elo

y,

ebrine

Organ loss is an evolutionary phenomenon commonly observed in all kinds of multicellular organisms. Across the angiosperms,petals have been lost several times over the course of their diversication. We examined the evolution of petal and stamen identity

parts in this strange condition, bearing the stamp of inutil- eral families of angiosperms exhibit a highly reduced peri-

lies Piperaceae and Saururaceae.Floral organ identity genes were rst described in the

model angiosperms Antirrhinum majus and Arabidopsis tha-liana, leading to the proposal of the ABC model of owerdevelopment (Coen and Meyerowitz, 1991). According tothis model, oral organ identity is determined by the over-

q Sequence data from this article have been deposited in GenBank underAccession Nos. EF424560EF424580.* Corresponding author. Present address: Division of Biological Sci-

ences, 109 Tucker Hall, University of Missouri-Columbia, Columbia, MO65211, USA.

E-mail address: jaramilloa@missouri.edu (M.A. Jaramillo).

Molecular Phylogenetics and Evolutity, are extremely common, or even general, throughout

nature (Darwin, 1859, pp. 454).

The loss of organs and physiological capacities has beencommon throughout evolution. Many of these changes arethe result of adaptation to the environment. Followingsuch losses, we may expect purifying selection to be relaxedon genes previously involved in the production of lost fea-tures. Some of the most striking examples of such lossinclude the absence of eyes in animals living in dark places

anth (the sterile organs: sepals and petals), a commonadaptation to wind pollination (e.g. grasses, oaks). Thiscase is particularly interesting since oral organ identitygenes function in two contiguous whorls. Petal identitygenes, for instance, are also responsible for stamen identity(Bowman et al., 1989), providing a double constraint onthe evolution of these genes. We have studied the molecularevolution of petal and stamen identity genes in the orderPiperales, a group that includes the Aristolochiaceae witha well-developed perianth as well as the perianthless fami-genes in the Piperales, a basal lineage of angiosperms that includes the perianthless (with no petals or sepals) families Piperaceaeand Saururaceae as well as the Aristolochiaceae, which exhibit a well-developed perianth. Here, we provide evidence for relaxationof selection on the putative petal and stamen identity genes, homologs of APETALA3 and PISTILLATA, following the loss of petalsin the Piperales. Our results are particularly interesting as the B-class genes are not only responsible for the production of petals butare also central to stamen identity, the male reproductive organs that show no modication in these plants. Relaxed purifying selec-tion after the loss of only one of these organs suggests that there has been dissociation of the functional roles of these genes in thePiperales. 2007 Elsevier Inc. All rights reserved.

Keywords: APETALA3; PISTILLATA; B-class genes; Piperales; Petal loss; Relaxed selection

1. Introduction

Rudimentary, atrophied, or aborted organsOrgans or

and the loss of photosynthetic capacities in parasitic plants(Jeery, 2001; Mathews, 2005). Floral organ loss is anothergood example of this type of adaptation. For example, sev-Molecular evolution of the petal andand PISTILLATA, after p

M. Alejandra Jaramil

Department of Organismic and Evolutionary Biolog

Received 1 August 2006; revised 8 FAvailable onl

Abstract1055-7903/$ - see front matter 2007 Elsevier Inc. All rights reserved.doi:10.1016/j.ympev.2007.03.015stamen identity genes, APETALA3tal loss in the Piperales q

*, Elena M. Kramer

Harvard University, Cambridge, MA 02138, USA

uary 2007; accepted 16 March 20074 April 2007

www.elsevier.com/locate/ympev

ion 44 (2007) 598609

lapping and combinatorial action of three types of genefunctions: A type genes alone determine sepals; A + B, pet-als; B + C, stamens; and C alone, carpels. Most of thegenes corresponding to these functions, with the exceptionof APETALA2, are members of the MADS-box family oftranscription factors (reviewed in Jack, 2004). More specif-ically, they are classied as MIKC-type or type II of plantMADS-box genes (Alvarez-Buylla et al., 2000). The abbre-viation MIKC refers to the four conserved domains presentin these genes. The MADS (M) domain contains 63 aa andis involved in DNA binding and protein dimerization(Riechmann et al., 1996b). The intervening (I) and kera-tin-like (K) domains are critical for dimerization (Riech-mann et al., 1996a). The C-terminal (C) region containsshort, highly conserved motifs and has been implicated inthe formation of higher-order protein complexes (Egea-Cortines et al., 1999; Honma and Goto, 2001).

The best-studied lineage of theMIKC-type genes in terms

2004; Kramer et al., 2003, 1998; Stellari et al., 2004).Two of the most signicant of these are the duplicationthat originated the independent APETALA3 and PISTIL-LATA lineages before the origin of the angiosperms (Aokiet al., 2004; Kim et al., 2004; Stellari et al., 2004) and,within the angiosperms, the duplication that gave rise tothe euAP3 and TM6 lineages within the core eudicots(Fig. 1a; Kramer et al., 1998, 2006). These lineages arecharacterized by the presence of conserved motifs in theC-terminal region known as the PI, paleoAP3 and euAP3motifs (Kramer et al., 1998). The paleoAP3 motif repre-sents the ancestral condition for the AP3 lineage, and itwas replaced by the euAP3 motif in the core eudicots (Kra-mer et al., 1998, 2006; Vandenbussche et al., 2003). Mostinformation concerning B-gene function comes from mem-bers of the euAP3 lineage, specically from the ArabidopsisAPETALA3, and comparatively little is known about themembers of the paleoAP3 lineage (reviewed in Kramer

ts + AN

et aajo

M.A. Jaramillo, E.M. Kramer / Molecular Phylogenetics and Evolution 44 (2007) 598609 599of both its evolutionary history and genetic function is theclade of B-class genes. This clade includes two closely relatedparalogous lineages represented in Arabidopsis by the genesAPETALA3 (AP3) and PISTILLATA (PI) (Bowman et al.,1989) and in Antirrhinum by the respective homologs DEF-ICIENS (DEF) and GLOBOSA (GLO) (Sommer et al.,1990; Trobner et al., 1992). In both species these genes havebeen shown to function as obligate heterodimers to establishthe identity of petals and stamens (Riechmann et al., 1996a;Zachgo et al., 1995). The genes exhibit auto- and cross-regu-latory interactions and are co-expressed after the initiationphase of transcription (Goto and Meyerowitz, 1994; Jacket al., 1994; Zachgo et al., 1995). In the petals of ArabidopsisandAntirrhinum, their continuous co-expression is necessaryin every cell tomaintainorgan identity (Jenik and Irish, 2001;Zachgo et al., 1995).

The evolutionary history of the B-class genes involvesmultiple gene duplication events at dierent taxonomiclevels (Aoki et al., 2004; Becker et al., 2002; Kim et al.,

euAP3

TM6

paleoAP3

PI

Core Eudicots

Lower eudicoMagnoliidae +

Bsister

Gymno B

a

Fig. 1. (a) A simplied phylogeny of the AP3/PI subfamily based on AokiGray circles represent duplications. The AP3 lineage is composed of three m

in the core eudicots. (b) A simplied phylogeny showing all of the families samand Nickrent et al. (2002).and Jaramillo, 2005). However, functional evidence hasbeen obtained in the derived monocots Zea and Oryzawhich suggests that AP3 and PI homologs play a con-served role in the identity of stamens and petal-derivedorgans (Ambrose et al., 2000; Kang et al., 1998; Nagasawaet al., 2003). Furthermore, in various species of basal eudi-cots and magnoliid dicots these genes are expressed in pet-aloid organs (Jaramillo and Kramer, 2004; Kim et al.,2005; Kramer et al., 2003; Kramer and Irish, 1999). Onthe other hand, the expression of AP3 and PI homologsoutside the core eudicots exhibits a much more dynamicpattern, both in time and space, than the homogeneousexpression of the B-class homologs within core eudicots(Jaramillo and Kramer, 2004; Kramer and Irish, 1999,2000). Additionally, there is evidence for functional homo-dimerization of the PI homologs in the monocots Liliumand Tulipa (Kanno et al., 2003; Winter et al., 2002). Theseresults suggest that the B-function is conserved in manyaspects but it has also been modied over time.

