathogen. Genes such as Glyma.10G116000 or Glyma10G115500 specific to PI

437654 and Glyma.14G022700 or Glyma.13G159700 specific to Forrest may show

different mechanisms of resistance in each of these resistant genotypes. Any of these

differentially expressed genes would be possible leads for gene editing to target a

resistance gene and further the development and understanding of different

pathogen recognition and resistance mechanisms to parasitic nematodes.

REFERENCES

Agudelo, P., Robbins, R.T., Kim, K.S., and Stewart, J.McD. 2005. Histological changes in Gossypium hirsutum associated with reduced reproduction of Rotylenchulus reniformis. J. Nematol. 37, 185–189. Allen, T.W., Bradley, C.A., Damicone, J.P., Dufault, N.S., Faske, T.R., Hollier, C.A., Isakeit, T., Kemerait, R.C., Kleczewski, N.M., Kratochvil, R.J., et al. 2017. Southern

78

United States soybean disease loss estimates for 2016. Proc. South. Soybean Dis. Work. Pensacola Beach 3–8. Allen, T.W., Bissonnette, K., Bradley, C.A., Damicone, J.P., Dufault, N.S., Faske, T.R., Isakeit, T., Kemerait, R.C., Koehler, A., Mehl, H.L., et al. 2018. Southern United States soybean disease loss estimates for 2018. Proc. 46th Annu. Meet. South. Soybean Dis. Work. Pensacola FL. Anand, S.C., Gallo, K.M., Baker, I.A., and Hartwig, E.E. 1988. Soybean plant introductions with resistance to races 4 or 5 of soybean cyst nematode. Crop Sci. 28, 563–564. Atamian, H.S., Roberts, P.A., and Kaloshian, I. 2012. High and low throughput screens with root-knot nematodes Meloidogyne spp. J. Vis. Exp. Bolger, A.M., Lohse, M., and Usadel, B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120. Faske, T.R. 2013. Penetration, Post-penetration Development, and Reproduction of Meloidogyne incognita on Cucumis melo var. texanus. J. Nematol. 45, 58–65. Grant, D., Nelson, R.T., Cannon, S.B., and Shoemaker, R.C. 2010. SoyBase, the USDA-ARS soybean genetics and genomics database. Nucleic Acids Res. 38, D843–D846. Heald, C.M., and Robinson, A.F. 1990. Survey of current distribution of Rotylenchulus reniformis in the United States. J. Nematol. 22, 695–699. Jiang, S-Y, Sevugan, M., and Ramachandran, S. 2018. Valine-glutamine (VQ) motif coding genes are ancient and non-plant-specific with comprehensive expression regulation by various biotic and abiotic stresses. BMC Genomics 19, 342. Jones, P., Binns, D., Chang, H.-Y., Fraser, M., Li, W., McAnulla, C., McWilliam, H., Maslen, J., Mitchell, A., Nuka, G., et al. 2014. InterProScan 5: genome-scale protein function classification. Bioinformatics 30, 1236–1240. Khuri, S., Bakker, F.T., and Dunwell, J.M. 2001. Phylogeny, Function, and Evolution of the Cupins, a Structurally Conserved, Functionally Diverse Superfamily of Proteins. Mol. Biol. Evol. 18, 593–605. Lee, J.-D., Kim, H.J., Robbins, R.T., Wrather, J.A., Bond, J., Nguyen, H.T., and Shannon, J.G. 2015. Reaction of soybean cyst nematode resistant plant introductions to root-knot and reniform nematodes. Plant Breed. Biotechnol. 3, 346–354.

79

Li, B., and Dewey, C.N. 2011. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323. Lim, B.K., and Castillo, M.B. 1978. Interactions of Meloidogyne incognita and Rotylenchulus reniformis with selected soybean varieties. Kalikasan Philipp. J. Biol. 7, 165–176. Liu, W., Tang, X., Qi, X., Fu, X., Ghimire, S., Ma, R., Li, S., Zhang, N., and Si, H. 2020. The ubiquitin conjugating enzyme: an important ubiquitin transfer platform in ubiquitin-proteasome system. Int. J. Mol. Sci. 21. Manohar, M., Tenjo-Castano, F., Chen, S., Zhang, Y.K., Kumari, A., Williamson, V.M., Wang, X., Klessig, D.F., and Schroeder, F.C. 2020. Plant metabolism of nematode pheromones mediates plant-nematode interactions. Nat. Commun. 11, 1–11. Manosalva, P., Manohar, M., Heinrich von Reuss, S., Chen, S., Koch, A., Kaplan, F., Choe, A., Micikas, R.J., Wang, X., Kogel, K., et al. 2015. Conserved nematode signaling molecules elicit plant defenses and pathogen resistance. Nat. Commun. 6, 7795. Mendy, B., Wang’ombe, M.W., Radakovic, Z.S., Holbein, J., Ilyas, M., Chopra, D., Holton, N., Zipfel, C., Grundler, F.M.W., and Siddique, S. 2017. Arabidopsis leucine-rich repeat receptor–like kinase NILR1 is required for induction of innate immunity to parasitic nematodes. PLOS Pathog. 13, e1006284. Mitchum, M.G., Hussey, R.S., Baum, T.J., Wang, X., Elling, A.A., Wubben, M., and Davis, E.L. 2013. Nematode effector proteins: an emerging paradigm of parasitism. New Phytol. 199, 879–894. Robbins, R.T., and Rakes, L. 1996. Resistance to the reniform nematode in selected soybean cultivars and germplasm lines. J. Nematol. 28, 612–615. Robbins, R.T., Rakes, L., Jackson, L.E., and Dombek, D.G. 1999. Reniform nematode resistance in selected soybean cultivars. J. Nematol. 31, 667–677. Robbins, R.T., Rakes, L., Jackson, L.E., Gbur, E.E., and Dombek, D.G. 2001. Host suitability in soybean cultivars for the reniform nematode, 2000 tests. J. Nematol. 33, 314–317. Robbins, R.T., Shipe, E.R., Rakes, L., Jackson, L.E., Gbur, E.E., and Dombek, D.G. 2002. Host suitability of soybean cultivars and breeding lines to reniform nematode in tests conducted in 2001. J. Nematol. 34, 378–383. Robbins, R.T., Arelli, P., Chen, P., Shannon, G., Kantartzi, S., Fallen, B., Li, Z., Faske, T., Velie, J., Gbur, E., et al. 2017. Reniform nematode reproduction on soybean cultivars

80

and breeding lines in 2016. Proc 2016 Beltwide Cotton Conf. January 4-6 2017 Dallas TX USA 184–214. Robinson, A.F. 2007. Reniform in U.S. cotton: when, where, why, and some remedies. Annu. Rev. Phytopathol. 45, 263–288. Robinson, A.F., Inserra, R.N., Caswell-Chen, E.P., Vovlas, N., and Troccoli, A. 1997. Review: Rotylenchulus species: identification, distribution, host ranges, and crop plant resistance. Nematropica 27, 127–180. Robinson, M.D., McCarthy, D.J., and Smyth, G.K. 2010. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinforma. Oxf. Engl. 26, 139–140. Sánchez-Vallet, A., Mesters, J.R., and Thomma, B.P.H.J. 2015. The battle for chitin recognition in plant-microbe interactions. FEMS Microbiol. Rev. 39, 171–183. Sauer, D.B., and Burroughs, R. 1986. Disinfection of seed surfaces with sodium hypochlorite. Phytopathology 76, 745–749. Schlueter, J.A., Lin, J.-Y., Schlueter, S.D., Vasylenko-Sanders, I.F., Deshpande, S., Yi, J., O’Bleness, M., Roe, B.A., Nelson, R.T., Scheffler, B.E., et al. 2007. Gene duplication and paleopolyploidy in soybean and the implications for whole genome sequencing. BMC Genomics 8, 330. Schmutz, J., Cannon, S.B., Schlueter, J., Ma, J., Mitros, T., Nelson, W., Hyten, D.L., Song, Q., Thelen, J.J., Cheng, J., et al. 2010. Genome sequence of the palaeopolyploid soybean. Nature 463, 178–183. Stetina, S.R. 2015. Postinfection development of Rotylenchulus reniformis on resistant Gossypium barbadense accessions. J. Nematol. 47, 302–309. Xu, J., Wang, X., and Guo, W. 2015. The cytochrome P450 superfamily: key players in plant development and defense. J. Integr. Agric. 14, 1673–1686. Young, M.D., Wakefield, M.J., Smyth, G.K., and Oshlack, A. 2010. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol. 11, R14.

81

A) B)

Figure 3.1. A principal component analysis (PCA) using a random subset of 500 raw transcript counts from of reniform nematode-inoculated and control soybean genotypes all three replicates (A) and reduced replicates (B)

Control Inoculated

Williams 82 Williams 82

Forrest Forrest

PI 437654 PI 437654

82

2

28

15

2

66

53

0

10

20

30

40

50

60

70

Williams82 Forrest PI437654

Nu

mb

er o

f ge

nes

Downregulated Upregulated

A) B)

Figure 3.2. Number of differentially expressed (DE) genes in each observed soybean genotype in response to reniform nematode. A) A Venn diagram shows 4 unique genes DE in reniform nematode-susceptible soybean genotype Williams 82 with no overlap in the other genotypes. There are 10 DE genes shared in the two reniform nematode-resistant soybean genotypes after 24 exposure to the nematode pathogen. B) Of the DE genes from the treated genotypes, more over 70% were down-regulated in the two resistant genotypes and an equal amount were down-regulated/up-regulated in the susceptible genotype.

