1

EFFECTS OF LIVER EXTRACELLULAR MATRIX GEL STIFFNESS ON

PRIMARY HEPATOCYTE FUNCTION

BY

DANIEL B. DEEGAN

A Dissertation Submitted to the Graduate Faculty of

WAKE FOREST UNIVESITY GRADUATE SCHOOL OF ARTS AND SCIENCES

in Partial Fulfillment of the Requirements

for the Degree of

DOCTOR OF PHILOSOPHY

Molecular Medicine and Translational Sciences

December 2015

Winston-Salem, North Carolina

Copyright Daniel B. Deegan 2015 (If Applicable)

Approved By:

Thomas D. Shupe, Ph.D., Advisor

Emmanuel C. Opara, Ph.D., Chair

Graça D. Almeida-Porada, M.D., Ph.D.

Michael C. Seeds, Ph.D.

Shay Soker, Ph.D.

2

DEDICATION AND ACKNOWLEDGEMENTS

A special thanks to my PI and advisor Dr. Tom Shupe for his guidance, patience,

and selflessness in mentoring me and helping me to complete the graduate school

process. Thanks to my undergraduate mentor at Virginia Tech, Dr. John McDowell, for

sparking my interest in laboratory research. Thanks to my previous mentors Dr. Tamer

Aboushwareb and Dr. Bryon Petersen for their assistance throughout graduate school.

Thanks to my labmate Cindy Zimmerman for her help and support on technical work of

my project. Thanks to my committee members, Dr. Emmanuel Opara, Dr. Graça

Almeida-Porada, Dr. Michael Seeds, and Dr. Shay Soker for their guidance on my thesis

project. Thanks to Dr. Aleksander Skardal for his support and expertise in hydrogel

formation. Thanks to Dr. Bridget Brosnihan for her counsel and advisement during

difficult times. Thanks to the Molecular Medicine and Translational Sciences program

and the Wake Forest Institute for Regenerative Medicine. Finally, thank you to my family

and friends for keeping me sane throughout the struggles of graduate school.

3

TABLE OF CONTENTS

List of Figures and Tables………………………………………………………………5-6

Abbreviations………………………………………………………………………...…6-8

Abstract……………………………………………………………………………..….9-10

Chapter 1…………………………………………………………………………..….11-59

Chapter 2……………………………………………………………………………...60-88

Chapter 3………………………………………………………………………...…..89-145

Chapter 4………………………………………………………………………...…146-159

Curriculum Vitae…………………………………………………………………..160-163

4

LIST OF FIGURES AND TABLES

Chapter 1

Figure 1: Hepatic Lobule Structure

Figure 2: Integrin Signaling and Regulation of Rho GTPases

Chapter 2

Figure 1: Rat Liver Decellularization

Figure 2: PEG Crosslinker Structures

Figure 3: PEGDA Crosslinking Saturation

Chapter 3

Figure 1: IHC of Decellularized Liver Tissue

Table 1: Storage Modulus Formulas

Table 2: Human Primers for RT-qPCR

Figure 2: Solubilized Liver Composition and Activity

Figure 3: Solubilized ECM Gel Increases Hepatocyte Viability

Figure 4: ECM Gels Increase Hepatocyte Attachment and Clustering

Figure 5: HA-ECM Gel Stiffnesses Formed by Varying Crosslinker Concentrations

Figure 6: Cell Viability and Filopodia Formation

Figure 7: Cytoskeletal Staining

Figure 8: Stiffness and Substrate Dependent Cell Attachment

Figure 9: Hepatocyte Phenotypic Marker Expression

Figure 10: Hepatocyte Functional Output

Figure 11: Expression of Cell Junction Molecules and Focal Adhesion Regulators

Figure 12: FAK and ILK ICC

Figure 13: Expression of the Cytoskeleton-Regulating Rho GTPases

Supplementary Figure 1: Growth Factor Binding Comparison

5

Supplementary Figure 2: Expression of HNF4α, SNAIL, and Claudin-1

Supplementary Figure 3: Integrin beta-1 Expression

Supplementary Figure 4: Hepatocyte Culture on Growth Factor Treated Gels

Supplementary Figure 5: Effects of Substrate Stiffness on Hepatic Stellate Cells

Chapter 4

No Tables or Figures

6

ABBREVIATIONS

Smooth endoplasmic reticulum SER

Cytochrome P450 CYP

Hepatic stellate cells HSC

Extracellular matrix ECM

Matrix metalloproteinases MMP

Alpha-smooth muscle actin α-SMA

Collagen-1 Col1

Glycosaminoglycans GAGs

Reactive oxygen species ROS

Blood cells RBC

Sinusoidal endothelial cells SEC

Transforming growth factor beta TGF-β

Endothelin-1 ET-1

Mitogen-activating protein kinases MAPK

Fibronectin FN

Arginine-Glycine-Aspartic acid RGD

Heparan sulfate HS

Chondroitin CS

Dermatan sulfate DS

Keratan sulfate KS

Hyaluronic acid HA

Hepatocyte growth factor HGF

Epidermal growth factor EGF

Fibroblast growth factor FGF

7

EGF receptor EGFR

Transforming growth factor alpha TGFα

Heparin binding EGF HB EGF

Basic fibroblast growth factor bFGF or FBF2

Urokinase-type plasminogen activator u-PA

N-2-acetylaminofluorene 2-AAF

Connective tissue growth factor CTGF

Mesenchymal to epithelial transition MET

Epithelial to mesenchymal transition EMT

Tissue inhibitor of metalloproteinases TIMP

Smooth muscle cells SMC

Hepatocellular carcinoma HCC

Cell adhesion molecules CAM

Focal adhesion kinase FAK

Phosphoinositide 3-kinase PI3K

Protein kinase B AKT

Crk-associated substrate CAS

c-Jun N-terminal kinases JNK

Mitogen-activated protein kinase 1 MAPK1

Mitogen-activated protein kinase 3 MAPK3

Ras homolog family member Rho

Ras-related C3 botulinum toxin substrate Rac

Growth factor receptor-bound 7 GRB7

Ras homolog family member A RhoA

Actin-related protein Arp 2/3

8

Cell division control protein 42 CDC42

Neural Wiskott-Aldrich syndrome protein N-WASP

Engulfment and Cell Motility 2 ELMO2

Integrin-linked kinase ILK

Rho-associated protein kinase ROCK

Polyethylene glycol PEG

Polyethylene glycol diacrylate PEGDA

Magnetic Resonance Elastography MRE

Loss modulus G’’

Storage modulus G’

Atomic force microscopy AFM

Superior vena cava SVC

Inferior vena cava IVC

Hepatocyte nuclear factor 4 alpha HNF4α

9

ABSTRACT

The extracellular matrix is a complex environment of mechanical and chemical

cues vital to individual cell growth, tissue formation, and ultimately complete organ

function. The field of regenerative medicine aims to recreate the unique biological

properties found in specific tissue types and to incorporate these properties into substrates

that support long term cell function for applications including tissue engineering, cell

therapies, and disease models. Because of the complexity of the extracellular matrix,

difficulties exist in characterizing and utilizing components of the matrix that contribute

to the long term function and viability of cells. Primary liver epithelial cells, or

hepatocytes, are easily isolated in large quantities. However, these cells quickly lose

viability and function once removed from the native organ. In order to support hepatocyte

phenotype in culture, decellularized liver matrix was incorporated into transplantable

hyaluronic acid hydrogels. These substrates were shown to bind growth factors, support

hepatocyte attachment, and promote cell junction formation. In liver tissue, the physical

property of matrix stiffness affects a myriad of cell behaviors including; cell attachment,

viability, function, growth factor utilization, motility, and cytoskeletal organization. Gels

were crosslinked at different stiffnesses in order to mimic and test a variety of mechanical

environments. The hepatocyte substrates were formulated within a narrow physiologic

range from slightly above to slightly below that of native liver. Primary human

hepatocyte attachment, viability, and functional output increased with stiffness. Stiffness

influenced hepatocyte morphology, cell signaling, and expression of important liver

specific markers dependent on duration in culture and presence or absence of matrix in

the gel. In conclusion, data demonstrates that inclusion of extracellular matrix in primary

10

hepatocyte cell culture substrates affects cell phenotype, and these effects are influenced

by small changes in stiffness of the substrates. This thesis work suggests that substrate

formulation and stiffness can be optimized for liver cell culture and different regenerative

medicine applications.

11

CHAPTER 1

Introduction to Liver Architecture and the Role of the

Extracellular Matrix on Liver Cellular Function

Daniel B. Deegan

Content

1. Function and Gross Anatomy……………………………………………..13

1.1 Liver Function…………………………………………………………13

1.2 Liver Vasculature……………….……………………………...……...14

1.3 Macroscopic Structures………….……………………………..….…..14

2. Cell Types of the Liver……………….……………………………………15

2.1 Hepatocytes……………………………………………………....……15

2.2 Hepatic Stellate Cells…………………………………………....…….17

2.3 Kupffer Cells……………………………………………….......……..18

2.4 Sinusoidal Endothelial Cells…………………………………...……...19

2.5 Cholangiocytes (Biliary Epithelial Cells).…………………...………..20

3. ECM Components………………………………………………….………20

12

3.1 Fibrillar Collagen…………………………………………………...….21

3.2 Non-Fibrillar Collagens………………………………………………..22

3.3 Non-Collagenous Glycoproteins…………………………….…………22

3.4 Glycosaminoglycans……………………………………………....…...24

3.5 ECM Bound Growth Factors…………………………………….……..26

4. Liver Regeneration…………………………………………………………28

4.1 Normal Liver Repair and Regeneration………………………………..28

4.2 Progenitor Mediated Repair and Regeneration………………………...30

5. Liver Disease………………………………………………………………31

5.1 Metabolic Disease………………………………………………….…..31

5.2 Cholangiopathies……………………………………………….………32

5.3 Progression of Liver Fibrosis…………………………………………..32

6. Stiffness in Tissue Microenvironments……………………………….……34

6.1 ECM Stiffness…………………………………….………….……35

6.2 Cellular Stiffness………………………………….………….……36

7. Liver ECM Stiffness during Developmental or Repair States.………….…37

8. Effects of Stiffness on Mechanotransduction and Focal Adhesion Signaling 39

8.1 Cell Adhesion Molecules……………………………………….…39

8.2 Mechanotransduction and Cytoskeletal Regulation…………….…41

13

1. Function and Gross Anatomy

1.1 Liver Function

The liver is the largest internal organ of the human body and performs over 500

unique functions (1). It is a major site of plasma protein biosynthesis, energy storage,

metabolism, and detoxification. The liver produces important compounds including

clotting factors, heparin, and albumin that give circulating blood many of its important

physical properties (1). It also produces bile, which aids the digestion of lipids into fatty

acids that are used throughout the body (2, 3). The liver is the main storage site for

glycogen and serves as a buffer for blood glucose levels through activation of

glycogenolysis, glycogenesis, or gluconeogenesis (4, 5). The organ also stores fat soluble

compounds, vitamins, and minerals for use by cells throughout the body.

The liver is not only crucial to the production and storage of many of the building

blocks used within the body, but is also vital for the removal of toxic compounds from

the system, such as cellular waste products and xenobiotics (6). The liver aids in the

filtration of damaged or dying red blood cells from the circulation. Bilirubin, formed

from breakdown of hemoglobin, causes jaundice unless processed and excreted by the

liver (7). The liver also metabolizes and excretes alcohol and toxic drug compounds like

acetaminophen. These compounds are detoxified by a two-phase process where

electrophilic intermediate metabolites are conjugated by substrates. This results in a

detoxified polar product that may be excreted in the bile or urine (8).

14

1.2 Liver Vasculature

The importance of the liver is evidenced by the fact that this organ receives ¼ of

the entire cardiac output. 25% of the blood moves directly from the heart through the

hepatic artery to the liver. The other 75% of input enters the liver though the portal vein

and is lower in oxygen content but contains nutrient rich blood from the intestines (9).

This portion of the blood supplies the liver with needed factors, while also allowing the

liver to filter and detoxify xenobiotic compounds entering the circulation through the

digestive tract.

1.3. Macroscopic Structures

The human liver is composed of four main lobes; the left, right, caudate, and

quadrate lobes. These lobes are further divided into subunits called lobules. Lobules are

hexagonal shaped arrangements that contain discontinuous fenestrated endothelium, or

sinusoids (10). These sinusoids are in intimate proximity to the liver parenchyma. The

unfettered diffusibility through the sinusoids allows for greater interactions of

parenchymal cells with compounds carried in the blood, as compared to endothelium

within other tissue types (11). Each liver lobule is fed by 6 portal triads positioned at the

periphery of the lobule. This structure is composed of a portal vein and hepatic artery, as

well as a bile duct. Blood flows out of the lobule through the central vein that is

positioned in the middle of the lobule. Bile canaliculi run parallel to the liver sinusoids

but flow in the opposite direction of the sinusoidal circulation (12). The canaliculi merge

with the biliary tree at structures called the Canals of Hering, which flow to the common

bile duct that terminates in the gall bladder (13).

15

(14)

2. Cell Types of the Liver

The liver contains least 15 unique cell types (10). These cells types can be

narrowed down to 5 main cell types found within and around the parenchyma, sinusoids,

and bile ducts of the liver. Within these liver regions, cells communicate through

autocrine and paracrine signaling to support various cell phenotypes. Together, these

cells function to affect liver homeostasis and maintain a healthy organism.

2.1 Hepatocytes

Hepatocytes are the main cell type of the liver parenchyma and can carry out all

major functions of the liver. Chief products include bile, cholesterol and albumin (15).

Hepatocytes constitute 60% of the cell number and 80% of the actual volume of the liver

(10, 16). They are polarized cells arranged in two-dimensional cords with one side of the

cell communicating with the hepatic sinusoid, while the opposing side communicates

Fig.1) Hepatic Lobule Structure, adapted from Mescher et al (14)

16

with the bile canaliculus (17, 18). The surface of the hepatocyte is covered with small

projections known as microvilli which extend into the perisinusoidal area between the

hepatocyte and the endothelium, called the space of Disse. These structures greatly

expand the surface area of the cell, facilitating interactions with blood plasma that

diffuses through the sinusoidal wall (19). Hepatocytes attach to each other by tight and

adherens junctions on their lateral surfaces (20). These junctions isolate the apical

surface, forming the canaliculus through which bile flows. These bile canaliculi provide

complex linkages surrounding the cells that allow bile to drain into the bile ducts of the

liver (17).

The functional roles of hepatocytes vary according to their location within a

lobule (21). The lobules can be divided into three zones according to differences in

oxygen, nutrient, and metabolite concentrations (22). Zone 1 is an oxygen and nutrient

rich area closest to the portal triads at the periphery of the liver lobules. In this zone,

hepatocytes have greater numbers of mitochondria which provide higher rates of

oxidative phosphorylation that drive processes requiring great amounts of energy such as

gluconeogenesis. Cells within this zone are also more frequently affected by viral

infections like hepatitis because of their proximity to the portal area (23). Zone 2 is a

transition region of lower oxygen content. Zone 3 surrounds the central vein and has

lowest oxygen and nutrient concentration. Hepatocytes in zone 3 contain less

mitochondria and a greater amount of smooth endoplasmic reticulum (SER) (24). They

carry out processes such as glycolysis, lipid production, and xenobiotic detoxification

that remove harmful compounds before they reenter the circulation (25, 26). These cells

are also vital for the detoxification of bilirubin. Because of their roles in filtration and

17

excretion, these cells highly express cytochrome P450 (CYP) enzymes and are the cells

most negatively impacted by toxin intake (27). The low oxygen content in zone 3 also

makes hepatocytes of this area most susceptible to ischemic damage resulting from

cirrhosis (26).

Upon liver injury, hepatocytes rapidly proliferate to regenerate liver tissue. The

proliferative capacity of hepatocytes allows the liver to repair itself, despite ongoing

contact with toxins or loss of up to 75% of tissue mass (28, 29). This unique ability is

most likely the result of evolutionary changes and adaptation to the liver’s role in the

body as a site of detoxification and waste processing.

2.2 Hepatic Stellate Cells (HSC)

Hepatic stellate cells are the architects of the liver and comprise 5-8% of the total

liver cell number (30). These cells exist in two states in the space of Disse, a quiescent fat

storing cell or an activated myofibroblast (31). In their normal quiescent state, stellate

cells have a spindle-like morphology with elongated processes that extend between the

sinusoids and hepatic cords and enable them to sense changes in the microenvironment

(32). These cells store fat droplets and fat soluble compounds such as vitamin A. Even if

not fully activated, cells in the less studied quiescent state have been reported to influence

the extracellular matrix (ECM) by balancing the production of ECM degrading matrix

metalloproteinases (MMPs) with low levels of matrix protein biosynthesis molecules (33,

34). Quiescent cells have also been shown to secrete soluble growth factors such as

hepatocyte growth factor (HGF) (31).

18

Hepatic stellate cells become activated when they sense physical cues in the

matrix or chemical signals released from immune cells and dead or dying hepatocytes

resulting from toxicity, metastatic tumor cells, or viral infections. Upon activation, these

cells express genes for alpha-smooth muscle actin (α-SMA) and collagen-1 (Col1) (32,

33). They adopt a myofibroblastic morphology, proliferate, and secrete various pro-

inflammatory and mitogenic cytokines. HSCs travel to sites of injury and remodel the

damaged tissue matrix by the production of MMPs, hepatocyte-influencing growth

factors, and ECM molecules (35). The majority of ECM molecules generated are

collagens. However, HSCs also produce several other ECM components including

fibronectin, laminin, and glycosaminoglycans (GAGs) (36). Although vital to repair and

acute injury response, HSCs can become overactive in a chronic liver injury state. This

imbalance causes excess deposition and accumulation of ECM in the liver, eventually

leading to fibrosis and cirrhosis (37, 38).

Like hepatocytes, HSC morphology and composition change between three zones

of the lobules. In the periportal region, stellate cells have a smaller cytoplasmic volume

and project numerous extensions into the space of Disse. In the middle zone, cells are

larger, longer, and contain greater reserves of lipids and desmin. Moving into the

pericentral zone, desmin levels in stellate cells decrease, while vitamin A amounts

increase (32).

2.3 Kupffer Cells

Kupffer cells are star shaped immune cells located within the sinusoidal barrier.

Although they only represent a small percentage of all cells within the liver, they

19

represent 80-90% of all macrophages in the body (39). Upon activation, Kupffer cells

secrete inflammatory cytokines, growth factors, and reactive oxygen species (ROS) in

response to various stimuli. These macrophages phagocytose large particles and eliminate

dead or damaged red blood cells (RBCs), cancer cells, and hepatocytes, as well as

bacteria and other foreign entities (40). Kupffer cells process millions of RBCs per

minute and breakdown their main component, hemoglobin, into reusable polypeptides,

iron, and bilirubin. Toxic bilirubin attaches to albumin within the blood and eventually

diffuses through the sinusoidal lining. In the space of Disse, hepatocytes conjugate

bilirubin for excretion out of the body (41).

2.4 Sinusoidal Endothelial Cells

Sinusoidal endothelial cells (SECs) constitute 20% of the total liver cell number.

Unlike normal endothelial cells, hepatic sinusoidal cells form a fenestrated endothelium

that lies on a discontinuous basal lamina in the liver lobules. These sinusoids control

passive diffusion of substances into the parenchyma through sieve-like action and filter

entering plasma as it passes from the blood into the space of Disse. Porosity of the

endothelium increases from the portal triad to the central vein (42). This property allows

for greater diffusion and interaction of waste products and metabolites with hepatocytes

and HSCs in zone 3. Besides passive diffusion, SECs also scavenge waste products and

cell remnants through phagocytosis or actively transport compounds from the sinusoidal

lumen to perisinusoidal space through transcytosis (16).

SECs secrete a wide variety of cytokines, growth factors, and other compounds

into the circulation. SECs contribute to the generation of fibronectin, collagen IV, and

20

participate in the activation of transforming growth factor beta (TGF-β) to the active form

(26, 43). These cells also produce autocrine vasoactive compounds, such as endothelin-1

(ET-1), to affect blood flow and uptake from the sinusoidal lumen (44). Presence and

long term exposure to certain drugs or toxins such as nicotine, endotoxin, and ethanol

decrease fenestration size and reduce the ability of molecules like cholesterol to pass

through the sinusoids for hepatocyte processing (10). This build-up in cholesterol can

lead to atherosclerosis. Defenestration also blocks retinol metabolism and activates HSCs

within the space of Disse (45). This activation exacerbates fibrosis of the perisinusoidal

space, eventually resulting in cirrhosis.

2.5 Cholangiocytes (Biliary Epithelial Cells)

Cholangiocytes are epithelial cells that represent an alternate differentiation

lineage of liver progenitor cells. Cholangiocytes vary in size and morphology and line

extrahepatic and intrahepatic bile ductules (46). Unlike hepatocytes which produce bile-

acids that must be actively transported to the canaliculus, cholangiocytes secrete

components of bile such as electrolytes that enter the bile ducts through passive ionic

exchange processes (39). Cholangiocytes modify bile by secretion and adsorption of ions

and other molecules as it passes through the biliary tree. Cholangiocytes ultimately traffic

bile through the liver, which exits to both the common bile duct and the gall bladder (47).

3. ECM components

As has been shown in multiple cell types, availability of nutrients and oxygen

controls cell morphology and functional capacity. Another factor which greatly

determines cell activity and viability is the underlying ECM. Liver cells are organized

21

and maintained by a complex extracellular microarchitecture. Unlike other organs, the

ECM composes less than 10% of the liver volume (48). Despite this small percentage,

ECM molecules play a tremendous role in liver function regulation, and direct repair and

regeneration processes within tissue (49). When out of balance, excess ECM deposition

causes dysfunction and disease states of the liver. Fibrillar collagens constitute the

majority of the liver, but non-fibrillar collagens, glycoproteins, and glycosaminoglycans

also play important roles in cell physiology.

3.1 Fibrillar Collagen

Fibrillar collagens, including collagens I, III, and V, comprise the largest

percentage of ECM proteins in the liver. These collagens contain rigid triple helix amino

acid structures and form heterogenous fiber bundles that give the liver its strength and

mechanical properties (49). Collagen I is the thickest and most prevalent type of fibrillar

collagen. It is a highly ubiquitous protein but can be found in the highest concentrations

in the periportal and pericentral regions (50). It contains several binding sites per peptide

that attach α1β1 and α1β2 integrins. Collagen I also possesses several non-specific low

affinity binding sites for cell attachment (51). Many other ECM components can complex

with collagen I to interact with cells including other collagens, fibronectin, and

proteoglycans.