ITA

PiperaceaeSaururaceaeHydnoraceaeLactoridaceaeAristolochiaceaeWinteraceae

MagnoliaceaeCalycanthaceae

ChloranthaceaeAlismataceae

IlliciaceaeNymphaeaceaeAmborellaceae

b

l. (2004), Kim et al. (2004), Kramer et al. (1998), and Stellari et al. (2004).r sublineages: paleoAP3, euAP3, and TM6. The latter two are only found

pled in this analysis, based on Borsch et al. (2003), Jaramillo et al. (2004),

hylThe perianthless Piperales provide a unique opportunityto investigate the evolution of petal and stamen identitygene lineages after the loss of the perianth. The Piperalesare a well-supported clade among the most basal lineagesof angiosperms (Borsch et al., 2003; Soltis et al., 2000).In the current circumscription (sensu APG, 2003), the Pipe-rales include the perianthlesslacking both petals andsepalsfamilies Piperaceae (black pepper family) andSaururaceae (lizards-tail family), as well as taxa with awell-developed perianth, the Aristolochiaceae (Dutchmanspipes), the monotypic Lactoris, and the parasitic familyHydnoraceae (Jaramillo et al., 2004; Nickrent et al.,2002; Soltis et al., 2000). The phylogenetic relationshipswithin the Piperales are well resolved, with the perianthlessmembers of the order forming a well-supported clade sisterto the other families that possess a perianth (Fig. 1b, Bors-ch et al., 2003; Jaramillo et al., 2004). The phylogeneticrelationships of the basal lineages of angiosperms suggestthat the perianthless condition of the Piperaceae andSaururaceae is derived within the Piperales. The othermembers of the order, Aristolochiaceae, Hydnoraceae,and Lactoris, as well as the members of the sister orderCanellales have a well-developed perianth composed ofone or more whorls of organs (Doyle and Endress, 2000;Zanis et al., 2003). Detailed developmental studies haveshown that perianth loss is complete in Piperaceae andSaururaceae as their owers do not show any vestigialstructures either at maturity or during development(Tucker and Douglas, 1993). One might predict that theevolutionary pressures on APETALA3 and PISTILLATAhave been relaxed in the perianthless Piperales as thesegenes are freed from their petal identity function.

In this study, we have examined the molecular evolu-tion of the B-class gene lineages, APETALA3 andPISTILLATA, in the order Piperales to determine if selec-tive pressures were relaxed after the loss of the perianth.We also examine the molecular evolution of the nucleargene PHYTOCHROME C, to test the possibility thatchanges in evolutionary constraints are a more generalfeature of the perianthless Piperales. Phytochromes arephotoreceptors for red and far-red light that are impor-tant in plant photomorphogenesis (reviewed in Mathewset al., 2003). PHYC is a nuclear locus that would notbe expected to be evolving in relation to oral morphol-ogy, thus it provides a control for the analysis of molec-ular evolution of the B-class genes. Tests of selectionprovide evidence that purifying selection on APETALA3and PISTILLATA is relaxed in the perianthless Piperales,and this does not seem to be a generalized feature fornuclear genes in this group of plants.

2. Materials and methods

2.1. Taxon sampling

600 M.A. Jaramillo, E.M. Kramer / Molecular PWe sampled taxa from across the basal lineages ofangiosperms. We included at least one species of each fam-ily in the order Piperales, except for Lactoridaceae andHydnoraceae for which ower material was not available.Floral buds were collected over a broad range of develop-mental stages from Aristolochia manshuriensis, Ar. tomen-tosa, Ar. promissa, Asarum speciosum, and A. splendens,growing in the Arnold Arboretum, the experimental gar-den at Harvard University, or the Botanical Garden ofBonn (Germany). Leaf material for DNA extraction andamplication of the PHYTOCHROME C locus was col-lected from the same plants. DNA was also extracted forthe following species A. canadense, Piper magnicum,A. splendens, A. europaeum. Sequences for other basalangiosperm representatives were obtained from Genbank(see Supplementary material for accession numbers).

2.2. Sequence data

2.2.1. Isolation of APETALA3 (AP3) and PISTILLATA

(PI) homologs

Isolation of AP3 and PI homologs was performed usingan RT-PCR approach similar to that described in Stellariet al. (2004). Floral RNA was isolated from frozen oralbuds. Initial amplication of rst-strand cDNA used oneof two degenerate forward primers: primer 1,50GGIMGIGGIAARATIGARATIAARMGIAT, or primer 2,50ATGGSIMGIGGIAARATISARAT, and a poly-T reverse primer,50CCGGATCTCTAGACGGCCGC(T)17. The productsof this primary PCR were cloned into TOPO-TA PCRcloning vectors (Invitrogen, Carlsbad, CA, USA). For eachtaxon, 100400 clones of >650 bp were characterized bysequencing (BigDye Terminator v3.0, ABI prism 3100,Applied Bioscience, Foster City, CA), and/or restrictionanalysis. At least ve independent clones were sequencedfor every putative locus. All cDNA sequences have beendeposited in GenBank under Accession Nos. EF424560EF424573.

2.2.2. Amplication of PHYTOCHROME C (PHYC)Total DNA was isolated from silica gel dried material

of plants collected in the eld or in living collections.DNA extractions were conducted using either a modiedCTAB (hexadecyl trimethyl ammonium bromide) methodof Doyle and Doyle (Doyle and Doyle, 1987) or theDNeasy Plant Mini kit (Qiagen Corporation, Valencia,CA). Amplications were conducted using PHYCupstream (c230f) and downstream (c623r) primers (Math-ews and Donoghue, 1999). The products of this PCR werecloned into TOPO-TA PCR cloning vectors (Invitrogen,Carlsbad, CA, USA), and four clones were sequencedper taxon. For all taxa, sequenced here, the multipleclones presented identical sequences, thus only onesequence per taxon was used for the nal analysis.Sequencing was conducted using the ABI PRISM 3100Genetic Analyzer according to the protocols providedby the manufacturer (Applied Bioscience, Foster City,

ogenetics and Evolution 44 (2007) 598609CA). Sequences were deposited in Genbank under Acces-sion Nos. EF424574EF424580.

hyl2.3. Phylogenetic analysis

Sequences were aligned manually using published AP3,PI (Stellari et al., 2004) and PHYC (Mathews and Donog-hue, 1999) alignments as a reference. Taking into consider-ation both nucleotide and amino acid sequences (seeSupplementary material for NEXUS les and accessionnumbers), full-length nucleotide alignments containing allnew and previously identied AP3, PI, and PHYC homo-logs for Piperales and other basal angiosperms, wereconstructed.

Bayesian phylogenetic analyses were conducted on thenucleotide alignments using the program MRBAYESv3.0 (Huelsenbeck and Ronquist, 2002). The best modelof evolution was determined using the Akaike InformationCriterion as implemented by Modeltest v3.06 (Posada andCrandall, 1998). The model of DNA substitution selectedfor all genes was GTR + I + G, which assumes generaltime reversibility (GTR), a certain proportion of invariablesites (I) and a discrete gamma approximation of the rate-variation among sites (G). We ran four chains of theMarkov chain Monte Carlo, sampling one tree every 500generations for one million generations starting with a ran-dom tree. Searches converged after about 3000 generations,however we considered a conservative burn-in period of100,000 generations. A total of 1801 trees were used toobtain the consensus topology for each analysis. Trees wererooted using sequences of Amborella trichopoda, as thistaxon has been repetitively identied as the sister to allother owering plants (Graham and Olmstead, 2000; Hiluet al., 2003; Soltis et al., 1999). We used the ShimodairaHasegawa (SH) test of topology (Shimodaira and Hase-gawa, 1999), as implemented in PAUP*4.0 (Swoord,2002), to determine if the B-class gene phylogenies wereconsistent with the known organismic phylogenies. Thesetests are based on maximum likelihood (ML) approachesthat use the likelihood ratio test (LRT) to evaluate if twocompeting topologies are equally supported by the data set.