83

Table 3.1. GO annotations for 10 differentially expressed genes shared in reniform nematode-resistant soybean lines Forrest and PI 437654, 24 hours after nematode inoculation

Gene ID logFC (F)

1 logFC(PI)

2 Gmax browser GO annotation Pfam annotation e-value

Glyma.02G156100 -1.77 -2.29

LRR receptor-like serine/threonine-

protein kinase RFK1-related

oxidoreductase activity, acting on paired donors,

with incorporation or reduction of molecular

oxygen Cytochrome P450

7.1E-111

Glyma.09G048700 -1.3 -1.41 PTHR24298/ (Family

not named) iron ion binding Cytochrome P450 6.70E-92

Glyma.10G114600 -2.12 -3.2 Replication factor a 1,

rfa1 heme binding Cytochrome P450 2E-107

Glyma.02G156000 -1.62 -2.65

Premnaspirodiene oxygenase /

Hyoscymus muticus premnaspirodiene

oxygenase oxidation-reduction

process Cytochrome P450

8.00E-111

Glyma.01G179600 -1.43 -1.82

Premnaspirodiene oxygenase /

Hyoscymus muticus premnaspirodiene

oxygenase

oxidoreductase activity, acting on paired donors,

with incorporation or reduction of molecular

oxygen Cytochrome P450

1.00E-100

Glyma.17G030100 -1 -1.68

Pathogenesis-related protein Bet v I family

(Bet_v_1) defense response

Pathogenesis-related protein Bet

v 1 family

2.5E-24

Glyma.02G125300 -3.62 -2.81 -3 - - -

Glyma.10G161500 -3.04 -2.88 - - - -

Glyma.15G230000 -1.72 -2.66 - - - -

Glyma.13G267300 -2.21 -2.49 - - - -

1. Log2(fold change) for Forrest control by Forrest inoculated 2. Log2(fold change) for PI 437654 control by PI 437654 inoculated 3. No annotation was available for four of the ten genes searched

http://amigo.geneontology.org/cgi-bin/amigo/term_details?term=PTHR24298//PTHR24298:SF61

http://amigo.geneontology.org/cgi-bin/amigo/term_details?term=PTHR24298//PTHR24298:SF61

84

Table 3.2. Genes uniquely upregulated in reniform nematode-resistant soybean Forrest and PI 437654 24 hours after inoculation with reniform nematode

Gene ID Pfam annotation e-value KEGG annotation

Forrest

Glyma.01G134600 UbiA prenyltransferase family 6.60E-34 homogentisate phytyltransferase

Glyma.02G112400 Eukaryotic elongation factor 5A hypusine, DNA-binding OB fold 9.70E-28 translation initiation factor 5A

Glyma.02G128100 S-adenosyl-l-methionine decarboxylase leader peptide 2.60E-32 -

Glyma.03G135800 HSF-type DNA-binding 4.50E-31 heat shock transcription factor, other eukaryote

Glyma.03G143700 Cytochrome P450 8.00E-101 cytochrome P450 family 93 subfamily A

Glyma.03G207400 S locus-related glycoprotein 1 binding pollen coat protein (SLR1-BP) 4.00E-05 -

Glyma.04G137600 Response regulator receiver domain 4.20E-19 two-component response regulator ARR-A family

Glyma.05G022100 Cytochrome P450 1.80E-104 flavonoid 3'-monooxygenase

Glyma.05G234600 Myb-like DNA-binding domain 6.10E-14 transcription factor MYB, plant

Glyma.06G102300 UDP-glucoronosyl and UDP-glucosyl transferase 1.60E-32 -

Glyma.07G254600 UDP-glucoronosyl and UDP-glucosyl transferase 3.40E-24 scopoletin glucosyltransferase

Glyma.08G087400 VQ motif 5.80E-09 -

Glyma.08G124500 Uncharacterized conserved protein 2.00E-17 KxDL motif-containing protein 1

Glyma.08G159900 ATP citrate lyase citrate-binding 1.10E-81 ATP citrate (pro-S)-lyase

Glyma.08G189600 Lipoxygenase 0 linoleate 9S-lipoxygenase

Glyma.08G301600 Domain of unknown function (DUF4228) 1.10E-28 -

Glyma.08G202700 - - cytochrome c oxidase assembly protein subunit 19


Glyma.09G138100 AMP-binding enzyme C-terminal domain 3.10E-19 oxalate---CoA ligase

Glyma.10G019900 Glutathione S-transferase, C-terminal domain 7.80E-16 glutathione S-transferase



Glyma.10G117600 HAD superfamily, subfamily IIIB (Acid phosphatase) 6.20E-21 -

Glyma.10G225900 - - vacuolar iron transporter family protein

Glyma.11G051800 Cytochrome P450 1.80E-92 isoflavone/4'-methoxyisoflavone 2'-hydroxylase

Glyma.11G150400 Dirigent-like protein 1.90E-48 -

Glyma.12G087200 Cytochrome P450 2.70E-59 fatty acid hydroxylase

Glyma.13G113100 Flavin-binding monooxygenase-like 3.60E-37 dimethylaniline monooxygenase (N-oxide forming)

Glyma.13G196500 NADPH-dependent FMN reductase 3.00E-34 chromate reductase, NAD(P)H dehydrogenase

Glyma.13G285300 Cytochrome P450 3.40E-91 -

Glyma.13G346700 Chitin recognition protein 2.00E-06 chitinase

Glyma.15G134300 FAD binding domain 9.50E-25 -


85

Glyma.16G195600 Cytochrome P450 9.40E-107

Glyma.16G219500 Aldo/keto reductase family 9.50E-51 3''-deamino-3''-oxonicotianamine reductase

Glyma.17G138500 Glycosyl hydrolases family 32 N-terminal domain 4.50E-110 beta-fructofuranosidase

Glyma.17G227000 Domain of unknown function (DUF3511) 1.30E-25 -

Glyma.18G106300 GDP-mannose 4,6 dehydratase 1.70E-66 UDP-glucose 4,6-dehydratase

Glyma.20G022500 - - solute carrier family 39 (zinc transporter)


PI 437654

Glyma.01G128100 WRKY DNA -binding domain 3.20E-24 WRKY transcription factor 33

Glyma.01G224800 WRKY DNA -binding domain 3.90E-25 -

Glyma.02G202200 - - SAUR family protein

Glyma.03G157800 EF-hand domain pair 1.70E-17 calmodulin


Glyma.04G053400 ERAP1-like C-terminal domain 1.30E-10 -

Glyma.04G223300 WRKY DNA -binding domain 1.10E-24 -


Glyma.05G124800 Berberine and berberine like 6.90E-21 -

Glyma.05G124800 FAD binding domain 1.80E-26 -

Glyma.05G147000 O-methyltransferase 7.20E-82 caffeoyl-CoA O-methyltransferase

Glyma.07G039700 Protein tyrosine and serine/threonine kinase 5.50E-48 -

Glyma.07G236500 Polysaccharide biosynthesis 1.90E-16 glucuronoxylan 4-O-methyltransferase

Glyma.08G277000 Transketolase, C-terminal domain 5.70E-31 1-deoxy-D-xylulose-5-phosphate synthase



Glyma.11G021500 Aminotransferase class I and II 1.80E-105 1-aminocyclopropane-1-carboxylate synthase

Glyma.11G036400 AP2 domain 5.60E-16 EREBP-like factor

Glyma.11G070600 NmrA-like family 3.00E-88 phenylcoumaran benzylic ether reductase

Glyma.13G123000 AP2 domain 9.90E-15 -

Glyma.13G346700 - - chitinase

Glyma.15G170500 Helix-loop-helix DNA-binding domain 6.60E-10 -

Glyma.15G214700 MYND finger 1.30E-06 -

Glyma.15G224100 SAWADEE domain 1.10E-10 -

Glyma.15G257700 No apical meristem (NAM) protein 4.00E-34 -

Glyma.16G008500 Protein tyrosine and serine/threonine kinase 6.90E-48 -

Glyma.16G060700 Cupin 5.60E-49 -

Glyma.16G060800 Cupin 1.80E-47 -

Glyma.16G219500 - - 3''-deamino-3''-oxonicotianamine reductase

Glyma.17G138500 - - beta-fructofuranosidase

Glyma.18G046300 Salt stress response/antifungal 2.30E-13 UDP-glucose 4,6-dehydratase

Glyma.18G249100 PRA1 family protein 2.10E-14 -

86

Glyma.19G059100 Cupin 1.50E-47 -


Glyma.20G036500 ZF-HD protein dimerisation region 3.80E-30 -

Glyma.20G022500 - - solute carrier family 39 (zinc transporter)

Glyma.20G245100 - - homogentisate phytyltransferase

87

Table 3.3. GO term enrichment for 56 and 43 upregulated genes in Forrest and PI 437654, respectively, 24 hours after inoculation with reniform nematode category p-value GO term descriptor ontology

Forrest

GO:0016705 1.55E-06 oxidoreductase activity, acting on paired donors MF

GO:0005506 4.5E-06 iron ion binding MF

GO:0020037 1.8E-05 heme binding MF

GO:0008194 1.9E-05 UDP-glycosyltransferase activity MF

GO:0016765 3.7E-05 transferase activity, transferring alkyl or aryl (other than methyl) groups MF

GO:0055114 4.1E-05 oxidation-reduction process BP

GO:0004564 0.005 beta-fructofuranosidase activity MF

GO:0004575 0.005 sucrose alpha-glucosidase activity MF

GO:0009695 0.005 jasmonic acid biosynthetic process BP

GO:0046423 0.005 allene-oxide cyclase activity MF

GO:0008460 0.006 dTDP-glucose 4,6-dehydratase activity MF

GO:0009225 0.006 nucleotide-sugar metabolic process BP

GO:0050660 0.009 flavin adenine dinucleotide binding MF

GO:0008061 0.01 chitin binding MF

GO:0004568 0.01 chitinase activity MF

GO:0006032 0.01 chitin catabolic process BP

GO:0016998 0.01 cell wall macromolecule catabolic process BP

GO:0045905 0.01 positive regulation of translational termination BP

GO:0045901 0.01 positive regulation of translational elongation BP

GO:0016491 0.01 oxidoreductase activity MF

GO:0004499 0.02 N,N-dimethylaniline monooxygenase activity MF

GO:0043022 0.03 ribosome binding MF

GO:0003746 0.04 translation elongation factor activity MF

PI 437654

GO:0030145 2.08E-07 manganese ion binding MF

GO:0045735 5.10E-07 nutrient reservoir activity MF

GO:0006355 8.82E-04 regulation of transcription, DNA-templated BP

GO:0003700 1.92E-03 DNA-binding transcription factor activity MF

GO:0043565 5.29E-03 sequence-specific DNA binding MF

GO:0008661 0.01 1-deoxy-D-xylulose-5-phosphate synthase activity MF

GO:0016114 0.01 terpenoid biosynthetic process BP

GO:0005819 0.01 spindle CC

GO:0032147 0.01 activation of protein kinase activity BP

GO:0060236 0.01 regulation of mitotic spindle organization BP

GO:0016705 0.03 oxidoreductase activity, acting on paired donors MF

GO:0005506 0.04 iron ion binding MF

88

GO:0005874 0.04 microtubule CC

GO:0003682 0.04 chromatin binding MF

89

Figure 3.3. Gene expression profile clustering of differentially expressed transcripts in reniform nematode-susceptible genotype, Williams 82, and two resistant genotypes, Forrest and PI 437654, 24 hours after inoculation. K-means was set to 7.

