Leishmania infantum (syn. Le. chagasi) in Brazil...Leishmania (Leishmania) infantum (syn....

Research ArticleRattus norvegicus (Rodentia Muridae) Infected byLeishmania (Leishmania) infantum (syn Le chagasi) in Brazil

Fabiana de Oliveira Lara-Silva1 Ricardo Andrade Barata2 Eacuterika Monteiro Michalsky1

Eduardo de Castro Ferreira3 Maria Oliacutempia Garcia Lopes4 Aimara da Costa Pinheiro5

Consuelo Latorre Fortes-Dias6 and Edelberto Santos Dias1

1 Laboratorio de Leishmanioses Centro de Pesquisas Rene Rachou Fundacao Oswaldo Cruz Belo Horizonte MG Brazil2 Laboratorio de Parasitologia Departamento de Ciencias Biologicas Universidade Federal dos Vales do Jequitinhonha e MucuriDiamantina MG Brazil

3 Fundacao Oswaldo Cruz MS Brazil4 Biodiversity Salvation Belo Horizonte MG Brazil5 Secretaria Municipal de Saude Governador Valadares MG Brazil6 Laboratorio de Enzimologia Aplicada Diretoria de Pesquisa e Desenvolvimento Fundacao Ezequiel DiasBelo Horizonte MG Brazil

Correspondence should be addressed to Edelberto Santos Dias edelcpqrrfiocruzbr

Received 27 October 2013 Accepted 3 January 2014 Published 23 February 2014

Academic Editor Amogh A Sahasrabuddhe

Copyright copy 2014 Fabiana de Oliveira Lara-Silva et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited

In the present study we surveyed the fauna of phlebotomine sand flies and small mammals in peridomestic areas from a Brazilianmunicipality where the American cutaneous leishmaniasis (ACL) is endemic A total of 608 female phlebotomine sand flies werecaptured during nine months in 2009 and 2010 Seven different species were represented with 60 of them being Lutzomyiaintermedia and Lu whitmani both incriminated vectors of ACL Lu longipalpis a proven vector of visceral leishmaniasis (VL)was also captured at high proportion (128) Genomic DNA analysis of 136 species-specific pools of female sand flies followedby molecular genotyping showed the presence of Leishmania infantum DNA in two pools of Lu longipalpis The same Leishmaniaspecies was found in one blood sample from Rattus norvegicus among 119 blood and tissue samples analysedThis is the first reportof Le infantum in R norvegicus in the Americas and suggests a possible role for this rodent species in the zoonotic cycle of VL Ourstudy coincided with the reemergence of VL in Governador Valadares

1 Introduction

Leishmaniases are a complex of parasitic diseases caused byflagellated protozoa belonging to the genus Leishmania Ross1903 In Brazil they are primarily transmitted to humansthrough the bites of Lutzomyia (Diptera Psychodidae) phle-botomine sand flies Domestic and synanthropic hosts play arole in the peridomestic transmission of those diseases due tohost and insect vector adaptation to new habitats created byhuman action [1]

In the 80rsquos human cases of the American cutaneousleishmaniasis (ACL) were reported in 19 of the 26 states ofBrazil In 2003 autochthonous cases were confirmed in all

of them [2 3] Among the seven Leishmania species knownto be causative agents of ACL in our country Leishmania(Viannia) braziliensis Le (V) guyanensis and Le (Leishma-nia) amazonensis are the most important ones [4] Reportsof wild reservoirs infected by Leishmania spp emphasize thezoonotic character of ACL [5] and increased the importanceof studies of domestic and peridomestic animals as spreadingagents of the parasite to humans A number of rodentmarsupial and wild canid species were identified as naturalhosts and potential reservoirs for Leishmania spp [6 7]

Our study aimed at a better understanding of ACL inan urban area where it is endemic with identification ofthe phlebotomine sand fly vector hosts and circulating

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 592986 7 pageshttpdxdoiorg1011552014592986

2 BioMed Research International

lowastlowast

lowast

lowastlowastlowast

lowastlowast

Doce River

Doce River

1

23

4

5

6

7

8 9

10

11

12

13

14

15

1617

Figure 1 Geographical location of Governador Valadares munic-ipality in the state of Minas Gerais Brazil Sites of capture ofphlebotomine sand flies (pink circles) and small mammals trapping(black stars) in the districts under study (identified with black dotsand numbers) Lu longipalpis samples infected by Le infantumwerecaptured at sites 3 and 15R norvegicus equally infectedwas capturedat site 14

Leishmania species The area was chosen based on the highnumbers (241 cases between 2001 and 2006) of human casesof ACL in the last decade [8] and on the peculiar patternof urban transmission in that region since most humancases of ACL are registered in residents from the urban areawith little or no contact with forested environments [9]A set of features in the districts selected in our study areknown to favor the occurrence of sand flies and mammalianreservoirs of Leishmania domestic animal shelters very closeto human dwellings lack of basic hygienic conditions aroundthe houses and close location to forest remnants [10]

2 Material and Methods

21 Study Area and Phlebotomine Sand Fly CapturesThe municipality of Governador Valadares (18∘5110158401210158401015840S41∘5610158404210158401015840W) is located in the administrative region of theVale do Rio Doce (Doce River Valley) in the Brazilianstate of Minas Gerais (Figure 1) The city is an importantsocioeconomic pole of the region with 2349Km2 of area and260000 inhabitants