2.4. Maximum likelihood test of selection

The ratio of non-synonymous (amino acid replacement;dN) versus synonymous (silent; dS) substitutions (x =dN/dS), is a measure of the selective pressure during genelineage evolution. This ratio is expected to be close toone under neutral evolution (Kimura, 1983). Divergencefrom this expectation is indicative of purifying selection(x < 1), or positive selection (x > 1). We used a tree-basedmaximum likelihood approach, as implemented in PAML(Yang, 1997), to test for changes in selection constraintsin the perianthless Piperales. We compared a one-ratiomodel, which assumes the same ratio (x) for all branches,with a two-ratio model that assumes one-ratio for the peri-anthless Piperales and another for all other branches. Thetest was conducted for the entire genes and also for each

M.A. Jaramillo, E.M. Kramer / Molecular Pof the functional domains dened for AP3 and PI genes.These analyses on each of the M, I, K, and C domains wereperformed in order to evaluate if there was a dierence inselection pressure on one or more of the distinct regions.

3. Results

3.1. B-class gene lineages

Bayesian phylogenetic analyses of the AP3 and PI oral-ly expressed homologs produced consensus reconstructionswith strong posterior probability support (>0.90) for mostbranches in the Piperales (Figs. 2 and 3). Both phylogeniesindicate several independent events of gene duplication.Within Aristolochiaceae, the species Ar. manshuriensisand Ar. tomentosa have two copies of AP3 and PI each.These paralogs are derived from a common and relativelyrecent duplication event, consistent with members of a tet-raploid clade within the genus Aristolochia (Gregory,1956). Within the family Piperaceae, we also recoveredtwo very similar copies of AP3 for Pi. nigrum. The presenceof these copies may similarly be related to issues of ploidy,as this species is reported to be tetraploid (Samuel et al.,1986). This pattern of multiple copies of B-class genehomologs is similar to the independent duplicationsdescribed for the Houttuynia PI homologs, and DrimysPI and AP3 homologs (Stellari et al., 2004), which are alsoassociated with changes in ploidy levels (Bennett andLeitch, 1995; Bennett et al., 1982; Sun et al., 1990). Thereis additional evidence for older gene duplication eventswithin both the AP3 and PI lineages of the Piperaceaeand Saururaceae (see below). Overall, the B-class genehomologs of the perianthless Piperales (families Saurura-ceae and Piperaceae) are more divergent relative to thoseof other basal angiosperms, as judged by their longbranches. Branch lengths among perianthless Piperalestaxa are at least twice or even 10 times longer than thosefound in other families, including the closely related familyAristolochiaceae.

Phylogenetic reconstructions for both the AP3 and PIhomologs included a well-supported (with posterior proba-bility, PP = 1.0) clade comprising the perianthless Piperales(Figs. 2 and 3). However, the phylogenetic relationshipsboth within the broader Piperales and within each familyconict with known organismic phylogenies (Borschet al., 2003; Jaramillo et al., 2004; Qiu et al., 2000). Forthe AP3 dataset, the Piperales sequences are monophyleticbut homologs of the Aristolochiaceae, Piperaceae, andSaururaceae do not each form monophyletic clades. ThePI dataset is even more complicated in that the PI homo-logs of the Piperales are not monophyletic, nor are the fam-ilies Piperaceae and Aristolochiaceae. We used the SH test(Shimodaira and Hasegawa, 1999) to evaluate if there aresignicant dierences between the gene and organismicrelationships. Trees on which we constrained the Aristolo-chiaceae or Piperaceae AP3 homologs to be monophyleticare not signicantly dierent from the reconstructions

ogenetics and Evolution 44 (2007) 598609 601shown here. However, if we constrained the AP3 homologsof Saururaceae to be monophyletic the resulting tree is sig-

HAri

Wi

1

hylArtAP3-1

ArmAP3-1

ArtAP3-2

ArmAP3-2

AreAP3

ArpAP3

TtsAP3

AsplAP3

AspeAP3

AeAP3-1

SrhAP3

DrwAP3-3

DrwAP3-2

1.00

0.98

1.00

1.00

1.00

1.00

1.00

0.96

0.95

1.001.00

1.00

1.001.00

602 M.A. Jaramillo, E.M. Kramer / Molecular Pnicantly dierent from the phylogeny obtained here, asjudged by the SH test (Table 1). Phylogenies where thePiperales PI homologs are constrained to be monophyleticare not signicantly dierent from the reconstructionshown here, but trees where the Aristolochiaceae and Pip-eraceae PI homologs are each constrained to be monophy-letic are signicantly dierent to the trees obtained here(Table 1). These results are consistent with relativelyancient duplications having occurred in both lineages.The AP3 and PI phylogenies indicate that duplicationevents pre-dated the split between Saururaceae and Pipera-ceae (circles Figs. 2 and 3) and, as previously described byStellari et al. (2004), there may have been another, evenolder duplication in the PI lineage, which is representedby the Thottea locus TtsPI2. There could be several expla-nations for the fact that we have not recovered all paralogsfor all sampled taxa. The rst two relate to the RT-PCRmethodology: paralogs that are expressed at extremelylow levels or strictly outside the inorescence may havebeen missed in our initial RT-PCR screen, or, given the

DrwAP3-1

DrwAP34

MpMADS7

LtAP3

CfAP3-1

CfAP3-2

CsAP3

IhAP3-3

IhAP3-2

IhAP3-1

NymAP3

AmAP30.1 substitutions/site

Ma

Ca

Ch

1.00

1.00

1.00

0.90Illiciacea

NymAmborellaceae

Fig. 2. Phylogenetic reconstruction of AP3 homologs from basal angiosperms.loci are labeled on the right as to their families of origin. The box indicates thAristolochia tomentosa; Arm, Ar. Manshuriensis; Are, Ar. eriantha; Sh, Papr: ASc, Saururus chinensis; Aspl, Asarum splendens; Aspe, Asarum speciosum; SrhCalycanthus oridus; Cs, Chloranthus spicatus; Ih, Illicium henryi; Nym, NympPpnAP3-1.1

PpnAP3-1.2

PhAP3

tcAP3

ScMADS651

PpnAP3-2

Piperaceae

Saururaceae

stolochiaceae

nteraceae

Piperaceae

Aristolochiaceae

1.00.00

ogenetics and Evolution 44 (2007) 598609high degree of sequence divergence among the PiperaceaeB-class homologs, some paralogs may have been misseddue to bias in our primers. Alternatively, it is possible thatsome paralogs may have been truly lost through pseudo-gene formation.

3.2. PHYTOCHROME C phylogeny

Bayesian reconstruction of the PHYC phylogenetic rela-tionships is in agreement with the organismic phylogeniesfor the Piperales. High posterior probabilities support mostbranches in the consensus reconstruction (Fig. 4). All spe-cies sampled had only one copy of the PHYC gene. Thisresult is somehow unexpected as many taxa included inour analysis are tetraploids, e.g. Ar. manshuriensis, Ar. tom-entosa, D. winteri, H. cordata, and Pi. nigrum (Bennett andLeitch, 1995; Bennett et al., 1982; Gregory, 1956; Samuelet al., 1986; Sun et al., 1990). There could be various expla-nations for this outcome. On the one hand, each taxon maytruly possess more than one identical copy of the PHYC

SmAP3

gnoliaceae

lycanthaceae

Illiciaceae

loranthaceae

Alismataceaee

phaeaceae

The numbers next to the nodes give posterior probabilities above 90%. Alle families of the perianthless Piperales. Locus names are as follows: Art,r. promissa; Tts, Thottea siliquosa; Ppn, Piper nigrum; Ph, Peperomia hirta;, Saruma henryi; Drw, Drimys winterii; Mp, Magnolia praecocissima; Cf,haea sp.; Am, Amborella trichopoda.

H

hyl1.00

M.A. Jaramillo, E.M. Kramer / Molecular Pgene. It is possible that we (and other researchers) couldhave missed additional copies due to the low number ofcolonies screened.