90

Figure 3.4. Ten differentially expressed soybean genes shared in reniform nematode resistant soybean lines (Forrest and PI 437654) 24 hours after inoculation

91

Figure 3.5. Six differentially expressed genes in reniform nematode-inoculated resistant soybean, Forrest, 24 hours after inoculation

92

Figure 3.6. Ten differentially expressed genes in reniform nematode-resistant soybean genotype, PI 437654, 24 hours after inoculation. Where applicable, gene annotations were assigned using the Pfam database

93

Figure 3.7. Annotation of differentially expressed genes in reniform nematode-resistant soybean lines Forrest and PI 437654 24 hours after inoculation. Annotation categories of each gene sequence provided by BlastKOALA (KEGG). A) 54 differentially expressed genes in Forrest and B) 43 differentially expressed genes in PI 437654. A)

B)

Carbohydrate metabolism

19%Protein families:

genetic information processes

15%

Biosynthesis of other secondary

metabolites11%

Metabolism of cofactors and

vitamins11%

Protein families: signaling and

cellular processes7%

Unclassified: metabolism

7%

Protein families: metabolism

7%

Lipid metabolism7%

Organismal Systems4%

Environmental information processing

4%

Xenobiotics biodegradation and

metabolism4%

Metabolism of other AA

4%

Environmental information processing

30%

Unclassified: metabolism

20%

Metabolism of cofactors and

vitamins10%

Amino acid metabolism

10%

Protein families: signaling and

cellular processes10%

Protein families: genetic

information processes

10%

Biosynthesis of other secondary

metabolites10%

94

Appendix 1.1. Gel image of normalized soybean DNA samples. Lanes 1-6 is 50ng of undigested DNA and lanes 7-12 are 100ng of individual DNA samples digested with PstI and MseI for 3 hours. Fragment sizes for digested DNA ranged from 200-1000 bp.

1 2 3 4 5 6 7 8 9 10 11 12

95

Appendix 1.2. List of gene candidates within QTLs rrn-1, rrn-2, and rrn-3, associated with reniform nematode resistance in soybean

Genes

Williams 82

annotation

(Wm82.v1.a2) pfam ncbi_CD BLAST_KOALA BLASTp TAIR, Arabidopsis Ortholog

rrn-1

Glyma.18G004200

MAC/Perforin domain-

containing protein MAC/Perforin domain

MACPF

superfamily -

MACPF domain-containing

protein At1g14780 [Arabidopsis

thaliana]

MAC/Perforin domain-

containing protein

Glyma.18G006800

DNA-binding HORMA

family protein HORMA domain HORMA -

HORMA domain-containing

protein 1 [Xenopus laevis]

DNA-binding HORMA family

protein

Glyma.18G007700

Minichromosome

maintenance

(MCM2/3/5) family

protein

RsgA GTPase YjeQ_EngC

rsgA; ribosome

biogenesis GTPase /

thiamine phosphate

phosphatase

Putative ribosome biogenesis

GTPase RsgA [Anabaena

variabilis ATCC 29413]

Minichromosome maintenance

(MCM2/3/5) family protein

Glyma.18G007300

Nuclear pore complex

protein HORMA

NUP214;

nuclear pore

complex protein

Nup214

NUP214; nuclear pore

complex protein

Nup214

Protein LONO1 [Arabidopsis

thaliana] Nuclear pore complex protein

Glyma.18G010600

TPX2 (targeting protein

for Xklp2) protein family TPX2 - -

Plant self-incompatibility

protein S1 family

Glyma.18G013200

mitogen-activated

protein kinase

phosphatase 1

Dual specificity

phosphatase,

catalytic domain

GEL - AtMKP1 [Arabidopsis thaliana] mitogen-activated protein

kinase phosphatase 1

Glyma.18G016400

leucine-rich repeat

transmembrane protein

kinase family protein

Leucine rich repeat N-

terminal domain;

Protein kinase

domain

LRRNT_2 -

Probable LRR receptor-like

serine/threonine-protein kinase

At5g10290; Flags: Precursor

[Arabidopsis thaliana]

leucine-rich repeat

transmembrane protein kinase

family protein

Glyma.18G017700 - - PRK05901 - Cupredoxin superfamily

protein

Glyma.18G019000

slufate transporter 2;1 Sulfate permease

family; STAS domain sulP

SULTR2; sulfate

transporter 2, low-

affinity

AST68 [Arabidopsis thaliana] sulfate transporter 2;1

96

Glyma.18G023200

Protein of unknown

function (DUF399 and

DUF3411)

Haem-binding

uptake, Tiki

superfamily, ChaN;

Protein RETICULATA-

related

Cofac_haem_bd

g

protein RETICULATA-RELATED 5,

chloroplastic

Protein of unknown function

(DUF399 and DUF3411)

Glyma.18G026600

Double Clp-N motif-

containing P-loop

nucleoside triphosphate

hydrolases superfamily

protein

chaperone_ClpB - -

Double Clp-N motif-containing

P-loop nucleoside triphosphate

hydrolases superfamily protein

-

Glyma.18G026800 CRINKLY4 related 3

Protein tyrosine

kinase

PKc_like

superfamily -

AtCRR3; Flags: Precursor

[Arabidopsis thaliana] CRINKLY4 related 3

Glyma.18G027900

cation/hydrogen

exchanger 15 PLN03159 - - AtCHX15 [Arabidopsis thaliana] cation/hydrogen exchanger 15

Glyma.18G028300

Cytochrome P450

superfamily protein Cytochrome P450 CypX

CYP90A1; cytochrome

P450 family 90

subfamily A

polypeptide 1

[EC:1.14.-.-]

Cytochrome P450 90A1


Cytochrome P450 superfamily

protein

Glyma.18G036400

rubisco activase

ATPase family

associated with

various cellular

activities (AAA)

AAA -

RuBisCO activase; Flags:

Precursor [Vigna radiata var.

radiata]

rubisco activase

Glyma.18G034900

Nucleotidyltransferase

family protein

Nucleotidyltransferas

e domain TRF4 -

mtPAP; Flags: Precursor [Homo

sapiens]

Nucleotidyltransferase family

protein

Glyma.18G036600

hAT transposon

superfamily

BED zinc finger; hAT

family C-terminal

dimerisation region

Dimer_Tnp_hAT - hAT transposon superfamily

--

Glyma.18G036300

purine biosynthesis 4

AIR synthase related

protein, C-terminal

domain

PLN03206

PFAS;

phosphoribosylformylgl

ycinamidine synthase

[EC:6.3.5.3]

Formylglycinamide ribotide

amidotransferase; Flags:

Precursor [Arabidopsis thaliana]

purine biosynthesis 4

Glyma.18G039000

DegP protease 7

PDZ-like domain;

Trypsin-like peptidase

domain

DegQ

NMA111; pro-

apoptotic serine

protease NMA111

[EC:3.4.21.-]

Protease Do-like 7 [Arabidopsis

thaliana] DegP protease 7

97

Glyma.18G039100

ARM repeat superfamily

protein

Armadillo/beta-

catenin-like repeat PLN03200 -

Plant U-box protein 4



protein

Glyma.18G039800

5\'-AMP-activated

protein kinase-related

Glycogen recognition

site of AMP-activated

protein kinase

E_set_AMPKbet

a_like_N - -

5'-AMP-activated protein

kinase-related

Glyma.18G040700 myb domain protein 43

Myb-like DNA-binding

domain SANT

MYBP; transcription

factor MYB, plant

MYB-like protein ODO1 [Petunia

x hybrida] myb domain protein 20

Glyma.18G041000


protein - SANT - - -

rrn-2

Glyma.18G241400

-

Uncharacterized

protein family

UPF0016

Gdt1 - GDT1-like protein 3; Flags:

Precursor [Arabidopsis thaliana] Uncharacterized protein family (UPF0016)

Glyma.18G242100

-

Putative adipose-

regulatory protein

(Seipin)

Seipin BSCL2; seipin - Putative adipose-regulatory protein (Seipin)

Glyma.18G243500 -

Biotin-requiring

enzyme PLN02983

accB; acetyl-CoA carboxylase biotin carboxyl carrier protein

BCCP; Flags: Precursor [Glycine

max] fatty acid metabolism

chloroplastic acetylcoenzyme A carboxylase 1

Glyma.18G245900

- Phosphopantetheine

attachment site PP-binding

NDUFAB1; NADH dehydrogenase (ubiquinone) 1 alpha/beta subcomplex 1, acyl-carrier protein

NADH-ubiquinone

oxidoreductase 9.6 kDa subunit;

Flags: Precursor [Arabidopsis

thaliana]

mitochondrial acyl carrier protein 1

Glyma.18G254300

Leucine-rich repeat

receptor-like protein

kinase family protein

Leucine rich repeat LRR_RI

superfamily

probable leucine-rich repeat receptor-like protein kinase At1g35710

Probable LRR receptor-like

serine/threonine-protein kinase

At4g08850; Flags: Precursor


Leucine-rich repeat receptor-like protein kinase family protein

Glyma.18G255000

-

Histidine

phosphatase

superfamily (branch

2)

His_Phos_2

PPIP5K; inositol-hexakisphosphate/diphosphoinositol-pentakisphosphate 1-kinase [EC:2.7.4.24]

InsP6 and PP-IP5 kinase 1 [Bos

taurus] Phosphoglycerate mutase-like family protein

Glyma.18G254600 - Leucine rich repeat

LRR_RI

superfamily - -

Leucine-rich repeat receptor-like protein kinase family protein

rrn-3

98

Glyma.11G228400 - - PHA03247 - - Clathrin light chain protein

Glyma.11G230000

Phosphoinositide-specific

phospholipase C family

protein

Phosphatidylinositol-

specific

phospholipase C, Y

domain

C2_PLC_like

PLCD; phosphatidylinositol phospholipase C, delta [EC:3.1.4.11]

PI-PLC6 [Arabidopsis thaliana] Phosphoinositide-specific phospholipase C family protein

Glyma.11G234700


protein PLN03200

ARM repeat

superfamily

protein

- - ARM repeat superfamily protein

Glyma.11G232900

P-loop containing

nucleoside triphosphate

hydrolases superfamily

protein

Helicase conserved C-

terminal domain;

Domain of unknown

function (DUF4217);

DEAD/DEAH box

helicase

SrmB

DDX55; ATP-dependent RNA helicase DDX55/SPB4 [EC:3.6.4.13]

DEAD-box ATP-dependent RNA

helicase 18 [Arabidopsis

thaliana]

P-loop containing nucleoside triphosphate hydrolases superfamily protein

99

Appendix 1.3. Comparison of the SNP positions in linkage groups to the Wm82.a2.v1 (Schmutz et al., 2010). The genetic reference map is located on the right or in the center of the corresponding linkage maps. Blue lines connect homologous markers.