Nonsystematic entomological captures were performedin 17 districts of Governador Valadares (Figure 1) basedon previous records of human cases of ACL HP traps[11] were installed in the peridomiciles from 400 pm to800 am for two consecutive days during nine months(MarchAprilMayOctoberNovemberDecember of 2009JanuaryFebruaryMarch of 2010)The captured female phle-botomine sand flies were stored in 6 DMSO under liquidnitrogen After dissection for species identification a varyingnumber of individuals from the same species and capture siteware pooled and tested for the presence of Leishmania sppDNA

22 Small Mammal Captures (Reservoir) Six captures wereperformed bimonthly between January and December 2008

using forty Tomahawk traps baited with banana and codliver oil The traps were distributed in eight sites in theperidomiciles (two traps per site) from 400 pm to 800 amfor three consecutive nights The captures were repeated inJanuary and March 2010 Blood ear and tail skins liver andspleen samples and bone marrow aspirates were collectedfrom the captured animalsThe blood samples were collectedin EDTA Other tissue samples were immediately used toprepare slide imprints which were stained with Giemsa aftermethanol fixation or stored in microtubes with saline con-taining antibiotics (100120583gmLof streptomycin and 500UmLof penicillin) The field captures were previously licensedby the Brazilian Institute of Environment and RenewableNatural Resources (IBAMA license 15407)

23 Extraction of Genomic DNA Total genomic DNA wasextracted from the female sand flies and from mammaliantissues using the Illustra Tissue and Cells genomicPrep MiniSpin kit (GE HealthCare) according to the manufacturerrsquosinstructions

24 Amplification of Constitutive Genes Genus-specificprimers for Lutzomyia (5Llcac 51015840 GTG GCC GAA CAT AATGTT AG 31015840 e 3Llcac 51015840 CCA CGA ACA AGT TCA ACA TC31015840) were used to amplify the IVS6 region (cacophony) of thephlebotomine sand fly DNA [12] For small mammals theDNA amplification was performed with primers (51015840 TCCAAC ATC ACC ACC ACT GAG TGG AC 31015840 and 5 AAGAAA TCG AGG GTG GAC TGG CC 31015840) for the IRBP gene[13] All the amplifications were performed with the PureTaqIllustra Ready-To-Go PCR Beads (GE Healthcare) for 35cycles under annealing temperature of 55∘C for 30 sec ina Perkin-Elmer thermocycler GeneAmpPCRSystem-2400Negative (no DNA) and positive (Lutzomyia or dog skinDNA) controls were included in every set of reactions Theamplified samples were submitted to electrophoresis on 2agarose gels containing ethidium bromide

25 Leishmania Nested PCR (LnPCR) Targeted to the SSU-rRNA Gene A first amplification step was performed withspecific (R221 and R332) primers for the order Kinetoplastidabut not exclusively for Leishmania [14 15]The amplificationsconditions were denaturation at 94∘C for 5min followedby 30 cycles of 30 seg at 94∘C 60∘C and 72∘C and afinal extension at 72∘C for 5min The resulting amplificationproduct of 603 bpwas used as template in a second reaction inthe presence of Leishmania-specific (R223 and R333) primers[14 15] The reaction conditions were the same as beforeexcept for an increased annealing temperature of 65∘C Thefinal reaction resulted in a 353 bp fragment thatwas visualizedafter electrophoresis on 2 agarose gel and ethidiumbromidestaining For the amplifications we used the pureTaq IllustraReady-To-Go PCRBeads kit (GEHealthcare) and every set ofreactions included a negative (noDNA) and a positive (Leish-mania braziliensisMHOMBR75M2903DNA) control

26 DNA Sequencing for Leishmania Species IdentificationLnPCR amplified fragments were extracted from agarose gels

BioMed Research International 3

Table 1 Female phlebotomine sand flies captured in Governador Valadares state of Minas Gerais (Brazil) with HP light traps The captureswere performed in 2009 and 2010 After identification the specimens were pooled according to species and capture site formolecular analysis

Species Females captured Number of pools per speciesNumber Percentage

Lutzomyia cortelezzii 63 104 27Lu intermedia 307 505 46Lu ischyracantha 42 69 11Lu longipalpis 78 128 21Lu quinquefer 65 107 18Lu termitophila 3 05 2Lu whitmani 50 82 11Total 608 100 136

Table 2 Small mammals captured in Governador Valadares state of Minas Gerais (Brazil) using Tomahawk traps The captures wereperformed bimonthly from January to December of 2009 and from January to March of 2010

Species Common name Specimens capturedNumber

Calomys sp Cotton rat 1 31Didelphis albiventris The white-eared opossum 2 62Didelphis aurita The big-eared opossum 7 219Mus musculus House mouse 3 94Rattus norvegicus Norway or brown rat 15 469Rattus rattus Black rat 4 125Total 32 100

by the QIAquick PCR Purification kit (QIAGEN) Sequenc-ing reactions were prepared with 4 120583L of PREMIX (BigDyeTerminator v31 kit) 32 pmol of primer in 1120583L and 5 120583L ofthe LnPCR product PCR amplification was performed with30 cycles of 95∘C for 20 sec 55∘C for 15 sec and 60∘C for 1minFor each sample the sequencing reactionswere preparedwithforward and reverse primers in a MegaBACE 1000 DNA Sys-tem Bioinformatics analysis of the sequences was performedusing the Lasergene sequence analysis (DNASTAR) and theBIOEDIT softwares