Ht

ScM

ArePI

ArpPI

ArtPI-1

ArtPI-2

ArmPI-2

ArmPI-1

TtsPI-1

AsplPI

AspePI

AePI-1

SrhPI

DrwPI-1

DrwPI-2

CfPI-1

MpMADS8

LtPI-1

TtsPI-2

CsPI

SmPI

CfPI-2

IhPI-1

IhPI-2

NymPI

AmtPI0.05 substitutions/site

Aris

1.00

1.001.00

1.00

1.001.00

1.00

1.00

1.00

1.00

1.00

1.00

0.98

0.98

1.00

1.00

Ar

Win

Ma

Ca

Illic

Ch

Ca

NyAm

Fig. 3. Phylogenetic reconstruction of PI homologs from basal angiosperms. Tloci are labeled on the right as to their families of origin. The box indicates th

Table 1Results of maximum likelihood test of topology using various constraints,comparisons of constrained versus unconstrained ML phylogeneticreconstructions

Topology tested lnL besttree

lnL constrainedtree

SH testP

APETALA3

Monophyly of Piperaceae 11414.913 11428.195 0.118Monophyly of

Saururaceae11432.422 0.011*

Monophyly ofAristolochiaceae

11416.267 0.282

PISTILLATA

Monophyly of Piperales 9118.906 9135.790 0.075Monophyly of Piperaceae 9144.499 0.003**

Monophyly ofAristolochiaceae

9137.938 0.024*

Signicance *p < 0.05, **p < 0.005.tcPI-1

cPI-2

ADS658

PmPI-1

PhPI

PpnPI

PmPI-2

Piperaceae

Saururaceae

tolochiaceae

1.00

teraceae

ogenetics and Evolution 44 (2007) 598609 6033.3. Test of selection among lineages

Maximum likelihood tests of selection suggest that theratio of non-synonymous versus synonymous substitutions(x) signicantly changes between the perianthless Piperalesand the rest of the branches in the phylogeny. For the AP3and PI lineages, the two-ratio model test, which assumes adierent x for all branches in the perianthless Piperales, t-ted the data signicantly better than a one-ratio model thatassumes x constant across the whole phylogeny (Table 2).For the PHYC lineage, the two-ratio model tested did nott the data signicantly better than the one-ratio model(Table 2). The value of x for PHYC is much lower thanthe one calculated for the B-class gene homologs suggestinghigher conservation of this gene relative to AP3 and PIhomologs.

Tests of selection were also conducted on each of thefunctional domains of the MADS-box containing genes.For the AP3 lineage, signicant changes in the x ratio wereidentied for the K domain of all the perianthless Piperales;a two-ratio model tted the data signicantly better thatthe one-ratio model (Table 3). For the PI lineage, signi-

istolochiaceae

gnoliaceae

lycanthaceae

iaceae

loranthaceae

lycanthaceaeAlismataceae

mphaeaceaeborellaceae

he numbers next to the nodes give posterior probabilities above 90%. Alle families of the perianthless Piperales. All locus names are as in Fig. 2.

Sa

Sau

Ho

Saruma

Asarum c

Asarum

Asarum

Asarum s

Aris

Arist

Tho

Drimys

Magnolia

Liriodendron

Calycanthus

Chloranthus

Illicium

Nymphaea

Amborella

0.05 substitutions/site

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

0.98

1.00

Fig. 4. Phylogenetic reconstruction of PHYC homologs from basal angiospermAll loci are labeled on the right as to their families of origin. The box indicat

Table 2Test of selection for the entire genes

Model lnLikelihood LRT Prob (1 df) xAPETALA3

One-ratio 11395.429 x = 0.1929Two-ratioa 11388.733 13.39 0.0002 xA = 0.1620,

xPP = 0.2364

PISTILLATA

One-ratio 9142.558 x = 0.166Two-ratioa 9133.777 17.56 0.0000 xA = 0.1470,

xPP = 0.2501

PHYTOCHROME C

One-ratio 20337.061 x = 0.0556Two-ratioa 20336.995 0.132 0.7163 xA = 0.0563,

xPP = 0.0533a Assumes one-ratio for all branches outside the perianthless Piperales

(xA), and another for the perianthless Piperales branches (xPP).

604 M.A. Jaramillo, E.M. Kramer / Molecular Phylgittaria

rurus

uttuynia

Piper

Peperomia

anadense

europaeum

speciosum

plendens

Piperaceae

Saururaceae

Alismataceae

Aristolochiaceae

ogenetics and Evolution 44 (2007) 598609cant changes were observed for the I and K domains of allthe perianthless Piperales branches (Table 3). The x esti-mates varied among the dierent functional domains. Asexpected, the MADS domain was the most conserved withx = 0.050.14, and the C domain was the least conservedwith x = 0.180.30.

4. Discussion

The goal of this study was to better understand patternsof molecular evolution among homologs of the petal andstamen identity genes AP3 and PI in the basal Magnoliidgroup Piperales, with a particular focus on the perianthlessfamilies Piperaceae and Saururaceae. Our results supportthe hypothesis that purifying selection has been relaxedon both lineages after the loss of the perianth in the familiesSaururaceae and Piperaceae. However, this nding iscomplicated by a number of factors, one of which is the

tolochia tomentosa

olochia manshuriensis

ttea

Winteraceae

Calycanthaceae

Magnoliaceae

Chloranthaceae

Illiciaceae

Nymphaeaceae

Amborellaceae

s. The numbers next to the nodes give posterior probabilities above 90%.es the families of the perianthless Piperales.

ing

in)

o-r

39.40.10.10.0

23.60.10.313.8

xA)

hyloccurrence of gene duplication. The phylogenetic recon-structions do not agree with the known organismic phylog-enies and suggest that there were gene duplication events inboth the AP3 and PI lineages pre-dating the separation ofthe families Saururaceae and Piperaceae. Many other stud-ies have found evidence for relaxation of purifying selec-tion following gene duplication (e.g. Aagaard et al., 2006;Baum et al., 2005; Jordan et al., 2004; Seoighe et al.,2003); see also reviews (Long et al., 2003; Zhang, 2003),so it is possible that the relaxed selection we observe inthe perianthless Piperales is at least in part due to theseduplications. It is notable, however, that there are severalother examples of gene duplications within this data set,both very recent and relatively ancient (e.g. CfAP3-1/2,DrwAP3-1/2/3/4, IhPI-1/2, see also Stellari et al., 2004),but none of these paralogs exhibit the extremely longbranch lengths that are seen in the perianthless Piperales.In addition, relaxed selection following gene duplicationoften dierentially aects one paralog (e.g. Conant and

Table 3Test of selection for each of domain identied for the MADS-box contain

Models M (MADS domain) I (intervening doma

One-ratioa Two-ratiob One-ratioa Tw

APETALA3

lnLikelihood 1599.387 1598.014 1439.500 14x or xA 0.0641 0.0507 0.1533xPP 0.0836LRT 2.746

PISTILLATA

lnLikelihood 1495.982 1494.358 1430.561 14x or xA 0.0888 0.0760 0.1455xPP 0.1380LRT 3.248

Signicance *p < 0.05, **p < 0.01, ***p < 0.001.a Assumes one-ratio for all branches (x).b Assumes one-ratio for all branches outside the perianthless Piperales (

M.A. Jaramillo, E.M. Kramer / Molecular PWagner, 2003) whereas, in this case, both paralogous lin-eages exhibit extremely long branches.

Another potential complicating factor is dierences inthe overall rates of molecular evolution in these taxa. Muchhigher levels of genetic divergence have been observed inchloroplast and mitochondrial genes from the genera Piperand Peperomia (Borsch et al., 2003; Jaramillo et al., 2004;Qiu et al., 2000), suggesting that rates of mutation maybe overall higher in these plants. Despite this observation,the relaxed purifying selection detected in the perianthlessPiperales for the AP3/PI gene lineages is not observed inPHYC, the other nuclear gene evaluated here. Althoughthe PHYC homologs from members of the perianthlessPiperales may have somewhat higher levels of geneticdivergence, as judged by the longer terminal branchesamong these taxa, dierences in dn/ds ratios were onlydetected in the AP3/PI homologs. A signicance test thatis able to include information about the overall genetic evo-lution of the genomes is needed in order to conrm ourresults.While the relaxed selection detected for the AP3 and PIhomologs of the Piperaceae and Saururaceae may have hadseveral contributing causes, it is not unreasonable to con-clude that the loss of the perianth was an important factor.Relaxed purifying selection has been reported for severalgenes that control processes which have been lost overthe course of evolution. For example, the plastid generps2 in parasitic plants shows relaxed purifying selection(dePamphilis et al., 1997; Leebens-Mack and dePamphilis,2002) as do the cone visual pigments of nocturnal geckos(Yokoyama and Blow, 2001), although the visual pigmentrhodopsin appears to still be under strong purifying selec-tion in cave-dwelling crawsh (Crandall and Hillis, 1997,but see Leebens-Mack and dePamphilis, 2002). Whatmakes our results especially interesting is that B-class func-tion determines the identity of both petals and stamens,and while petals have been completely lost in the perianth-less Piperales, the stamens do not show any degeneration.The relaxed selection in these loci may be due to a kind

genes

K (Keratin-like domain) C (C-terminal domain)

atiob One-ratioa Two-ratiob One-ratioa Two-ratiob

65 3057.629 3054.253 4948.209 4946.660484 0.1794 0.1405 0.2589 0.2251608 0.2452 0.304770 6.752** 3.098