Collagen III is structurally similar to collagen I and is found in all areas of the

liver. Greater amounts are present in the periportal regions (22). This collagen type also

comprises a large percentage of developing tissue. In adult liver, collagen III associates

strongly with collagen I bundles. Collagen V is the last major fibrillar collagen found

22

throughout liver. Their thin fragile fibers link multiple collagen types to each other to

form cohesive units at both ends of the sinusoids (50).

3.2 Non-Fibrillar Collagens

Non-fibrillar collagens are a category of basement membrane molecules with

fragmented triple-helical structures. Their flexible structures create networks between

other ECM components (49). Collagen IV is the main constituent of the basement

membrane and secures other basement membrane components like perlecan and laminin

(52) to the underlying structure. This collagen is chiefly secreted by endothelial cells. It

forms the discontinuous sinusoids of liver lobules that allow for blood plasma flow into

the space of Disse (49).

Other collagens of the basement membrane include collagen VI and VIII.

Collagen VI forms networks with different collagen types and assembles collagen

bundles, including collagens I and III fibers. Collagen VI affixes smaller basement

membrane molecules as well as larger structures, such as blood vessels, by attachment

and connection to collagen IV subunits (50). This collagen also functions in tissue repair

through the binding and release of soluble factors that regulate mitogen-activating protein

kinases (MAPKs). Collagen VIII also binds cytokines that may be liberated to initiate

wound healing, especially during angiogenesis (49). This collagen type connects elastic

fibers of the vasculature and contributes to the physical properties of vessels.

3.3 Non-Collagenous Glycoproteins

Fibronectin and laminin are the most widespread glycoproteins of the liver. Both

glycoproteins have numerous roles in development, injury repair, and normal cellular

23

activity. Fibronectin (FN) is a high molecular weight protein dimer that encompasses

numerous variants with two principal forms; plasma and cellular fibronectin. Plasma

fibronectin is the most abundant glycoprotein found in the liver and is synthesized

primarily by hepatocytes (53). Cellular fibronectin is an insoluble form that exists at low

levels in normal liver tissue. The highest concentrations of this form are found in the

pericentral area (22). It is secreted by a variety of cell types, but the main producer is the

stellate cell. Cellular FN binds several other ECM components including collagen I,

perlecan, and fibrin (54). It concentrates in bundles attached to hepatocyte microvilli and

collagens of the space of Disse (55). It also occupies the pericellular spaces and basal

membranes in the liver’s portal regions (56, 57)

During tissue repair, plasma FN enters the site of injured tissue and initiates ECM

degradation and remodeling by activation of Kupffer cells and hepatic stellate cells. In

this process, activated stellate cells produce MMPs that degrade plasma FN. Hepatocytes

replace plasma FN with insoluble cellular FN for incorporation into the ECM (55).

Fibronectin contains the Arginine-Glycine-Aspartic acid (RGD) cell binding sequence

that interacts with several integrin types. With these high affinity binding sites, cellular

FN acts as a chemoattractant, cell adhesion molecule, and growth factor for migrating

cells.

Laminin is another RGD-containing ligand found chiefly in the basement

membrane of the portal region and the sinusoidal wall. It is also present in certain liver

growth and developmental states in the perisinusoidal space (58). Laminin attaches cells

of the sinusoids through integrin interactions and can induce cell migration and motility.

This glycoprotein secreted by hepatic stellate cells is vital in vascular structural

24

maintenance, but is also important in the regulation of development and differentiation in

the liver (49, 59).

3.4 Glycosaminoglycans

GAGs are another important group of molecules that promote cell adhesion and

viability within the ECM. GAGs are long polysaccharide chains of various sizes and

sulfation states (60). There are six total GAG types that are classified into four

structurally distinct families; heparan sulfate (HS)/heparin, chondroitin (CS)/dermatan

sulfate (DS), keratan sulfate (KS), and hyaluronan (61). Most of these polysaccharides

covalently attach to distinct protein cores to form proteoglycans and integrate with the

ECM. The exception is HA, which does not directly covalently bond to proteins to form

proteoglycans, but directly and independently attaches to the ECM (62).

GAGs bind and affect enzymes, enzyme inhibitors, cell attachment molecules,

ECM proteins, and growth factors of the liver and other organ systems. These proteins

contain positively charged amino acids that form ionic and hydrogen bonds to negatively

charged sulfates and carboxylates of GAGs (63, 64). Specificity and strength of these

interactions are determined by protein confirmation and how certain amino acid residues

align with the arrangement of sulfated sites (62, 63). Through these interactions, GAGs

influence the mechanical properties of the ECM, enzyme activation, and activity of a vast

array of tissue specific growth factors.

GAGs greatly increase the half-life of growth factors compared to soluble growth

factors that remain free in plasma. GAG binding protects these proteins from proteolytic

degradation (65). This interaction also enhances presentation and utilization of growth

25

factors by clustering bound growth factors close to cell receptors of attached cells (66).

With the capacity to control periodic release, cells easily exploit housed growth factors

when needed for growth and functional maintenance (19). The ability to preserve and

display growth factors reduces the need of tissues to generate large quantities of growth

factors in a short period of time, which might produce adverse systemic effects.

The most common proteoglycan in the liver is perlecan, which is mainly produced

by hepatocytes and is comprised of the GAG, heparan sulfate (67). HS proteoglycans

compose 60% of all proteoglycans in the liver and are normally found in the ECM of the

sinusoids, perisinusoidal space, and sinusoidal walls (49). HS has a similar structure to

heparin but is generally longer in length and more varied in disaccharide and sulfated

configurations (63, 68). This complexity and flexibility in arrangement allows HS to

interact with a wide variety of biologically active proteins, growth factors, and cellular

receptors (69). This GAG binds to collagen, fibronectin, and laminin in the ECM to

support tissue structure and cell adhesion. HS binding to collagen organizes collagen

bundles. Interactions with fibronectin and laminin control their confirmation and

biological activity (70). HS is also a receptor for several different growth factors that

affect cell growth and function, which includes a high specificity for HGF in the liver

(62, 71, 72).

Hyaluronic acid (HA) comprises only a minor fraction of the liver ECM and total

proteoglycan volume but still has significant roles in the physical properties of liver

tissue. HA sequesters water to maintain hydration of the ECM and also provides

lubrication to enable cell motility and migration (73). HA is important during new liver

tissue formation. Concentrations of HA increase during development and tissue

26

regeneration to promote activity of proliferating cells (74). These properties and its

ability to avoid immune reactions upon transplantation make HA a suitable substrate for

cell culture and eventual use for in vivo treatments (75).

3.5 ECM Bound Growth Factors

Growth factors have a wide range of functions that vary from cell growth and

proliferation to phenotypic determination and maintenance. Glycoproteins of the ECM

bind these growth factors non-covalently through hydrogen binding and electrostatic

interactions to protect them from degradation, concentrate them in specific areas of the

tissue, and regulate interactions with cell receptors (76-78). Following attachment to

nearby ECM molecules, cells utilize proteolytic cleavage to free bound growth factors,

making them available to interact with membrane bound receptors (79). Numerous

growth factors are important to the regulation of liver function. Three of these proteins

with the most significant impact in the liver are hepatocyte growth factor (HGF),

epidermal growth factor (EGF), and fibroblast growth factor (FGF).

HGF is a unique heterodimer chiefly secreted by mesenchymal cells, especially

HSCs in the liver. It is also produced in lower levels by SECs in the liver (80, 81). After

activation of this growth factor by serine protease, HGF acts as a powerful mitogen and

stimulates cell proliferation by binding to the c-Met receptor of epithelial and endothelial

cells to activate tyrosine kinase signaling (82, 83). HGF strongly affects both liver

progenitor cells and differentiated hepatocytes (84-88). Studies with mesenchymal stem

cells showed that the presence of HGF on surrounding ECM drives differentiation toward

adult hepatocytes (89). HGF is vital to both progenitor cell and hepatocyte-mediated liver

27

regeneration. Spikes in HGF release, up to 20-fold normal plasma levels, correlate with

increased liver mass production (29, 90, 91). This protein also controls morphology,

migration, and tissue organization during reparative processes in the liver (84, 92, 93). In

animal models, HGF treatment accelerated recovery from cirrhosis and enhanced

regeneration (94). Because of its mitogenic properties, increased HGF levels have also

been implicated in aiding development of certain types of cancer (95).

HGF binds with a high affinity to the liver matrix through the GAGs, heparin and

heparan sulfate. HS mediates HGF use by cells and increases its half-life from 4 minutes

in blood plasma to several hours to match usage rates of surrounding cells (96-98). HGF

also has the ability to bind to areas of the matrix without HS through low affinity

interactions with several collagen types (99). These properties of HGF show its

importance in maintaining hepatocyte viability and function and demonstrate how

substrates could be designed to maximize HGF utilization in vitro or during cell

therapies.

While the importance of HGF in the maintenance of hepatocytes is well

established, other factors greatly affect and support liver cells. EGF is an important

growth factor that affects growth, viability, and differentiation of cells. EGF is primarily

produced in the Brunner’s gland of the duodenum (100). In the liver, it enters through the

portal vein of the portal triad and stimulates G1 to S phase transition and activates cell

division of hepatocytes. Unlike HGF, EGF acts through the tyrosine kinase EGF receptor

(EGFR) (101). It is vital for normal liver regeneration and induces Cyclin D1 (102, 103).

Other ligands of the EGFR also have similar mitogenic effects to EGF, like transforming

growth factor alpha (TGFα) and heparin binding EGF (HB EGF). They are manufactured

28

by endothelial cells and Kupffer cells in the liver and have both autocrine and paracrine

roles in proliferation (29, 104).

Another highly mitogenic growth factor family is the fibroblast growth factor

family. Like with HGF, heparin and heparan sulfate have a strong affinity for FGF. There

are 22 members of FGF family, but the most studied and recognized member is basic

fibroblast growth factor (bFGF or FBF2) (91, 105). FBF2 is secreted by HSCs in the

perisinusoidal region and, similar to HGF and EGF, is vital to wound healing and

angiogenesis in the liver (106).

4. Liver Regeneration

The roles of all of these tissue components show the importance of interplay

between cells, ECM structural molecules, and growth factors in the liver. These

relationships are not only important for normal function but also for development and

regeneration. Liver regeneration is a well-studied growth process which gives insights

into ontogeny of all organs (107). During liver regeneration, there is a complex step-wise

process that creates coordination between all liver components in order to grow and

organize new tissue. The exact mechanisms that mediate liver regeneration and the cell

phenotypes involved in the process are still hotly debated.

4.1 Normal Liver Repair and Regeneration

Loss of liver tissue, either by physical removal of tissue mass or acute chemical

toxicity, initiates the liver regenerative process. In the case of acute liver failure, dying

cells stimulate an immune response by Kupffer cells to clear dead cellular material (108).

Kupffer cells then activate HSCs and hepatocytes to begin regeneration of liver tissue

29

(29, 109). According to one model, liver regeneration is primarily accomplished by

proliferation of adult hepatocytes of the parenchyma (110). An alternate theory states that

regeneration is a delicate balance between epithelial to mesenchymal transitions (EMT)

and mesenchymal to epithelial transitions (MET), similar to the lineage transitions that

occur during development. This theory claims that following injury, epithelial cells

within the liver undergo EMT and migrate to the periportal zone. These fibroblasts

initiate repair and replicate before reverting back to hepatocytes or cholangiocytes in

order to repopulate the liver parenchyma (111).

During liver restoration, one of the first molecules secreted to regulate cells is a

proteinase called urokinase-type plasminogen activator (u-PA). It is released as rapidly as

1 minute following partial hepatectomy and correlates with an increase in its receptor u-

PAR (58). Besides releasing plasminogen, u-PA frees and activates ECM bound HGF for

immediate use and stimulation of hepatocytes. A peak in the release of HGF occurs just

one hour post-partial hepatectomy. During this time, HSCs, Kupffer cells, and SECs are

activated to release HGF, EGF, and other growth factors to promote further hepatocyte

proliferation, as well as autocrine mediated proliferation. Peaks in growth factor

production occur at 24 hours and 48 hours post-injury (90, 91, 112, 113).

MMPs are also produced to degrade old or damaged matrix and allow for

unrestricted hepatocyte replication. As a result, fibronectin and other cellular attachment

molecules decrease in the periportal regions until after the cellular mass is restored(29,

59). Hepatocytes proliferate starting in the periportal area. Proliferation proceeds into the

mid-lobular area, before finally initiating in the pericentral region. Full cellular mass is

replaced by 5-7 days in assays with rat models and around 3 months in humans (28, 114).

30

In normal intact ECM, HSCs simultaneously remodel matrix as new cells

proliferate. HSCs fully transdifferentiate into myofibroblasts and migrate to damaged

areas to lay down ECM, starting with collagen I and FN in the perisinusoidal space (18).

However, in an injury where whole tissue is lost, HSCs delay ECM production until new

hepatocyte clusters are created. HSCs infiltrate newly proliferated masses and secrete

laminin, collagen, and fibronectin to align hepatocytes into cords (59). This action

attracts endothelial cells to form new bile ducts and fenestrated sinusoids. Hepatocyte

division ceases when newly synthesized glycoproteins sequester HGF (115). Feedback

mechanisms between HSCs and hepatocytes also increase production of TGF-β1, which

halts new HGF secretion and returns proliferating hepatocytes to their resting states (35).

In the days that follow, further ECM is produced to organize cells into proper lobule

structures and restore full function in the liver.

4.2 Progenitor Cell Mediated Repair and Regeneration

In specific cases of liver repair, massive necrosis or chronic injury inhibits

proliferation of the resident hepatocyte population. This scenario is modeled in rats by

treatment of the chemical N-2-acetylaminofluorene (2-AAF) followed by partial

hepatectomy (116). In these situations, the liver activates bipotential hepatic progenitor

cells, to repopulate the tissue. In progenitor cell mediated regeneration, HSCs work in

close proximity with progenitor cells to direct migration, proliferation, and differentiation

(115, 117). HA deposits surround these two cell types during OC regeneration and

provide lubrication to allow cells to more easily migrate (38, 73). HSCs create a

provisional fibronectin rich matrix, which guides progenitor cells to damaged tissue with

the aid of bound connective tissue growth factor (CTGF) (116). CTGF and HS-bound

31

HGF stimulate progenitor cells to attach and replicate (118). These bipotential cells either

become differentiated hepatocytes or cholangiocytes to replenish lost tissue. Evidence

also exists that stellate cells themselves could undergo mesenchymal to epithelial

transition in order to bolster the compensatory hyperplasia (119). Following attachment

and differentiation, fibronectin and HA concentrations diminish, and a normal matrix

composition replaces the provisional matrix of the liver. This alternative method of

regeneration proves that nature has more than one method of repair in the body to

overcome different scenarios.

5. Liver Disease

Repair or regeneration is a delicate balance between matrix production, matrix

degradation, and cell proliferation. Despite the extraordinary abilities of the liver to repair

itself from acute trauma, problems arise when imbalances exist. Persistent stresses of

toxins, alcohol, or viral hepatitis cause fibrosis and advanced cirrhosis, which lead to

health complications or mortality in humans (52). Autoimmune responses, metabolic

disorders, and simple genetics can also initiate liver dysfunction in both infants and adults

(120). Many hallmarks of liver disease can be attributed to either the overactivation of

fibroblasts and/or dedifferentiation of hepatocytes. In certain disease states, loss of

function in cholangiocytes is also evident.

5.1 Metabolic Disease

Inheritance of faulty genes can cause specific enzyme deficiencies which result in

disorders of the liver. These deficiencies can occur in several different cell organelles and

impair various metabolic functions. Lysosomal and peroxisomal disorders can lead to

32

buildup of excess toxins and wastes that damage liver tissue (121). Specific diseases

related to these organelles include Tay-Sachs disease, Gaucher disease, and Zellweger

syndrome (122). Hemochromatosis is a deficiency in metabolism of metals in the body

which creates an accumulation of toxic levels of iron in the liver. Problems with

metabolism of galactose (galactosemia) or glycogen storage disease can lead to

impairment in regulation blood glucose levels. These imbalances can cause energy loss

and swelling of the liver (123). All of these metabolic diseases are currently incurable but

can be managed with proper nutrition or enzyme replacement therapies.

5.2 Cholangiopathies

Chronic liver disease is the progressive loss of liver function which can result in

end-stage liver disease and death. One of the cell types potentially targeted during the

development of chronic liver disease is the cholangiocyte. Cholangiopathies were

responsible for 16% of liver transplants from the years 1988 to 2014 (124). These

diseases include primary sclerosing cholangitis, biliary atresia, cystic fibrosis, and biliary

cirrhosis. During progression of these disorders, apoptosis of cholangiocytes,

inflammation, and excess collagen deposition results in obstruction or destruction of bile

ducts. This biliary degeneration can lead to increased levels of lipids and cholesterol,

portal hypertension, and liver scarring ultimately resulting in high mortality rates (124,

125).

5.3 Progression of Liver Fibrosis

One of the chief orchestrators of chronic liver disease and patient morbidity is

HSCs. Constant trauma and damage triggers release of inflammatory mediators and pro-

33

fibrotic cytokines that activate HSCs and portal fibroblasts (126). These activated cells

deposit excess quantities of ECM leading to hallmarks of fibrosis. Hepatocytes, SECs,

and cells that have undergone EMT also contribute to increased matrix and cytokine

production (43).

Collagen I, the most prevalent ECM component, increases throughout the liver

tissue and initiates further HSC activation. Cells in the space of Disse of the periportal

region deposit abnormal amounts of laminin, type IV collagen, and perlecan. Collagen IV

can increase up to 10-fold, while perlecan increases 8-times the normal liver

concentration (49). This build-up of matrix increases endothelial cell attachment and

eventually closes off the fenestrated sinusoids (42). Creating a continuous basement

membrane seals off the sinusoids and has several detrimental effects on the liver. Most

importantly wastes, toxins, and xenobiotics no longer easily interact with hepatocytes and

instead, move through the liver into the peripheral circulation. If left unprocessed, excess

bilirubin, the byproduct of hemoglobin catabolism, causes jaundice (127). Closed

sinusoids also prevent lipids from being metabolized in the parenchyma and leads to

atherosclerosis in patients (42). With increased fibrosis, sinusoids and liver vessels

constrict and block, which restricts blood flow and causes portal hypertension in patients

(128).

Changes during fibrosis also occur in the ECM of the centrilobular region. This

area accumulates irregular levels of fibronectin, type III collagen, and dermatan sulfate.

Elevated amounts of insoluble cFN activate HSCs and increase SEC attachment.

Increased plasma FN causes aberrant Kupffer cell activation and increased inflammation

34

in the liver. Without corrections in matrix deposition, cirrhosis leads to complications and

total loss of liver function.

Fibrosis is not only the result of increased matrix synthesis but additionally from

reduced matrix degradation. During normal liver repair, HSCs maintain an equilibrium

between production of MMPs and tissue inhibitor of metalloproteinases (TIMPs) (57).

However, during fibrosis, TIMPs, especially TIMP1 and TIMP2, are secreted at a greater

rate and block any action of MMPs (49). This inhibition, along with increases in matrix

production, worsens liver health and function. To treat liver disease, therapies need to

both revert HSCs and other ECM secreting cells to quiescent states and block the release

of TIMPs. Through these actions, balance and normal liver function can be restored.

6. Stiffness in Tissue Microenvironments

Increased collagen deposition and crosslinking during fibrosis cause changes in

the mechanical properties of the ECM. Mechanical properties of tissue

microenvironments contribute to the overall function and health of the organ systems

they comprise. These forces include shear stress induced by laminar flow in the

vasculature, tension from attachment to adjacent cells, and compression or bending of

tissue in response to external stimuli (129). One of the physical factors with the greatest

impact on cell behavior is stiffness. Stiffness is the mechanical property that represents

rigidity or the resistance to deformity following an applied force (130, 131). Variations in

stiffness are found in both the cells and extracellular matrix (ECM) that constitute tissue.

35

6.1 ECM Stiffness

ECM stiffness varies with tissue or organ type. Brain and fat are two of the softest

tissue types, while bone has the most rigid matrix composition and is several-fold stiffer

(132). The mechanical properties of ECM directly correlate to tissue function. Physical

characteristics of the matrix are determined by its composition of structural molecules,

the tension generated by cell attachment and migration, and exogenous physiological

forces such as blood flow.(133, 134) Stiffness also depends on location within the tissue

or organ. Gradients of bone and skeletal muscle stiffness can be found in the body. ECM

composition in the liver changes from the periportal to the pericentral regions of lobules

resulting in changes in cell phenotype, even among cells of the same lineage (22, 135).

Because of differences in the molecular arrangement throughout these liver

microstructures, one can infer that variations in stiffness also exist. A clinical study

supported this concept by measuring stiffness of liver sections in separate locations.

Results showed differing measurements between lobes of same liver and among smaller

areas within each lobe (136). Organ and tissue physiology show that the slightest

differences in mechanical properties can alter function of adult cells.

Studies have additionally shown the abilities of stiffness to direct stem cells

towards specific cell lineages. In a previous study, mesenchymal stem cells (MSCs) were

differentiated on varying substrate stiffnesses into three different cell lineages;

neurogenic, myogenic, and osteogenic cells (137). A separate group’s analysis revealed

that effects of growth factors on MSCs also changed with substrate stiffness. TGF-β

differentiated MSCs into smooth muscle cells (SMCs) at a low stiffness while

upregulating expression of chondrogenic markers at a higher stiffness level (138). By

36

simply changing this mechanical property, cell development and growth was directed to

mimic cells of a certain tissue type.

Cells not only change function but also migrate according to stiffness gradients.

In previous assays, MSCs under cell culture conditions traveled to areas of higher

substrate stiffness. The hypothesis stated that the cells migrate toward an injury-related

stiffness or a more scar-like site in order to aid in repair (139, 140). This phenomenon

called durotaxis has been observed in several cell types and is thought to be related to

mechanisms of development and wound healing (141). These studies show that physical

cues are just as important as chemical stimuli in determining cell arrangement, activation,

and phenotype.

6.2 Cellular Stiffness

Cell stiffness is directly correlated to the mechanical properties of the substrate to which

it is attached. This material could be the underlying ECM, a tissue culture biomaterial, or

a neighboring cell. Cell rigidity also depends on the cell lineage type, the cell’s maturity,

and the functional state or health of the cell (142). Cell stiffness ranges from softer

epithelial cells to stiffer smooth muscle cells and rigid osteocytes. Stem cells and

progenitor cells adapt their physical structures as they mature and differentiate (143,

144).