27 MinimumRate of Infection Theminimum rate of naturalinfection (TMI) was calculated by dividing the number ofpositive pools of a given species by the total number ofindividuals of the same species times100

3 Results

During the study period we captured 608 female phle-botomine sandflies from seven different species (Table 1)withalmost 60 of them being Lu intermedia and Lu whitmaniboth incriminated vectors in the transmission of ACL Lulongipalpis proven vector of visceral leishmaniasis (VL) wasalso captured at high proportion (128) The number ofspecies-specific pool samples prepared for molecular analysisis listed in Table 1

The extraction process of phlebotomine sand fly DNAwas validated through amplification of a cacophony geneEvery pool sample of sand fly DNA showed the expected

M 1 2 3 NC PC

353bp

Figure 2 Agarose gel electrophoresis of the amplification productsfrom LnPCR for the SSUrRNA gene Samples M ΦX174HaeIIIDNA digest (1) Lu longipalpis genomic DNA (GV05) (2) Lulongipalpis genomic DNA (GV09) (3) R norvegicus blood DNA(GV017) NC Negative control (no DNA) PC Positive control (LebraziliensisMHOMBR74M2930) DNA

220 bp band due to amplification of the IVS6 region (datanot shown) After LnPCR we observed the characteristic353 bp fragment of Leishmania genus in two of the 136 poolsamples of phlebotomine sand fly DNA analyzed (Figure 2)Both of them corresponded to Lu longipalpis pool samplesand their capture sites are identified in Figure 1 Thus theTMI of natural Leishmania spp infection in Lu longipalpisin Governador Valadares was calculated as 25 None of the134 remaining phlebotomine sand fly pool samples showedany amplification product


1 TCCCATCGCAACTTCGGTTCGGTGTGTGGCGCCTTTGGAGGGGTTTAGTGCGTCCGGTGCGAGCTCCGGTTCGTCCGGCC 80

801 TCCCATCGCAACTTCGGTTCGGTGTGTGGCGCCTTTGGAGGGGTTTAGTGCGTCCGGTGCGGGCTCCGGTTCGTCCGGCC1 TCCCATCGCAACCTCGGTTCGGTGTGTGGCGCCTTTG-AGGGGTTTAGTGCGTCCGGTACGAGCTCCGGTTCGTCCGGCC1 TCCCATCGCAACCTCGGTTCGGTGTGTGGCGCCTTTG-AGGGGTTTAGTGCGTCCGGTACGAGCTCCGGTTCGTCCGGCC1 TCCCATCGCAACCTCGGTTCGGTGTGTGGCGCCTTTG-AGGGGTTTAGTGCGTCCGGTACGAGCTCCGGTTCGTCCGGCC1 TCCCATCGCAACCTCGGTTCGGTGTGTGGCGCCTTTG-AGGGGTTTAGTGCGTCCGGTACGAGCTCCGGTTCGTCCGGCC

GTAACGCCTTTTCAACTCACGGCCTCTAGGAATGAAGGAGGGTAGTTCGGGGGAGAACGTACTGGGGCGTCAGAGGTGAAGTAACGCCTTTTCAACTCACGGCCTCTAGGAATGAAGGAGGGTAGTTCGGGGGAGAACGTACTGGGGCGTCAGAGGTGAAGTAACGCCTTTTCAACTCACGGCCTCTAGGAATGAAGGAGGGTAGTTCGGGGGAGAACGTACTGGGGCGTCAGAGGTGAAGTAACGCCTTTTCAACTCACGGCCTCTAGGAATGAAGGAGGGTAGTTCGGGGGAGAACGTACTGGGGCGTCAGAGGTGAAGTAACGCCTTTTCAACTCACGGCCTCTAGGAATGAAGGAGGGTAGTTCGGGGGAGAACGTACTGGGGCGTCAGAGGTGAAGTAACGCCTTTTCAACTCACGGCCTCTAGGAATGAAGGAGGGTAGTTCGGGGGAGAACGTACTGGGGCGTCAGAGGTGAA 160

160

160

160

160

160

ATTCTTAGACCGCACCAAGACGAACTACAGCGAAGGCATTCTTCAAGGATACCTTCCTCAATCAAGAACCAAAGTGTGGA 240

240

240

240

240

240

ATTCTTAGACCGCACCAAGACGAACTACAGCGAAGGCATTCTTCAAGGATACCTTCCTCAATCAAGAACCAAAGTGTGGAATTCTTAGACCGCACCAAGACGAACTACAGCGAAGGCATTCTTCAAGGATACCTTCCTCAATCAAGAACCAAAGTGTGGAATTCTTAGACCGCACCAAGACGAACTACAGCGAAGGCATTCTTCAAGGATACCTTCCTCAATCAAGAACCAAAGTGTGGAATTCTTAGACCGCACCAAGACGAACTACAGCGAAGGCATTCTTCAAGGATACCTTCCTCAATCAAGAACCAAAGTGTGGAATTCTTAGACCGCACCAAGACGAACTACAGCGAAGGCATTCTTCAAGGATACCTTCCTCAATCAAGAACCAAAGTGTGGA