53 2870.790 2867.907 3663.649 3662.243105 0.1558 0.1357 0.2023 0.1841898 0.2412 0.269916*** 5.766** 2.812

, and another for the perianthless Piperales branches (xPP).

ogenetics and Evolution 44 (2007) 598609 605of subfunctionalizationthe loss of one part of the func-tional repertoire has changed the pattern of selection onthe loci. Although the formulation of the duplicationdegenerationcomplementation model proposed by Forceet al. (1999) focused on the regulatory basis for subfunc-tionalization, Hughes gave equal emphasis to potentialchanges in protein sequences (Hughes, 1999). Evidence infact exists from other MADS-box genes that changes inprotein function can coincide with subfunctionalizationevents. In Antirrhinum, the C class genes PLENA andFARINELLI have undergone subfunctionalization thathas impacted both their regulation and their biochemicalcapacities (Causier et al., 2005). The Chloranthaceae isanother basal angiosperm lineage that lacks a perianth, acondition that originally led botanists to classify it withinthe Piperales (Cronquist, 1981), this relationship was laterrefuted by molecular phylogenetic studies (Borsch et al.,2003; Qiu et al., 2000), however. Analysis of molecular evo-lution in the oral MADS-box genes of Chloranthus showno evidence of relaxed selection in this lineage, although

AmPI Q Q A L T A F R V Q P I Q P N L Q Q N K *

SrhAP3AsplAP3AeAP3-1AreAP3PaprAP3-1PaprAP3-2ArtAP3-1ArmAP3-1ArtAP3-2ArmAP3-2TtsAP3

HtcAP3

PhAP3PpnAP3-1

ScMADS651

PpnAP3-2

DrwAP3-1DrwAP3-2DrwAP3-3DrwAP3-4MpMADS7LtAP3CfAP3-1CfAP3-2CsAP3SmAP3IhAP3-1IhAP3-2IhAP3-3NymAP3AmAP3

SrhPIAsplPIAePIArePIPaprPIArtPI-1ArmPI-1ArtPI-2ArmPI-2TtsPI-1TtsPI-2

HtcPI-1HtcPI-2

PhPIPpnPI

ScMADS658

PmPI-1PmPI-2

DrwPI-1DrwPI-2MpMADS8LtPICfPI-1CfPI-2CsPISmPIIhPI-1IhPI-2NymPI

S H I - F A F R V Q P C Q P N L H D - - - A G Y G T H D L RS H I - F A F R I Q P C Q P N L H N - - - A G Y G I H D L RS H I - F A F R I Q P C Q P N L H N - - - A G Y G I H D L RP H M - F G F R L Q P C Q P N L Q D - - - A G Y G T H D L RP H M - F G F R L Q P C Q P N L Q D - - - A G Y G T H D L RP H M - F G F R L Q P C Q P N L Q D - - - A G Y G T H D L RP H M - F G F R L Q P C Q P N L H D - - - A G Y G T N D L RP H M - F G F R L Q P C Q P N L H D - - - A G Y S T N D L RP H M - F G F R V Q P C Q P N L H D - - - S G Y G N D D L RP H M - F G F R V Q P C Q P N L H D - - - S G Y G N D D L RA N L - F A F R L Q P F Q P N L H D D - - A G Y G T Q D L R

S H I - F A C - - - P Y Q P N L H D - - - A S Y G I P D L R

P - - - Y H E S A H S D V T T A N N - I S S A Y G I Y D L RY H Q - Y N E S G H S D I T T A N - - V T S T F G M Y D F R

S H I - F A F R G Q P C Q P N L H D - - -

-

A S F R D R D T H

S H I - F A F H G Q P C Q P N L N N - - A S Y R I H D H F H

S H I - F A F R V Q P Y Q P N L H D - - - P S Y G I H D *

*

RS H I - F A F R M Q P Y Q P N L H D - - - P S Y G I H D L HS H I - F A F R V Q P F Q P N L H D - - - P S Y G I H D L HS H I - F A F H V Q P C Q P N L Q D - - - N G Y G C H E L RV H -- - - - - - - - - - -S L H D - - - T G F G I H D L RA H -- - - - - - - - - - -R L H N - - - T G F G I H D L RN H -- - - - - - - - - - -D L H E - - - I A Y G S N D L RS Q M - F A L C V Q P C H P N L Q D - - - A R S G H H D L RG H V - F A F R L Q P I Q P N L H D - - - N G Y G T HD V G - Y A F H H S A G Q S N V H D - - - V G Y G F H E L RS L M - F A F R V Q P S Q P N L H D - - - V V Y S T H E L RS Q L - V E F H M Q D T N Q I Y D D - - - T G F D F H D L RQ Q L - E Y Y H L Q P N N H Q A E V G D D I G Y N F H D L RA Q P - C P V R V Q S S H P N L H E - - - R G Y G C H D L IL F A - Y R M R - - P A E G N I H D - - - R G Y G L N D L R

S Q M P F A F C V Q P M Q P N L H Q K K *S Q M P F A F C V Q P M Q P N L H Q K K *S Q M P F A F C V Q P M Q P N L H Q K K *S H I P Y T F C A Q P I Q P N L H Q K K *S Q I P Y T F C A Q P M Q P N L H Q K K *S Q I P Y T F C A Q P S Q P N L H Q K K *S Q I P Y T F C A K P I Q P N L H Q K K *S Q I P Y T F C A Q P S Q P N L H Q K K *S Q I P Y T F C A Q P S Q P N L H Q K K *- H M P Y A F C A Q P F H P N F Q R A N *S Q M L F P F F L Q S S Q P N L H E H C *

- - S S F P F R V H P F H P N L Q R A N *- - S S L T F R V Q P L Q P N L Q Q M K *

- - S P I A F H V Q P L H P N L Q E M K *- - L P F A F R V Q P I Q P N L Q E Q *

- - S S F A F R V Q P L Q P N L Q L M K *

- - I P I A F H V Q P L H P N L Q E M K *- - L P F A F R V Q P I Q P N L Q E Q K *

A Q M P L T F R V Q P I Q P N L H H D K *S Q I P L S F C I Q P I Q P N L Q Q N K *- Q M P F A F R V Q P I Q P N L H Q N N *Q Q L P F T F R L Q P I Q P N L H Q N Q *N Q M P F A F R I Q P I Q P N L H Q D K *S D M Q L A F R V Q P L Q P N L Q N K *S Q M P F I F R V Q P I Q P N L Q Q S K *A P V P F G F R V Q P M Q P N L Q E N K *S Q M P F A F R V Q P I Q P N L Q E N K *S Q M S F A F R A Q P I Q P N L Q G N K *S R V P F G F C V Q P I Q P N L Q Q N K *

L A *L A *L A *L A *L A *L A *L A *L A *L A *L A *L A *

F G *

L A *L A *

*

L E T

I R SL A *L A *L A *L A *L A *L A *L A *

L A **

L G *L V *L G *L G *L G *

PI Motif paleoAP3 Motif

Pipe

rale

sPi

pera

les

Mag

Dic

ots

Mag

Dic

ots

Mon

Mon

AN

ITA

AN

ITA

Fig. 5. Aligned C-terminal motifs for the predicted proteins of the AP3 and PI homologs. The PI and paleoAP3 motifs are indicated with vertical boxes.Residues in each region that show chemical conservation with the PI or paleoAP3 motif consensus sequences (Kramer et al., 1998) are shaded. Horizontalboxes indicate representatives from the perianthless Piperales. Vertical labels on the left indicate phylogenetic positions of the taxa of origin. Mag Dicots,Magnoliid Dicots, Mon, Monocots, and ANITA, the basal ANITA grade (Qiu et al., 1999; Soltis et al., 1999).