Chr1_1Chr1_4Chr1_5Chr1_6Chr1_8Chr1_23Chr1_27Chr1_33Chr1_37Chr1_38Chr1_39Chr1_45Chr1_46Chr1_48Chr1_53Chr1_62Chr1_64Chr1_67Chr1_69Chr1_77Chr1_81 Chr1_82

Chr1_83

Chr1_90Chr1_92Chr1_91Chr1_94Chr1_100Chr1_109Chr1_111Chr1_112

Chr1_117Chr1_132 Chr1_135Chr1_141Chr1_147Chr1_150Chr1_154Chr1_155 Chr1_156Chr1_173Chr1_183Chr1_184Chr1_185 Chr1_186Chr1_192Chr1_193Chr1_200Chr1_203Chr1_202

Chr1_204

Chr1_206

Chr1_212

Chr1_215Chr1_216

Chr1_218


Chr1_234

Chr1_236Chr1_246

Chr1_251

Chr1_253

Chr1_254Chr1_257

LG13

Chr1_1 Chr1_4Chr1_5 Chr1_6Chr1_8Chr1_23Chr1_27Chr1_33 Chr1_37Chr1_38 Chr1_39Chr1_45Chr1_46 Chr1_48Chr1_53Chr1_62Chr1_64 Chr1_67Chr1_69Chr1_77Chr1_81 Chr1_82Chr1_83Chr1_90Chr1_91Chr1_92Chr1_94Chr1_100Chr1_109Chr1_111 Chr1_112Chr1_117

Chr1_132Chr1_135Chr1_141Chr1_147Chr1_150Chr1_154Chr1_155Chr1_156Chr1_173 Chr1_183Chr1_184Chr1_185Chr1_186Chr1_192Chr1_193Chr1_200Chr1_202 Chr1_203Chr1_204Chr1_206Chr1_212Chr1_215Chr1_216 Chr1_218Chr1_219Chr1_220Chr1_221 Chr1_222Chr1_224 Chr1_226Chr1_229Chr1_234Chr1_236Chr1_246Chr1_251Chr1_253Chr1_254Chr1_257Chr1_261

chrom_1

Chr2_1Chr2_12Chr2_6 Chr2_8

Chr2_21Chr2_19Chr2_24Chr2_23Chr2_29 Chr2_30Chr2_33Chr2_42Chr2_44Chr2_45Chr2_46 Chr2_47Chr2_52Chr2_50 Chr2_48Chr2_54Chr2_56Chr2_58 Chr2_59Chr2_63Chr2_62Chr2_60 Chr2_61Chr2_64Chr2_68Chr2_71 Chr2_69Chr2_72Chr2_79Chr2_82 Chr2_84Chr2_86 Chr2_87Chr2_89Chr2_94Chr2_106Chr2_104Chr2_103Chr2_108Chr2_112Chr2_138Chr2_137Chr2_133Chr2_132Chr2_128Chr2_121Chr2_126Chr2_118Chr2_136Chr2_142Chr2_143Chr2_145Chr2_146Chr2_147Chr2_148Chr2_150Chr2_153Chr2_154Chr2_190Chr2_189 Chr2_165Chr2_178Chr2_173Chr2_161Chr2_191Chr2_194Chr2_195Chr2_200Chr2_201Chr2_203Chr2_206Chr2_212Chr2_214Chr2_215Chr2_217Chr2_219 Chr2_223Chr2_232Chr2_235Chr2_241Chr2_249Chr2_255Chr2_270Chr2_271Chr2_272Chr2_277Chr2_276Chr2_285Chr2_283Chr2_282Chr2_286Chr2_291 Chr2_293Chr2_289 Chr2_287Chr2_298Chr2_299Chr2_300Chr2_301Chr2_302Chr2_304 Chr2_306Chr2_309Chr2_317Chr2_322 Chr2_324Chr2_323Chr2_326Chr2_321Chr2_329Chr2_330 Chr2_333Chr2_342 Chr2_337Chr2_339Chr2_340Chr2_336Chr2_335Chr2_344Chr2_352Chr2_350Chr2_351 Chr2_355Chr2_361Chr2_362Chr2_356Chr2_363Chr2_364Chr2_365Chr2_381 Chr2_372Chr2_366Chr2_369Chr2_375Chr2_380Chr2_368Chr2_386 Chr2_376Chr2_378Chr2_382Chr2_388Chr2_387 Chr2_389Chr2_374Chr2_384

LG5

Chr2_1Chr2_6Chr2_8 Chr2_12Chr2_19 Chr2_21Chr2_23 Chr2_24Chr2_29 Chr2_30Chr2_33Chr2_42 Chr2_44Chr2_45 Chr2_46Chr2_47Chr2_48 Chr2_50Chr2_52Chr2_54Chr2_56Chr2_58 Chr2_59Chr2_60 Chr2_61Chr2_62 Chr2_63Chr2_64Chr2_68Chr2_69 Chr2_71Chr2_72Chr2_79Chr2_82 Chr2_84Chr2_86 Chr2_87Chr2_89Chr2_94Chr2_103 Chr2_104Chr2_106Chr2_108Chr2_112Chr2_118Chr2_121Chr2_126 Chr2_128Chr2_132Chr2_133Chr2_136Chr2_137 Chr2_138Chr2_142Chr2_143Chr2_145 Chr2_146Chr2_147Chr2_148Chr2_150Chr2_153Chr2_154Chr2_161Chr2_165Chr2_173Chr2_178Chr2_189Chr2_190Chr2_191Chr2_194Chr2_195Chr2_200 Chr2_201Chr2_203Chr2_206 Chr2_212Chr2_214 Chr2_215Chr2_217Chr2_219Chr2_223 Chr2_232Chr2_235Chr2_241 Chr2_249Chr2_255Chr2_270Chr2_271 Chr2_272Chr2_276Chr2_277Chr2_282Chr2_283 Chr2_285Chr2_286Chr2_287 Chr2_289Chr2_291Chr2_293Chr2_298 Chr2_299Chr2_300Chr2_301Chr2_302 Chr2_304Chr2_306Chr2_309Chr2_317Chr2_321 Chr2_322Chr2_323 Chr2_324Chr2_326 Chr2_329Chr2_330 Chr2_333Chr2_336 Chr2_335Chr2_337 Chr2_339Chr2_340Chr2_342 Chr2_344Chr2_350 Chr2_351Chr2_352 Chr2_355Chr2_356 Chr2_361Chr2_362Chr2_363Chr2_364Chr2_365Chr2_366 Chr2_369Chr2_368 Chr2_372Chr2_375 Chr2_374Chr2_376 Chr2_378Chr2_380 Chr2_381Chr2_382Chr2_384Chr2_386 Chr2_387Chr2_388Chr2_389

chrom_2

Chr3_1Chr3_5Chr3_7

Chr3_13

Chr3_18Chr3_21Chr3_28Chr3_31Chr3_35Chr3_38Chr3_49Chr3_50Chr3_51Chr3_56 Chr3_57Chr3_58Chr3_59Chr3_60Chr3_61Chr3_67Chr3_71Chr3_74Chr3_77Chr3_78Chr3_83Chr3_87 Chr3_98Chr3_110Chr3_117Chr3_119Chr3_120Chr3_126Chr3_130Chr3_132Chr3_133Chr4_103Chr3_134 Chr3_136Chr4_104 Chr4_105Chr4_107Chr3_142

Chr3_151

Chr3_153Chr3_155Chr3_159 Chr3_160Chr3_161Chr3_164Chr3_168

Chr3_170Chr3_176Chr3_178Chr3_180

Chr3_181 Chr3_182

Chr3_183Chr3_185Chr3_192Chr3_198Chr3_202Chr3_210Chr3_222Chr3_228Chr3_241Chr3_242

Chr3_243Chr3_244

Chr3_253Chr3_247Chr3_260

Chr3_271

Chr3_273

Chr3_274

Chr3_287Chr3_276Chr3_293 Chr3_297Chr3_301Chr3_302Chr3_306Chr3_308Chr3_309 Chr3_310Chr3_312Chr3_317Chr3_318Chr3_320Chr3_323Chr3_330Chr3_333Chr3_363Chr3_367