GATCGAAGATGATTAGAGACCATTGTAGTCCACACTGCAAACGATGACACCCATGAATTGGGG-ATCTTATGGGCCGGCC 319

319

319

319

319

319

GATCGAAGATGATTAGAGACCATTGTAGTCCACACTGCAAACGATGACACCCATGAATTGGGG-ATCTTATGGGCCGGCCGATCGAAGATGATTAGAGACCATTGTAGTCCACACTGCAAACGATGACACCCATGAATTGGGGGATCTTATGGGCCGGCCGATCGAAGATGATTAGAGACCATTGTAGTCCACACTGCAAACGATGACACCCATGAATTGGGGGATCTTATGGGCCGGCCGATCGAAGATGATTAGAGACCATTGTAGTCCACACTGCAAACGATGACACCCATGAATTGGGGGATCTTATGGGCCGGCCGATCGAAGATGATTAGAGACCATTGTAGTCCACACTGCAAACGATGACACCCATGAATTGGGGGATCTTATGGGCCGGCC

TGCGGCAGGTTTACCCTGTGTCCAGCACCGCGC 353

353

353

353

353

353

TGCGGCAGGTTTACCCTGTGTCCAGCACCGCGCTGCGGCAGGTTTACCCTGTGTCCAGCACCGCGCTGCGGCAGGTTTACCCTGTGTCCAGCACCGCGCTGCGGCAGGTTTACCCTGTGTCCAGCACCGCGCTGCGGCAGGTTTACCCTGTGTCCAGCACCGCGC

80

80

80

80

81

81

81

81

81

81

161

161

161

161

161

161

241

241

241

241

241

241

320

320

320

320

320

320

Le amazonensis M80293

Le braziliensis M80292

Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017

Figure 3 Nucleotide (nt) alignment of the 353 bp fragment of Leishmania spp DNA from Lu longipalpis (GV05 andGV09) and R norvegicus(GV017) with Le (Viannia) braziliensis (M802921) Le (V) amazonensis (M802931) and Le (Le) infantum (M814301) (syn Le chagasi)Identical nucleotides are represented by dots and nucleotide deletion by a hyphen

DNA sequencing of the 353 pb fragment followed bymultiple alignment with database sequences for Leishmaniaspecies indicated Le infantum the etiological agent of VLas the infecting agent in both pool samples of Lu longipalpis(Figure 3)

Thirty-two small mammals belonging to six distinctspecies were captured during our study (Table 2) Themost abundant species was Rattus norvegicus with almost50 of the captured specimens The 227 bp fragment thatis characteristic of the IRBP gene was amplified in onehundred and nineteen blood and tissue samples from thesmall mammals captured (data not shown) indicating thatDNA extractions were successful in every case After LnPCRamplification the presence of the characteristic 353 pb DNAfragment of Leishmania was verified in one among the 119samples analysed That single sample corresponded to bloodDNA from a R norvegicus specimen captured in January2008 at the site identified in Figure 2 DNA sequencing andmultiple alignments with data base sequences for Leishmaniaspp indicated Le infantum the etiological agent of the VLas the infecting parasite species in the R norvegicus specimen(Figure 3) Leishmania spp amastigotes were not observed inany of the 39 tissue imprints examined

4 Discussion

In the present study we evaluated the epidemiological profilein an urban area endemic forACL in relation to the vector thehosts and the parasite Our entomological survey pointed to

a high proportion of two ACL vector species Lu intermediaand Lu whitmani Lu intermedia reached about 50 ofall female sand flies This finding is in accordance withanother entomological survey also performed in GovernadorValadares [16] Although we did not identify DNA fromany Leishmania species involved in ACL transmission inLu intermedia and Lu whitmani both species may beprobably involved in the transmission of ACL in GovernadorValadaresThe primary vector of VL in Brazil Lu longipalpiswas also found and its presence has also been observed beforein the same municipality [16] DNA from Le infantum theetiological agent of the same disease was detected in two poolsamples of this species The TMI of 25 for Le infantumin Lu longipalpis is consistent with data described by others[17 18]

The infection of domestic and wild mammals by Leinfantum has been studied in order to identify other possiblereservoirs for VL besides dogs [19] Rodent species suchas Rattus rattus (roof rat) and R norvegicus (Norway rat)both nonnative species to South America but well adaptedto human environment stood out as possibilities [20] Thosespecies display consistent characteristics expected for reser-voirs Besides living in colonies they are asymptomatic forleishmaniasis and have a sufficient longevity to maintain theinfectious agent for the required period [21] R rattus wasfound naturally infected by Le donovani and Le infantum inthe Old World [22ndash25] and by Le mexicana Le braziliensisand Le donovani complexes in theNewWorld [26ndash28]Thosefindings indicate thatR rattus is a potential reservoir for bothACL and VL


Although limited in numbers previous studies suggesteda possible role for R norvegicus in the transmission cycleof ACL Besides the identification of Le braziliensis DNAin some rodent specimens [29] experimental inoculationwith Le major led to the development of infection [30] Thenumber of reports most of them restricted to the OldWorldis still smaller regarding R norvegicus infection by Le infan-tum [25 31] A seroprevalence of 333 was reported for Rnorvegicus in Italy [25] Differently a much lower prevalencewas found in Greece and the authors considered it unlikelythat the rodent species might play any role as Leishmaniareservoir [32]Nevertheless two important pointswere raisedregarding low prevalence data of Leishmania infection inrodents [30] Firstly insufficient sensitivity of the tests usedcould account for an underestimation of the prevalence ratesof Leishmania infection Even if that situation is surpassedtoday by the introduction of more modern and sensitivetechniques a second important point still remains In generalthe rodents captured are adults and the susceptibility toinfection may be restricted to young animals Consideringtheir continuous presence in the human environment dueto the proximity of the borrows and to the all-year-roundreproduction the infection of younger rodent specimenseven if transient might increase their role as Leishmaniareservoirs [30]