606 M.A. Jaramillo, E.M. Kramer / Molecular Phylogenetics and Evolution 44 (2007) 598609

hylthese tests, with a much smaller sampling from the Pipe-rales, did detect relaxed selection in representatives of theSaururaceae (Li et al., 2005). Thus, it appears that relaxedselection is not necessarily the rule following organ loss andit may be the compounding eect of multiple factorsgeneduplication, increased mutation rate and loss of the peri-anthwhich has promoted relaxed selection in the Pipera-ceae and Saururaceae.

Further insight into the nature of the relaxed selectionon these genes comes from the domain-specic tests. Asexpected, the highly conserved MADS domain does notexhibit relaxed selection. However, the I domain of thePI lineage and the K domains of both lineages have expe-rienced signicant relaxation in purifying selection in theperianthless Piperales. Both regions typically show moder-ately high levels of sequence conservation and play roles inprotein dimerization (Riechmann et al., 1996a). Little isknown about the specic functional residues in the Idomain but Yang et al. (2003) have identied multiplefunctionally important positions within the K domain.There are three amphipathic a-helices, designated K13(Figs. S12), the rst two of which fall within the tradition-ally dened K domain while the third spans the boundaryof the K and C domains. These are composed of heptad(abcdefg)n repeats where the a and d residues are usuallyhydrophobic. It appears that the hydrophobic sites withinK1 and K2 regions, along with several other critical resi-dues, are primarily responsible for dimerization interac-tions between AP3 and PI (Yang et al., 2003, see Figs.S1 and 2 for full list of sites). If we examine these sites inthe AP3 and PI homologs of the perianthless Piperales,we nd that most are conserved, with a few exceptions.In the K1, the AP3 homologs are somewhat divergent witha small number of charged substitutions at normallyhydrophobic sites. Most notably, the AP3 homolog fromSaururus (ScMADS651), appears to have a large deletionthat would eliminate much of the K1. Based on what isknow from Arabidopsis, this might be expected to signi-cantly alter dimerization capabilities, but this dramatic dif-ference is not observed in other homologs from theperianthless Piperales. One possible explanation for theScMADS651 deletion, however, is that it is an alternativelyspliced sequence, given that the position of the deletionmatches the predicted 50 end of the third exon (Jack et al.,1994). Similarly, the PI homolog from Peperomia (PhPI)has a large deletion in the region of the K3 helix, which cor-responds to an expected splice site (Goto and Meyerowitz,1994). This published sequence forPhPIwas the only variantrecovered at the time of the original screening (Kramer et al.,1998) but further analysis will be required to conrm thatother forms are not expressed.Overall, the residues that havebeen identied as critical to AP3/PI dimerization are gener-ally conserved in the homologs from Piperaceae and Saurur-aceae, suggesting that sequence divergence has beenconcentrated in other sites (Figs. S12). It remains to be

M.A. Jaramillo, E.M. Kramer / Molecular Pdetermined whether these dierences have aected thedimerization specicities of the proteins.In the C-terminal domain, which is the most diverseoverall, we nd a higher degree of relaxation of functionalconstraints (x = 0.180.30). Similar to our results, relaxa-tion of selection was also detected for the C-terminaldomains of several other Arabidopsis MADS-box genes(Lawton-Rauh et al., 1999; Moore et al., 2005). The func-tions of C-terminal domains remain poorly understood butare thought to include transcriptional activation (Choet al., 1999), the formation of ternary and quaternary com-plexes (Egea-Cortines et al., 1999), post-translation modi-cation (Yalovsky et al., 2000), and aspects of functionalspecicity (Krizek and Meyerowitz, 1996; Lamb and Irish,2003). Although the C-terminal domains show low conser-vation overall, embedded within them are short, highlyconserved, lineage-specic motifs that have been associatedwith some of the functions described above. Given the factthat these motifs are so short (912 aa in the case of theAP3 and PI motifs, respectively) and are surrounded bysequence that shows a lower degree of overall conservation,detecting statistically signicant changes in selection forthese regions can be very dicult. Visual examination ofthe C domain motifs of basal angiosperms does show dif-ferences in the level of conservation in both the perianthlessPiperales and Chloranthaceae. Particularly in the AP3 line-age, the representatives from the Piperaceae and Saurura-ceae exhibit a number of non-synonymous dierences aswell as small deletions (Fig. 5). In Chloranthus AP3, thepaleoAP3 motif is truncated, missing the last ve aminoacids (Fig. 5, Li et al., 2005; Stellari et al., 2004). TheseC-terminal motifs are known to be important for the func-tion of AP3 and PI in Arabidopsis (Krizek and Meyerowitz,1996; Lamb and Irish, 2003). Given these ndings, in addi-tion to their otherwise high degree of sequence conserva-tion, it is reasonable to hypothesize that such sequencemodications could have functional importance. The exactnature of their signicance is dicult to predict, however.Yeast two-hybrid and domain swapping analyses will pro-vide insight into the biochemical functions of the AP3 andPI proteins from taxa across the Piperales and help us tounderstand how their interactions may have been remod-eled after perianth loss in the Piperaceae and Saururaceae.

Acknowledgments

The authors thank members of the Kramer and Math-ews lab for comments on the manuscript. We would partic-ularly like to thank Sarah Mathews for help with thecloning and analysis of the PHYC homologs. In addition,we thank one anonymous reviewer for comments on themanuscript. This work was supported by a Mercer Fellow-ship to M.A.J.

Appendix A. Supplementary data

Supplementary data associated with this article can be

ogenetics and Evolution 44 (2007) 598609 607found, in the online version, at doi:10.1016/j.ympev.2007.03.015.

hylogenetics and Evolution 44 (2007) 598609References

Aagaard, J.E., Willis, J.H., Phillips, P.C., 2006. Relaxed selection amongduplicate oral regulatory genes in Lamiales. J. Mol. Evol. 63, 493503.

Alvarez-Buylla, E.R., Pelaz, S., Liljegren, S.J., Gold, S.E., Burge, C.,Ditta, G.S., Ribas de Pouplana, L., Martinez-Castilla, L., Yanofsky,M.F., 2000. An ancestral MADS-box gene duplication occurred beforethe divergence of plants and animals. Proc. Natl. Acad. Sci. USA 97,53285333.

Ambrose, B.A., Lerner, D.R., Ciceri, P., Padilla, C.M., Yanofsky, M.F.,Schmidt, R.J., 2000. Molecular and genetic analyses of the Silky1 genereveal conservation in oral organ specication between eudicots andmonocots. Mol. Cell 5, 569579.

Aoki, S., Uehara, K., Imafuku, M., Hasebe, M., Ito, M., 2004. Phylogenyand divergence of basal angiosperms inferred from APETALA3- andPISTILLATA-like MADS-box genes. J. Plant Res. 117, 229244.

APG, 2003. An update of the Angiosperm Phylogeny Group classicationfor the orders and families of owering plants: APG II. Bot. J. Linn.Soc. 141, 399436.

Baum, D.A., Yoon, H.S., Oldham, R.L., 2005. Molecular evolution of thetranscription factor LEAFY in Brassicaceae. Mol. Phylogenet. Evol.37, 114.

Becker, A., Kaufmann, K., Freialdenhoven, A., Vincent, C., Li, M.A.,Saedler, H., Theissen, G., 2002. A novel MADS-box gene subfamilywith a sister-group relationship to class B oral homeotic genes. Mol.Genet. Genomics 266, 942950.

Bennett, M.D., Leitch, I.J., 1995. Nuclear DNA amounts in angiosperms.Ann. Bot. 76, 113176.

Bennett, M.D., Smith, J.B., Heslop-Harrison, J.S., 1982. Nuclear-DNAamounts in angiosperms. Proc. Roy. Soc. Lon. Ser. B. Biol. Sci. 216,179199.

Borsch, T., Hilu, K.W., Quandt, D., Wilde, V., Neinhuis, C., Barthlott,W., 2003. Noncoding plastid trnT-trnF sequences reveal a wellresolved phylogeny of basal angiosperms. J. Evol. Biol. 16, 558576.

Bowman, J.L., Smyth, D.R., Meyerowitz, E.M., 1989. Genes directingower development in Arabidopsis. Plant Cell 1, 3752.