Certain disease and repair conditions can direct mechanical properties. Cells adapt

to dynamic physical environments and can change their activation states accordingly.

During the development of atherosclerosis, endothelial cells increase in stiffness which,

along with plaque build-up, limits flow of oxygen-rich blood (145, 146). Valvular

37

interstitial cells activate and become fibroblastic in diseased valves. They return to

quiescent states following repair and remodeling (147). In cancer, cells with decreased

stiffness have the highest metastatic potential (148). This concept holds true in ovarian

cancer cells where stiffness can be used as a biomarker for invasiveness (142).

Mechanical properties regulate cell-cell and cell-matrix interactions. Stiffness of

cells and the ECM can have independent or cumulative effects that cause systemic

imbalances and disease. Cells and matrix can also interact to balance physical conditions

and maintain normal tissue homeostasis and function. Determining methods to achieve a

healthy stiffness state in tissue will lead to effective treatments to correct disorders or

diseases in patients.

7. Liver ECM Stiffness during Developmental or Repair States

Stiffness is not a static property in liver tissue but fluctuates with organ

development, disease, and repair. In early liver development, a low stiffness environment

maintains progenitor cells in their undifferentiated form in the endoderm. As ECM

structures are created, cytokine and environmental cues eventually initiate cell migration

and differentiation of these cells into mature parenchymal liver cells (149, 150). These

observations are supported by in vitro studies which have shown the ability of low

stiffness substrates to maintain expression of stem cell markers in hepatic progenitor cells

(151).

Normal liver repair or regeneration is also initiated by elements of stiffness.

Matrix-producing hepatic stellate cells and endothelial cells are activated by damage or

increases in stiffness and migrate to these areas for repair (59). In these situations, MMPs

38

are required to degrade proteolytic-resistant collagens. These MMPs break-up or remove

damaged or excess ECM to allow formation of new matrix structures (37, 152). Physical

properties of the ECM as well as cell signaling enable new cells to repopulate these

repaired sites to restore normal tissue function (58).

In the instance of tissue resection such as a partial hepatectomy, the lost ECM

mass is fully regenerated de novo with the help of the activated matrix-producing cells.

The provisional matrix produced during early stages of repair or regeneration contains

uncrosslinked collagen I (58). In progenitor cell-mediated regeneration, this softer

composition initially maintains the hepatoblast phenotype of cells until ECM structures

are fully formed with the addition of collagen IV and the crosslinking of collagen I (153).

Regeneration initiated by proliferating hepatocytes occurs simultaneously to matrix

production by HSCs. However, physical cues provided by the ECM contribute to control

of the initiation and cessation of cell propagation (31, 35, 154).

Imbalances in these reparative processes can cause increases in stiffness and liver

dysfunction. Liver stiffness is an important parameter in the prognosis of liver diseases

including cirrhosis, hepatitis, and hepatocellular carcinoma (HCC) (155, 156). During a

fibrotic state, HSCs undergo uncontrolled activation and deposit excess amounts of

laminin and collagen, especially collagen IV (43, 59). Fibrosis also occurs because of a

loss of MMP production and increase in collagen crosslinking by lysyl oxidases (LOX)

(157). All these factors contribute to an increase in stiffness and lead to a loss of

hepatocyte phenotype and cell death (151). The liver is typically able to repair itself if the

causative stresses are eliminated. However, prolonged fibrosis can cause worsening

levels of stiffness and cellular impairment which eventually lead to irreversible cirrhosis

39

and liver failure (43, 130, 151). Elevated liver stiffness is also a precursor for the

development of HCC (158). It can predict both the appearance and metastatic potential of

tumors. Increased stiffness correlates with increased proliferation of cancer cells and

greater resistance to chemotherapeutic agents (151).

Novel research and treatments for liver disease attempt to address the mechanisms

that cause changes in tissue stiffness. Therapeutic strategies include inhibition of

activated stellate cells to limit ECM accumulation and developing agents to block LOX

to block collagen crosslinking. Groups are also investigating methods to better control the

release and action of a variety of MMPs to enable better manipulation of matrix

degradation to soften fibrotic tissue. Studies have shown that once cells are returned to a

normal stiffness environment, full function and health can be restored. Obtaining better

control over ECM stiffness levels will lead to greater management of liver disease.

8. Effects of Stiffness on Mechanotransduction and Focal Adhesion Signaling

8.1 Cell Adhesion Molecules

Cells sense mechanical properties of their microenvironment through cell

attachment initiated by integrins, syndecans, or other glycoproteins (159). Integrins are

the most common cell adhesion molecules (CAMs) and are composed of both an alpha

and beta subunit (160). These structural components determine the integrin’s specificity

to certain ECM molecules including collagens, fibronectin, laminin, or vitronectin (161).

Integrin engagement is vital for survival and normal phenotype of all epithelial cell types

(162). These transmembrane structures initiate signal transduction by formation of focal

adhesions that connect the ECM with the cytoskeleton. This mechanical force-induced

40

signaling allows cells to sense and interact with the surrounding substrate and affects cell

proliferation, motility, and function (163, 164).

Other adhesion molecules also have roles in regulating cell behavior. Syndecans

are transmembrane proteins that are linked to GAG chains of heparan sulfate and

chondroitin sulfate (165). Syndecans, with the aid of these GAGs, bind and concentrate

important growth factors, such as the liver HGF and EGF (166, 167). Although not as

prevalent as integrins, these proteoglycans also form anchoring junctions and can bind to

collagens and fibronectin of the ECM to support cell to matrix attachment. In addition,

syndecans can act alongside certain integrins to promote cell-cell adhesion (159).

Cadherins are a large family of glycoproteins that are the main effectors of cell-

cell binding. They provide connections between actin filaments of various cells to help

determine morphology and motility (168). Several classes of these calcium dependent

structures exist. Expression of E-cadherin (epithelial-cadherin) is specifically vital to

epithelial cell viability and polarity. E-cadherin forms homophilic cell-cell junctions

between hepatocytes within the liver and is critical to tissue formation (168, 169). Loss of

E-cadherin in vivo has been correlated with loss of cell phenotype and the development of

metastases in patients (170).

Tight junctions are another type of intercellular complex important to epithelial

cell adhesion, cell polarity, and function (171, 172). These structures prevent leaking of

material between cells and allow for direct diffusion and active transport of molecules

and ions between cells (173). Claudins, especially claudin-1, are required for structural

maintenance of tight junctions (174). Although not an integral structural component, the

41

tight junction protein occludin is a central protein involved in cell polarity and directional

migration. Occludin enables organization of actin filaments in response to stimuli that

lead to formation of cell protrusions and cell movement (175).

8.2 Mechanotransduction and Cytoskeletal Regulation

Cell adhesion molecules are fundamental for sensing the physical characteristics

of adjacent cells and the ECM or underlying cell culture material. Although all CAMs are

important to normal cellular functions, integrins are the molecules that are essential for

detecting substrate stiffness (176). Bound integrins develop small focal adhesion

complexes and stimulate assembly of more mature focal adhesions through recruitment

of kinases and adaptor proteins to enable cellular mechanotransduction (177, 178).

Cytoplasmic proteins serve as mediators to amplify or modify the signals generated from

integrin attachment. Signals are passed bidirectionally through either inside-out or

outside-in activation to affect cell phenotype and create changes in the surrounding ECM

microenvironment (179, 180).

During cell attachment, several different focal adhesion molecules are recruited to

interact at the cytoplasmic domains of the integrins. One of the first proteins to bind to

the integrin tail regions is talin. Talin is a key component of focal adhesions that

functionally activates integrins and determines their affinity for specific ligands (181).

Talin recruits the adaptor proteins paxillin and vinculin to focal adhesion complexes to

regulate the actin cytoskeleton (182). These linkages generate strain between integrins

and cytoskeletal structures to allow cells to sense substrate mechanical properties, which

in turn direct morphology and motility (183). Vinculin localizes to focal adhesion sites as

42

well as cadherin junctions. It directly connects talin to actin filaments within the cell.

Presence of vinculin is required for cell attachment, cell spreading, and filopodia

formation (184-186). Paxillin is another scaffold component that joins with talin to

control focal adhesion stability and turnover. It also interacts with different intracellular

kinases to regulate assembly of focal adhesion complexes and organization of the

cytoskeleton (183).

Focal adhesion kinase (FAK) is one of the main kinases that co-localizes with

integrins and affects their activation (179, 183). FAK has an integral role in

mechanotransduction. In previous studies utilizing FAK negative fibroblasts, mechanical

stiffness did not initiate normal cellular responses, and cell migration tendencies were

blocked (187). To initiate responses, FAK interacts with Src tyrosine kinase as well as

adaptor proteins and dozens of other focal adhesion signaling molecules (164). FAK

contains C-terminal and N-terminal domains that specify activity and transduction of

signals. The C-terminal domain allows FAK to migrate, attach, and disrupt focal

adhesion sites, while the N-terminus binds and regulates localization of ligands such as

paxillin (188, 189). Integrin attachment activates FAK by inducing kinase clustering and

autophosphorylation. This action subsequently allows Src to bind, activate, and further

phosphorylate FAK at various amino acid residues (164, 190).

Depending on the site targeted, phosphorylation of FAK affects a wide variety of

proteins and intracellular pathways to execute different and sometimes opposing

functions. FAK is important in cell viability and stimulates phosphoinositide 3-kinase

(PI3K) mediated upregulation of protein kinase B (AKT) (191). FAK also supports

survival by serving as a scaffold for phosphorylation of Crk-associated substrate (CAS)

43

which activates c-Jun N-terminal kinases (JNK), mitogen-activated protein kinase 1

(MAPK1), and mitogen-activated protein kinase 3 (MAPK3) (192). Previous studies have

shown the ability to prevent anoikis, or detachment related apoptosis, in epithelial cells

through FAK expression (193, 194).

In addition to influencing viability and proliferation, activated FAK in

combination with Src can phosphorylate talin and lead to the disassembly of focal

adhesion complexes (195, 196). Under unique conditions, FAK has also been observed to

strengthen integrin attachment and enhance focal adhesion formation (197, 198).

Differences in results of these studies could be explained by the ability of FAK to

stimulate at least four separate pathways of actin assembly and cell motility (199). PI3K

and CAS pathways are not only FAK targets implicated in cell survival, but also

stimulate cell spreading and migration (164, 200). Both PI3K and CAS serve as

regulators of the downstream Ras homolog family member (Rho) GTPase, Ras-related

C3 botulinum toxin substrate (Rac) (192, 201). FAK also regulates function of the

adaptor protein growth factor receptor-bound 7 (GRB7) as well as neural Wiskott-

Aldrich syndrome protein (N-WASP) (202). N-WASP controls actin polymerization and

remodeling through the actin-related protein (Arp) 2/3 complex and another type of Rho

GTPase, cell division control protein 42 (CDC42) (164, 199). Studies have also shown

that FAK can actually suppress a third type of Rho GTPase, Ras homolog family member

A (RhoA), to promote focal adhesion turnover (203).

FAK regulates Rho GTPases that are vital to focal adhesion assembly and

disassembly, actin organization, and ultimately cell motility. The three main Rho

GTPases (Rac1, CDC42, and RhoA) work in concert with each other to initiate cell

44

migration (204). However, cells seeded on varying ECM molecules or stiffnesses can

produce activation profiles of the Rac1 and CDC42 that differ from RhoA in timing or

expression levels. In research on fibroblasts seeded on fibronectin, Rac1 and CDC42

were stimulated at early time points post-seeding, while RhoA was activated much later

in vitro (199). These previous studies show that FAK activation occurs at various

phosphorylation sites or affects different pathways to control the two sets of Rho

GTPases (205).

Rac1 and CDC42 stimulate actin polymerization and extension of cellular

processes for movement. Rac1 is directly involved in formation of lamellipodia at the

leading edge of polarized cells (206, 207). Besides activation by FAK, paxillin can bind

and stimulate Rac1 activity. CDC42 binds and activates n-WASP to create thin

projections called filopodia past the frontal cellular boundary (183). Both GTPases and

FAK are required for durotaxis and other forms of directional migration controlled by

feedback signaling mechanisms (208). Lower substrate stiffness levels have been shown

to support turnover of focal adhesion sites, easier alteration of cell morphology, and

simpler cell detachment for motility (199).

RhoA can act in opposition to cell movement by increasing the assembly and

formation of mature focal adhesions and contractile actin stress fibers through stimulation

of Rho-associated protein kinase (ROCK). Increases in RhoA correlate with increases in

stiffness and create greater cytoskeletal organization, actin polarization, and stabilization

and anchorage of cell structures (209). However, overexpression of RhoA can actually

lead to build-up of stress fibers and EMT which promotes the development of cancer

(210, 211). In contrast to formation of stable adhesions, RhoA is also essential to

45

generate traction force for migration on substrates. Cells can initiate stronger traction

forces on stiffer or inflexible surfaces (209). The tradeoff is that greater stiffness in

substrates creates more stable focal adhesions that make cell detachment more difficult

(199). Therefore, an intermediate, substrate stiffness is optimal for traction and speed for

cell motility.

In addition to FAK’s effects on Rho GTPase expression, integrin-linked kinase

(ILK) can act in parallel to influence cell morphology and motility (212). ILK recruits

PINCH1 to focal adhesions to regulate assembly and disassembly during cell migration.

ILK also complexes with Engulfment and Cell Motility 2 (ELMO2) and RhoG for cell

polarization (213). Similar to FAK, ILK can stimulate PI3K-induced activation of Rac1

to control cytoskeletal rearrangement and formation of cellular processes (214, 215).

As discussed, mechanical sensing and signaling involves a complex array of focal

adhesion sites, intracellular kinases, and Rho GTPases. These various molecules act in

conjunction to affect the actin cytoskeleton and form cellular protrusions. The outside-in

signaling and resultant inside-out adjustments applied by the cell can affect morphology,

motility, and ultimately the overall function of the cell. Understanding the mechanisms

and actions of important effectors like FAK, ILK, and Rho GTPases in specific cell types

under defined culture conditions will allow researchers to better model disease and more

precisely manipulate substrates for use in testing or therapies.

46

Works Cited

(216)

1. Martini F, Bartholomew EF. Essentials of anatomy & physiology. 4th ed. San Francisco: Pearson/Benjamin Cummings; 2007. 2. Sherwood L, Cengage Learning (Firm). Human physiology : from cells to systems. 7th ed. Australia ; United States: Brooks/Cole, Cengage Learning; 2010. 3. Ganong's review of medical physiology. New York: McGraw-Hill Medical; 2010. 4. Gropper SS. Advanced nutrition and human metabolism. 6th Ed. ed. Belmont, OH: Cengage Learning; 2012. 5. Chatterjea MN, Shinde R. Textbook of medical biochemistry. 8th ed. New Delhi: Jaypee Brothers Medical Publications (P) Ltd.; 2012. xvii, 876 p. p. 6. LeCluyse EL, Witek RP, Andersen ME, Powers MJ. Organotypic liver culture models: meeting current challenges in toxicity testing. Crit Rev Toxicol. 2012;42(6):501-48. doi: 10.3109/10408444.2012.682115. PubMed PMID: 22582993; PMCID: 3423873. 7. Tzanakakis ES, Hess DJ, Sielaff TD, Hu WS. Extracorporeal tissue engineered liver-assist devices. Annu Rev Biomed Eng. 2000;2:607-32. doi: 10.1146/annurev.bioeng.2.1.607. PubMed PMID: 11701525. 8. Xu C, Li CY, Kong AN. Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch Pharm Res. 2005;28(3):249-68. PubMed PMID: 15832810. 9. Lautt WW. Hepatic Circulation: Physiology and Pathophysiology. San Rafael (CA)2009. 10. Malarkey DE, Johnson K, Ryan L, Boorman G, Maronpot RR. New insights into functional aspects of liver morphology. Toxicol Pathol. 2005;33(1):27-34. doi: 10.1080/01926230590881826. PubMed PMID: 15805053. 11. Reichen J. The Role of the Sinusoidal Endothelium in Liver Function. News Physiol Sci. 1999;14:117-21. PubMed PMID: 11390834. 12. Wingerd BD. The human body : concepts of anatomy and physiology. Third edition. ed. Philadelphia: Wolters Kluwer/Lippincott Williams & Wilkins; 2014. xvi, 528 pages p. 13. Lanza RP, Atala A. Essentials of stem cell biology. Second edition. ed. Amsterdam: Elsevier/Academic Press; 2014. xxviii, 680 pages p.

Fig.2) Integrin Signaling and Regulation of Rho GTPases, partially adapted from Mayor et al (209)

47

14. Mescher AL. Junqueira's Basic Pathology: Text & Atlas. 12 ed: McGraw-Hill Education 2010. 15. Berry MN, Edwards AM. The hepatocyte review. Dordrecht ; Boston: Kluwer Academic Publishers; 2000. xvi, 605 p. p. 16. Jungermann K, Stumpel F. Role of hepatic, intrahepatic and hepatoenteral nerves in the regulation of carbohydrate metabolism and hemodynamics of the liver and intestine. Hepatogastroenterology. 1999;46 Suppl 2:1414-7. PubMed PMID: 10431702. 17. Treyer A, Musch A. Hepatocyte polarity. Compr Physiol. 2013;3(1):243-87. doi: 10.1002/cphy.c120009. PubMed PMID: 23720287; PMCID: 3697931. 18. Arias IM. The liver : biology and pathobiology. 5th ed. Chichester, West Sussex, UK ; Hoboken, NJ: John Wiley & Sons; 2009. p. p. 19. Warren A, Le Couteur DG, Fraser R, Bowen DG, McCaughan GW, Bertolino P. T lymphocytes interact with hepatocytes through fenestrations in murine liver sinusoidal endothelial cells. Hepatology. 2006;44(5):1182-90. doi: 10.1002/hep.21378. PubMed PMID: 17058232. 20. Fu D, Wakabayashi Y, Ido Y, Lippincott-Schwartz J, Arias IM. Regulation of bile canalicular network formation and maintenance by AMP-activated protein kinase and LKB1. J Cell Sci. 2010;123(Pt 19):3294-302. doi: 10.1242/jcs.068098. PubMed PMID: 20826460; PMCID: 2939801. 21. Gumucio JJ. Hepatocyte heterogeneity: the coming of age from the description of a biological curiosity to a partial understanding of its physiological meaning and regulation. Hepatology. 1989;9(1):154-60. PubMed PMID: 2642292. 22. McClelland R, Wauthier E, Uronis J, Reid L. Gradients in the liver's extracellular matrix chemistry from periportal to pericentral zones: influence on human hepatic progenitors. Tissue Eng Part A. 2008;14(1):59-70. doi: 10.1089/ten.a.2007.0058. PubMed PMID: 18333805. 23. Bacon BR, Di Bisceglie AM. Hepatitis C virus infection. N Engl J Med. 2001;345(19):1425-6; author reply 7-8. PubMed PMID: 11794183. 24. Dufour J-Fo, Clavien P-A. Signaling pathways in liver diseases. 2nd ed. Heidelberg ; New York: Springer; 2010. xv, 526 p. p. 25. Katz NR. Metabolic heterogeneity of hepatocytes across the liver acinus. J Nutr. 1992;122(3 Suppl):843-9. PubMed PMID: 1542056. 26. Schiff ER, Maddrey WC, Sorrell MF, Schiff L. Schiff's diseases of the liver. 11th ed. Chichester, West Sussex, UK: John Wiley & Sons; 2011. p. p. 27. Hailfinger S, Jaworski M, Braeuning A, Buchmann A, Schwarz M. Zonal gene expression in murine liver: lessons from tumors. Hepatology. 2006;43(3):407-14. doi: 10.1002/hep.21082. PubMed PMID: 16496347. 28. Helling TS. Liver failure following partial hepatectomy. HPB (Oxford). 2006;8(3):165-74. doi: 10.1080/13651820510035712. PubMed PMID: 18333270; PMCID: 2131683. 29. Michalopoulos GK. Liver regeneration. J Cell Physiol. 2007;213(2):286-300. doi: 10.1002/jcp.21172. PubMed PMID: 17559071; PMCID: 2701258. 30. Geerts A. History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells. Semin Liver Dis. 2001;21(3):311-35. doi: 10.1055/s-2001-17550. PubMed PMID: 11586463. 31. Haussinger D. Liver regeneration. Berlin: de Gruyter; 2011. xvii, 210 p. p. 32. Friedman SL. Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver. Physiol Rev. 2008;88(1):125-72. doi: 10.1152/physrev.00013.2007. PubMed PMID: 18195085; PMCID: 2888531.