Although our initial focus was the study of ACL inan endemic area we identified the causative agent of VL(Le infantum) in Lu longipalpis and in R norvegicus inGovernador Valadares The infected pool samples of Lulongipalpis were captured in two distinct urban districts onemore central and the other closer to the Ibiturunarsquos Peak(Figure 1) The urban characteristics of both districts testifythe adaptation of Lu longipalpis to environments modifiedby humans and the urban transmission pattern of VL inGovernador Valadares In a previous study of the local fauna90 of the phlebotomine sand flies captured in GovernadorValadares were Lu longipalpis [33] The presence of Leinfantum DNA in this species of phlebotomine sand fliesindicate the potential of VL transmission in the region

VL is endemic in four of the five geographical regionsof Brazil and in recent years it gained an increased impor-tance in public health due to geographical expansion andurbanization [34 35] Dogs are considered themain domesticreservoirs of VL [36] Wild Lycalopex vetulus and Cerdocyonthous canids and Didelphis albiventrismarsupials were foundnaturally infected by Leishmania in the New World [36ndash38]whereas Canis aureus jackals Canis lupus wolves and Vulpesvulpes foxes have been described as wild hosts of VL in theOld World [39] The presence of Le infantum DNA in Rnorvegicus is reported here for the first time in theNewWorldand it seems possible that these rodents might play a role asVL reservoir The parasite was detected only in blood not inskin samples However it is known that phlebotomine sandflies feed through a pool feeding mechanism and that VLtransmission may occur if the parasite is present in the skinor in the peripheral blood of the reservoir [40] Anywayfuture studies will be needed to clarify any role playedby R norvegicus in VL transmission especially regardingsusceptibility and development of Le infantum infection at

different life cycle stages of that rodent species R norvegicusspecimens accounted for almost 50 of the small mammalscaptured Thus the fact that we did not find LeishmaniaDNA in other species might be due to the small number ofspecimens captured from each one

The Doce River Valley was considered endemic for ACLand VL in the past After successful application of controlmeasures for VL the region was considered under controlaround the 80rsquos [9] The number of human VL cases wasstrongly reduced and restricted to non-autochthonous onesIn the beginning of the 90rsquos however the control programwas interrupted and the epidemiological surveillance was notregularly performed In 2007Malaquias et al [41] suggested apossible reemergency of human VL in Governador Valadaresbased on the high prevalence of canine VL in the urban(137) and rural (124) areas and the confirmation of theparasite in seropositive dogs Very recently higher preva-lences of canine VL were confirmed there by Barata et al [33]reaching up to 534 depending on the district Fifty percentof the seropositive dogs examined were symptomatic

From 2001 to 2006 sixteen cases of human VL wereconfirmed in Governador Valadares Between 2007 and 2013that number increased ten times with 164 cases notified upto now These data demonstrate the urgency of resumptionof control measures in the municipality According to theepidemiological criteria adopted by the Brazilian Ministry ofHealth the average number of human cases ge 44 in the lastfive years characterizes intense transmission of VL and this ispresently the case of Governador Valadares

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This work was partially supported by FAPEMIG FIOCRUZand CNPq The authors acknowledge Ailton Antunes Juniorda Costa for helping with figure formatting and HelbertAntonio Botelho for helping with field captures

References

[1] A P Lima L Minelli U Teodoro and E Comunello ldquoDis-tribuicao da leishmaniose tegumentar por imagens de sensore-amento remoto orbital no Estado do Parana Brasilrdquo AnaisBrasileiros de Dermatologia vol 77 no 6 pp 681ndash692 2002

[2] L Saraiva J S Lopes G B M Oliveira F A Batista A LFalcao and J D Andrade Filho ldquoEstudo dos flebotomıneos(Diptera Psychodidae) em area de leishmaniose tegumentaramericana nos municıpios de Alto Caparao e Caparao estadode Minas Geraisrdquo Revista da Sociedade Brasileira de MedicinaTropical vol 39 no 1 pp 56ndash63 2006

[3] ANA JuniorO Silva J L PMoraes et al ldquoFoco emergente deLeishmaniose Tegumentar (LT) no entorno do ParqueNacionaldos Lencois Maranhenses Nordeste Brasilrdquo Gazeta Medica daBahia vol 79 pp 103ndash109 2009


[4] E C S Vale and T Furtado ldquoLeishmaniose Tegumentar noBrasil revisao historica da origem expansao e etiologiardquo AnaisBrasileiros de Dermatologia vol 80 no 4 pp 421ndash428 2005

[5] F N Guimaraes M Azevedo and R Damasceno ldquoLeishman-iose tegumentar- zoonose de roedores silvestres na AmazoniardquoMemorias do Instituto Oswaldo Cruz vol 66 pp 151ndash168 1968

[6] S P Brandao-Filho F G de Carvalho M E de Brito F AAlmeida and L A Nascimento ldquoAmerican Cutaneous Leish-maniasis in Pernambuco Brasil eco- epidemiological aspectsin lsquoZona da Matarsquo regionrdquoMemorias do Instituto Oswaldo Cruzvol 89 no 3 pp 445ndash449 1994