Causier, B., Castillo, R., Zhou, J.L., Ingram, R., Xue, Y.B., Schwarz-Sommer, Z., Davies, B., 2005. Evolution in action: followingfunction in duplicated oral homeotic genes. Curr. Biol. 15, 15081512.

Cho, S., Jang, S., Chae, S., Chung, K.M., Moon, Y.-W., An, G., Jang,S.K., 1999. Analysis of the C-terminal region of Arabidopsis thalianaAPETALA1 as a transcription activation domain. Plant Mol. Biol. 40,419429.

Coen, E.S., Meyerowitz, E.M., 1991. The war of the whorls: geneticinteractions controlling ower development. Nature 353, 3137.

Conant, G.C., Wagner, A., 2003. Asymmetric sequence divergence ofduplicate genes. Genome Res. 13, 20522058.

Crandall, K.A., Hillis, D.M., 1997. Rhodopsin evolution in the dark.Nature 387, 667668.

Cronquist, A., 1981. An Integrated System of Classication of FloweringPlants. Columbia University Press, New York.

Darwin, C., 1859. On the Origin of Species by Means of Natural Selection,or the Perservation of Favoured Races in the Struggle for Life. JohnMurray, London.

dePamphilis, C.W., Young, N.D., Wolfe, A.D., 1997. Evolution of plastidgene rps2 in a lineage of hemiparasitic and holoparasitic plants: Manylosses of photosynthesis and complex patterns of rate variation. Proc.Natl. Acad. Sci. USA 94, 73677372.

Doyle, J.A., Endress, P.K., 2000. Morphological phylogenetic analysis ofbasal angiosperms: comparison and combination with molecular data.Int. J. Plant Sci. 161, S121S153.

Doyle, J.J., Doyle, J.A., 1987. A rapid DNA isolation procedure for smallquantities of fresh leaf tissue. Phytochem.Bull., Bot. Soc.Am. 19, 1115.

Egea-Cortines, M., Saedler, H., Sommer, H., 1999. Ternary complex

608 M.A. Jaramillo, E.M. Kramer / Molecular Pformation between the MADS-box proteins SQUAMOSA, DEFIC-IENS and GLOBOSA is involved in the control of oral architecturein Antirrhinum majus. EMBO J. 18, 53705379.

Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y.-L., Postlethwait,J., 1999. Preservation of duplicate genes by complementary, degener-ative mutations. Genetics 151, 15311545.

Goto, K., Meyerowitz, E.M., 1994. Function and regulation of the Arabid-opsis oral homeotic gene PISTILLATA. Genes Dev. 8, 15481560.

Graham, S.W., Olmstead, R.G., 2000. Utility of 17 chloroplast genes forinferring the phylogeny of the basal angiosperms. Am. J. Bot. 87,17121730.

Gregory, M.P., 1956. A phyletic rearrangement in the Aristolochiaceae.Am. J. Bot. 43, 110122.

Hilu, K.W., Borsch, T., Muller, K., Soltis, D.E., Soltis, P.S., Savolainen,V., Chase, M.W., Powell, M.P., Alice, L.A., Evans, R., Sauquet, H.,Neinhuis, C., Slotta, T.A.B., Rohwer, J.G., Campbell, C.S., Chatrou,L.W., 2003. Angiosperm phylogeny based on matK sequence infor-mation. Am. J. Bot. 90, 17581776.

Honma, T., Goto, K., 2001. Complexes of MADS-box proteins aresucient to convert leaves into oral organs. Nature 409, 525529.

Huelsenbeck, J., Ronquist, F., 2002. MrBayes v3. Uppsala University,Uppsala, Switzerland.

Hughes, A.L., 1999. Adaptive Evolution of Genes and Genomes. OxfordUniversity Press.

Jack, T., 2004. Molecular and genetic mechanisms of oral control. PlantCell 16, S1S17.

Jack, T., Fox, G.L., Meyerowitz, E.M., 1994. Arabidopsis homeotic geneAPETALA3 ectopic expression: transcriptional and posttranscrip-tional regulation determine oral organ identity. Cell 76, 703716.

Jaramillo, M.A., Kramer, E.M., 2004. APETALA3 and PISTILLATAhomologs exhibit novel expression patterns in the unique perianth inAristolochia (Aristolochiaceae). Evol. Dev. 6, 449458.

Jaramillo, M.A., Manos, P.S., Zimmer, E.A., 2004. Phylogenetic rela-tionships of the perianthless Piperales: reconstructing the evolution oforal development. Int. J. Plant Sci. 165, 403416.

Jeery, W.R., 2001. Cavesh as a model system in evolutionary develop-mental biology. Dev. Biol. 231, 112.

Jenik, P.D., Irish, V.F., 2001. The Arabidopsis oral homeotic geneAPETALA3 dierentially regulates intercellular signaling required forpetal and stamen development. Development 128, 1323.

Jordan, I.K.,Wolf,Y.I.,Koonin, E.V., 2004.Duplicated genes evolve slowerthan singletons despite the initial rate increase. BMC Evol. Biol. 4.

Kang, H.-G., Jeon, J.-S., Lee, S., An, G., 1998. Identication of class Band class C oral organ identity genes from rice plants. Plant Mol.Biol. 38, 10211029.

Kanno, A., Saeki, H., Kameya, T., Saedler, H., Theissen, G., 2003.Heterotopic expression of class B oral homeotic genes supports amodied ABC model for tulip (Tulipa gesneriana). Plant Mol. Biol. 52,831841.

Kim, S., Koh, J., Yoo, M.J., Kong, H.Z., Hu, Y., Ma, H., Soltis, P.S.,Soltis, D.E., 2005. Expression of oral MADS-box genes in basalangiosperms: implications for the evolution of oral regulators. PlantJ. 43, 724744.

Kim, S., Yoo, M., Albert, V.A., Farris, J.S., Soltis, P.S., Soltis, D.E., 2004.Phylogeny and diversication of B-function genes in angiosperms:evolutionary and functional implications of a 260-million year oldduplication. Am. J. Bot. 91, 21022118.

Kimura, M., 1983. The Neutral Theory of Molecular Evolution.Cambridge University Press, Cambridge, UK.

Kramer, E.M., Di Stilio, V.S., Schluter, P., 2003. Complex patterns ofgene duplication in the APETALA3 and PISTILLATA lineages of theRanunculaceae. Int. J. Plant Sci. 164, 111.

Kramer, E.M., Dorit, R.L., Irish, V.F., 1998. Molecular evolution ofgenes controlling petal and stamen development: duplication anddivergence within the APETALA3 and PISTILLATA MADS-boxgene lineages. Genetics 149, 765783.

Kramer, E.M., Irish, V.F., 1999. Evolution of genetic mechanisms

controlling petal development. Nature 399, 144148.

Kramer, E.M., Irish, V.F., 2000. Evolution of the petal and stamendevelopmental programs: evidence from comparative studies of thelower eudicots and basal angiosperms. Int. J. Plant Sci. 161, S29S40.

Samuel, R., Smith, J.B., Bennett, M.D., 1986. Nuclear DNA variation inPiper (Piperaceae). Can. J. Gen. Cyt. 28, 10411043.

M.A. Jaramillo, E.M. Kramer / Molecular Phylogenetics and Evolution 44 (2007) 598609 609Kramer, E.M., Jaramillo, M.A., 2005. The genetic basis for innova-tions in oral organ identity. J. Exp. Zool. (Mol. Dev. Evol.)304B, 526535.

Kramer, E.M., Su, H.-J., Wu, J.M., Hu, J.M., 2006. A simpliedexplanation for the frameshift mutation that created a novel C-terminal motif in the APETALA3 gene lineage. BMC Evol. Biol. 6, 30.

Krizek, B.A., Meyerowitz, E.M., 1996. Mapping the protein regionsresponsible for the functional specicities of the Arabidopsis MADSdomain organ-identity proteins. Proc. Natl. Acad. Sci. USA 93, 40634070.

Lamb, R.S., Irish, V.F., 2003. Functional divergence within the APET-ALA3/PISTILLATA oral homeotic gene lineages. Proc. Natl. Acad.Sci. USA 100, 65586563.

Lawton-Rauh, A.L., Buckler, E.S., Purugganan, M.D., 1999. Patterns ofmolecular evolution among paralogous oral homeotic genes. Mol.Biol. Evol. 16, 10371045.