48

33. Jiang F, Parsons CJ, Stefanovic B. Gene expression profile of quiescent and activated rat hepatic stellate cells implicates Wnt signaling pathway in activation. J Hepatol. 2006;45(3):401-9. doi: 10.1016/j.jhep.2006.03.016. PubMed PMID: 16780995. 34. Coll M, Taghdouini AE, Perea L, Mannaerts I, Vila-Casadesus M, Blaya D, Rodrigo-Torres D, Affo S, Morales-Ibanez O, Graupera I, Lozano JJ, Najimi M, Sokal E, Lambrecht J, Gines P, van Grunsven LA, Sancho-Bru P. Integrative miRNA and Gene Expression Profiling Analysis of Human Quiescent Hepatic Stellate Cells. Sci Rep. 2015;5:11549. doi: 10.1038/srep11549. PubMed PMID: 26096707; PMCID: 4476106. 35. Yin C, Evason KJ, Asahina K, Stainier DY. Hepatic stellate cells in liver development, regeneration, and cancer. The Journal of clinical investigation. 2013;123(5):1902-10. doi: 10.1172/JCI66369. PubMed PMID: 23635788; PMCID: 3635734. 36. Wang P, Liu T, Cong M, Wu X, Bai Y, Yin C, An W, Wang B, Jia J, You H. Expression of extracellular matrix genes in cultured hepatic oval cells: an origin of hepatic stellate cells through transforming growth factor beta? Liver Int. 2009;29(4):575-84. doi: 10.1111/j.1478-3231.2009.01992.x. PubMed PMID: 19323784. 37. Iredale JP, Thompson A, Henderson NC. Extracellular matrix degradation in liver fibrosis: Biochemistry and regulation. Biochim Biophys Acta. 2013;1832(7):876-83. doi: 10.1016/j.bbadis.2012.11.002. PubMed PMID: 23149387. 38. Kikuchi S, Griffin CT, Wang SS, Bissell DM. Role of CD44 in epithelial wound repair: migration of rat hepatic stellate cells utilizes hyaluronic acid and CD44v6. J Biol Chem. 2005;280(15):15398-404. doi: 10.1074/jbc.M414048200. PubMed PMID: 15691832. 39. Ishibashi H, Nakamura M, Komori A, Migita K, Shimoda S. Liver architecture, cell function, and disease. Semin Immunopathol. 2009;31(3):399-409. doi: 10.1007/s00281-009-0155-6. PubMed PMID: 19468732. 40. Johnson LR. Physiology of the gastrointestinal tract. 4th ed. Burlington, MA: Elsevier Academic Press; 2006. p. p. 41. Willekens FL, Werre JM, Kruijt JK, Roerdinkholder-Stoelwinder B, Groenen-Dopp YA, van den Bos AG, Bosman GJ, van Berkel TJ. Liver Kupffer cells rapidly remove red blood cell-derived vesicles from the circulation by scavenger receptors. Blood. 2005;105(5):2141-5. doi: 10.1182/blood-2004-04-1578. PubMed PMID: 15550489. 42. Braet F, Wisse E. Structural and functional aspects of liver sinusoidal endothelial cell fenestrae: a review. Comp Hepatol. 2002;1(1):1. PubMed PMID: 12437787; PMCID: 131011. 43. Wells RG. Cellular sources of extracellular matrix in hepatic fibrosis. Clin Liver Dis. 2008;12(4):759-68, viii. doi: 10.1016/j.cld.2008.07.008. PubMed PMID: 18984465; PMCID: 2617723. 44. Kuntz E. Hepatology, textbook and atlas. 3rd ed. New York: Springer; 2008. 45. Cogger VC, Roessner U, Warren A, Fraser R, Le Couteur DG. A Sieve-Raft Hypothesis for the regulation of endothelial fenestrations. Comput Struct Biotechnol J. 2013;8:e201308003. doi: 10.5936/csbj.201308003. PubMed PMID: 24688743; PMCID: 3962122. 46. Tabibian JH, Masyuk AI, Masyuk TV, O'Hara SP, LaRusso NF. Physiology of cholangiocytes. Compr Physiol. 2013;3(1):541-65. doi: 10.1002/cphy.c120019. PubMed PMID: 23720296; PMCID: 3831353. 47. Strazzabosco M, Fabris L. Functional anatomy of normal bile ducts. Anat Rec (Hoboken). 2008;291(6):653-60. doi: 10.1002/ar.20664. PubMed PMID: 18484611; PMCID: 3743051. 48. Meadows GG. Integration/interaction of oncologic growth. Dordrecht: Springer; 2005. xix, 454 p. p. 49. Rodes J. Textbook of hepatology : from basic science to clinical practice. 3rd ed. Malden, Mass.: Blackwell; 2007.

49

50. Zern MA, Reid LM. Extracellular matrix : chemistry, biology, and pathobiology with emphasis on the liver. New York: Dekker; 1993. xiv, 591 p. p. 51. Rubin K, Borg TK, Holmdahl R, Klareskog L, Obrink B. Interactions of mammalian cells with collagen. Ciba Found Symp. 1984;108:93-116. PubMed PMID: 6569833. 52. Bedossa P, Paradis V. Liver extracellular matrix in health and disease. J Pathol. 2003;200(4):504-15. doi: DOI 10.1002/path.1397. PubMed PMID: WOS:000183925700010. 53. Pankov R, Yamada KM. Fibronectin at a glance. J Cell Sci. 2002;115(Pt 20):3861-3. PubMed PMID: 12244123. 54. Clark K, Pankov R, Travis MA, Askari JA, Mould AP, Craig SE, Newham P, Yamada KM, Humphries MJ. A specific alpha5beta1-integrin conformation promotes directional integrin translocation and fibronectin matrix formation. J Cell Sci. 2005;118(Pt 2):291-300. doi: 10.1242/jcs.01623. PubMed PMID: 15615773; PMCID: 3329624. 55. Wierzbicka-Patynowski I, Schwarzbauer JE. The ins and outs of fibronectin matrix assembly. J Cell Sci. 2003;116(Pt 16):3269-76. doi: 10.1242/jcs.00670. PubMed PMID: 12857786. 56. Moriya K, Bae E, Honda K, Sakai K, Sakaguchi T, Tsujimoto I, Kamisoyama H, Keene DR, Sasaki T, Sakai T. A fibronectin-independent mechanism of collagen fibrillogenesis in adult liver remodeling. Gastroenterology. 2011;140(5):1653-63. doi: 10.1053/j.gastro.2011.02.005. PubMed PMID: 21320502; PMCID: 3081910. 57. Boyer JL. Liver cirrhosis and its development : proceedings of the Falk Symposium 115 held in Basel, Switzerland, 22-24 October, 1999 (part II of the Basel Liver Week 1999; XI International Congress of Liver Diseases). Dordrecht ; Boston: Kluwer Academic; 2001. xii, 354 p. p. 58. Kim TH, Mars WM, Stolz DB, Petersen BE, Michalopoulos GK. Extracellular matrix remodeling at the early stages of liver regeneration in the rat. Hepatology. 1997;26(4):896-904. doi: 10.1002/hep.510260415. PubMed PMID: 9328311. 59. Martinez-Hernandez A, Amenta PS. The extracellular matrix in hepatic regeneration. Faseb J. 1995;9(14):1401-10. PubMed PMID: 7589981. 60. Taniguchi N. Glycoscience : biology and medicine. New York: Springer; 2014. pages cm p. 61. Taylor KR, Gallo RL. Glycosaminoglycans and their proteoglycans: host-associated molecular patterns for initiation and modulation of inflammation. Faseb J. 2006;20(1):9-22. doi: 10.1096/fj.05-4682rev. PubMed PMID: 16394262. 62. Esko JD, Kimata K, Lindahl U. Proteoglycans and Sulfated Glycosaminoglycans. In: Varki A, Cummings RD, Esko JD, Freeze HH, Stanley P, Bertozzi CR, Hart GW, Etzler ME, editors. Essentials of Glycobiology. 2nd ed. Cold Spring Harbor (NY)2009. 63. Hileman RE, Smith AE, Toida T, Linhardt RJ. Preparation and structure of heparin lyase-derived heparan sulfate oligosaccharides. Glycobiology. 1997;7(2):231-9. PubMed PMID: 9134430. 64. Esko JD, Linhardt RJ. Proteins that Bind Sulfated Glycosaminoglycans. In: Varki A, Cummings RD, Esko JD, Freeze HH, Stanley P, Bertozzi CR, Hart GW, Etzler ME, editors. Essentials of Glycobiology. 2nd ed. Cold Spring Harbor (NY)2009. 65. Zern BJ, Chu H, Wang Y. Control growth factor release using a self-assembled [polycation:heparin] complex. PLoS One. 2010;5(6):e11017. doi: 10.1371/journal.pone.0011017. PubMed PMID: 20543985; PMCID: 2882380. 66. Shute J. Glycosaminoglycan and chemokine/growth factor interactions. Handb Exp Pharmacol. 2012(207):307-24. doi: 10.1007/978-3-642-23056-1_13. PubMed PMID: 22566230. 67. Berry MN, Grivell AR, Grivell MB, Phillips JW. Isolated hepatocytes--past, present and future. Cell Biol Toxicol. 1997;13(4-5):223-33. PubMed PMID: 9298243.

50

68. Fromm JR, Hileman RE, Caldwell EE, Weiler JM, Linhardt RJ. Differences in the interaction of heparin with arginine and lysine and the importance of these basic amino acids in the binding of heparin to acidic fibroblast growth factor. Arch Biochem Biophys. 1995;323(2):279-87. doi: 10.1006/abbi.1995.9963. PubMed PMID: 7487089. 69. Munoz EM, Linhardt RJ. Heparin-binding domains in vascular biology. Arterioscler Thromb Vasc Biol. 2004;24(9):1549-57. doi: 10.1161/01.ATV.0000137189.22999.3f. PubMed PMID: 15231514; PMCID: 4114236. 70. Dumitriu S, Popa VI. Polymeric biomaterials. Boca Raton: CRC Press, Taylor & Francis Group; 2013. v. <1-2> p. 71. Lyon M, Deakin JA, Rahmoune H, Fernig DG, Nakamura T, Gallagher JT. Hepatocyte growth factor/scatter factor binds with high affinity to dermatan sulfate. J Biol Chem. 1998;273(1):271-8. PubMed PMID: 9417075. 72. Sarrazin S, Lamanna WC, Esko JD. Heparan sulfate proteoglycans. Cold Spring Harb Perspect Biol. 2011;3(7). doi: 10.1101/cshperspect.a004952. PubMed PMID: 21690215; PMCID: 3119907. 73. McCourt PA. How does the hyaluronan scrap-yard operate? Matrix Biol. 1999;18(5):427-32. PubMed PMID: 10601730. 74. Steinhoff G. Regenerative medicine : from protocol to patient. New York: Springer; 2013. 75. Murphy SV, Skardal A, Atala A. Evaluation of hydrogels for bio-printing applications. J Biomed Mater Res A. 2013;101(1):272-84. doi: 10.1002/jbm.a.34326. PubMed PMID: 22941807. 76. Jones JI, Gockerman A, Busby WH, Jr., Camacho-Hubner C, Clemmons DR. Extracellular matrix contains insulin-like growth factor binding protein-5: potentiation of the effects of IGF-I. J Cell Biol. 1993;121(3):679-87. PubMed PMID: 7683690; PMCID: 2119570. 77. Hudalla GA, Murphy WL. Biomaterials that regulate growth factor activity via bioinspired interactions. Adv Funct Mater. 2011;21(10):1754-68. doi: 10.1002/adfm.201002468. PubMed PMID: 21921999; PMCID: 3171147. 78. King WJ, Krebsbach PH. Growth factor delivery: how surface interactions modulate release in vitro and in vivo. Advanced drug delivery reviews. 2012;64(12):1239-56. doi: 10.1016/j.addr.2012.03.004. PubMed PMID: 22433783; PMCID: 3586795. 79. Bonnans C, Chou J, Werb Z. Remodelling the extracellular matrix in development and disease. Nat Rev Mol Cell Biol. 2014;15(12):786-801. doi: 10.1038/nrm3904. PubMed PMID: 25415508; PMCID: 4316204. 80. LeCouter J, Moritz DR, Li B, Phillips GL, Liang XH, Gerber HP, Hillan KJ, Ferrara N. Angiogenesis-independent endothelial protection of liver: role of VEGFR-1. Science. 2003;299(5608):890-3. doi: 10.1126/science.1079562. PubMed PMID: 12574630. 81. DeLeve LD. Liver sinusoidal endothelial cells and liver regeneration. The Journal of clinical investigation. 2013;123(5):1861-6. doi: 10.1172/JCI66025. PubMed PMID: 23635783; PMCID: 3635729. 82. Pediaditakis P, Monga SPS, Mars WM, Michalopoulos GK. Differential mitogenic effects of single chain hepatocyte growth factor (HGF)/scatter factor and HGF/NK1 following cleavage by factor Xa. Journal of Biological Chemistry. 2002;277(16):14109-15. doi: DOI 10.1074/jbc.M112196200. PubMed PMID: WOS:000175096000099. 83. Naldini L, Vigna E, Narsimhan RP, Gaudino G, Zarnegar R, Michalopoulos GK, Comoglio PM. Hepatocyte growth factor (HGF) stimulates the tyrosine kinase activity of the receptor encoded by the proto-oncogene c-MET. Oncogene. 1991;6(4):501-4. PubMed PMID: 1827664.

51

84. Matsumoto K, Nakamura T. Hepatocyte growth factor (HGF) as a tissue organizer for organogenesis and regeneration. Biochem Bioph Res Co. 1997;239(3):639-44. PubMed PMID: WOS:A1997YG93100001. 85. Kim SH, Akaike T. Epidermal growth factor signaling for matrix-dependent cell proliferation and differentiation in primary cultured hepatocytes. Tissue Eng. 2007;13(3):601-9. doi: 10.1089/ten.2006.0104. PubMed PMID: 17518606. 86. Steiger-Luther NC, Darwiche H, Oh SH, Williams JM, Petersen BE. Insulin-like growth factor binding protein-3 is required for the regulation of rat oval cell proliferation and differentiation in the 2AAF/PHX model. Hepatic medicine : evidence and research. 2010;2010(2):13-32. doi: 10.2147/HMER.S7660. PubMed PMID: 21852899; PMCID: 3156464. 87. Kim M, Lee JY, Jones CN, Revzin A, Tae G. Heparin-based hydrogel as a matrix for encapsulation and cultivation of primary hepatocytes. Biomaterials. 2010;31(13):3596-603. doi: 10.1016/j.biomaterials.2010.01.068. PubMed PMID: 20153045; PMCID: 2837121. 88. Sellaro TL, Ranade A, Faulk DM, McCabe GP, Dorko K, Badylak SF, Strom SC. Maintenance of human hepatocyte function in vitro by liver-derived extracellular matrix gels. Tissue Eng Part A. 2010;16(3):1075-82. doi: 10.1089/ten.TEA.2008.0587. PubMed PMID: 19845461; PMCID: 2863084. 89. Ghaedi M, Tuleuova N, Zern MA, Wu J, Revzin A. Bottom-up signaling from HGF-containing surfaces promotes hepatic differentiation of mesenchymal stem cells. Biochem Biophys Res Commun. 2011;407(2):295-300. doi: 10.1016/j.bbrc.2011.03.005. PubMed PMID: 21382341; PMCID: 3075384. 90. Stolz DB, Mars WM, Petersen BE, Kim TH, Michalopoulos GK. Growth factor signal transduction immediately after two-thirds partial hepatectomy in the rat. Cancer Res. 1999;59(16):3954-60. PubMed PMID: 10463591. 91. Bohm F, Kohler UA, Speicher T, Werner S. Regulation of liver regeneration by growth factors and cytokines. EMBO Mol Med. 2010;2(8):294-305. doi: 10.1002/emmm.201000085. PubMed PMID: 20652897; PMCID: 3377328. 92. Ishikawa H, Jo JI, Tabata Y. Liver Anti-Fibrosis Therapy with Mesenchymal Stem Cells Secreting Hepatocyte Growth Factor. Journal of biomaterials science Polymer edition. 2011. doi: 10.1163/156856211X614761. PubMed PMID: 22182291. 93. Ichihara A. BCA, HGF, and proteasomes. Biochem Biophys Res Commun. 1999;266(3):647-51. doi: 10.1006/bbrc.1999.1882. PubMed PMID: 10603302. 94. Xue F, Takahara T, Yata Y, Kuwabara Y, Shinno E, Nonome K, Minemura M, Takahara S, Li X, Yamato E, Watanabe A. Hepatocyte growth factor gene therapy accelerates regeneration in cirrhotic mouse livers after hepatectomy. Gut. 2003;52(5):694-700. PubMed PMID: 12692055; PMCID: 1773642. 95. Bottaro DP, Rubin JS, Faletto DL, Chan AM, Kmiecik TE, Vande Woude GF, Aaronson SA. Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science. 1991;251(4995):802-4. PubMed PMID: 1846706. 96. Rubin JS, Day RM, Breckenridge D, Atabey N, Taylor WG, Stahl SJ, Wingfield PT, Kaufman JD, Schwall R, Bottaro DP. Dissociation of heparan sulfate and receptor binding domains of hepatocyte growth factor reveals that heparan sulfate-c-met interaction facilitates signaling. J Biol Chem. 2001;276(35):32977-83. doi: 10.1074/jbc.M105486200. PubMed PMID: 11435444. 97. Liu KX, Kato Y, Kato M, Kaku TI, Nakamura T, Sugiyama Y. Existence of two nonlinear elimination mechanisms for hepatocyte growth factor in rats. Am J Physiol. 1997;273(5 Pt 1):E891-7. PubMed PMID: 9374673. 98. Sakata H, Stahl SJ, Taylor WG, Rosenberg JM, Sakaguchi K, Wingfield PT, Rubin JS. Heparin binding and oligomerization of hepatocyte growth factor/scatter factor isoforms.

52

Heparan sulfate glycosaminoglycan requirement for Met binding and signaling. J Biol Chem. 1997;272(14):9457-63. PubMed PMID: 9083085. 99. Schuppan D, Schmid M, Somasundaram R, Ackermann R, Ruehl M, Nakamura T, Riecken EO. Collagens in the liver extracellular matrix bind hepatocyte growth factor. Gastroenterology. 1998;114(1):139-52. PubMed PMID: 9428228. 100. Orlando RC. Pathophysiology of gastroesophageal reflux disease. J Clin Gastroenterol. 2008;42(5):584-8. doi: 10.1097/MCG.0b013e31815d0628. PubMed PMID: 18364588. 101. Francavilla A, Ove P, Polimeno L, Sciascia C, Coetzee ML, Starzl TE. Epidermal growth factor and proliferation in rat hepatocytes in primary culture isolated at different times after partial hepatectomy. Cancer Res. 1986;46(3):1318-23. PubMed PMID: 3002614; PMCID: 2963441. 102. Mullhaupt B, Feren A, Fodor E, Jones A. Liver expression of epidermal growth factor RNA. Rapid increases in immediate-early phase of liver regeneration. J Biol Chem. 1994;269(31):19667-70. PubMed PMID: 7519599. 103. Mullhaupt B, Feren A, Jones A, Fodor E. DNA sequence and functional characterization of the human and rat epidermal growth factor promoter: regulation by cell growth. Gene. 2000;250(1-2):191-200. PubMed PMID: 10854792. 104. Monga SP. Role of Wnt/beta-catenin signaling in liver metabolism and cancer. Int J Biochem Cell Biol. 2011;43(7):1021-9. doi: 10.1016/j.biocel.2009.09.001. PubMed PMID: 19747566; PMCID: 2891959. 105. Ornitz DM, Itoh N. Fibroblast growth factors. Genome Biol. 2001;2(3):REVIEWS3005. PubMed PMID: 11276432; PMCID: 138918. 106. Cao R, Brakenhielm E, Pawliuk R, Wariaro D, Post MJ, Wahlberg E, Leboulch P, Cao Y. Angiogenic synergism, vascular stability and improvement of hind-limb ischemia by a combination of PDGF-BB and FGF-2. Nat Med. 2003;9(5):604-13. doi: 10.1038/nm848. PubMed PMID: 12669032. 107. Papp V, Dezso K, Laszlo V, Nagy P, Paku S. Architectural changes during regenerative and ontogenic liver growth in the rat. Liver Transpl. 2009;15(2):177-83. doi: 10.1002/lt.21665. PubMed PMID: 19177433. 108. Wynn TA, Barron L. Macrophages: master regulators of inflammation and fibrosis. Semin Liver Dis. 2010;30(3):245-57. doi: 10.1055/s-0030-1255354. PubMed PMID: 20665377; PMCID: 2924662. 109. Barrett KE. Epithelial biology in the gastrointestinal system: insights into normal physiology and disease pathogenesis. J Physiol. 2012;590(Pt 3):419-20. doi: 10.1113/jphysiol.2011.227058. PubMed PMID: 22298901; PMCID: 3379689. 110. Michalopoulos GK. Liver regeneration after partial hepatectomy: critical analysis of mechanistic dilemmas. Am J Pathol. 2010;176(1):2-13. doi: 10.2353/ajpath.2010.090675. PubMed PMID: 20019184; PMCID: 2797862. 111. Choi SS, Diehl AM. Epithelial-to-mesenchymal transitions in the liver. Hepatology. 2009;50(6):2007-13. doi: 10.1002/hep.23196. PubMed PMID: 19824076; PMCID: 2787916. 112. Boulton R, Woodman A, Calnan D, Selden C, Tam F, Hodgson H. Nonparenchymal cells from regenerating rat liver generate interleukin-1alpha and -1beta: a mechanism of negative regulation of hepatocyte proliferation. Hepatology. 1997;26(1):49-58. doi: 10.1053/jhep.1997.v26.pm0009214451. PubMed PMID: 9214451. 113. Makino H, Shimizu H, Ito H, Kimura F, Ambiru S, Togawa A, Ohtsuka M, Yoshidome H, Kato A, Yoshitomi H, Sawada S, Miyazaki M. Changes in growth factor and cytokine expression in biliary obstructed rat liver and their relationship with delayed liver regeneration after partial

53

hepatectomy. World J Gastroentero. 2006;12(13):2053-9. PubMed PMID: WOS:000239996100012. 114. Thenappan A, Li Y, Kitisin K, Rashid A, Shetty K, Johnson L, Mishra L. Role of transforming growth factor beta signaling and expansion of progenitor cells in regenerating liver. Hepatology. 2010;51(4):1373-82. doi: 10.1002/hep.23449. PubMed PMID: 20131405; PMCID: 3001243. 115. Fausto N. Liver regeneration and repair: hepatocytes, progenitor cells, and stem cells. Hepatology. 2004;39(6):1477-87. doi: 10.1002/hep.20214. PubMed PMID: 15185286. 116. Pintilie DG, Shupe TD, Oh SH, Salganik SV, Darwiche H, Petersen BE. Hepatic stellate cells' involvement in progenitor-mediated liver regeneration. Laboratory investigation; a journal of technical methods and pathology. 2010;90(8):1199-208. doi: 10.1038/labinvest.2010.88. PubMed PMID: 20440274; PMCID: 2912420. 117. Dezso K, Papp V, Bugyik E, Hegyesi H, Safrany G, Bodor C, Nagy P, Paku S. Structural analysis of oval-cell-mediated liver regeneration in rats. Hepatology. 2012;56(4):1457-67. doi: 10.1002/hep.25713. PubMed PMID: 22419534. 118. Pi L, Ding X, Jorgensen M, Pan JJ, Oh SH, Pintilie D, Brown A, Song WY, Petersen BE. Connective tissue growth factor with a novel fibronectin binding site promotes cell adhesion and migration during rat oval cell activation. Hepatology. 2008;47(3):996-1004. doi: 10.1002/hep.22079. PubMed PMID: 18167060; PMCID: 3130595. 119. Sicklick JK, Choi SS, Bustamante M, McCall SJ, Perez EH, Huang J, Li YX, Rojkind M, Diehl AM. Evidence for epithelial-mesenchymal transitions in adult liver cells. Am J Physiol Gastrointest Liver Physiol. 2006;291(4):G575-83. doi: 10.1152/ajpgi.00102.2006. PubMed PMID: 16710052. 120. Washington MK. Autoimmune liver disease: overlap and outliers. Mod Pathol. 2007;20 Suppl 1:S15-30. doi: 10.1038/modpathol.3800684. PubMed PMID: 17486048. 121. Kelly DA. Diseases of the liver and biliary system in children. 3rd ed. Chichester, UK ; Hoboken, NJ: Wiley-Blackwell; 2008. x, 630 p. p. 122. Marcdante KJ, Kliegman R. Nelson essentials of pediatrics. 7th edition. ed. Philadelphia, PA: Elsevier/Saunders; 2015. xxii, 754 pages p. 123. Hoffmann GF, Zschocke J, Nyhan WL. Inherited metabolic diseases : a clinical approach. Heidelberg: Springer; 2010. xiv, 386 p. p. 124. Lazaridis KN, LaRusso NF. The Cholangiopathies. Mayo Clin Proc. 2015;90(6):791-800. doi: 10.1016/j.mayocp.2015.03.017. PubMed PMID: 25957621; PMCID: 4533104. 125. Lazaridis KN, Strazzabosco M, Larusso NF. The cholangiopathies: disorders of biliary epithelia. Gastroenterology. 2004;127(5):1565-77. PubMed PMID: 15521023. 126. Xu R, Zhang Z, Wang FS. Liver fibrosis: mechanisms of immune-mediated liver injury. Cell Mol Immunol. 2012;9(4):296-301. doi: 10.1038/cmi.2011.53. PubMed PMID: 22157623; PMCID: 4132585. 127. Benjamin IJ, Griggs RC, Wing EJ, Fitz JG. Andreoli and Carpenter's Cecil essentials of medicine. 9th edition. ed. Philadelphia, PA: Elsevier/Saunders; 2015. p. p. 128. Rockey DC. Hepatic fibrosis, stellate cells, and portal hypertension. Clin Liver Dis. 2006;10(3):459-79, vii-viii. doi: 10.1016/j.cld.2006.08.017. PubMed PMID: 17162223. 129. Salameh A, Dhein S. Effects of mechanical forces and stretch on intercellular gap junction coupling. Biochim Biophys Acta. 2013;1828(1):147-56. doi: 10.1016/j.bbamem.2011.12.030. PubMed PMID: 22245380. 130. Wells RG. The role of matrix stiffness in regulating cell behavior. Hepatology. 2008;47(4):1394-400. doi: 10.1002/hep.22193. PubMed PMID: 18307210. 131. Baumgart E. Stiffness--an unknown world of mechanical science? Injury. 2000;31 Suppl 2:S-B14-23. PubMed PMID: 10853758.