LG4

Chr3_1 Chr3_5Chr3_7Chr3_13Chr3_18Chr3_21Chr3_28Chr3_31Chr3_35Chr3_38Chr3_49Chr3_50Chr3_51 Chr3_56Chr3_57Chr3_58Chr3_59Chr3_60Chr3_61Chr3_67Chr3_71 Chr3_74Chr3_77Chr3_78Chr3_83Chr3_87Chr3_98 Chr3_110Chr3_117 Chr3_119Chr3_120Chr3_126Chr3_130Chr3_132Chr3_133Chr3_134Chr3_136Chr3_142Chr3_151Chr3_153Chr3_155Chr3_159 Chr3_160Chr3_161 Chr3_164Chr3_168Chr3_170Chr3_176 Chr3_178Chr3_180Chr3_181 Chr3_182Chr3_183Chr3_185Chr3_192Chr3_198Chr3_202Chr3_210Chr3_222Chr3_228Chr3_241 Chr3_242Chr3_243 Chr3_244Chr3_247 Chr3_253Chr3_260Chr3_271Chr3_273Chr3_274Chr3_276Chr3_287Chr3_293Chr3_297Chr3_301 Chr3_302Chr3_306 Chr3_308Chr3_309Chr3_310Chr3_312Chr3_317 Chr3_318Chr3_320Chr3_323Chr3_330Chr3_333Chr3_363Chr3_367

chrom_3

Chr4_5Chr4_8Chr4_9

Chr4_11Chr4_14

Chr4_17

Chr4_18Chr4_21Chr4_23Chr4_25Chr4_27Chr4_30

Chr4_34Chr4_35

Chr4_38 Chr4_47Chr4_39Chr4_48

Chr4_50

Chr4_59

Chr4_72

Chr4_77Chr4_79

Chr4_89Chr4_91Chr4_94Chr4_99Chr4_101

Chr4_116

Chr6_168Chr4_117Chr4_120


Chr4_154Chr4_156Chr4_159

Chr4_160

Chr4_161Chr4_162Chr4_165

Chr4_181Chr4_173

Chr4_186

Chr4_187Chr4_189 Chr6_80Chr6_81Chr6_77 Chr6_76Chr4_198Chr4_199Chr4_200

LG22

Chr4_5Chr4_8Chr4_9Chr4_11Chr4_14Chr4_17Chr4_18Chr4_21Chr4_23 Chr4_25Chr4_27 Chr4_30Chr4_34Chr4_35Chr4_38 Chr4_39Chr4_47Chr4_48Chr4_50Chr4_59Chr4_72Chr4_77Chr4_79Chr4_89Chr4_91 Chr4_94Chr4_99Chr4_101

Chr4_116Chr4_117Chr4_120Chr4_136 Chr4_138Chr4_146 Chr4_147Chr4_149Chr4_153Chr4_154 Chr4_156Chr4_159Chr4_160Chr4_161 Chr4_162Chr4_165Chr4_173Chr4_181Chr4_186Chr4_187Chr4_189Chr4_198Chr4_199Chr4_200

chrom_4


Chr5_117 Chr5_123Chr5_96

Chr5_94

Chr5_87

Chr5_86

Chr5_70

Chr5_67Chr5_66 Chr5_51Chr5_43

Chr5_37

Chr5_36Chr5_35Chr5_34

Chr5_15

Chr5_32

Chr5_122 Chr5_134Chr5_141Chr5_142Chr5_143Chr5_144Chr5_145Chr5_154Chr5_155 Chr5_159Chr5_164Chr5_167Chr5_174Chr5_180Chr5_181Chr5_184Chr5_182Chr5_186Chr5_189Chr5_191Chr5_204Chr5_212Chr5_215Chr5_226Chr5_243Chr5_263Chr5_273Chr5_278Chr5_282Chr5_288

LG8

Chr5_15Chr5_32Chr5_34Chr5_35Chr5_36Chr5_37Chr5_43Chr5_51Chr5_66Chr5_67Chr5_68Chr5_69

Chr5_70 Chr5_77Chr5_79 Chr5_81Chr5_85 Chr5_86Chr5_87Chr5_94Chr5_96Chr5_117Chr5_122Chr5_123Chr5_134Chr5_141 Chr5_142Chr5_143 Chr5_144Chr5_145Chr5_154 Chr5_155Chr5_159Chr5_164Chr5_167Chr5_174 Chr5_180Chr5_181 Chr5_182Chr5_184 Chr5_186Chr5_189 Chr5_191Chr5_204Chr5_212Chr5_215Chr5_226Chr5_243Chr5_263Chr5_273Chr5_278Chr5_282Chr5_288

chrom_5

Chr6_25Chr6_26Chr6_28Chr6_34Chr6_36Chr6_40Chr6_42Chr6_45Chr6_48Chr6_51

Chr6_55Chr6_59

Chr6_60

Chr6_63Chr6_71 Chr6_75Chr6_65Chr6_70Chr6_69

Chr6_82

Chr6_92


Chr6_100

Chr6_102


Chr6_131

Chr6_140Chr6_147

Chr6_150Chr6_156Chr6_157Chr6_165Chr6_171Chr15_102 Chr15_101Chr6_174Chr6_180Chr6_182Chr6_183Chr6_184Chr6_190Chr6_194Chr8_275Chr6_203Chr18_110Chr6_226Chr6_233Chr6_228Chr6_237Chr6_242Chr6_245Chr6_249Chr6_264Chr6_266Chr6_288Chr1_122Chr6_292 Chr6_286Chr1_118Chr6_297 Chr6_300Chr6_305Chr6_316Chr6_320 Chr6_322Chr6_357Chr6_383Chr6_392Chr6_416Chr6_411Chr6_430 Chr6_433Chr6_436Chr6_438Chr6_442 Chr6_443Chr6_452Chr6_453Chr6_466Chr6_483

LG20

Chr6_25Chr6_26Chr6_28 Chr6_34Chr6_36Chr6_40Chr6_42Chr6_45Chr6_48 Chr6_51Chr6_55Chr6_59Chr6_60Chr6_63Chr6_65 Chr6_69Chr6_70 Chr6_71Chr6_75Chr6_82Chr6_92Chr6_94Chr6_98 Chr6_99Chr8_275Chr6_100Chr6_102Chr6_104Chr6_105Chr6_108 Chr6_109Chr6_123Chr6_128Chr6_131Chr6_140 Chr6_147Chr6_150Chr6_156Chr6_157Chr6_165Chr6_171Chr6_174Chr6_180Chr6_182Chr6_183Chr6_184Chr6_190Chr6_194Chr6_203Chr6_226Chr6_228Chr6_233Chr6_237 Chr6_242Chr6_245Chr6_249Chr6_264Chr6_266Chr6_286Chr6_288Chr6_292Chr6_297Chr6_300Chr6_305Chr6_316Chr6_320Chr6_322Chr6_357Chr6_383Chr6_392Chr6_411Chr6_416Chr6_430Chr6_433Chr6_436Chr6_438Chr6_442 Chr6_443Chr6_452 Chr6_453Chr6_466Chr6_483

chrom_6

10

0

Chr7_1Chr7_2Chr7_4Chr7_11 Chr7_13Chr7_15Chr7_16Chr7_22Chr7_28Chr7_29Chr7_30Chr7_31 Chr7_42Chr7_43Chr7_36Chr7_34Chr7_46Chr7_58Chr7_57

Chr7_60

Chr4_108 Chr4_109

Chr18_161 Chr18_162Chr7_79 Chr7_78Chr7_76Chr7_61 Chr7_92Chr7_107

Chr7_108Chr7_110Chr7_116 Chr7_111Chr7_118Chr7_132Chr7_142Chr7_149Chr7_163Chr7_164Chr7_167Chr7_170 Chr7_169Chr7_171Chr7_172Chr7_182Chr7_187Chr7_197 Chr7_193Chr7_200Chr7_201

Chr7_254

Chr7_255 Chr7_263Chr7_256Chr7_235 Chr7_237Chr7_225

Chr7_214

Chr7_206Chr7_202

Chr7_189

LG11

Chr7_1Chr7_2 Chr7_4Chr7_11Chr7_13 Chr7_15Chr7_16Chr7_22Chr7_28 Chr7_29Chr7_30Chr7_31Chr7_34 Chr7_36Chr7_42 Chr7_43Chr7_46 Chr7_57Chr7_58Chr7_60Chr7_61 Chr7_76Chr7_78 Chr7_79Chr7_92Chr7_107Chr7_108Chr7_110 Chr7_111Chr7_116Chr7_118Chr7_132Chr7_142Chr7_149Chr7_163Chr7_164Chr7_167Chr7_170 Chr7_169Chr7_171Chr7_172Chr7_182Chr7_187Chr7_189 Chr7_193Chr7_197Chr7_200 Chr7_201Chr7_202Chr7_206Chr7_214Chr7_225Chr7_235 Chr7_237Chr7_254Chr7_255Chr7_256Chr7_263Chr7_268Chr7_271 Chr7_277Chr7_286Chr7_287Chr7_288Chr7_289Chr7_293

chrom_7

Chr7_268

Chr7_271

Chr7_277

Chr7_286Chr7_287Chr7_288Chr7_289

Chr7_293

LG16

Chr8_1Chr8_2Chr8_5Chr8_6Chr8_7Chr8_12Chr8_14Chr8_18Chr8_25 Chr8_27Chr8_29Chr8_31Chr8_32Chr8_36 Chr8_37Chr8_40Chr8_56 Chr8_57Chr8_63Chr8_68Chr8_69Chr8_70


Chr8_83Chr8_85Chr8_86Chr8_105Chr8_110Chr8_111Chr8_112Chr8_113Chr8_115Chr8_126Chr8_127Chr8_133 Chr8_135Chr8_136Chr8_139Chr8_142Chr8_146Chr8_148 Chr8_152Chr8_156Chr8_157Chr8_159Chr8_163Chr8_165Chr8_168 Chr8_179Chr8_181Chr8_183Chr8_185 Chr8_197Chr8_198Chr8_199Chr8_200Chr8_202Chr8_203Chr8_210Chr8_213 Chr8_212Chr8_216Chr8_219Chr8_222Chr8_223Chr8_224Chr8_225Chr8_230Chr8_231Chr8_232Chr8_235Chr8_236 Chr8_243Chr8_247Chr8_248Chr8_254Chr8_278Chr4_113Chr4_115Chr8_291Chr8_293Chr8_298Chr8_302Chr8_303Chr8_311Chr8_312Chr8_314Chr8_315Chr8_319Chr8_327Chr8_332 Chr8_333Chr8_346Chr8_347Chr8_355Chr8_348Chr8_352Chr8_356Chr8_357Chr8_359Chr8_360