[7] I A B Vasconcelos A W Vasconcelos N M Fe Filho etal ldquoThe identity of Leishmania isolated from sand flies andvertebrate hosts in a major focus of cutaneous Leishmaniasis inBaturite Northeastern BrazilrdquoTheAmerican Journal of TropicalMedicine and Hygiene vol 50 no 2 pp 158ndash164 1994

[8] T M Miranda L C C Malaquias P M F Escalda et alldquoDescriptive study of American tegumentary Leishmaniasis inthe urban area of the Municipality of Governador ValadaresMinas Gerais State Brazilrdquo Revista Pan-Amazonica de Saudevol 2 no 1 pp 27ndash35 2011

[9] W Mayrink P Williams and M V Coelho ldquoEpidemiology ofdermal Leishmaniasis in the Rio Doce Valley State of MinasGerais Brazilrdquo Annals of Tropical Medicine and Parasitologyvol 73 no 2 pp 123ndash137 1979

[10] U Teodoro T G V Silveira D R Santos et al ldquoFrequencia dafauna de flebotomıneos no domicılio e em abrigos de animaisdomesticos no peridomicılio nos municıpios de Cianorte eDoutorCamargo Estado doParana BrasilrdquoRevista de PatologiaTropical vol 30 no 2 pp 209ndash224 2001

[11] H Pugedo R A Barata J C Franca-Silva J C Silva and ES Dias ldquoHP um modelo aprimorado de armadilha luminosade succao para a captura de pequenos insetosrdquo Revista daSociedade Brasileira de Medicina Tropical vol 38 no 1 pp 70ndash72 2005

[12] R M M A Lins S G Oliveira N A Souza et al ldquoMolecularevolution of the cacophony IVS6 region in sandfliesrdquo InsectMolecular Biology vol 11 no 2 pp 117ndash122 2002

[13] E C Ferreira C M Gontijo I Cruz M N Melo and A MSilva ldquoAlternative PCR protocol using a single primer set forassessing DNA quality in several tissues from a large variety ofmammalian species living in areas endemic for LeishmaniasisrdquoMemorias do InstitutoOswaldoCruz vol 105 no 7 pp 895ndash8982010

[14] G J J M van Eys G J Schoone N C M Kroon and S BEbeling ldquoSequence analysis of small subunit ribosomal RNagenes and its use for detection and identification of LeishmaniaparasitesrdquoMolecular and Biochemical Parasitology vol 51 no 1pp 133ndash142 1992

[15] I Cruz C Canavate J M Rubio et al ldquoA nested polymerasechain reaction (Ln-PCR) for diagnosing monitoring Leishma-nia infantum infection in patients co-infected with humanimmunodeficiency virusrdquo Transactions of the Royal Society ofTropical Medicine and Hygiene vol 96 no 1 pp 185ndash189 2002

[16] R A Barata G F Paz M C Bastos et al ldquoPhlebotominesandflies (Diptera Psychodidae) in Governador Valadares atransmission area for American tegumentary Leishmaniasis inState of Minas Gerais Brasilrdquo Revista da Sociedade Brasileira deMedicina Tropical vol 44 no 2 pp 136ndash139 2011

[17] J CMiranda E Reis A Schriefer et al ldquoFrequency of infectionof Lutzomyia phlebotomines with Leishmania braziliensis ina Brazilian endemic area as assessed by pinpoint capture and

polymerase chain reactionrdquo Memorias do Instituto OswaldoCruz vol 97 no 2 pp 185ndash188 2002

[18] Y N Oliveira-Pereira J M M Rebelo J L P Moraes and S RF Pereira ldquoDiagnostico molecular da taxa de infeccao naturalde flebotomıneos (Psychodidae Lutzomyia) por Leishmania spna Amazonia maranhenserdquo Revista da Sociedade Brasileira deMedicina Tropical vol 39 pp 540ndash543 2006

[19] R J Quinnell and O Courtenay ldquoTransmission reservoir hostsand control of zoonotic visceral Leishmaniasisrdquo Parasitologyvol 136 no 14 pp 1915ndash1934 2009

[20] R B Mackenzie ldquoPublic health importance of rodents in SouthAmericardquo Bulletin of the World Health Organization vol 47 no2 pp 161ndash169 1972

[21] R W Ashford ldquoLeishmaniasis reservoirs and their significancein controlrdquo Clinics in Dermatology vol 14 no 5 pp 523ndash5321996

[22] E Pozio L Gradoni S Bettini andM Gramiccia ldquoLeishmani-asis in Tuscany (Italy) V Further isolation of Leishmania fromRattus rattus in the province of Grossetordquo Annals of TropicalMedicine and Parasitology vol 75 no 4 pp 393ndash395 1981

[23] B El Adhami ldquoIsolation of Leishmania from a black rat in theBaghdad area IraqrdquoThe American Journal of Tropical Medicineand Hygiene vol 25 no 5 pp 759ndash761 1976

[24] E A Ibrahim M A Al-Zahrani A S Al-Tuwaigri F J Al-Shammary and D A Evans ldquoLeishmania infecting man andwild animals in Saudi Arabia 9 The black rat (Rattus rattus) aprobable reservoir of visceral Leishmaniasis in Gizan provincesouth-west Saudi Arabiardquo Transactions of the Royal Society ofTropical Medicine and Hygiene vol 86 no 5 pp 513ndash514 1992

[25] C Di Bella F Vitale G Russo et al ldquoAre rodents a potentialreservoir for Leishmania infantum in Italyrdquo Journal of Moun-tain Ecology vol 7 pp 125ndash129 2003