54

132. Ma PX. Biomaterials and regenerative medicine. Cambridge, United Kingdom: Cambridge University Press; 2014. xvi, 703 pages p. 133. Mason BN, Starchenko A, Williams RM, Bonassar LJ, Reinhart-King CA. Tuning three-dimensional collagen matrix stiffness independently of collagen concentration modulates endothelial cell behavior. Acta biomaterialia. 2013;9(1):4635-44. doi: 10.1016/j.actbio.2012.08.007. PubMed PMID: 22902816; PMCID: 3508162. 134. Bhatia SK. Engineering biomaterials for regenerative medicine : novel technologies for clinical applications. New York, NY: Springer; 2012. x, 352 p. p. 135. Reid LM, Fiorino AS, Sigal SH, Brill S, Holst PA. Extracellular matrix gradients in the space of Disse: relevance to liver biology. Hepatology. 1992;15(6):1198-203. PubMed PMID: 1592356. 136. Rusak G, Zawada E, Lemanowicz A, Serafin Z. Whole-organ and segmental stiffness measured with liver magnetic resonance elastography in healthy adults: significance of the region of interest. Abdom Imaging. 2015;40(4):776-82. doi: 10.1007/s00261-014-0278-7. PubMed PMID: 25331569; PMCID: 4372679. 137. Engler AJ, Sen S, Sweeney HL, Discher DE. Matrix elasticity directs stem cell lineage specification. Cell. 2006;126(4):677-89. doi: 10.1016/j.cell.2006.06.044. PubMed PMID: 16923388. 138. Park JS, Chu JS, Tsou AD, Diop R, Tang Z, Wang A, Li S. The effect of matrix stiffness on the differentiation of mesenchymal stem cells in response to TGF-beta. Biomaterials. 2011;32(16):3921-30. doi: 10.1016/j.biomaterials.2011.02.019. PubMed PMID: 21397942; PMCID: 3073995. 139. Raab M, Swift J, Dingal PC, Shah P, Shin JW, Discher DE. Crawling from soft to stiff matrix polarizes the cytoskeleton and phosphoregulates myosin-II heavy chain. J Cell Biol. 2012;199(4):669-83. doi: 10.1083/jcb.201205056. PubMed PMID: 23128239; PMCID: 3494847. 140. Tse JR, Engler AJ. Stiffness gradients mimicking in vivo tissue variation regulate mesenchymal stem cell fate. PLoS One. 2011;6(1):e15978. doi: 10.1371/journal.pone.0015978. PubMed PMID: 21246050; PMCID: 3016411. 141. Lo CM, Wang HB, Dembo M, Wang YL. Cell movement is guided by the rigidity of the substrate. Biophysical Journal. 2000;79(1):144-52. PubMed PMID: WOS:000088048500011. 142. Xu W, Mezencev R, Kim B, Wang L, McDonald J, Sulchek T. Cell stiffness is a biomarker of the metastatic potential of ovarian cancer cells. PLoS One. 2012;7(10):e46609. doi: 10.1371/journal.pone.0046609. PubMed PMID: 23056368; PMCID: 3464294. 143. Tee SY, Fu J, Chen CS, Janmey PA. Cell shape and substrate rigidity both regulate cell stiffness. Biophys J. 2011;100(5):L25-7. doi: 10.1016/j.bpj.2010.12.3744. PubMed PMID: 21354386; PMCID: 3043219. 144. Wang YK, Chen CS. Cell adhesion and mechanical stimulation in the regulation of mesenchymal stem cell differentiation. J Cell Mol Med. 2013;17(7):823-32. doi: 10.1111/jcmm.12061. PubMed PMID: 23672518; PMCID: 3741348. 145. Holzapfel GA, Ogden RW. Mechanics of biological tissue. Berlin ; New York: Springer; 2006. xii, 522 p. p. 146. Brown XQ, Bartolak-Suki E, Williams C, Walker ML, Weaver VM, Wong JY. Effect of substrate stiffness and PDGF on the behavior of vascular smooth muscle cells: implications for atherosclerosis. J Cell Physiol. 2010;225(1):115-22. doi: 10.1002/jcp.22202. PubMed PMID: 20648629; PMCID: 2920297. 147. Rabkin-Aikawa E, Farber M, Aikawa M, Schoen FJ. Dynamic and reversible changes of interstitial cell phenotype during remodeling of cardiac valves. J Heart Valve Dis. 2004;13(5):841-7. PubMed PMID: 15473488.

55

148. Swaminathan V, Mythreye K, O'Brien ET, Berchuck A, Blobe GC, Superfine R. Mechanical stiffness grades metastatic potential in patient tumor cells and in cancer cell lines. Cancer Res. 2011;71(15):5075-80. doi: 10.1158/0008-5472.CAN-11-0247. PubMed PMID: 21642375; PMCID: 3220953. 149. Si-Tayeb K, Lemaigre FP, Duncan SA. Organogenesis and development of the liver. Dev Cell. 2010;18(2):175-89. doi: 10.1016/j.devcel.2010.01.011. PubMed PMID: 20159590. 150. Si-Tayeb K, Noto FK, Nagaoka M, Li J, Battle MA, Duris C, North PE, Dalton S, Duncan SA. Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells. Hepatology. 2010;51(1):297-305. doi: 10.1002/hep.23354. PubMed PMID: 19998274; PMCID: 2946078. 151. Schrader J, Gordon-Walker TT, Aucott RL, van Deemter M, Quaas A, Walsh S, Benten D, Forbes SJ, Wells RG, Iredale JP. Matrix stiffness modulates proliferation, chemotherapeutic response, and dormancy in hepatocellular carcinoma cells. Hepatology. 2011;53(4):1192-205. doi: 10.1002/hep.24108. PubMed PMID: 21442631; PMCID: 3076070. 152. Han YP. Matrix metalloproteinases, the pros and cons, in liver fibrosis. J Gastroenterol Hepatol. 2006;21 Suppl 3:S88-91. doi: 10.1111/j.1440-1746.2006.04586.x. PubMed PMID: 16958682; PMCID: 2646497. 153. Zhang L, Theise N, Chua M, Reid LM. The stem cell niche of human livers: symmetry between development and regeneration. Hepatology. 2008;48(5):1598-607. doi: 10.1002/hep.22516. PubMed PMID: 18972441. 154. Kordes C, Sawitza I, Gotze S, Herebian D, Haussinger D. Hepatic stellate cells contribute to progenitor cells and liver regeneration. The Journal of clinical investigation. 2014;124(12):5503-15. doi: 10.1172/JCI74119. PubMed PMID: 25401473; PMCID: 4348953. 155. Jung KS, Kim SU, Ahn SH, Park YN, Kim do Y, Park JY, Chon CY, Choi EH, Han KH. Risk assessment of hepatitis B virus-related hepatocellular carcinoma development using liver stiffness measurement (FibroScan). Hepatology. 2011;53(3):885-94. doi: 10.1002/hep.24121. PubMed PMID: 21319193. 156. Tsukuma H, Hiyama T, Tanaka S, Nakao M, Yabuuchi T, Kitamura T, Nakanishi K, Fujimoto I, Inoue A, Yamazaki H, et al. Risk factors for hepatocellular carcinoma among patients with chronic liver disease. N Engl J Med. 1993;328(25):1797-801. doi: 10.1056/NEJM199306243282501. PubMed PMID: 7684822. 157. Cox TR, Bird D, Baker AM, Barker HE, Ho MW, Lang G, Erler JT. LOX-mediated collagen crosslinking is responsible for fibrosis-enhanced metastasis. Cancer Res. 2013;73(6):1721-32. doi: 10.1158/0008-5472.CAN-12-2233. PubMed PMID: 23345161; PMCID: 3672851. 158. Cox TR, Erler JT. Remodeling and homeostasis of the extracellular matrix: implications for fibrotic diseases and cancer. Dis Model Mech. 2011;4(2):165-78. doi: 10.1242/dmm.004077. PubMed PMID: 21324931; PMCID: 3046088. 159. Morgan MR, Humphries MJ, Bass MD. Synergistic control of cell adhesion by integrins and syndecans. Nat Rev Mol Cell Biol. 2007;8(12):957-69. doi: 10.1038/nrm2289. PubMed PMID: 17971838; PMCID: 3329926. 160. Hynes RO. Integrins: bidirectional, allosteric signaling machines. Cell. 2002;110(6):673-87. PubMed PMID: 12297042. 161. Humphries JD, Byron A, Humphries MJ. Integrin ligands at a glance. J Cell Sci. 2006;119(Pt 19):3901-3. doi: 10.1242/jcs.03098. PubMed PMID: 16988024; PMCID: 3380273. 162. Taddei ML, Giannoni E, Fiaschi T, Chiarugi P. Anoikis: an emerging hallmark in health and diseases. J Pathol. 2012;226(2):380-93. doi: 10.1002/path.3000. PubMed PMID: 21953325.

56

163. Hynes RO, Lively JC, McCarty JH, Taverna D, Francis SE, Hodivala-Dilke K, Xiao Q. The diverse roles of integrins and their ligands in angiogenesis. Cold Spring Harb Symp Quant Biol. 2002;67:143-53. PubMed PMID: 12858535. 164. Kim SH, Turnbull J, Guimond S. Extracellular matrix and cell signalling: the dynamic cooperation of integrin, proteoglycan and growth factor receptor. J Endocrinol. 2011;209(2):139-51. doi: 10.1530/JOE-10-0377. PubMed PMID: 21307119. 165. Lambaerts K, Wilcox-Adelman SA, Zimmermann P. The signaling mechanisms of syndecan heparan sulfate proteoglycans. Curr Opin Cell Biol. 2009;21(5):662-9. doi: 10.1016/j.ceb.2009.05.002. PubMed PMID: 19535238; PMCID: 2758656. 166. Derksen PW, Keehnen RM, Evers LM, van Oers MH, Spaargaren M, Pals ST. Cell surface proteoglycan syndecan-1 mediates hepatocyte growth factor binding and promotes Met signaling in multiple myeloma. Blood. 2002;99(4):1405-10. PubMed PMID: 11830493. 167. Ramani VC, Yang Y, Ren Y, Nan L, Sanderson RD. Heparanase plays a dual role in driving hepatocyte growth factor (HGF) signaling by enhancing HGF expression and activity. J Biol Chem. 2011;286(8):6490-9. doi: 10.1074/jbc.M110.183277. PubMed PMID: 21131364; PMCID: 3057851. 168. Halbleib JM, Nelson WJ. Cadherins in development: cell adhesion, sorting, and tissue morphogenesis. Genes Dev. 2006;20(23):3199-214. doi: 10.1101/gad.1486806. PubMed PMID: 17158740. 169. van Roy F, Berx G. The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci. 2008;65(23):3756-88. doi: 10.1007/s00018-008-8281-1. PubMed PMID: 18726070. 170. Onder TT, Gupta PB, Mani SA, Yang J, Lander ES, Weinberg RA. Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways. Cancer Res. 2008;68(10):3645-54. doi: 10.1158/0008-5472.CAN-07-2938. PubMed PMID: 18483246. 171. Anderson JM, Van Itallie CM. Physiology and function of the tight junction. Cold Spring Harb Perspect Biol. 2009;1(2):a002584. doi: 10.1101/cshperspect.a002584. PubMed PMID: 20066090; PMCID: 2742087. 172. Shin K, Fogg VC, Margolis B. Tight junctions and cell polarity. Annual review of cell and developmental biology. 2006;22:207-35. doi: 10.1146/annurev.cellbio.22.010305.104219. PubMed PMID: 16771626. 173. Hirase T, Kawashima S, Wong EY, Ueyama T, Rikitake Y, Tsukita S, Yokoyama M, Staddon JM. Regulation of tight junction permeability and occludin phosphorylation by Rhoa-p160ROCK-dependent and -independent mechanisms. J Biol Chem. 2001;276(13):10423-31. doi: 10.1074/jbc.M007136200. PubMed PMID: 11139571. 174. Osanai M, Murata M, Nishikiori N, Chiba H, Kojima T, Sawada N. Occludin-mediated premature senescence is a fail-safe mechanism against tumorigenesis in breast carcinoma cells. Cancer Sci. 2007;98(7):1027-34. doi: 10.1111/j.1349-7006.2007.00494.x. PubMed PMID: 17459053. 175. Du D, Xu F, Yu L, Zhang C, Lu X, Yuan H, Huang Q, Zhang F, Bao H, Jia L, Wu X, Zhu X, Zhang X, Zhang Z, Chen Z. The tight junction protein, occludin, regulates the directional migration of epithelial cells. Dev Cell. 2010;18(1):52-63. doi: 10.1016/j.devcel.2009.12.008. PubMed PMID: 20152177. 176. Burridge K, Chrzanowska-Wodnicka M. Focal adhesions, contractility, and signaling. Annual review of cell and developmental biology. 1996;12:463-518. doi: 10.1146/annurev.cellbio.12.1.463. PubMed PMID: 8970735. 177. Zaidel-Bar R, Cohen M, Addadi L, Geiger B. Hierarchical assembly of cell-matrix adhesion complexes. Biochem Soc Trans. 2004;32(Pt3):416-20. doi: 10.1042/BST0320416. PubMed PMID: 15157150.

57

178. Wu C. Focal adhesion: a focal point in current cell biology and molecular medicine. Cell Adh Migr. 2007;1(1):13-8. PubMed PMID: 19262093; PMCID: 2633675. 179. Barczyk M, Carracedo S, Gullberg D. Integrins. Cell Tissue Res. 2010;339(1):269-80. doi: 10.1007/s00441-009-0834-6. PubMed PMID: 19693543; PMCID: 2784866. 180. Bae YH, Mui KL, Hsu BY, Liu SL, Cretu A, Razinia Z, Xu T, Pure E, Assoian RK. A FAK-Cas-Rac-lamellipodin signaling module transduces extracellular matrix stiffness into mechanosensitive cell cycling. Sci Signal. 2014;7(330):ra57. doi: 10.1126/scisignal.2004838. PubMed PMID: 24939893; PMCID: 4345117. 181. Tadokoro S, Shattil SJ, Eto K, Tai V, Liddington RC, de Pereda JM, Ginsberg MH, Calderwood DA. Talin binding to integrin beta tails: a final common step in integrin activation. Science. 2003;302(5642):103-6. doi: 10.1126/science.1086652. PubMed PMID: 14526080. 182. Wang P, Ballestrem C, Streuli CH. The C terminus of talin links integrins to cell cycle progression. J Cell Biol. 2011;195(3):499-513. doi: 10.1083/jcb.201104128. PubMed PMID: 22042621; PMCID: 3206343. 183. Mitra SK, Hanson DA, Schlaepfer DD. Focal adhesion kinase: in command and control of cell motility. Nat Rev Mol Cell Biol. 2005;6(1):56-68. doi: 10.1038/nrm1549. PubMed PMID: 15688067. 184. Xu W, Baribault H, Adamson ED. Vinculin knockout results in heart and brain defects during embryonic development. Development. 1998;125(2):327-37. PubMed PMID: 9486805. 185. Carisey A, Tsang R, Greiner AM, Nijenhuis N, Heath N, Nazgiewicz A, Kemkemer R, Derby B, Spatz J, Ballestrem C. Vinculin regulates the recruitment and release of core focal adhesion proteins in a force-dependent manner. Current biology : CB. 2013;23(4):271-81. doi: 10.1016/j.cub.2013.01.009. PubMed PMID: 23375895; PMCID: 3580286. 186. Humphries JD, Wang P, Streuli C, Geiger B, Humphries MJ, Ballestrem C. Vinculin controls focal adhesion formation by direct interactions with talin and actin. J Cell Biol. 2007;179(5):1043-57. doi: 10.1083/jcb.200703036. PubMed PMID: 18056416; PMCID: 2099183. 187. Wang HB, Dembo M, Hanks SK, Wang Y. Focal adhesion kinase is involved in mechanosensing during fibroblast migration. Proc Natl Acad Sci U S A. 2001;98(20):11295-300. doi: 10.1073/pnas.201201198. PubMed PMID: 11572981; PMCID: 58723. 188. Bertolucci CM, Guibao CD, Zheng J. Structural features of the focal adhesion kinase-paxillin complex give insight into the dynamics of focal adhesion assembly. Protein Sci. 2005;14(3):644-52. doi: 10.1110/ps.041107205. PubMed PMID: 15689512; PMCID: 2279287. 189. Scheswohl DM, Harrell JR, Rajfur Z, Gao G, Campbell SL, Schaller MD. Multiple paxillin binding sites regulate FAK function. J Mol Signal. 2008;3:1. doi: 10.1186/1750-2187-3-1. PubMed PMID: 18171471; PMCID: 2246129. 190. Westhoff MA, Serrels B, Fincham VJ, Frame MC, Carragher NO. SRC-mediated phosphorylation of focal adhesion kinase couples actin and adhesion dynamics to survival signaling. Mol Cell Biol. 2004;24(18):8113-33. doi: 10.1128/MCB.24.18.8113-8133.2004. PubMed PMID: 15340073; PMCID: 515031. 191. Hanks SK, Ryzhova L, Shin NY, Brabek J. Focal adhesion kinase signaling activities and their implications in the control of cell survival and motility. Front Biosci. 2003;8:d982-96. PubMed PMID: 12700132. 192. Cho SY, Klemke RL. Extracellular-regulated kinase activation and CAS/Crk coupling regulate cell migration and suppress apoptosis during invasion of the extracellular matrix. J Cell Biol. 2000;149(1):223-36. PubMed PMID: 10747099; PMCID: 2175095. 193. Sonoda Y, Matsumoto Y, Funakoshi M, Yamamoto D, Hanks SK, Kasahara T. Anti-apoptotic role of focal adhesion kinase (FAK). Induction of inhibitor-of-apoptosis proteins and

58

apoptosis suppression by the overexpression of FAK in a human leukemic cell line, HL-60. J Biol Chem. 2000;275(21):16309-15. PubMed PMID: 10821872. 194. Kurenova E, Xu LH, Yang X, Baldwin AS, Jr., Craven RJ, Hanks SK, Liu ZG, Cance WG. Focal adhesion kinase suppresses apoptosis by binding to the death domain of receptor-interacting protein. Mol Cell Biol. 2004;24(10):4361-71. PubMed PMID: 15121855; PMCID: 400455. 195. Hamadi A, Bouali M, Dontenwill M, Stoeckel H, Takeda K, Ronde P. Regulation of focal adhesion dynamics and disassembly by phosphorylation of FAK at tyrosine 397. J Cell Sci. 2005;118(Pt 19):4415-25. doi: 10.1242/jcs.02565. PubMed PMID: 16159962. 196. Nagano M, Hoshino D, Koshikawa N, Akizawa T, Seiki M. Turnover of focal adhesions and cancer cell migration. Int J Cell Biol. 2012;2012:310616. doi: 10.1155/2012/310616. PubMed PMID: 22319531; PMCID: 3272802. 197. Kwong L, Wozniak MA, Collins AS, Wilson SD, Keely PJ. R-Ras promotes focal adhesion formation through focal adhesion kinase and p130(Cas) by a novel mechanism that differs from integrins. Mol Cell Biol. 2003;23(3):933-49. PubMed PMID: 12529399; PMCID: 140691. 198. Wozniak MA, Modzelewska K, Kwong L, Keely PJ. Focal adhesion regulation of cell behavior. Biochim Biophys Acta. 2004;1692(2-3):103-19. doi: 10.1016/j.bbamcr.2004.04.007. PubMed PMID: 15246682. 199. Li S, Guan JL, Chien S. Biochemistry and biomechanics of cell motility. Annu Rev Biomed Eng. 2005;7:105-50. doi: 10.1146/annurev.bioeng.7.060804.100340. PubMed PMID: 16004568. 200. Kim SH, Kim SH. Antagonistic effect of EGF on FAK phosphorylation/dephosphorylation in a cell. Cell Biochem Funct. 2008;26(5):539-47. doi: 10.1002/cbf.1457. PubMed PMID: 18543351. 201. Welch HC, Coadwell WJ, Stephens LR, Hawkins PT. Phosphoinositide 3-kinase-dependent activation of Rac. FEBS Lett. 2003;546(1):93-7. PubMed PMID: 12829242. 202. Rhoads DS, Guan JL. Analysis of directional cell migration on defined FN gradients: role of intracellular signaling molecules. Exp Cell Res. 2007;313(18):3859-67. doi: 10.1016/j.yexcr.2007.06.005. PubMed PMID: 17640633; PMCID: 2083117. 203. Ren XD, Kiosses WB, Sieg DJ, Otey CA, Schlaepfer DD, Schwartz MA. Focal adhesion kinase suppresses Rho activity to promote focal adhesion turnover. J Cell Sci. 2000;113 ( Pt 20):3673-8. PubMed PMID: 11017882. 204. Sakumura Y, Tsukada Y, Yamamoto N, Ishii S. A molecular model for axon guidance based on cross talk between rho GTPases. Biophys J. 2005;89(2):812-22. doi: 10.1529/biophysj.104.055624. PubMed PMID: 15923236; PMCID: 1366631. 205. Chen R, Kim O, Li M, Xiong X, Guan JL, Kung HJ, Chen H, Shimizu Y, Qiu Y. Regulation of the PH-domain-containing tyrosine kinase Etk by focal adhesion kinase through the FERM domain. Nat Cell Biol. 2001;3(5):439-44. doi: 10.1038/35074500. PubMed PMID: 11331870. 206. Kurokawa K, Itoh RE, Yoshizaki H, Nakamura YO, Matsuda M. Coactivation of Rac1 and Cdc42 at lamellipodia and membrane ruffles induced by epidermal growth factor. Mol Biol Cell. 2004;15(3):1003-10. doi: 10.1091/mbc.E03-08-0609. PubMed PMID: 14699061; PMCID: 363057. 207. Ballestrem C, Wehrle-Haller B, Hinz B, Imhof BA. Actin-dependent lamellipodia formation and microtubule-dependent tail retraction control-directed cell migration. Mol Biol Cell. 2000;11(9):2999-3012. PubMed PMID: 10982396; PMCID: 14971. 208. Hsia DA, Mitra SK, Hauck CR, Streblow DN, Nelson JA, Ilic D, Huang S, Li E, Nemerow GR, Leng J, Spencer KS, Cheresh DA, Schlaepfer DD. Differential regulation of cell motility and invasion by FAK. J Cell Biol. 2003;160(5):753-67. doi: 10.1083/jcb.200212114. PubMed PMID: 12615911; PMCID: 2173366.