Chr8_361Chr8_393Chr8_402Chr8_405Chr8_409Chr8_424Chr8_427Chr8_430 Chr8_432

Chr8_435

LG6

Chr8_1Chr8_2Chr8_5Chr8_6 Chr8_7Chr8_12Chr8_14 Chr8_18Chr8_25 Chr8_27Chr8_29 Chr8_31Chr8_32 Chr8_36Chr8_37Chr8_40Chr8_56 Chr8_57Chr8_63Chr8_68Chr8_69Chr8_70Chr8_71 Chr8_75Chr8_76Chr8_83Chr8_85Chr8_86Chr8_105Chr8_110Chr8_111Chr8_112Chr8_113Chr8_115Chr8_126Chr8_127Chr8_133 Chr8_135Chr8_136Chr8_139Chr8_142Chr8_146Chr8_148Chr8_152 Chr8_156Chr8_157Chr8_159Chr8_163Chr8_165Chr8_168 Chr8_179Chr8_181 Chr8_183Chr8_185Chr8_197Chr8_198 Chr8_199Chr8_200 Chr8_202Chr8_203Chr8_210 Chr8_212Chr8_213Chr8_216Chr8_219Chr8_222 Chr8_223Chr8_224Chr8_225Chr8_230 Chr8_231Chr8_232 Chr8_235Chr8_236 Chr8_243Chr8_247 Chr8_248Chr8_254Chr8_278Chr8_291Chr8_293Chr8_298Chr8_302 Chr8_303Chr8_311Chr8_312Chr8_314Chr8_315Chr8_319Chr8_327Chr8_332Chr8_333Chr8_346Chr8_347Chr8_348Chr8_352 Chr8_355Chr8_356Chr8_357Chr8_359Chr8_360Chr8_361Chr8_393Chr8_402Chr8_405Chr8_409Chr8_424Chr8_427Chr8_430Chr8_432Chr8_435

chrom_8

Chr9_4 Chr9_6

Chr9_7

Chr9_12Chr9_15Chr9_14Chr9_18 Chr9_24Chr9_29Chr9_31Chr9_36Chr9_41Chr9_47Chr9_51Chr9_52Chr9_57Chr9_59Chr9_61Chr9_62Chr9_74Chr9_88Chr9_90Chr9_92Chr9_97

Chr9_115Chr9_117Chr9_124Chr9_126Chr9_137Chr9_138Chr9_142Chr9_144Chr9_147Chr9_150Chr9_155 Chr9_157Chr9_162Chr9_166Chr9_168

Chr9_179

Chr9_181

Chr9_185

Chr9_187Chr9_190Chr9_195Chr9_197Chr9_199Chr9_200Chr9_202 Chr9_203Chr9_209 Chr9_212Chr9_215Chr9_225Chr9_229Chr9_230Chr9_233Chr9_238Chr9_248Chr9_250Chr9_257Chr9_258Chr2_156Chr9_274Chr9_266Chr9_265Chr9_263Chr9_281Chr9_276Chr9_277Chr9_286Chr9_290

Chr9_293


Chr9_306Chr9_308Chr9_311Chr9_313


Chr9_341Chr9_345Chr9_348Chr9_349Chr9_352Chr9_355Chr9_357Chr9_373Chr9_391Chr9_394Chr9_400Chr9_406Chr9_407 Chr9_408Chr9_409Chr9_411Chr9_413Chr9_414Chr9_425Chr9_430Chr9_441Chr9_448Chr9_450Chr9_451

LG18

Chr9_4 Chr9_6Chr9_7Chr9_12 Chr9_15Chr9_14Chr9_18Chr9_24Chr9_29 Chr9_31Chr9_36 Chr9_41Chr9_47Chr9_51 Chr9_52Chr9_57Chr9_59Chr9_61 Chr9_62Chr9_74Chr9_88 Chr9_90Chr9_92Chr9_97Chr9_115Chr9_117Chr9_124Chr9_126Chr9_137Chr9_138Chr9_142Chr9_144 Chr9_147Chr9_150Chr9_155 Chr9_157Chr9_162 Chr9_166Chr9_168Chr9_179Chr9_181Chr9_185Chr9_187Chr9_190Chr9_195Chr9_197Chr9_199Chr9_200Chr9_202Chr9_203Chr9_209Chr9_212Chr9_215Chr9_225Chr9_229Chr9_230Chr9_233Chr9_238Chr9_248Chr9_250Chr9_257Chr9_258Chr9_263Chr9_265Chr9_266Chr9_274Chr9_276Chr9_277Chr9_281Chr9_286Chr9_290Chr9_293 Chr9_292Chr9_294Chr9_299Chr9_300Chr9_303Chr9_306Chr9_308Chr9_311Chr9_313Chr9_315Chr9_318Chr9_327Chr9_328Chr9_331Chr9_341Chr9_345Chr9_348 Chr9_349Chr9_352Chr9_355 Chr9_357Chr9_373Chr9_391Chr9_394 Chr9_400Chr9_406Chr9_407 Chr9_408Chr9_409Chr9_411Chr9_413Chr9_414Chr9_425Chr9_430Chr9_441Chr9_448 Chr9_450Chr9_451

chrom_9

Chr10_3Chr10_9Chr10_16Chr10_23Chr10_25 Chr10_24Chr10_34 Chr10_35Chr10_38Chr10_39 Chr10_41Chr10_43Chr10_45Chr10_48Chr10_54Chr10_56Chr10_77

Chr10_79Chr10_80Chr10_82Chr10_87Chr10_89Chr10_88Chr10_92Chr10_93Chr10_94Chr10_95Chr10_98Chr10_102

Chr10_104

Chr10_116Chr10_123Chr10_124Chr10_126

Chr10_132 Chr10_134

Chr10_135Chr10_148Chr10_149Chr10_161Chr10_162Chr10_168 Chr10_169Chr10_171Chr10_181Chr10_189Chr10_190Chr10_191Chr10_195


Chr10_212Chr10_217Chr10_219 Chr10_220Chr10_221Chr10_224Chr10_226Chr10_227 Chr10_228Chr10_233Chr10_238Chr10_255Chr10_257Chr10_260Chr10_275


Chr10_288

Chr10_289 Chr10_290Chr10_292Chr10_295Chr10_296

Chr10_298Chr10_299

Chr10_301Chr10_302Chr10_307Chr10_310Chr10_312Chr10_314Chr10_319Chr10_320Chr10_334 Chr10_339Chr10_325Chr10_329Chr10_333Chr10_331Chr10_323 Chr10_322Chr10_341Chr10_346Chr10_347 Chr10_348

Chr10_356

LG17

Chr10_3Chr10_9Chr10_16Chr10_23Chr10_24Chr10_25Chr10_34 Chr10_35Chr10_38 Chr10_39Chr10_41Chr10_43 Chr10_45Chr10_48Chr10_54Chr10_56Chr10_77Chr10_79Chr10_80Chr10_82Chr10_87Chr10_88Chr10_89Chr10_92Chr10_93Chr10_94 Chr10_95Chr10_98Chr10_102Chr10_104Chr10_116 Chr10_123Chr10_124Chr10_126Chr10_132 Chr10_134Chr10_135Chr10_148Chr10_149Chr10_161Chr10_162Chr10_168Chr10_169Chr10_171 Chr10_181Chr10_189Chr10_190Chr10_191Chr10_195Chr10_196 Chr10_197Chr10_198 Chr10_199Chr10_205Chr10_212Chr10_217 Chr10_219Chr10_220Chr10_221Chr10_224 Chr10_226Chr10_227 Chr10_228Chr10_233Chr10_238Chr10_255 Chr10_257Chr10_260Chr10_275Chr10_276Chr10_278 Chr10_279Chr10_280Chr10_282Chr10_288Chr10_289Chr10_290Chr10_292Chr10_295Chr10_296Chr10_298Chr10_299Chr10_301Chr10_302Chr10_307Chr10_310Chr10_312Chr10_314Chr10_319 Chr10_320Chr10_322Chr10_323 Chr10_325Chr10_329 Chr10_331Chr10_333 Chr10_334Chr10_339Chr10_341 Chr10_346Chr10_347 Chr10_348Chr10_356

chrom_10

Chr11_1


Chr11_8Chr11_9Chr11_10Chr11_14Chr11_15Chr11_16Chr11_17Chr11_18Chr11_27Chr11_36Chr11_38Chr11_40Chr11_48Chr11_62Chr11_64Chr11_67Chr11_69Chr11_71Chr11_79Chr11_83Chr11_88Chr11_92Chr11_94Chr11_115Chr11_116


Chr11_160

Chr11_149Chr11_143

Chr11_158 Chr11_159Chr11_157Chr11_153 Chr11_154Chr11_152

Chr11_162Chr11_164

Chr11_169 Chr11_168

Chr11_171Chr11_174Chr11_181Chr11_182Chr11_183Chr11_190Chr11_187

Chr11_193Chr11_195 Chr11_198Chr11_200 Chr11_202Chr11_204Chr11_210 Chr11_213Chr11_214Chr11_225

LG21

Chr11_1Chr11_3Chr11_4Chr11_6Chr11_8Chr11_9Chr11_10Chr11_14 Chr11_15Chr11_16 Chr11_17Chr11_18 Chr11_27Chr11_36Chr11_38Chr11_40Chr11_48Chr11_62Chr11_64Chr11_67Chr11_69Chr11_71Chr11_79Chr11_83 Chr11_88Chr11_92Chr11_94Chr11_115Chr11_116Chr11_123 Chr11_135Chr11_137Chr11_139Chr11_141Chr11_143Chr11_149Chr11_152 Chr11_153Chr11_154 Chr11_157Chr11_158 Chr11_159Chr11_160Chr11_162Chr11_164Chr11_168 Chr11_169Chr11_171Chr11_174Chr11_181 Chr11_182Chr11_183Chr11_187Chr11_190Chr11_193Chr11_195 Chr11_198Chr11_200 Chr11_202Chr11_204Chr11_210 Chr11_213Chr11_214Chr11_225

chrom_11

Chr12_3Chr12_8

Chr12_18Chr12_19 Chr12_25Chr12_27 Chr12_28Chr12_38

Chr12_42

Chr12_48

LG12

Chr12_3Chr12_8Chr12_18Chr12_19 Chr12_25Chr12_27Chr12_28Chr12_38Chr12_42Chr12_48Chr12_50