[26] E J Alencar E P Pessoa and Z F Fontenele ldquoInfeccao naturalde Rattus rattus alexandrinus por Leishmania (provavelmenteL braziliensis) em zona endemica de leishmaniose tegumentardo Estado do Ceara Brasilrdquo Revista do Instituto de MedicinaTropical de Sao Paulo vol 2 pp 347ndash348 1960

[27] AM Zulueta E Villarroel N Rodriguez et al ldquoEpidemiologicaspects of American visceral leishmaniasis in na endemicfocus in eastern Venezuelardquo The American Journal of TropicalMedicine and Hygiene vol 61 no 6 pp 945ndash950 1999

[28] F S Oliveira C Pirmez M Q Pires R P Brazil and R SPacheco ldquoPCR-based diagnosis for detection of Leishmania inskin and blood of rodents from an endemic area of cutaneousand visceral Leishmaniasis in Brazilrdquo Veterinary Parasitologyvol 129 no 3-4 pp 219ndash227 2005

[29] A PMarcelino E C Ferreira J S Avendanha et al ldquoMoleculardetection of Leishmania braziliensis in Rattus norvegicus in anarea endemic for cutaneous Leishmaniasis in BrazilrdquoVeterinaryParasitology vol 183 no 1-2 pp 54ndash58 2011

[30] S H Giannini ldquoInduction and detection of Leishmanial infec-tions in Rattus norvegicusrdquo Transactions of the Royal Society ofTropical Medicine and Hygiene vol 79 no 4 pp 458ndash461 1985

[31] Z Petrovic A Bordjoski and Z Savin ldquoLes resultats derecherches sur le reservoir de Leishmania donovani dans uneregion endemique du Kala-azarrdquo in Proceedings of the 2ndEuropean Multicolloquy of Parasitology vol 2 pp 97ndash98 1975

[32] E Papadogiannakis G Spanakos V Kontos P G MenounosN Tegos and N Vakalis ldquoMolecular detection of Leishma-nia infantum in wild rodents (Rattus norvegicus) in GreecerdquoZoonoses and Public Health vol 57 no 7-8 pp 23ndash25 2010


[33] R A Barata J C Peixoto A Tanure et al ldquoEpidemiologyof visceral Leishmaniasis in a reemerging focus of intensetransmission in Minas Gerais State Brazilrdquo BioMed ResearchInternational vol 2013 Article ID 405083 6 pages 2013

[34] C M F Gontijo and M N Melo ldquoLeishmaniose visceral noBrasil quadro atual desafios e perspectivasrdquo Revista Brasileirade Epidemiologia vol 7 no 3 pp 338ndash349 2004

[35] M B G Furlan ldquoEpidemia de leishmaniose visceral nomunicıpio de Campo Grande- MS 2002 a 2006rdquo Epidemiologiae Servicos de Saude vol 19 no 1 pp 16ndash25

[36] L M Deane and M P Deane ldquoEncontro de leishmanias nasvısceras e na pele de uma raposa em zona endemica de calazarnos arredores de Sobral Cearardquo O Hospital vol 45 no 4 pp419ndash421 1954

[37] R Lainson J J Shaw F T Silveira and R R Braga ldquoAmericanvisceral Leishmaniasis on the origin of Leishmania (Leish-mania) chagasirdquo Transactions of the Royal Society of TropicalMedicine and Hygiene vol 81 no 3 p 517 1987

[38] I A Sherlock J C Miranda M Sadigursky and G GrimaldiJunior ldquoNatural infection of the opossum Didelphis albiven-tris (Marsupialia Didelphidae) with Leishmania donovani inBrazilrdquo Memorias do Instituto Oswaldo Cruz vol 79 no 4 p511 1984


[40] Brazilian Ministry of Health Manual of Surveillance andControl of Visceral Leishmaniasis Ministry of Health BrasiliaBrazil 2006

[41] L C C Malaquias R Do Carmo Romualdo J B Do Anjos JrR CGiunchetti R Correa-Oliveira andA B Reis ldquoSerologicalscreening confirms the re-emergence of canine leishmaniosisin urban and rural areas in Governador Valadares Vale do RioDoce Minas Gerais Brazilrdquo Parasitology Research vol 100 no2 pp 233ndash239 2007

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


lowastlowast

lowast

lowastlowastlowast

lowastlowast

Doce River

Doce River

1

23

4

5

6

7

8 9

10

11

12

13

14

15

1617

Figure 1 Geographical location of Governador Valadares munic-ipality in the state of Minas Gerais Brazil Sites of capture ofphlebotomine sand flies (pink circles) and small mammals trapping(black stars) in the districts under study (identified with black dotsand numbers) Lu longipalpis samples infected by Le infantumwerecaptured at sites 3 and 15R norvegicus equally infectedwas capturedat site 14

Leishmania species The area was chosen based on the highnumbers (241 cases between 2001 and 2006) of human casesof ACL in the last decade [8] and on the peculiar patternof urban transmission in that region since most humancases of ACL are registered in residents from the urban areawith little or no contact with forested environments [9]A set of features in the districts selected in our study areknown to favor the occurrence of sand flies and mammalianreservoirs of Leishmania domestic animal shelters very closeto human dwellings lack of basic hygienic conditions aroundthe houses and close location to forest remnants [10]