59

209. Tojkander S, Gateva G, Lappalainen P. Actin stress fibers--assembly, dynamics and biological roles. J Cell Sci. 2012;125(Pt 8):1855-64. doi: 10.1242/jcs.098087. PubMed PMID: 22544950. 210. Bhowmick NA, Ghiassi M, Bakin A, Aakre M, Lundquist CA, Engel ME, Arteaga CL, Moses HL. Transforming growth factor-beta1 mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent mechanism. Mol Biol Cell. 2001;12(1):27-36. PubMed PMID: 11160820; PMCID: 30565. 211. Reffay M, Parrini MC, Cochet-Escartin O, Ladoux B, Buguin A, Coscoy S, Amblard F, Camonis J, Silberzan P. Interplay of RhoA and mechanical forces in collective cell migration driven by leader cells. Nat Cell Biol. 2014;16(3):217-23. doi: 10.1038/ncb2917. PubMed PMID: 24561621. 212. Khyrul WA, LaLonde DP, Brown MC, Levinson H, Turner CE. The integrin-linked kinase regulates cell morphology and motility in a rho-associated kinase-dependent manner. J Biol Chem. 2004;279(52):54131-9. doi: 10.1074/jbc.M410051200. PubMed PMID: 15485819. 213. Ho E, Irvine T, Vilk GJ, Lajoie G, Ravichandran KS, D'Souza SJ, Dagnino L. Integrin-linked kinase interactions with ELMO2 modulate cell polarity. Mol Biol Cell. 2009;20(13):3033-43. doi: 10.1091/mbc.E09-01-0050. PubMed PMID: 19439446; PMCID: 2704155. 214. Qian Y, Zhong X, Flynn DC, Zheng JZ, Qiao M, Wu C, Dedhar S, Shi X, Jiang BH. ILK mediates actin filament rearrangements and cell migration and invasion through PI3K/Akt/Rac1 signaling. Oncogene. 2005;24(19):3154-65. doi: 10.1038/sj.onc.1208525. PubMed PMID: 15735674. 215. Tu Y, Huang Y, Zhang Y, Hua Y, Wu C. A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol. 2001;153(3):585-98. PubMed PMID: 11331308; PMCID: 2190577. 216. Mayor R, Carmona-Fontaine C. Keeping in touch with contact inhibition of locomotion. Trends Cell Biol. 2010;20(6):319-28. doi: 10.1016/j.tcb.2010.03.005. PubMed PMID: 20399659; PMCID: 2927909.

60

CHAPTER 2

Decellularization and the Incorporation of Liver Extracellular

Matrix in Cell Culture Substrates

Daniel B. Deegan

Content

1. ECM Isolation through Decellularization Methods .………………..……61

2. Substrate Forms………………………………………………….…….….65

2.1 Decellularized Tissue Constructs…………………………...………...65

2.2 ECM Hydrogels……………………………………………...………..66

2.3 Species Differences………………………………………………..….67

3. Results and Advantages of ECM Use in Cell Culture……..………….…67

4. Altering Stiffness in Cell Culture Substrates……………………………..69

4.1 Methods for Manipulating Hydrogel Stiffness ……….…….………..69

4.2 Measuring Stiffness……………………………………………..…….73

5. Conclusions and Potential Applications…………………………………..77

61

In order to optimize cell culture conditions, substrates must contain the proper

milieu of structural components and growth factors. These molecules also must be

present in the correct ratios to grow and maintain specific cell types. The method of

decellularization solves this problem by removing native cells from tissue while

preserving the natural ECM arrangement. The byproduct is a non-immunogenic scaffold

that can be directly seeded or indirectly incorporated into tissue culture substrates and

cell therapies. In turn, these substrates can be utilized to test the effects of certain

substrate properties on cell signaling and function. Our own assays used the versatile

nature of liver ECM hydrogels in order to study the effects of mechanical stiffness on

primary hepatocyte function.

1. ECM Isolation through Decellularization Methods

A wide variety of approaches were developed to decellularize tissue or whole

organs for ECM isolation and eventual use in cell culture. Methods are dependent upon

the tissue and animal type being processed. Variations exist in the mechanical or

chemical procedures used. Protocols utilize different physical forces, compounds, and

reagents for cellular removal. Incubations in solutions and subsequent washing steps vary

in duration. These diverse procedures for decellularization have experienced a wide range

of success and failure.

Each decellularization technique possesses a set of advantages and disadvantages.

One of the first methods developed in this field ruptured cells through utilization of

distilled water and salt solutions in combination with mechanical force (1). Use of

hypertonic and hypotonic solutions to lyse cells does minimum harm to the underlying

62

ECM structure but on the other hand, does not remove smaller cellular components from

the tissue (2-8). Addition of physical disruption and agitation of tissue promotes full

clearance, however, it can also lead to damage of the intact architecture and unintended

removal of ECM constituents (9).

Another early decellularization technique implemented the use of freezing and

thawing to eliminate cells from tissue constructs (10-14). This simple method does not

require creation of solutions or the involvement of physical force. Repeated freeze thaw

effectively kills and lyses cells but can ultimately degrade certain proteins of the ECM,

especially growth factors which exhibit limited half-lives (15). Because of the sensitivity

of specific molecules and the unknown extent of ECM damage due to this process, freeze

thaw cycles should be kept to a minimum.

Newer methods incorporated varying concentrations of enzymatic reagents and

detergents into decellularization protocols. Enzymes including trypsin and DNase are

often used to treat scaffolds for cellular removal (16-24). These compounds are highly

successful in liberating cells from the ECM and break down immunogenic cellular

components such as nucleic acids (16). During natural processes in the body, apoptotic

cells trigger caspase-activated DNases which degrade DNA into 180 base pair fragments.

These nucleic acids are further degraded by DNase II of macrophages to avoid initiation

of innate immune reactions (25). For these reasons, important criteria established for

decellularization include degrading any residual DNA fragments to below 200 base pairs

(bp) in length and reducing DNA levels to below 50 ng of DNA per mg of dried tissue

(9). These actions are vital in avoiding immune responses when these substrates are

implanted into in vivo systems. Despite abilities to reduce immunoreactivity, lengthy

63

enzymatic treatments can also lead to destruction of ECM proteins and

glycosaminoglycans (GAGs) (26). Difficulties also exist in subsequent removal of

enzymes from the scaffold. Remnant enzymes could be harmful to animal models or

human patients and induce their own immune reactions.

An alternative option to enzymes for elimination of cellular material is detergents.

Previous publications have reported advantages of detergents over enzymatic methods in

maintenance of mechanical and elastic properties of the ECM (27). Detergents vary in

structure and strength, which both dictate concentrations applied and length of time

utilized. The two main types of detergents used in decellularization are ionic and non-

ionic detergents. Ionic detergents contain a charged head group and hydrophobic tail

group. This structure allows for rapid and effective disruption of the cellular membrane

and full removal of all cellular components from tissue (16, 24, 28-31). However,

because of its strength, this compound can easily denature or remove ECM molecules

such as GAGs and basement membrane proteins if not limited in concentration or

duration of use (32, 33). In comparison, non-ionic detergents are gentle on the underlying

matrix. Their hydrophilic groups are uncharged but are still able to disrupt lipid bonds

(28, 34-38). However, their mild nature means greater detergent concentrations and

longer washes are required for full cellular removal. Non-ionic detergents are often

combined with other reagents to ensure complete and timely decellularization (7, 39, 40).

The decellularization method designed by our research group and chosen for use

in this thesis project involves use of both ionic and non-ionic detergents. The

decellularization protocol has been optimized for use with livers of rat models. The

process takes advantage of the rat’s intact vasculature in order to perfuse solutions

64

Fig.1) Rat Liver Decellularization, adapted from Shupe et al (1)

A) PBS washing removes blood from the liver. B) Triton-X 100 detergent solubilizes lipid

membranes, while C) SDS detergent removes remnant cellular material.

throughout the organ. This approach enables solutions to infiltrate all areas of the tissue

for maximal contact with cells. The impact is faster and more efficient decellularization

as compared to simply immersing tissue surfaces. These developed methods allow

preservation of structural and biologically active components vital for effective growth

and maintenance of cells. For whole organ engineering, perfusion also allows for later

use of the vasculature during reseeding of cells. Through this established protocol,

decellularized liver tissue or substrates supplemented with the isolated ECM improve

liver cell viability and long term function in the cell culture assays of this thesis work.

65

2. Substrate Forms

ECM isolated from the decellularization process can be utilized in several

different configurations for many different applications. The intended objective

determines how this material must be used.

2.1 Decellularized Tissue Constructs

One of the main uses of decellularized organs and vascular constructs is for tissue

engineering. With a large disparity between donor organs and patients requiring

transplantations, the goal of organ engineering is to narrow this gap by supplying lab

grown tissues, preferably with patients’ own cells to avoid an immune response. To

engineer complex organs, one of the primary objectives is to create a fully cellularized

and patent vasculature. This task is made easier by maintaining an intact vessel basement

membrane.

Several groups have successfully generated re-endothelialized and functional

vascular grafts through seeding of decellularized scaffolds (41-46). Similar strides have

been made at a reduced scale in the recellularization of small animal organs or small

tissue samples (39, 47-49). Decellularization not only preserves the ECM composition

but also the structural architecture of the tissue. This remnant microarchitecture allows

cells to attach, align, and self-organize into proper functional units within both

parenchymal and vascular regions.

Challenges remain in whole organ engineering. Consistency of decellularized

tissue samples and the ability to control the physical and biochemical properties of the

decellularized matrix remain a problem. The exact physical and biological toll various

66

detergents take on ECM during decellularization is not fully controllable or known.

Certain key growth factors or smaller microstructures may need to be replaced or

reconstructed in order to produce an optimally functional cell scaffold. Microscopic

structures are easily damaged by decellularization reagents, including glomeruli of the

kidney, as well as bile canaliculi and sinusoids of the liver. Future studies should focus

on modifying and improving methods for preserving these delicate but important

structures. Research is still needed to optimize exact concentrations of reagents, duration

of individual steps, and storage methods for decellularized tissue. Studies also need to

gain a better understanding of complex interactions within tissue-specific ECM,

including the binding and biological activity of growth factors. New knowledge will

build upon current advances and lead the field closer to achieving functional tissue

products.

2.2 ECM Hydrogels

Hydrogels provide a versatile platform to isolate and test individual physical and

chemical properties. The flexibility of gel substrates allows for alteration of properties

such as stiffness, growth factor content, and ECM composition. These substrates can be

applied to everything from drug testing to a variety of novel therapies and treatments.

Supplementing these gels with organ-specific ECM improves attachment, growth, and

phenotype of cells similar to levels exhibited in fully functional tissue.

One of the uses of ECM hydrogels is to reproduce conditions found in vivo in order to

model certain disease or repair states. Three-dimensional cell culture in gels effectively

model tumors and metastatic phenotypes for cancer research (50, 51). High stiffness gels

67

can simulate diseases like liver cirrhosis, while lower stiffness mimics a developmental

or regenerative environment (52, 53). An upregulation of cellular production of specific

growth factors and matrix proteins also occurs during disease or regeneration (54-57).

Exogenous growth factors can be bound to active sites in ECM supplemented gels, or

ratios of specific structural molecules can be altered. This capacity for modifications

allows accurate modeling of ECM microenvironments for many tissue types and

physiological scenarios. Allows us to explore effects of composition

2.3 Species Differences

For this thesis project, decellularized rat liver tissue was integrated into HA gels

for preliminary primary rat hepatocyte studies and subsequently, primary human

hepatocyte culture. ECM components including collagens, polysaccharides, and

fibronectin are highly ubiquitous in mammalian tissue (58, 59). Molecular structures and

cell binding sites of these proteins are highly conserved between rats and humans and

interact with common cellular factors (60-62). GAGs and associated growth factors also

contain conserved structures and functions (58, 63, 64). In our own assays, we have

observed human growth factors including HGF and EGF stimulating rat cells and vice

versa. Because of their structural similarities, species differences between rat and human

liver ECM proved to be inconsequential in our assays.

3. Results and Advantages of ECM Use in Cell Culture

Traditional cell culture methods use synthetic materials or incorporate single

protein coatings like collagen into substrates for cell attachment and growth. With the

development of decellularization, a fuller representation of organ-specific ECM

68

components could be included. Several studies have shown the advantages of culturing

different cell types on natural, tissue-specific ECM substrates compared to purely

synthetic substrates. ECM from different tissue types can direct stem cells towards

various cell lineages (65-70). In liver culture systems, specific ECM cues can promote

the differentiation of hepatic progenitor cells into fully mature hepatocytes or

cholangiocytes (44, 71-74).

To develop effective and successful treatments, long term viability and phenotype

maintenance needs to be supported. Heparin and HA hydrogels are favorable substrate

bases because these molecules are naturally found in the body, do not induce immune

reactions upon implantation, and have the ability to bind and present growth factors (75,

76). We hypothesize addition of tissue-specific ECM would allow cells to function at

higher levels for use in cell based therapies. Previous studies have shown how tissue

specific ECM improves long term cell function in vitro. Both liver progenitor cells and

adult hepatocytes seeded onto isolated liver ECM maintained viability and function over

longer periods of time than cells grown on tissue culture plastic or collagen alone (44, 77-

79). Decellularized matrix has supported growth and phenotype of cells of several

different tissue types for a variety of uses (80-82). By recreating a natural

microenvironment in culture, cells are able to function and interact as they would within

normal, healthy tissue of the body.

With the addition of diverse species of GAGs present in natural ECM, greater

control over growth factor binding and release could be achieved to aid the efficiency of

cell therapies. Improvements in phenotypic maintenance were observed in cells

encapsulated with a combination of several structural molecules and growth factors,

69

especially hepatocyte growth factor (HGF) and epidermal growth factor (EGF) with

hepatocytes (83, 84). New data on the cellular effects of various substrate compositions

and properties will enable better design of cell therapies. Combining innovative methods

and knowledge will optimize their effectiveness in combating or correcting diseases in

patients.

4. Altering Stiffness in Cell Culture Substrates

4.1 Methods for Manipulating Hydrogel Stiffness

As mentioned in the previous chapter, physical properties are as important as the

presence of specific ECM components for differentiation or maintenance of various cell

types during seeding of intact tissue. Mechanical properties are modified by a wide

variety of strategies and techniques in cell culture. Previous groups have used increased

concentrations of proteins or synthetic compounds such as acrylamide to bolster substrate

stiffness (85-87). However, these alterations can influence cells in ways beyond stiffness,

and tend to complicate assay results. To isolate the property of stiffness during

experiments, the best techniques avoid addition of biologically active molecules.

One of the simplest and most common methods for modifying stiffness is through

substrate crosslinking. Crosslinking allows precise manipulation with limited

confounding effects on attachment sites or biological activity of the substrate. Stiffness

alterations can be made by varying the crosslinker type, the structure and arm length of

the crosslinker, the crosslinker concentration, or the duration of the crosslinker treatment

(88). The choice for crosslinker type is contingent on which molecules are available in

the substrate. These reagents chemically react with several different moieties including;

70

thiols, amines, carboxyls, hydroxyls, and carbonyls (89). Crosslinkers can also be

photoreactive and are activated by exposure to ultraviolet light (90, 91).

A crosslinker is either classified as homofunctional or heterofunctional, reacting

and covalently binding to one or more classes of functional groups. Homofunctional

crosslinkers act at rates and strengths dependent on the concentration of the crosslinker,

as well as the density of reactive groups in the substrate’s constituents. Greater

concentrations of the reagent cause a faster and higher degree of crosslinking. A larger

quantity of active sites in the substrate also translates to quicker bonding and stiffer

materials (92). Multiple homofunctional crosslinker types can be used in procedures to

gradually stiffen materials during activities such as bioprinting (93). Unlike

homofunctional reagents, a single heterofunctional linker type can be utilized in multiple

step reactions to produce viable substrates. Instead of combining all substrate components

at once, the crosslinker is allowed to react with one molecule before additional

compounds are added. This process provides greater control over specificity of

interactions and spacing of bonds for more exact material construction (93, 94).

Properties of the crosslinker are not only dependent on its chemical specificity but

also vary according to the length and number of structural arms it contains. A longer

distance between crosslinks creates a looser assembly of compounds and a softer

substrate. Therefore, to increase stiffness, one must use a crosslinker that is shorter in

length (92, 95). The typical reagent is bifunctional and holds two binding sites. However,

crosslinkers have been engineered to contain as many as eight arms. Greater amount of

branching leads to more reactive ends and a greater degree of binding. The geometry of

71

multi-armed crosslinkers is also more compact which generates tighter packed and stiffer

structures (96).

For this thesis project, our group chose a polyethylene glycol (PEG) based

compound for crosslinking applications during formation of liver ECM hydrogels. PEG

based chemicals are nontoxic and do not influence cell function (97). They also do not

initiate immune reactions upon implantation in vivo (98, 99). Because PEG is water-

soluble, clumping of the compound is avoided, and crosslinking is evenly spaced within

the polymer (100). PEG creates hydrophilic substrates which have been shown to

promote better cell adhesion, proliferation, spreading, and function than hydrophobic

materials (101, 102). The combination of these characteristics makes PEG an ideal

crosslinker for use in primary hepatocyte culture and development of cell treatments.

Liver ECM gels were created by mixing solubilized liver matrix with hyaluronic

acid and denatured collagen solutions. These HA gel components were specifically

modified to contain reactive thiols for crosslinking (103). Acrylate is a type of molecule

often attached to a PEG spacer to form a crosslinker that contains reactive double bonds

which bind to sulfhydryl groups. Our assays tested several geometric variations of PEG

acrylate in order to solidify the liver hydrogels at various stiffnesses.

Polyethylene glycol diacrylate (PEGDA) is one of the most commonly used

crosslinkers. It has a two-arm linear structure that produces a softer gel type (104). This

substrate stiffness was used as a baseline for our assays. PEG acrylate variations

containing four or eight arms also exist (105). More acrylate arms allow for a greater

number of reactive ends to bind thiol groups. In our own assays, PEGDA, four-arm PEG

72

acrylate, and eight-arm PEG acrylate were added to HA-ECM gel constituents at various

concentrations. Results showed that eight-arm PEG acrylate at the highest concentration

of 6% weight by volume produced the highest stiffness.

Although most combinations of crosslinker geometry and concentration produced

distinctively different stiffness levels, a saturation point of each crosslinker was also

determined. Higher concentrations of crosslinker past this limit did not significantly

affect stiffness, regardless of additional reaction time (Figure 3). This upper limit is

reached when all thiol groups are utilized. To ensure excess crosslinker is not retained in

the gel, no concentration above the observed saturation threshold was chosen for

subsequent assays. Furthermore, gels were thoroughly washed with PBS to clear out

excess crosslinker.

Fig.2) PEG Crosslinker Structures, adapted from Zhu et al (119) Greater PEG branching or arm number creates a tighter molecular network and increases

substrate stiffness.

73

4.2 Measuring Stiffness

Several methods and instrumentation were developed to measure the property of

stiffness. For centuries, the simple practice of palpation was used to diagnose patients

(106). Clinicians now utilize a non-invasive method called elastography to image and

quantitate stiffness of intact organs. This technique employs the use of ultrasound or

magnetic resonance imaging (MRI).

Several variations of ultrasound elastography evolved over time. Early forms

involved application of a manual force to the exterior of patients which was then

measured internally by ultrasound to calculate organ stiffness (107). Accuracy improved

through use of mechanical pulse generators and more advanced sonography systems.

During transient elastography, an automated device creates shear waves that penetrate

through the skin into organs of the abdominal cavity such as the liver (108, 109). The

0

200

400

600

800

1000

1200

1400

1% 2% 4%

G' (P

a)

Crosslinker Concentration % (w/v)

Crosslinked Gel Stiffness

Fig.3) PEGDA Crosslinking Saturation- HA-ECM gels were crosslinked with 1%,

2, or 4% w/v PEGDA (3.4 kDa). Only the 1% and 2% PEGDA gels were

significantly different (*p<.05, Student’s t test, n=4)

74

velocity of the waves is measured by ultrasound as they pass through the tissue of

interest. This data allows clinicians to calculate the stiffness of a large representative area

of the organ for diagnosis (110). Instead of acting on the surface of the skin, newer

adaptations employ concentrated sonography waves to generate acoustic radiation forces

at the site of measurement within the tissue (111-113). These processes improve the

distance pulses can be directed within the body. Acoustic radiation forces also increase

the precision of deep tissue ultrasound measurements through their ability to travel across

fluid build-up in the peritoneal cavity which normally impedes transient elastography

(110, 112).