Chr12_54Chr12_55 Chr12_59Chr12_65 Chr12_72Chr12_75Chr12_76Chr12_77Chr12_78Chr12_81 Chr12_82Chr12_85Chr12_86Chr12_94Chr12_98Chr12_105Chr12_106Chr12_109Chr12_110

chrom_12

Chr12_50

Chr12_54

Chr12_55Chr12_59

Chr12_65Chr12_75Chr12_72

Chr12_76Chr12_77Chr12_78Chr12_82Chr12_81Chr12_85Chr12_86Chr12_94Chr12_98Chr12_105Chr12_106Chr12_109Chr12_110

LG14

10

1

Chr13_9Chr13_14Chr13_15Chr13_19Chr13_22Chr13_25Chr13_26Chr13_27 Chr13_31Chr13_34Chr13_35Chr13_37Chr13_41Chr13_42Chr13_43Chr13_48Chr13_45Chr13_50Chr13_46Chr13_53 Chr13_54Chr13_51 Chr13_52Chr13_55Chr13_56Chr13_64Chr13_67 Chr13_68Chr13_69 Chr13_70Chr13_75Chr13_76Chr13_78Chr13_85 Chr13_84Chr13_87Chr13_90Chr6_506Chr6_503Chr13_93 Chr13_92Chr13_91Chr13_94Chr13_98Chr13_97Chr13_95Chr13_96Chr13_99Chr13_107Chr13_106Chr13_113 Chr13_116Chr13_117Chr13_119Chr13_121Chr13_122Chr13_123Chr11_167Chr11_166Chr13_125Chr13_127Chr13_129Chr13_131Chr13_142Chr13_134 Chr13_133Chr13_137Chr13_141Chr13_143 Chr13_138Chr13_140Chr13_151 Chr13_147Chr13_158Chr13_168Chr13_176Chr13_185 Chr13_189Chr13_191Chr13_192Chr13_198Chr13_197Chr13_201 Chr13_202Chr13_199 Chr13_193Chr13_203Chr13_204 Chr13_208Chr13_207 Chr13_209Chr13_206 Chr13_205Chr13_212Chr13_210Chr13_223 Chr13_216Chr13_225Chr13_233Chr13_250 Chr13_238Chr13_237Chr13_252Chr13_261Chr13_263Chr13_268Chr13_272Chr13_277 Chr13_275Chr13_279Chr13_287Chr13_290 Chr13_291Chr13_295Chr13_294Chr13_293Chr13_303Chr13_306Chr13_310Chr13_311Chr13_315 Chr13_317Chr13_322 Chr13_323Chr13_325Chr13_328Chr13_329Chr13_333Chr13_336Chr13_344Chr13_345 Chr13_349Chr13_347 Chr13_348Chr13_352Chr13_356Chr13_364Chr13_372Chr13_374Chr13_370Chr13_365 Chr13_366Chr13_373 Chr13_369Chr13_371 Chr13_367Chr13_368Chr13_377Chr13_376Chr13_375Chr13_378Chr13_381Chr13_386Chr13_384Chr13_383Chr13_385Chr13_379 Chr13_380Chr13_382Chr13_389 Chr13_387Chr13_404Chr13_403Chr13_399Chr13_395Chr13_398Chr13_402 Chr13_401Chr13_400Chr13_405Chr13_406Chr13_412 Chr13_410Chr13_409 Chr13_411Chr13_416Chr13_419Chr13_451Chr13_443 Chr13_456Chr13_454Chr13_442 Chr13_448Chr13_445Chr13_449 Chr13_444Chr13_440Chr13_439Chr13_438Chr13_433 Chr13_431Chr13_437Chr13_421Chr13_427Chr13_426Chr13_458

LG1

Chr13_9Chr13_14 Chr13_15Chr13_19Chr13_22 Chr13_25Chr13_26Chr13_27 Chr13_31Chr13_34Chr13_35Chr13_37Chr13_41Chr13_42 Chr13_43Chr13_45 Chr13_46Chr13_48 Chr13_50Chr13_51 Chr13_52Chr13_53 Chr13_54Chr13_55 Chr13_56Chr13_64Chr13_67 Chr13_68Chr13_69 Chr13_70Chr13_75Chr13_76Chr13_78Chr13_84 Chr13_85Chr13_87Chr13_90Chr13_91Chr13_92 Chr13_93Chr13_94Chr13_95 Chr13_96Chr13_97Chr13_98Chr13_99Chr13_106 Chr13_107Chr13_113 Chr13_116Chr13_117Chr13_119 Chr13_121Chr13_122Chr13_123Chr13_125Chr13_127Chr13_129Chr13_131Chr13_134 Chr13_133Chr13_137Chr13_138 Chr13_140Chr13_142 Chr13_141Chr13_143Chr13_147Chr13_151Chr13_158Chr13_168Chr13_176Chr13_185 Chr13_189Chr13_191 Chr13_192Chr13_193 Chr13_197Chr13_198 Chr13_199Chr13_201 Chr13_202Chr13_203Chr13_204Chr13_205Chr13_206 Chr13_207Chr13_208 Chr13_209Chr13_210Chr13_212 Chr13_216Chr13_223Chr13_225Chr13_233 Chr13_237Chr13_238Chr13_250Chr13_252Chr13_261 Chr13_263Chr13_268Chr13_272Chr13_275Chr13_277Chr13_279Chr13_287Chr13_290 Chr13_291Chr13_293 Chr13_295Chr13_294Chr13_303Chr13_306Chr13_310Chr13_311Chr13_315 Chr13_317Chr13_322 Chr13_323Chr13_325Chr13_328 Chr13_329Chr13_333Chr13_336Chr13_344 Chr13_345Chr13_347 Chr13_348Chr13_349Chr13_352 Chr13_356Chr13_364Chr13_365 Chr13_366Chr13_367 Chr13_368Chr13_369 Chr13_370Chr13_371 Chr13_372Chr13_373Chr13_374Chr13_375 Chr13_376Chr13_377 Chr13_378Chr13_379 Chr13_380Chr13_381 Chr13_382Chr13_383 Chr13_384Chr13_385 Chr13_386Chr13_387 Chr13_389Chr13_395 Chr13_398Chr13_399 Chr13_400Chr13_401Chr13_402 Chr13_403Chr13_404Chr13_405Chr13_406Chr13_409 Chr13_410Chr13_411Chr13_412Chr13_416Chr13_419 Chr13_421Chr13_426 Chr13_427Chr13_431 Chr13_433Chr13_437 Chr13_438Chr13_439Chr13_440 Chr13_442Chr13_443 Chr13_444Chr13_445 Chr13_448Chr13_449 Chr13_451Chr13_454Chr13_456Chr13_458

chrom_13


Chr14_24

Chr14_105Chr14_108

Chr14_112Chr14_113Chr14_119Chr14_122Chr14_124Chr14_126Chr14_127 Chr14_128Chr14_129Chr14_133Chr14_132Chr14_134Chr14_140Chr14_141 Chr14_142

LG9

Chr14_1Chr14_2Chr14_5Chr14_7 Chr14_16Chr14_24Chr14_105Chr14_108 Chr14_112Chr14_113Chr14_119Chr14_122 Chr14_124Chr14_126 Chr14_127Chr14_128Chr14_129Chr14_132 Chr14_133Chr14_134Chr14_140Chr14_141 Chr14_142Chr14_145Chr14_146

Chr14_147

Chr14_151Chr14_152Chr14_155Chr14_156Chr14_160Chr14_162Chr14_163Chr14_164 Chr14_165Chr14_168 Chr14_170Chr14_171Chr14_172Chr14_173Chr14_174Chr14_181Chr14_182

chrom_14

Chr14_145

Chr14_146Chr14_147

Chr14_151Chr14_152

Chr14_155Chr14_156Chr14_160Chr14_162


Chr14_181

Chr14_182

Chr14_164Chr14_163Chr14_165

LG10

Chr16_1Chr16_3Chr16_4Chr16_11

Chr16_13Chr16_14Chr16_16Chr16_20Chr16_33Chr16_34Chr16_37Chr16_40Chr16_44Chr16_45Chr16_46Chr16_47Chr16_48Chr16_53Chr16_55Chr16_56Chr16_60Chr16_66Chr16_67Chr16_70Chr16_71Chr16_72


Chr16_108Chr16_109Chr16_118

Chr16_121Chr16_124Chr16_134

Chr16_150Chr16_154 Chr16_161Chr16_163

Chr16_173

Chr16_175

Chr16_176

Chr16_178Chr16_180Chr16_191

Chr16_198Chr16_213Chr16_221

LG23

Chr16_1Chr16_3Chr16_4Chr16_11Chr16_13Chr16_14Chr16_16Chr16_20Chr16_33Chr16_34 Chr16_37Chr16_40Chr16_44 Chr16_45Chr16_46Chr16_47Chr16_48Chr16_53 Chr16_55Chr16_56Chr16_60Chr16_66 Chr16_67Chr16_70Chr16_71 Chr16_72Chr16_75Chr16_84Chr16_89Chr16_99 Chr16_102Chr16_103Chr16_107Chr16_108 Chr16_109Chr16_118Chr16_121Chr16_124Chr16_134Chr16_150 Chr16_154Chr16_161Chr16_163Chr16_173Chr16_175Chr16_176Chr16_178 Chr16_180Chr16_191Chr16_198Chr16_213Chr16_221

chrom_16

Chr18_1Chr18_3Chr18_5Chr18_4 Chr18_19Chr18_14Chr18_18 Chr18_21Chr18_6Chr18_10 Chr18_8Chr18_7Chr18_24Chr18_25Chr18_29Chr18_36Chr18_38Chr18_45Chr18_39Chr18_46Chr18_51 Chr18_56Chr18_54Chr18_50Chr18_53Chr18_52Chr18_58Chr18_60Chr18_62Chr18_68 Chr18_63Chr18_69Chr18_66Chr18_67Chr18_76 Chr18_74Chr18_77Chr18_80Chr18_90Chr18_91Chr18_93Chr18_94Chr18_104Chr18_106Chr18_107Chr18_109Chr18_115Chr18_116Chr18_118Chr18_145Chr18_153 Chr18_155Chr18_157Chr18_159Chr18_160Chr18_163Chr18_166Chr18_167Chr18_172Chr18_175Chr18_179Chr18_186Chr18_189Chr18_190Chr18_194Chr18_199Chr18_200Chr18_203Chr18_204Chr18_206Chr18_208Chr18_212Chr18_213Chr18_231 Chr18_227Chr18_232Chr18_234Chr18_237Chr18_238Chr18_247Chr18_248Chr18_258Chr18_270Chr18_276Chr18_282 Chr18_286Chr18_287Chr18_300Chr18_288 Chr18_298Chr18_303Chr18_311Chr18_326Chr18_332Chr18_334Chr18_338Chr18_339Chr18_343Chr18_356Chr18_358Chr18_359Chr18_362Chr18_366 Chr18_369Chr18_373Chr18_387Chr18_389Chr18_393Chr18_404Chr18_405Chr18_419Chr18_422Chr18_429Chr18_431Chr18_444Chr18_446Chr18_448Chr18_453Chr18_458Chr18_462Chr18_479Chr18_492Chr18_499Chr18_501Chr18_505Chr18_519 Chr18_520Chr18_522Chr18_523Chr18_553Chr18_536 Chr18_554Chr18_560Chr18_557Chr18_603Chr18_591Chr18_615Chr18_676Chr18_679Chr18_683