Leebens-Mack, J., dePamphilis, C.W., 2002. Power analysis of tests forloss of selective constraint in cave craysh and nonphotosyntheticplant lineages. Mol. Biol. Evol. 19, 12911302.

Li, G.S., Meng, Z., Kong, H.Z., Chen, Z.D., Theissen, G., Lu, A.M.,2005. Characterization of candidate class A, B and E oral homeoticgenes from the perianthless basal angiosperm Chloranthus spicatus(Chloranthaceae). Dev. Genes Evol. 215, 437449.

Long, M., Betran, E., Thornton, K., Wang, W., 2003. The origin of newgenes: glimpses from the young and old. Nat. Rev. Gen. 4, 865875.

Mathews, S., 2005. Phytochrome evolution in green and nongreen plants.J. Heredity 96, 197204.

Mathews, S., Burleigh, J.G., Donoghue, M.J., 2003. Adaptive evolution inthe photosensory domain of phytochrome A in early angiosperms.Mol. Biol. Evol. 20, 10871097.

Mathews, S., Donoghue,M.J., 1999. The root of the angiosperm phylogenyinferred from duplicate phytochrome genes. Science 286, 947950.

Moore, R.C., Grant, S.R., Purugganan, M., 2005. Molecular populationgenetics of redundant oral-regulatory genes in Arabidopsis thaliana.Mol. Biol. Evol. 22, 91103.

Nagasawa, N., Miyoshi, M., Sano, Y., Satoh, H., Hirano, H., Sakai, H.,Nagato, Y., 2003. SUPERWOMAN1 and DROOPING LEAF genescontrol oral organ identity in rice. Development 130, 705718.

Nickrent, D.L., Blarer, A., Qiu, Y.-L., Soltis, D.E., Soltis, P.S., Zanis, M.,2002. Molecular data place Hydnoraceae with Aristolochiaceae. Am.J. Bot. 89, 18091817.

Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model ofDNA substitution. Bioinformatics 14, 817818.

Qiu, Y.-L., Lee, J., Bernasconi-Quadroni, F., Soltis, D.E., Soltis, P.A.,Zanis, M., Zimmer, E.A., Chen, Z., Savolainen, V., Chase, M.W.,1999. The earliest angiosperms: evidence from mitochondrial, plastidand nuclear genomes. Nature 402, 404407.

Qiu, Y.-L., Lee, J., Bernasconi-Quadroni, F., Soltis, D.E., Soltis, P.S.,Zanis, M., Zimmer, E.A., Chen, Z., Savolainen, V., Chase, M.W.,2000. Phylogeny of basal angiosperms: analyses of ve genes fromthree genomes. Int. J. Plant Sci. 161, S3S27.

Riechmann, J.L., Krizek, B.A., Meyerowitz, E.M., 1996a. Dimerizationspecicity of Arabidopsis MADS domain homeotic proteins APET-ALA1, APETALA3, PISTILLATA, and AGAMOUS. Proc. Natl.Acad. Sci. USA 93, 47934798.

Riechmann, J.L., Wang, M., Meyerowitz, E.M., 1996b. DNA-bindingproperties of Arabidopsis MADS domain homeotic proteins APET-ALA1, APETALA3, PISTILLATA and AGAMOUS. Nucleic AcidsRes. 24, 31343141.Seoighe, C., Johnston, C.R., Shields, D.C., 2003. Signicantly dierentpatterns of amino acid replacement after gene duplication as comparedto after speciation. Mol. Biol. Evol. 20, 484490.

Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol.Evol. 16, 11141116.

Soltis, D.E., Soltis, P.S., Chase, M.W., Mort, M.E., Albach, D.C., Zanis,M., Savolainen, V., Hahn, W.H., Hoot, S.B., Fay, M.F., Axtell, M.,Swensen, S.M., Prince, L.M., Kress, W.J., Nixon, K.C., Farris, J.S.,2000. Angiosperm phylogeny inferred from 18S rDNA, rbcL, and atpBsequences. Bot. J. Linn. Soc. 133, 381461.

Soltis, P.S., Soltis, D.E., Chase, M.W., 1999. Angiosperm phylogenyinferred from multiple genes as a tool for comparative biology. Nature402, 402403.

Sommer, H., Beltran, J.-P., Huijser, P., Pape, H., Lonnig, W.-E., Saedler,H., Schwarz-Sommer, Z., 1990. Deciens, a homeotic gene involved inthe control of ower morphogenesis in Antirrhinum majus: the proteinshows homology to transcription factors. EMBO J. 9, 605613.

Stellari, G.M., Jaramillo, M.A., Kramer, E.M., 2004. Evolution of theAPETALA3 and PISTILLATA lineages of MADS-box containinggenes in basal angiosperms. Mol. Biol. Evol. 21, 506519.

Sun, B.Y., Stuessy, T.F., Crawford, D.J., 1990. Chromosome counts fromthe ora of the Juan Fernandez Islands, Chile. III. Pac. Sci. 44, 258264.

Swoord, D.L., 2002. PAUP*: Phylogenetic Analysis Using Parasimony (*and other methods). Sinauer Associates, Sunderland, Massachusetts.

Trobner, W., Ramirez, L., Motte, P., Hue, I., Huijser, P., Lonnig, W.E.,Saedler, H., Sommer, H., Schwarz-Sommer, Z., 1992. Globosaahomeotic gene which interacts with deciens in the control ofantirrhinum oral organogenesis. EMBO J. 11, 46934704.

Tucker, S.C., Douglas, A.W., 1993. Utility of ontogenetic and conven-tional characters in determining phylogenentic relationships ofSaururaceae and Piperaceae (Piperales). Syst. Bot. 18, 614641.

Vandenbussche, M., Theissen, G., Van de Peer, Y., Gerats, T., 2003.Structural diversication and neo-functionalization during oralMADS-box gene evolution by C-terminal frameshift mutations.Nucleic Acids Res. 31, 44014409.

Winter, K.U., Weiser, C., Kaufmann, K., Bohne, A., Kirchner, C.,Kanno, A., Saedler, H., Theissen, G., 2002. Evolution of class B oralhomeotic proteins: obligate heterodimerization originated from homo-dimerization. Mol. Biol. Evol. 19, 587596.

Yalovsky, S., Rodriguez-Concepcion, M., Bracha, K., Toledo-Ortiz, G.,Gruissem, W., 2000. Prenylation of the oral transcription factorAPETALA1 modulates its function. Plant Cell 12, 12571266.

Yang, Y., Fanning, L., Jack, T., 2003. The K domain mediatesheterodimerization of the Arabidopsis oral organ identity proteins,APETALA3 and PISTILLATA. Plant J. 33, 4759.

Yang, Z., 1997. PAML: a program package for phylogenetic analysis bymaximum likelihood. Comput. Appl. Biosci. 13, 555556.

Yokoyama, S., Blow, N.S., 2001. Molecular evolution of the cone visualpigments in the pure rod-retina of the nocturnal gecko, Gekko gekko.Gene 276, 117125.

Zachgo, S., de Andrade Silva, E., Motte, P., Trobner, W., Saedler, H.,Schwarz-Sommer, Z., 1995. Functional analysis of the Antirrhinumoral homeotic Deciens gene in vivo and in vitro by using atemperature-sensitive mutant. Development 121, 28612875.

Zanis, M., Soltis, P.S., Qiu, Y.-L., Zimmer, E.A., Soltis, D.E., 2003.Phylogenetic analyses and perianth evolution in basal angiosperms.Ann. Mo. Bot. Gard. 90, 129150.

Zhang, J.Z., 2003. Evolution by gene duplication: an update. Trends Ecol.Evol. 18, 292298.

Molecular evolution of the petal and stamen identity genes, APETALA3 and PISTILLATA, after petal loss in the PiperalesIntroductionMaterials and methodsTaxon samplingSequence dataIsolation of APETALA3 (AP3) and PISTILLATA (PI) homologsAmplification of PHYTOCHROME C (PHYC)

Phylogenetic analysisMaximum likelihood test of selection

ResultsB-class gene lineagesPHYTOCHROME C phylogenyTest of selection among lineages

DiscussionAcknowledgmentsSupplementary dataReferences