Magnetic Resonance Elastography (MRE) incorporates these same mechanisms to

propagate shear waves. However, the velocity of these waves is subsequently measured

by MRI. Unlike ultrasound technology, a three-dimensional image of the entire tissue is

produced alongside a map of various stiffness values (114, 115). This tool provides a

more complete analysis of the organ being tested. MRE has proven to be a reliable tool

for detection of fibrosis in diseased liver (116). It has also successfully evaluated

stiffnesses in organs such as the brain that were unattainable by ultrasound methods

(117). Further refinement is needed to optimize the use of MRE in other tissue or organ

types (114).

In a laboratory setting, a rheometer is one of the most popular instruments used to

measure stiffness for samples prepared ex vivo. Unlike non-invasive clinical methods,

Rheometry is used to analyze biopsies or excised tissue outside of a living organism. This

technique is also commonly used in calculating stiffness of hydrogels, biomaterials, or

synthetic substrates used in cell culture. Because samples are isolated from irrelevant

75

tissues, fluids, or other confounding factors, rheometry increases accuracy and precision

of measurements compared to ultrasound and MRE (118). Engineers developed several

variations of rheometers based upon the material being tested and the type of data

required for analyses.

Rotational or shear rheometry is often used to measure stiffness in viscoelastic

soft tissue, hydrogels, or polymers (119, 120). These methods were applied in our own

assays to determine stiffness in liver ECM hydrogels and decellularized liver tissue.

During testing with these rheometers, a sample is stabilized on a fixed platform or plate.

An oscillating geometry in the form of a cone, plate, or cylinder is subsequently lowered

until it comes into contact with the sample (118). From the various forces applied, an

elastic modulus can be measured and calculated. The elastic modulus, or resistance to

deformity, can be expressed by three types of calculations; Young’s modulus, bulk

modulus and shear modulus. Young’s modulus is the ratio of tensile stress to tensile

strain or the force required to compress an object (121). The bulk modulus is the amount

of force needed to uniformly deform a material or the ratio of volumetric stress to

volumetric strain (122). The shear modulus describes how a sample responds to opposing

forces parallel to its surface and is calculated by dividing shear stress by shear strain

(123).

In the stiffness tests we performed, the Discovery Series HR-2 Rheometer (TA

Instruments, New Castle, DE) was used with a parallel plate geometry. Oscillation stress

sweeps incrementally increased shear stress on the samples up to 10.0 Pa and were run at

a constant oscillatory frequency and axial force. Both the shear storage modulus (G’) and

shear loss modulus (G’’) were measured and recorded. The storage modulus describes the

76

elastic properties or stored energy, while the loss modulus describes the viscous

characteristics or energy lost as heat (124). The storage modulus was the main stiffness

value utilized for reporting and comparison of hydrogels in our assays.

Shear rheometry provides an overall representation of stiffness in materials by

assessing a substantial portion of the substrate. For rheology measurements of smaller

microstructures or individual cells, atomic force microscopy (AFM) is required. An

atomic force microscope contains a high resolution nano-indenter or tip and detection

probe that scans indented samples to evaluate microscopic areas for stiffness (125-128).

Instead of measuring the combined effects of cell and ECM stiffness, AFM allows

separate analysis of components. Singular structures and cells in a sample can easily be

distinguished and measured to assess conditions such as cancer (129). Multiple readings

of a larger homogenous substrate can also be obtained and averaged to calculate more

wide-ranging stiffness (130, 131).

Despite AFM’s exceptional resolution, disadvantages also exist. AFM performed

on a heterogeneous sample can give an incomplete or inaccurate representation of the

material tested if too few readings are acquired or only a partial area is covered (132).

Problems can also arise depending on the indenter type used. Improper tips cause artifacts

to develop in samples (127, 131). Indenters can also adhere to softer materials and cause

miscalculations of stiffness (133).

Every analysis of stiffness presents unique objectives and obstacles. Clinicians

require a quick and noninvasive strategy, while a laboratory setting affords greater time

and control over samples. By effectively evaluating the overall stiffness of cell culture

77

substrates, shear rheometry demonstrated the greatest ability to study altered stiffness in

our liver ECM gels.

5. Conclusions and Potential Applications

In previous studies, hepatocytes cultured on different substrate stiffnesses have

been reported to have generalized effects. Low stiffness is associated with a growth

arrested and differentiated adult phenotype. High stiffness is associated with increased

viability and cell proliferation but also dedifferentiation and possible initiation of EMT

(53). However, the exact stiffness ranges defined in these studies and substrate

compositions vary greatly. Stiffness levels are also often at non-physiologically

achievable levels.

The assays we conducted utilized liver specific ECM isolated by decellularization

to form gels so that substrate components were similar to what composes normal liver

tissue. We also designed our study to focus on a narrow physiological relevant range of

stiffness. The adjustable system was created to culture primary human hepatocytes to

determine optimal conditions for cell function and distinguish specific mechanisms for

stiffness-induced changes in cell mechanics and morphology. We hypothesized that the

substrate stiffness closest to the actual stiffness of native liver tissue promotes the highest

long term function.

This knowledge can enable advancement in the creation of substrates for liver cell

therapies to treat disease in patients. This technology was developed to easily manipulate

and test effects of mechanical properties on cells. Future studies can use these abilities to

simulate the effects of disease states in a variety of organ systems and determine disease

78

mechanisms in order to form possible treatment strategies. Increased dimensions of

complexity in architecture and cell types could also be added to the system. These ECM-

containing hydrogels could eventually be used for tissue engineering applications.

Because of its semi-fluidic properties, cells encapsulated in gels can be injected into

numerous sites in vivo (134-138). Gels can also be “printed” into various patterns for

tissue construction. Bioprinting is a new technology that rapidly deposits substrates into a

predetermined form. The process controls substrate shape, composition, and physical

properties like stiffness. After gels are printed into constructs, materials can be fully

cross-linked depending upon the desired tissue type. Bioprinted tissues currently in

development include everything from skin patches and vessels to complex organs like the

liver (80, 139-142). With the use of ECM hydrogels and new emerging technologies, the

possibilities for new therapeutic products and treatments are endless.

Works Cited

1. Wicha MS, Lowrie G, Kohn E, Bagavandoss P, Mahn T. Extracellular matrix promotes mammary epithelial growth and differentiation in vitro. Proc Natl Acad Sci U S A. 1982;79(10):3213-7. PubMed PMID: 6954472; PMCID: 346385. 2. Remlinger NT, Czajka CA, Juhas ME, Vorp DA, Stolz DB, Badylak SF, Gilbert S, Gilbert TW. Hydrated xenogeneic decellularized tracheal matrix as a scaffold for tracheal reconstruction. Biomaterials. 2010;31(13):3520-6. doi: 10.1016/j.biomaterials.2010.01.067. PubMed PMID: 20144481. 3. Courtman DW, Pereira CA, Kashef V, McComb D, Lee JM, Wilson GJ. Development of a pericardial acellular matrix biomaterial: biochemical and mechanical effects of cell extraction. Journal of biomedical materials research. 1994;28(6):655-66. doi: 10.1002/jbm.820280602. PubMed PMID: 8071376. 4. Xu CC, Chan RW, Tirunagari N. A biodegradable, acellular xenogeneic scaffold for regeneration of the vocal fold lamina propria. Tissue Eng. 2007;13(3):551-66. doi: 10.1089/ten.2006.0169. PubMed PMID: 17518602. 5. Shafiq MA, Gemeinhart RA, Yue BY, Djalilian AR. Decellularized human cornea for reconstructing the corneal epithelium and anterior stroma. Tissue engineering Part C, Methods. 2012;18(5):340-8. doi: 10.1089/ten.TEC.2011.0072. PubMed PMID: 22082039; PMCID: 3338110.

79

6. Lee W, Miyagawa Y, Long C, Cooper DK, Hara H. A comparison of three methods of decellularization of pig corneas to reduce immunogenicity. Int J Ophthalmol. 2014;7(4):587-93. doi: 10.3980/j.issn.2222-3959.2014.04.01. PubMed PMID: 25161926; PMCID: 4137190. 7. Rosario DJ, Reilly GC, Ali Salah E, Glover M, Bullock AJ, Macneil S. Decellularization and sterilization of porcine urinary bladder matrix for tissue engineering in the lower urinary tract. Regen Med. 2008;3(2):145-56. doi: 10.2217/17460751.3.2.145. PubMed PMID: 18307398. 8. Flynn LE, Prestwich GD, Semple JL, Woodhouse KA. Proliferation and differentiation of adipose-derived stem cells on naturally derived scaffolds. Biomaterials. 2008;29(12):1862-71. doi: 10.1016/j.biomaterials.2007.12.028. PubMed PMID: 18242690. 9. Crapo PM, Gilbert TW, Badylak SF. An overview of tissue and whole organ decellularization processes. Biomaterials. 2011;32(12):3233-43. doi: 10.1016/j.biomaterials.2011.01.057. PubMed PMID: 21296410; PMCID: 3084613. 10. Gulati AK. Evaluation of acellular and cellular nerve grafts in repair of rat peripheral nerve. J Neurosurg. 1988;68(1):117-23. doi: 10.3171/jns.1988.68.1.0117. PubMed PMID: 3335896. 11. Jackson DW, Grood ES, Wilcox P, Butler DL, Simon TM, Holden JP. The effects of processing techniques on the mechanical properties of bone-anterior cruciate ligament-bone allografts. An experimental study in goats. Am J Sports Med. 1988;16(2):101-5. PubMed PMID: 3377093. 12. Nonaka PN, Campillo N, Uriarte JJ, Garreta E, Melo E, de Oliveira LV, Navajas D, Farre R. Effects of freezing/thawing on the mechanical properties of decellularized lungs. J Biomed Mater Res A. 2014;102(2):413-9. doi: 10.1002/jbm.a.34708. PubMed PMID: 23533110. 13. Lu H, Hoshiba T, Kawazoe N, Chen G. Comparison of decellularization techniques for preparation of extracellular matrix scaffolds derived from three-dimensional cell culture. J Biomed Mater Res A. 2012;100(9):2507-16. doi: 10.1002/jbm.a.34150. PubMed PMID: 22623317. 14. Burk J, Erbe I, Berner D, Kacza J, Kasper C, Pfeiffer B, Winter K, Brehm W. Freeze-thaw cycles enhance decellularization of large tendons. Tissue engineering Part C, Methods. 2014;20(4):276-84. doi: 10.1089/ten.TEC.2012.0760. PubMed PMID: 23879725; PMCID: 3968887. 15. Kisand K, Kerna I, Kumm J, Jonsson H, Tamm A. Impact of cryopreservation on serum concentration of matrix metalloproteinases (MMP)-7, TIMP-1, vascular growth factors (VEGF) and VEGF-R2 in Biobank samples. Clin Chem Lab Med. 2011;49(2):229-35. doi: 10.1515/CCLM.2011.049. PubMed PMID: 21118050. 16. Sullivan DC, Mirmalek-Sani SH, Deegan DB, Baptista PM, Aboushwareb T, Atala A, Yoo JJ. Decellularization methods of porcine kidneys for whole organ engineering using a high-throughput system. Biomaterials. 2012;33(31):7756-64. doi: 10.1016/j.biomaterials.2012.07.023. PubMed PMID: 22841923. 17. Prasertsung I, Kanokpanont S, Bunaprasert T, Thanakit V, Damrongsakkul S. Development of acellular dermis from porcine skin using periodic pressurized technique. J Biomed Mater Res B Appl Biomater. 2008;85(1):210-9. doi: 10.1002/jbm.b.30938. PubMed PMID: 17853423. 18. Chen RN, Ho HO, Tsai YT, Sheu MT. Process development of an acellular dermal matrix (ADM) for biomedical applications. Biomaterials. 2004;25(13):2679-86. PubMed PMID: 14751754. 19. Meyer SR, Chiu B, Churchill TA, Zhu L, Lakey JR, Ross DB. Comparison of aortic valve allograft decellularization techniques in the rat. J Biomed Mater Res A. 2006;79(2):254-62. doi: 10.1002/jbm.a.30777. PubMed PMID: 16817222.

80

20. Schenke-Layland K, Vasilevski O, Opitz F, Konig K, Riemann I, Halbhuber KJ, Wahlers T, Stock UA. Impact of decellularization of xenogeneic tissue on extracellular matrix integrity for tissue engineering of heart valves. J Struct Biol. 2003;143(3):201-8. PubMed PMID: 14572475. 21. Yang M, Chen CZ, Wang XN, Zhu YB, Gu YJ. Favorable effects of the detergent and enzyme extraction method for preparing decellularized bovine pericardium scaffold for tissue engineered heart valves. J Biomed Mater Res B Appl Biomater. 2009;91(1):354-61. doi: 10.1002/jbm.b.31409. PubMed PMID: 19507136. 22. Yang B, Zhang Y, Zhou L, Sun Z, Zheng J, Chen Y, Dai Y. Development of a porcine bladder acellular matrix with well-preserved extracellular bioactive factors for tissue engineering. Tissue engineering Part C, Methods. 2010;16(5):1201-11. doi: 10.1089/ten.TEC.2009.0311. PubMed PMID: 20170425. 23. Fitzpatrick JC, Clark PM, Capaldi FM. Effect of decellularization protocol on the mechanical behavior of porcine descending aorta. Int J Biomater. 2010;2010. doi: 10.1155/2010/620503. PubMed PMID: 20689621; PMCID: 2910464. 24. Elder BD, Eleswarapu SV, Athanasiou KA. Extraction techniques for the decellularization of tissue engineered articular cartilage constructs. Biomaterials. 2009;30(22):3749-56. doi: 10.1016/j.biomaterials.2009.03.050. PubMed PMID: 19395023; PMCID: 2743309. 25. Nagata S, Hanayama R, Kawane K. Autoimmunity and the clearance of dead cells. Cell. 2010;140(5):619-30. doi: 10.1016/j.cell.2010.02.014. PubMed PMID: 20211132. 26. Kasimir MT, Rieder E, Seebacher G, Silberhumer G, Wolner E, Weigel G, Simon P. Comparison of different decellularization procedures of porcine heart valves. The International journal of artificial organs. 2003;26(5):421-7. PubMed PMID: 12828309. 27. Zou Y, Zhang Y. Mechanical evaluation of decellularized porcine thoracic aorta. J Surg Res. 2012;175(2):359-68. doi: 10.1016/j.jss.2011.03.070. PubMed PMID: 21571306; PMCID: 3100660. 28. Seddon AM, Curnow P, Booth PJ. Membrane proteins, lipids and detergents: not just a soap opera. Biochim Biophys Acta. 2004;1666(1-2):105-17. doi: 10.1016/j.bbamem.2004.04.011. PubMed PMID: 15519311. 29. Allaire E, Guettier C, Bruneval P, Plissonnier D, Michel JB. Cell-free arterial grafts: morphologic characteristics of aortic isografts, allografts, and xenografts in rats. J Vasc Surg. 1994;19(3):446-56. PubMed PMID: 8126857. 30. DeQuach JA, Mezzano V, Miglani A, Lange S, Keller GM, Sheikh F, Christman KL. Simple and high yielding method for preparing tissue specific extracellular matrix coatings for cell culture. PLoS One. 2010;5(9):e13039. doi: 10.1371/journal.pone.0013039. PubMed PMID: 20885963; PMCID: 2946408. 31. Bolland F, Korossis S, Wilshaw SP, Ingham E, Fisher J, Kearney JN, Southgate J. Development and characterisation of a full-thickness acellular porcine bladder matrix for tissue engineering. Biomaterials. 2007;28(6):1061-70. doi: 10.1016/j.biomaterials.2006.10.005. PubMed PMID: 17092557. 32. Faulk DM, Carruthers CA, Warner HJ, Kramer CR, Reing JE, Zhang L, D'Amore A, Badylak SF. The effect of detergents on the basement membrane complex of a biologic scaffold material. Acta biomaterialia. 2014;10(1):183-93. doi: 10.1016/j.actbio.2013.09.006. PubMed PMID: 24055455; PMCID: 3857635. 33. Gratzer PF, Harrison RD, Woods T. Matrix alteration and not residual sodium dodecyl sulfate cytotoxicity affects the cellular repopulation of a decellularized matrix. Tissue Eng. 2006;12(10):2975-83. doi: 10.1089/ten.2006.12.2975. PubMed PMID: 17518665.

81

34. Vavken P, Joshi S, Murray MM. TRITON-X is most effective among three decellularization agents for ACL tissue engineering. J Orthop Res. 2009;27(12):1612-8. doi: 10.1002/jor.20932. PubMed PMID: 19504590; PMCID: 2824567. 35. Ozeki M, Narita Y, Kagami H, Ohmiya N, Itoh A, Hirooka Y, Niwa Y, Ueda M, Goto H. Evaluation of decellularized esophagus as a scaffold for cultured esophageal epithelial cells. Journal of Biomedical Materials Research Part A. 2006;79a(4):771-8. doi: DOI 10.1002/jbm.a.30885. PubMed PMID: WOS:000242360400002. 36. Ren H, Shi X, Tao L, Xiao J, Han B, Zhang Y, Yuan X, Ding Y. Evaluation of two decellularization methods in the development of a whole-organ decellularized rat liver scaffold. Liver Int. 2013;33(3):448-58. doi: 10.1111/liv.12088. PubMed PMID: 23301992. 37. Guyette JP, Gilpin SE, Charest JM, Tapias LF, Ren X, Ott HC. Perfusion decellularization of whole organs. Nat Protoc. 2014;9(6):1451-68. doi: 10.1038/nprot.2014.097. PubMed PMID: 24874812. 38. Mendoza-Novelo B, Avila EE, Cauich-Rodriguez JV, Jorge-Herrero E, Rojo FJ, Guinea GV, Mata-Mata JL. Decellularization of pericardial tissue and its impact on tensile viscoelasticity and glycosaminoglycan content. Acta biomaterialia. 2011;7(3):1241-8. doi: 10.1016/j.actbio.2010.11.017. PubMed PMID: 21094703. 39. Shupe T, Williams M, Brown A, Willenberg B, Petersen BE. Method for the decellularization of intact rat liver. Organogenesis. 2010;6(2):134-6. PubMed PMID: 20885860; PMCID: 2901817. 40. Reing JE, Brown BN, Daly KA, Freund JM, Gilbert TW, Hsiong SX, Huber A, Kullas KE, Tottey S, Wolf MT, Badylak SF. The effects of processing methods upon mechanical and biologic properties of porcine dermal extracellular matrix scaffolds. Biomaterials. 2010;31(33):8626-33. doi: 10.1016/j.biomaterials.2010.07.083. PubMed PMID: 20728934; PMCID: 2956268. 41. Ott HC, Matthiesen TS, Goh SK, Black LD, Kren SM, Netoff TI, Taylor DA. Perfusion-decellularized matrix: using nature's platform to engineer a bioartificial heart. Nat Med. 2008;14(2):213-21. doi: 10.1038/nm1684. PubMed PMID: 18193059. 42. Ravi S, Chaikof EL. Biomaterials for vascular tissue engineering. Regen Med. 2010;5(1):107-20. doi: 10.2217/rme.09.77. PubMed PMID: 20017698; PMCID: 2822541. 43. Gui L, Muto A, Chan SA, Breuer CK, Niklason LE. Development of decellularized human umbilical arteries as small-diameter vascular grafts. Tissue Eng Part A. 2009;15(9):2665-76. doi: 10.1089/ten.TEA.2008.0526. PubMed PMID: 19207043; PMCID: 2735599. 44. Baptista PM, Siddiqui MM, Lozier G, Rodriguez SR, Atala A, Soker S. The use of whole organ decellularization for the generation of a vascularized liver organoid. Hepatology. 2011:n/a-n/a. doi: 10.1002/hep.24067. 45. Yazdani SK, Watts B, Machingal M, Jarajapu YP, Van Dyke ME, Christ GJ. Smooth muscle cell seeding of decellularized scaffolds: the importance of bioreactor preconditioning to development of a more native architecture for tissue-engineered blood vessels. Tissue Eng Part A. 2009;15(4):827-40. doi: 10.1089/ten.tea.2008.0092. PubMed PMID: 19290806. 46. Ko IK, Peng L, Peloso A, Smith CJ, Dhal A, Deegan DB, Zimmerman C, Clouse C, Zhao W, Shupe TD, Soker S, Yoo JJ, Atala A. Bioengineered transplantable porcine livers with re-endothelialized vasculature. Biomaterials. 2015;40:72-9. doi: 10.1016/j.biomaterials.2014.11.027. PubMed PMID: 25433603. 47. Uygun BE, Soto-Gutierrez A, Yagi H, Izamis ML, Guzzardi MA, Shulman C, Milwid J, Kobayashi N, Tilles A, Berthiaume F, Hertl M, Nahmias Y, Yarmush ML, Uygun K. Organ reengineering through development of a transplantable recellularized liver graft using decellularized liver matrix. Nat Med. 2010;16(7):814-20. doi: 10.1038/nm.2170. PubMed PMID: 20543851; PMCID: 2930603.