LG15

Chr18_1Chr18_3Chr18_5 Chr18_4Chr18_6 Chr18_8Chr18_7 Chr18_10Chr18_14 Chr18_18Chr18_19Chr18_21Chr18_24 Chr18_25Chr18_29Chr18_36 Chr18_38Chr18_39 Chr18_45Chr18_46Chr18_50 Chr18_51Chr18_52 Chr18_53Chr18_54 Chr18_56Chr18_58 Chr18_60Chr18_62Chr18_63Chr18_66 Chr18_67Chr18_68 Chr18_69Chr18_74 Chr18_76Chr18_77 Chr18_80Chr18_90 Chr18_91Chr18_93Chr18_94Chr18_104Chr18_106Chr18_107Chr18_109Chr18_115Chr18_116Chr18_118Chr18_145Chr18_153 Chr18_155Chr18_157Chr18_159Chr18_160Chr18_163Chr18_166 Chr18_167Chr18_172Chr18_175Chr18_179Chr18_186Chr18_189Chr18_190 Chr18_194Chr18_199 Chr18_200Chr18_203Chr18_204 Chr18_206Chr18_208Chr18_212Chr18_213Chr18_227 Chr18_231Chr18_232Chr18_234Chr18_237Chr18_238Chr18_247Chr18_248Chr18_258Chr18_270Chr18_276Chr18_282 Chr18_286Chr18_287Chr18_288Chr18_298 Chr18_300Chr18_303Chr18_311Chr18_326Chr18_332Chr18_334Chr18_338Chr18_339 Chr18_343Chr18_356Chr18_358Chr18_359 Chr18_362Chr18_366 Chr18_369Chr18_373Chr18_387Chr18_389Chr18_393Chr18_404Chr18_405 Chr18_419Chr18_422Chr18_429 Chr18_431Chr18_444Chr18_446 Chr18_448Chr18_453 Chr18_458Chr18_462Chr18_479Chr18_492Chr18_499Chr18_501Chr18_505Chr18_519 Chr18_520Chr18_522Chr18_523Chr18_536Chr18_553 Chr18_554Chr18_557 Chr18_560Chr18_591Chr18_603Chr18_615Chr18_676 Chr18_679Chr18_683

chrom_18


Chr17_20


Chr17_45 Chr17_46

Chr17_51Chr17_57Chr17_60

Chr17_62Chr17_63Chr17_68Chr17_74 Chr17_75Chr17_83Chr17_86Chr17_91Chr17_108Chr17_110Chr17_111Chr17_118Chr17_128Chr17_129

Chr17_131

Chr17_133Chr17_139Chr17_146Chr17_147

Chr17_148Chr17_149 Chr17_150Chr17_151Chr17_160Chr17_165Chr17_174Chr17_182Chr17_191Chr17_183Chr17_195Chr17_198Chr17_203Chr17_214Chr17_218Chr17_220Chr17_222Chr17_235Chr17_240Chr17_241Chr17_242Chr17_243

Chr17_251


Chr17_267 Chr17_269Chr17_270Chr17_273

Chr17_278Chr17_276

Chr17_282

Chr17_284Chr17_287

19

Chr17_2Chr17_3Chr17_10Chr17_16Chr17_17Chr17_20Chr17_21Chr17_24 Chr17_25Chr17_28Chr17_29Chr17_30 Chr17_31Chr17_45 Chr17_46Chr17_51Chr17_57 Chr17_60Chr17_62Chr17_63Chr17_68Chr17_74 Chr17_75Chr17_83Chr17_86Chr17_91Chr17_108Chr17_110 Chr17_111Chr17_118Chr17_128Chr17_129Chr17_131Chr17_133Chr17_139Chr17_146Chr17_147Chr17_148Chr17_149 Chr17_150Chr17_151Chr17_160Chr17_165Chr17_174Chr17_182Chr17_183Chr17_191Chr17_195Chr17_198Chr17_203Chr17_214Chr17_218Chr17_220Chr17_222Chr17_235Chr17_240Chr17_241 Chr17_242Chr17_243Chr17_251Chr17_253Chr17_254Chr17_256 Chr17_258Chr17_260Chr17_264Chr17_267 Chr17_269Chr17_270Chr17_273Chr17_276 Chr17_278Chr17_282Chr17_284Chr17_287

17

Chr15_82Chr15_83Chr15_93

Chr15_99Chr15_100

Chr15_103Chr15_104Chr15_112Chr15_114 Chr15_115Chr15_118 Chr15_119Chr15_120Chr15_130Chr15_133Chr15_138Chr15_142Chr15_143Chr15_148

LG3

Chr15_82Chr15_83Chr15_93Chr15_99Chr15_100Chr15_103Chr15_104Chr15_112Chr15_114 Chr15_115Chr15_118 Chr15_119Chr15_120Chr15_130Chr15_133Chr15_138Chr15_142Chr15_143Chr15_148Chr15_173Chr15_176 Chr15_178Chr15_189Chr15_191Chr15_192Chr15_196Chr15_197Chr15_206Chr15_226Chr15_229Chr15_238Chr15_242 Chr15_247Chr15_250Chr15_263Chr15_264 Chr15_268Chr15_269Chr15_285 Chr15_288Chr15_300 Chr15_301Chr15_302Chr15_304Chr15_306Chr15_310 Chr15_311Chr15_312 Chr15_313Chr15_314Chr15_322Chr15_329Chr15_331Chr15_332 Chr15_333Chr15_337Chr15_339Chr15_344Chr15_347Chr15_348Chr15_354

chrom_15

Chr15_301

Chr15_173Chr15_176Chr15_178Chr15_189Chr15_192Chr15_191Chr15_196Chr15_206 Chr15_197Chr15_238Chr15_229Chr15_226Chr15_242Chr15_247Chr15_250Chr15_263Chr15_264Chr15_269Chr15_268Chr15_285Chr15_288Chr15_300Chr15_302Chr15_304Chr15_306Chr15_310 Chr15_311Chr15_312Chr15_313Chr15_322Chr15_314Chr15_329Chr15_331Chr15_332Chr15_333Chr15_337Chr15_339Chr15_344Chr15_347Chr15_348Chr15_354

LG2

Chr20_1

Chr20_7Chr20_8

Chr20_17Chr20_18

Chr20_20Chr20_21Chr20_22

Chr20_25

Chr20_26

Chr20_27

Chr20_28

Chr20_33Chr20_37

Chr20_38

Chr20_40Chr20_41Chr20_43Chr20_49Chr20_55Chr20_57Chr20_58Chr20_61Chr20_71Chr20_75Chr20_79Chr20_82Chr20_83Chr20_81Chr20_87Chr20_88Chr20_92 Chr20_97Chr20_98Chr20_99Chr20_110Chr20_114Chr20_120Chr20_121Chr20_133Chr20_137Chr20_142Chr20_150Chr20_162Chr20_166Chr20_170Chr20_171Chr20_172Chr20_173Chr20_175Chr20_176Chr20_182Chr20_185Chr20_190 Chr20_192Chr20_194 Chr20_196Chr20_199

Chr20_201Chr20_206Chr20_208Chr20_213 Chr20_220Chr20_225

Chr20_226

Chr20_241

Chr20_244

Chr20_235

Chr20_234

Chr20_245

Chr20_246

Chr20_248 Chr20_250

Chr20_255 Chr20_257Chr20_259Chr20_264Chr20_258Chr20_266Chr20_265Chr20_268Chr20_273


LG7

Chr20_1Chr20_7 Chr20_8Chr20_17 Chr20_18Chr20_20 Chr20_21Chr20_22Chr20_25 Chr20_26Chr20_27Chr20_28 Chr20_33Chr20_37Chr20_38Chr20_40Chr20_41Chr20_43Chr20_49Chr20_55Chr20_57 Chr20_58Chr20_61Chr20_71Chr20_75Chr20_79 Chr20_81Chr20_82 Chr20_83Chr20_87 Chr20_88Chr20_92Chr20_97Chr20_98 Chr20_99Chr20_110Chr20_114Chr20_120Chr20_121Chr20_133 Chr20_137Chr20_142Chr20_150Chr20_162Chr20_166Chr20_170Chr20_171 Chr20_172Chr20_173 Chr20_175Chr20_176Chr20_182Chr20_185Chr20_190Chr20_192Chr20_194 Chr20_196Chr20_199Chr20_201Chr20_206Chr20_208Chr20_213Chr20_220 Chr20_225Chr20_226Chr20_234Chr20_235Chr20_241Chr20_244Chr20_245Chr20_246Chr20_248 Chr20_250Chr20_255 Chr20_257Chr20_259 Chr20_258Chr20_264Chr20_265Chr20_266Chr20_268Chr20_273Chr20_277Chr20_278Chr20_280Chr20_295Chr20_297 Chr20_299Chr20_301Chr20_303

chrom_20

102

Appendix 3.1. Thirteen-day-old soybean plants, Forrest and PI 437654, 24 hours after inoculation with reniform nematode

Forrest PI 437654

Mapping Genetic Resistance to Reniform Nematode ...

Documents

Transcript of Mapping Genetic Resistance to Reniform Nematode ...