2 Material and Methods

21 Study Area and Phlebotomine Sand Fly CapturesThe municipality of Governador Valadares (18∘5110158401210158401015840S41∘5610158404210158401015840W) is located in the administrative region of theVale do Rio Doce (Doce River Valley) in the Brazilianstate of Minas Gerais (Figure 1) The city is an importantsocioeconomic pole of the region with 2349Km2 of area and260000 inhabitants

Nonsystematic entomological captures were performedin 17 districts of Governador Valadares (Figure 1) basedon previous records of human cases of ACL HP traps[11] were installed in the peridomiciles from 400 pm to800 am for two consecutive days during nine months(MarchAprilMayOctoberNovemberDecember of 2009JanuaryFebruaryMarch of 2010)The captured female phle-botomine sand flies were stored in 6 DMSO under liquidnitrogen After dissection for species identification a varyingnumber of individuals from the same species and capture siteware pooled and tested for the presence of Leishmania sppDNA

22 Small Mammal Captures (Reservoir) Six captures wereperformed bimonthly between January and December 2008

using forty Tomahawk traps baited with banana and codliver oil The traps were distributed in eight sites in theperidomiciles (two traps per site) from 400 pm to 800 amfor three consecutive nights The captures were repeated inJanuary and March 2010 Blood ear and tail skins liver andspleen samples and bone marrow aspirates were collectedfrom the captured animalsThe blood samples were collectedin EDTA Other tissue samples were immediately used toprepare slide imprints which were stained with Giemsa aftermethanol fixation or stored in microtubes with saline con-taining antibiotics (100120583gmLof streptomycin and 500UmLof penicillin) The field captures were previously licensedby the Brazilian Institute of Environment and RenewableNatural Resources (IBAMA license 15407)

23 Extraction of Genomic DNA Total genomic DNA wasextracted from the female sand flies and from mammaliantissues using the Illustra Tissue and Cells genomicPrep MiniSpin kit (GE HealthCare) according to the manufacturerrsquosinstructions

24 Amplification of Constitutive Genes Genus-specificprimers for Lutzomyia (5Llcac 51015840 GTG GCC GAA CAT AATGTT AG 31015840 e 3Llcac 51015840 CCA CGA ACA AGT TCA ACA TC31015840) were used to amplify the IVS6 region (cacophony) of thephlebotomine sand fly DNA [12] For small mammals theDNA amplification was performed with primers (51015840 TCCAAC ATC ACC ACC ACT GAG TGG AC 31015840 and 5 AAGAAA TCG AGG GTG GAC TGG CC 31015840) for the IRBP gene[13] All the amplifications were performed with the PureTaqIllustra Ready-To-Go PCR Beads (GE Healthcare) for 35cycles under annealing temperature of 55∘C for 30 sec ina Perkin-Elmer thermocycler GeneAmpPCRSystem-2400Negative (no DNA) and positive (Lutzomyia or dog skinDNA) controls were included in every set of reactions Theamplified samples were submitted to electrophoresis on 2agarose gels containing ethidium bromide

25 Leishmania Nested PCR (LnPCR) Targeted to the SSU-rRNA Gene A first amplification step was performed withspecific (R221 and R332) primers for the order Kinetoplastidabut not exclusively for Leishmania [14 15]The amplificationsconditions were denaturation at 94∘C for 5min followedby 30 cycles of 30 seg at 94∘C 60∘C and 72∘C and afinal extension at 72∘C for 5min The resulting amplificationproduct of 603 bpwas used as template in a second reaction inthe presence of Leishmania-specific (R223 and R333) primers[14 15] The reaction conditions were the same as beforeexcept for an increased annealing temperature of 65∘C Thefinal reaction resulted in a 353 bp fragment thatwas visualizedafter electrophoresis on 2 agarose gel and ethidiumbromidestaining For the amplifications we used the pureTaq IllustraReady-To-Go PCRBeads kit (GEHealthcare) and every set ofreactions included a negative (noDNA) and a positive (Leish-mania braziliensisMHOMBR75M2903DNA) control

26 DNA Sequencing for Leishmania Species IdentificationLnPCR amplified fragments were extracted from agarose gels










3 Results



M 1 2 3 NC PC

353bp







160

160

160

160

160


240

240

240

240

240



319

319

319

319

319



353

353

353

353

353


80

80

80

80

81

81

81

81

81

81

161

161

161

161

161

161

241

241

241

241

241

241

320

320

320

320

320

320



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017




4 Discussion













Acknowledgments


References


















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

























3 Results



M 1 2 3 NC PC

353bp







160

160

160

160

160


240

240

240

240

240



319

319

319

319

319



353

353

353

353

353


80

80

80

80

81

81

81

81

81

81

161

161

161

161

161

161

241

241

241

241

241

241

320

320

320

320

320

320



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017




4 Discussion













Acknowledgments


References


















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




















160

160

160

160

160


240

240

240

240

240



319

319

319

319

319



353

353

353

353

353


80

80

80

80

81

81

81

81

81

81

161

161

161

161

161

161

241

241

241

241

241

241

320

320

320

320

320

320



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017



Le infantum M81430

Lu longipalpis GV05

Lu longipalpis GV09

R norvegicus GV017




4 Discussion













Acknowledgments


References


















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

























Acknowledgments


References


















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of






























































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















Leishmania infantum (syn. Le. chagasi) in Brazil...Leishmania (Leishmania) infantum (syn....

Documents

Transcript of Leishmania infantum (syn. Le. chagasi) in Brazil...Leishmania (Leishmania) infantum (syn....