82

48. Petersen TH, Calle EA, Zhao L, Lee EJ, Gui L, Raredon MB, Gavrilov K, Yi T, Zhuang ZW, Breuer C, Herzog E, Niklason LE. Tissue-engineered lungs for in vivo implantation. Science. 2010;329(5991):538-41. doi: 10.1126/science.1189345. PubMed PMID: 20576850; PMCID: 3640463. 49. Bonvillain RW, Scarritt ME, Pashos NC, Mayeux JP, Meshberger CL, Betancourt AM, Sullivan DE, Bunnell BA. Nonhuman primate lung decellularization and recellularization using a specialized large-organ bioreactor. J Vis Exp. 2013(82):e50825. doi: 10.3791/50825. PubMed PMID: 24378384. 50. Xu X, Prestwich GD. Inhibition of tumor growth and angiogenesis by a lysophosphatidic acid antagonist in an engineered three-dimensional lung cancer xenograft model. Cancer. 2010;116(7):1739-50. doi: 10.1002/cncr.24907. PubMed PMID: 20143443; PMCID: 2847044. 51. Griffini P, Smorenburg SM, Verbeek FJ, van Noorden CJ. Three-dimensional reconstruction of colon carcinoma metastases in liver. J Microsc. 1997;187(Pt 1):12-21. PubMed PMID: 9263437. 52. Wells RG. Cellular sources of extracellular matrix in hepatic fibrosis. Clin Liver Dis. 2008;12(4):759-68, viii. doi: 10.1016/j.cld.2008.07.008. PubMed PMID: 18984465; PMCID: 2617723. 53. Wells RG. The role of matrix stiffness in regulating cell behavior. Hepatology. 2008;47(4):1394-400. doi: 10.1002/hep.22193. PubMed PMID: 18307210. 54. Bohm F, Kohler UA, Speicher T, Werner S. Regulation of liver regeneration by growth factors and cytokines. EMBO Mol Med. 2010;2(8):294-305. doi: 10.1002/emmm.201000085. PubMed PMID: 20652897; PMCID: 3377328. 55. Huh CG, Factor VM, Sanchez A, Uchida K, Conner EA, Thorgeirsson SS. Hepatocyte growth factor/c-met signaling pathway is required for efficient liver regeneration and repair. Proc Natl Acad Sci U S A. 2004;101(13):4477-82. doi: 10.1073/pnas.0306068101. PubMed PMID: 15070743; PMCID: 384772. 56. Fausto N, Laird AD, Webber EM. Liver regeneration. 2. Role of growth factors and cytokines in hepatic regeneration. Faseb J. 1995;9(15):1527-36. PubMed PMID: 8529831. 57. Pi L, Ding X, Jorgensen M, Pan JJ, Oh SH, Pintilie D, Brown A, Song WY, Petersen BE. Connective tissue growth factor with a novel fibronectin binding site promotes cell adhesion and migration during rat oval cell activation. Hepatology. 2008;47(3):996-1004. doi: 10.1002/hep.22079. PubMed PMID: 18167060; PMCID: 3130595. 58. Alberts B. Molecular biology of the cell. 4th ed. New York: Garland Science; 2002. xxxiv, 1548 p. p. 59. Ramalingam M. Tissue engineering and regenerative medicine : a nano approach. Boca Raton: CRC Press; 2013. xxii, 570 p. p. 60. Lessey BA, Albelda S, Buck CA, Castelbaum AJ, Yeh I, Kohler M, Berchuck A. Distribution of integrin cell adhesion molecules in endometrial cancer. Am J Pathol. 1995;146(3):717-26. PubMed PMID: 7887452; PMCID: 1869177. 61. Grose R, Hutter C, Bloch W, Thorey I, Watt FM, Fassler R, Brakebusch C, Werner S. A crucial role of beta 1 integrins for keratinocyte migration in vitro and during cutaneous wound repair. Development. 2002;129(9):2303-15. PubMed PMID: 11959837. 62. Williams D. Collagen: ubiquitous in nature, multifunctional in devices. Med Device Technol. 1998;9(6):10-3. PubMed PMID: 10182119. 63. Simon Davis DA, Parish CR. Heparan sulfate: a ubiquitous glycosaminoglycan with multiple roles in immunity. Front Immunol. 2013;4:470. doi: 10.3389/fimmu.2013.00470. PubMed PMID: 24391644; PMCID: 3866581.

83

64. Dreyfuss JL, Regatieri CV, Jarrouge TR, Cavalheiro RP, Sampaio LO, Nader HB. Heparan sulfate proteoglycans: structure, protein interactions and cell signaling. An Acad Bras Cienc. 2009;81(3):409-29. PubMed PMID: 19722012. 65. Watt FM, Huck WT. Role of the extracellular matrix in regulating stem cell fate. Nat Rev Mol Cell Biol. 2013;14(8):467-73. doi: 10.1038/nrm3620. PubMed PMID: 23839578. 66. Santiago JA, Pogemiller R, Ogle BM. Heterogeneous differentiation of human mesenchymal stem cells in response to extended culture in extracellular matrices. Tissue Eng Part A. 2009;15(12):3911-22. doi: 10.1089/ten.tea.2008.0603. PubMed PMID: 19911955; PMCID: 2792070. 67. Lin H, Yang G, Tan J, Tuan RS. Influence of decellularized matrix derived from human mesenchymal stem cells on their proliferation, migration and multi-lineage differentiation potential. Biomaterials. 2012;33(18):4480-9. doi: 10.1016/j.biomaterials.2012.03.012. PubMed PMID: 22459197. 68. Ross EA, Williams MJ, Hamazaki T, Terada N, Clapp WL, Adin C, Ellison GW, Jorgensen M, Batich CD. Embryonic stem cells proliferate and differentiate when seeded into kidney scaffolds. Journal of the American Society of Nephrology : JASN. 2009;20(11):2338-47. doi: 10.1681/ASN.2008111196. PubMed PMID: 19729441; PMCID: 2799178. 69. Discher DE, Mooney DJ, Zandstra PW. Growth factors, matrices, and forces combine and control stem cells. Science. 2009;324(5935):1673-7. doi: 10.1126/science.1171643. PubMed PMID: 19556500; PMCID: 2847855. 70. Sundelacruz S, Kaplan DL. Stem cell- and scaffold-based tissue engineering approaches to osteochondral regenerative medicine. Semin Cell Dev Biol. 2009;20(6):646-55. doi: 10.1016/j.semcdb.2009.03.017. PubMed PMID: 19508851; PMCID: 2737137. 71. Gattazzo F, Urciuolo A, Bonaldo P. Extracellular matrix: a dynamic microenvironment for stem cell niche. Biochim Biophys Acta. 2014;1840(8):2506-19. doi: 10.1016/j.bbagen.2014.01.010. PubMed PMID: 24418517; PMCID: 4081568. 72. Tanimizu N, Miyajima A, Mostov KE. Liver progenitor cells develop cholangiocyte-type epithelial polarity in three-dimensional culture. Mol Biol Cell. 2007;18(4):1472-9. doi: 10.1091/mbc.E06-09-0848. PubMed PMID: 17314404; PMCID: 1838984. 73. Tanimizu N, Saito H, Mostov K, Miyajima A. Long-term culture of hepatic progenitors derived from mouse Dlk+ hepatoblasts. J Cell Sci. 2004;117(Pt 26):6425-34. doi: 10.1242/jcs.01572. PubMed PMID: 15572411. 74. Malinen MM, Kanninen LK, Corlu A, Isoniemi HM, Lou YR, Yliperttula ML, Urtti AO. Differentiation of liver progenitor cell line to functional organotypic cultures in 3D nanofibrillar cellulose and hyaluronan-gelatin hydrogels. Biomaterials. 2014;35(19):5110-21. doi: 10.1016/j.biomaterials.2014.03.020. PubMed PMID: 24698520. 75. Murphy SV, Skardal A, Atala A. Evaluation of hydrogels for bio-printing applications. J Biomed Mater Res A. 2013;101(1):272-84. doi: 10.1002/jbm.a.34326. PubMed PMID: 22941807. 76. Burdick JA, Prestwich GD. Hyaluronic acid hydrogels for biomedical applications. Adv Mater. 2011;23(12):H41-56. doi: 10.1002/adma.201003963. PubMed PMID: 21394792; PMCID: 3730855. 77. Zhou P, Lessa N, Estrada DC, Severson EB, Lingala S, Zern MA, Nolta JA, Wu JA. Decellularized Liver Matrix as a Carrier for the Transplantation of Human Fetal and Primary Hepatocytes in Mice. Liver Transplant. 2011;17(4):418-27. doi: Doi 10.1002/Lt.22270. PubMed PMID: WOS:000289004000009. 78. Skardal A, Smith L, Bharadwaj S, Atala A, Soker S, Zhang Y. Tissue specific synthetic ECM hydrogels for 3-D in vitro maintenance of hepatocyte function. Biomaterials. 2012;33(18):4565-75. doi: 10.1016/j.biomaterials.2012.03.034. PubMed PMID: 22475531; PMCID: 3719050.

84

79. Nakamura S, Ijima H. Solubilized matrix derived from decellularized liver as a growth factor-immobilizable scaffold for hepatocyte culture. J Biosci Bioeng. 2013;116(6):746-53. doi: DOI 10.1016/j.jbiosc.2013.05.031. PubMed PMID: WOS:000329087800016. 80. Pati F, Jang J, Ha DH, Won Kim S, Rhie JW, Shim JH, Kim DH, Cho DW. Printing three-dimensional tissue analogues with decellularized extracellular matrix bioink. Nat Commun. 2014;5:3935. doi: 10.1038/ncomms4935. PubMed PMID: 24887553; PMCID: 4059935. 81. Lin P, Chan WC, Badylak SF, Bhatia SN. Assessing porcine liver-derived biomatrix for hepatic tissue engineering. Tissue Eng. 2004;10(7-8):1046-53. doi: 10.1089/ten.2004.10.1046. PubMed PMID: 15363162. 82. Fishman JM, Lowdell MW, Urbani L, Ansari T, Burns AJ, Turmaine M, North J, Sibbons P, Seifalian AM, Wood KJ, Birchall MA, De Coppi P. Immunomodulatory effect of a decellularized skeletal muscle scaffold in a discordant xenotransplantation model. Proc Natl Acad Sci U S A. 2013;110(35):14360-5. doi: 10.1073/pnas.1213228110. PubMed PMID: 23940349; PMCID: 3761636. 83. Zhang FT, Wan HJ, Li MH, Ye J, Yin MJ, Huang CQ, Yu J. Transplantation of microencapsulated umbilical-cord-blood-derived hepatic-like cells for treatment of hepatic failure. World journal of gastroenterology : WJG. 2011;17(7):938-45. doi: 10.3748/wjg.v17.i7.938. PubMed PMID: 21412504; PMCID: 3051145. 84. Kim M, Lee JY, Jones CN, Revzin A, Tae G. Heparin-based hydrogel as a matrix for encapsulation and cultivation of primary hepatocytes. Biomaterials. 2010;31(13):3596-603. doi: 10.1016/j.biomaterials.2010.01.068. PubMed PMID: 20153045; PMCID: 2837121. 85. Tse JR, Engler AJ. Stiffness gradients mimicking in vivo tissue variation regulate mesenchymal stem cell fate. PLoS One. 2011;6(1):e15978. doi: 10.1371/journal.pone.0015978. PubMed PMID: 21246050; PMCID: 3016411. 86. Mih JD, Sharif AS, Liu F, Marinkovic A, Symer MM, Tschumperlin DJ. A multiwell platform for studying stiffness-dependent cell biology. PLoS One. 2011;6(5):e19929. doi: 10.1371/journal.pone.0019929. PubMed PMID: 21637769; PMCID: 3103526. 87. You J, Park SA, Shin DS, Patel D, Raghunathan VK, Kim M, Murphy CJ, Tae G, Revzin A. Characterizing the effects of heparin gel stiffness on function of primary hepatocytes. Tissue Eng Part A. 2013;19(23-24):2655-63. doi: 10.1089/ten.TEA.2012.0681. PubMed PMID: 23815179; PMCID: 3856597. 88. Ratner BD, Bryant SJ. Biomaterials: where we have been and where we are going. Annu Rev Biomed Eng. 2004;6:41-75. doi: 10.1146/annurev.bioeng.6.040803.140027. PubMed PMID: 15255762. 89. Green NS, Reisler E, Houk KN. Quantitative evaluation of the lengths of homobifunctional protein cross-linking reagents used as molecular rulers. Protein Sci. 2001;10(7):1293-304. doi: 10.1110/ps.51201. PubMed PMID: 11420431; PMCID: 2374107. 90. Radosevich JA. UV radiation : properties, effects, and applications. New York: Nova Publishers; 2014. xiii, 355 pages p. 91. Mattson G, Conklin E, Desai S, Nielander G, Savage MD, Morgensen S. A practical approach to crosslinking. Mol Biol Rep. 1993;17(3):167-83. PubMed PMID: 8326953. 92. Narain R. Chemistry of bioconjugates : synthesis, characterization, and biomedical applications. Hoboken, New Jersey: Wiley; 2014. x, 464 pages p. 93. Skardal A, Zhang J, McCoard L, Xu X, Oottamasathien S, Prestwich GD. Photocrosslinkable hyaluronan-gelatin hydrogels for two-step bioprinting. Tissue Eng Part A. 2010;16(8):2675-85. doi: 10.1089/ten.TEA.2009.0798. PubMed PMID: 20387987; PMCID: 3135254.

85

94. Guvendiren M, Burdick JA. Stiffening hydrogels to probe short- and long-term cellular responses to dynamic mechanics. Nat Commun. 2012;3:792. doi: 10.1038/ncomms1792. PubMed PMID: 22531177. 95. Hermanson GT. Bioconjugate techniques. Third edition. ed. London ; Waltham, MA: Elsevier/AP; 2013. xvii, 1146 pages p. 96. Rubinstein M, Colby RH. Polymer physics. Oxford ; New York: Oxford University Press; 2003. xi, 440 p. p. 97. Ali ME, Lamprecht A. Polyethylene glycol as an alternative polymer solvent for nanoparticle preparation. Int J Pharm. 2013;456(1):135-42. doi: 10.1016/j.ijpharm.2013.07.077. PubMed PMID: 23958752. 98. Webster R, Didier E, Harris P, Siegel N, Stadler J, Tilbury L, Smith D. PEGylated proteins: evaluation of their safety in the absence of definitive metabolism studies. Drug Metab Dispos. 2007;35(1):9-16. doi: 10.1124/dmd.106.012419. PubMed PMID: 17020954. 99. Zalipsky S, Mullah N, Harding JA, Gittelman J, Guo L, DeFrees SA. Poly(ethylene glycol)-grafted liposomes with oligopeptide or oligosaccharide ligands appended to the termini of the polymer chains. Bioconjug Chem. 1997;8(2):111-8. doi: 10.1021/bc9600832. PubMed PMID: 9095350. 100. Oliveira CP, Ribeiro ME, Ricardo NM, Souza TV, Moura CL, Chaibundit C, Yeates SG, Nixon K, Attwood D. The effect of water-soluble polymers, PEG and PVP, on the solubilisation of griseofulvin in aqueous micellar solutions of Pluronic F127. Int J Pharm. 2011;421(2):252-7. doi: 10.1016/j.ijpharm.2011.10.010. PubMed PMID: 22001534. 101. Bacakova L, Filova E, Parizek M, Ruml T, Svorcik V. Modulation of cell adhesion, proliferation and differentiation on materials designed for body implants. Biotechnol Adv. 2011;29(6):739-67. doi: 10.1016/j.biotechadv.2011.06.004. PubMed PMID: 21821113. 102. Benhabbour SR, Sheardown H, Adronov A. Cell adhesion and proliferation on hydrophilic dendritically modified surfaces. Biomaterials. 2008;29(31):4177-86. doi: 10.1016/j.biomaterials.2008.07.016. PubMed PMID: 18678405. 103. Lee KY, Mooney DJ. Hydrogels for tissue engineering. Chem Rev. 2001;101(7):1869-79. PubMed PMID: 11710233. 104. Tseng H, Cuchiara ML, Durst CA, Cuchiara MP, Lin CJ, West JL, Grande-Allen KJ. Fabrication and mechanical evaluation of anatomically-inspired quasilaminate hydrogel structures with layer-specific formulations. Ann Biomed Eng. 2013;41(2):398-407. doi: 10.1007/s10439-012-0666-5. PubMed PMID: 23053300; PMCID: 3545057. 105. Zhu J. Bioactive modification of poly(ethylene glycol) hydrogels for tissue engineering. Biomaterials. 2010;31(17):4639-56. doi: 10.1016/j.biomaterials.2010.02.044. PubMed PMID: 20303169; PMCID: 2907908. 106. Wells PN, Liang HD. Medical ultrasound: imaging of soft tissue strain and elasticity. Journal of the Royal Society, Interface / the Royal Society. 2011;8(64):1521-49. doi: 10.1098/rsif.2011.0054. PubMed PMID: 21680780; PMCID: 3177611. 107. Ophir J, Cespedes I, Ponnekanti H, Yazdi Y, Li X. Elastography: a quantitative method for imaging the elasticity of biological tissues. Ultrason Imaging. 1991;13(2):111-34. PubMed PMID: 1858217. 108. Ganne-Carrie N, Ziol M, de Ledinghen V, Douvin C, Marcellin P, Castera L, Dhumeaux D, Trinchet JC, Beaugrand M. Accuracy of liver stiffness measurement for the diagnosis of cirrhosis in patients with chronic liver diseases. Hepatology. 2006;44(6):1511-7. doi: 10.1002/hep.21420. PubMed PMID: 17133503. 109. Sandrin L, Fourquet B, Hasquenoph JM, Yon S, Fournier C, Mal F, Christidis C, Ziol M, Poulet B, Kazemi F, Beaugrand M, Palau R. Transient elastography: a new noninvasive method

86

for assessment of hepatic fibrosis. Ultrasound Med Biol. 2003;29(12):1705-13. PubMed PMID: 14698338. 110. Ferraioli G, Tinelli C, Lissandrin R, Zicchetti M, Dal Bello B, Filice G, Filice C. Point shear wave elastography method for assessing liver stiffness. World journal of gastroenterology : WJG. 2014;20(16):4787-96. doi: 10.3748/wjg.v20.i16.4787. PubMed PMID: 24782633; PMCID: 4000517. 111. Parker KJ, Doyley MM, Rubens DJ. Imaging the elastic properties of tissue: the 20 year perspective. Phys Med Biol. 2011;56(1):R1-R29. doi: 10.1088/0031-9155/56/1/R01. PubMed PMID: 21119234. 112. Ferraioli G, Parekh P, Levitov AB, Filice C. Shear wave elastography for evaluation of liver fibrosis. J Ultrasound Med. 2014;33(2):197-203. doi: 10.7863/ultra.33.2.197. PubMed PMID: 24449721. 113. Nightingale K. Acoustic Radiation Force Impulse (ARFI) Imaging: a Review. Curr Med Imaging Rev. 2011;7(4):328-39. doi: 10.2174/157340511798038657. PubMed PMID: 22545033; PMCID: 3337770. 114. Mariappan YK, Glaser KJ, Ehman RL. Magnetic resonance elastography: a review. Clin Anat. 2010;23(5):497-511. doi: 10.1002/ca.21006. PubMed PMID: 20544947; PMCID: 3066083. 115. Muthupillai R, Lomas DJ, Rossman PJ, Greenleaf JF, Manduca A, Ehman RL. Magnetic resonance elastography by direct visualization of propagating acoustic strain waves. Science. 1995;269(5232):1854-7. PubMed PMID: 7569924. 116. Yin M, Talwalkar JA, Glaser KJ, Manduca A, Grimm RC, Rossman PJ, Fidler JL, Ehman RL. Assessment of hepatic fibrosis with magnetic resonance elastography. Clin Gastroenterol Hepatol. 2007;5(10):1207-13 e2. doi: 10.1016/j.cgh.2007.06.012. PubMed PMID: 17916548; PMCID: 2276978. 117. Sarvazyan A, Hall TJ, Urban MW, Fatemi M, Aglyamov SR, Garra BS. An Overview of Elastography - an Emerging Branch of Medical Imaging. Curr Med Imaging Rev. 2011;7(4):255-82. PubMed PMID: 22308105; PMCID: 3269947. 118. Klatt D, Friedrich C, Korth Y, Vogt R, Braun J, Sack I. Viscoelastic properties of liver measured by oscillatory rheometry and multifrequency magnetic resonance elastography. Biorheology. 2010;47(2):133-41. doi: 10.3233/BIR-2010-0565. PubMed PMID: 20683156. 119. Chan RW, Rodriguez ML. A simple-shear rheometer for linear viscoelastic characterization of vocal fold tissues at phonatory frequencies. J Acoust Soc Am. 2008;124(2):1207-19. doi: 10.1121/1.2946715. PubMed PMID: 18681608; PMCID: 2561277. 120. Wang M, Kornfield JA. Measuring shear strength of soft-tissue adhesives. J Biomed Mater Res B Appl Biomater. 2012;100(3):618-23. doi: 10.1002/jbm.b.31981. PubMed PMID: 22323271. 121. Askeland DR, Fulay PP, Wright WJ. The science and engineering of materials. 6th ed. Stamford, CT: Cengage Learning; 2011. xxi, 921 p. p. 122. Megson THG. Structural and stress analysis. Third edition. ed. Amsterdam ; Boston: Butterworth-Heinemann is an imprint of Elsevier; 2014. xvii, 748 pages p. 123. McNaught AD, Wilkinson A, International Union of Pure and Applied Chemistry. Compendium of chemical terminology : IUPAC recommendations. 2nd ed. Oxford England ; Malden, MA, USA: Blackwell Science; 1997. vii, 450 p. p. 124. Meyers MA, Chawla KK. Mechanical behavior of materials. Upper Saddle River, N.J.: Prentice Hall; 1999. xv, 680 p. p. 125. Yang J, Shao Z. Recent advances in biological atomic force microscopy. Micron. 1995;26(1):35-49. PubMed PMID: 7704519.

87

126. Giessibl FJ, Morita S. Non-contact AFM. J Phys Condens Matter. 2012;24(8):080301. doi: 10.1088/0953-8984/24/8/080301. PubMed PMID: 22311696. 127. Hofmann T, Pielmeier F, Giessibl FJ. Chemical and crystallographic characterization of the tip apex in scanning probe microscopy. Phys Rev Lett. 2014;112(6):066101. PubMed PMID: 24580694. 128. Roduit C, Sekatski S, Dietler G, Catsicas S, Lafont F, Kasas S. Stiffness tomography by atomic force microscopy. Biophys J. 2009;97(2):674-7. doi: 10.1016/j.bpj.2009.05.010. PubMed PMID: 19619482; PMCID: 2711326. 129. Lekka M, Gil D, Pogoda K, Dulinska-Litewka J, Jach R, Gostek J, Klymenko O, Prauzner-Bechcicki S, Stachura Z, Wiltowska-Zuber J, Okon K, Laidler P. Cancer cell detection in tissue sections using AFM. Arch Biochem Biophys. 2012;518(2):151-6. doi: 10.1016/j.abb.2011.12.013. PubMed PMID: 22209753. 130. Wiesendanger R. Scanning probe microscopy and spectroscopy : methods and applications. Cambridge England ; New York: Cambridge University Press; 1994. xxii, 637 p. p. 131. Eaton PJ, West P. Atomic force microscopy. Oxford ; New York: Oxford University Press; 2010. viii, 248 p. p. 132. Korkin A, Krstic P, Miskovic Z, Yu H, Zhitomirsky I. Nanoscale Science and Technology for Electronics, Photonics and Renewable Energy Applications: Selected Papers from NGC2009 & CSTC2009 conference (http://asdn.net/ngc2009/). Nanoscale Res Lett. 2010;5(3):453. doi: 10.1007/s11671-010-9564-7. PubMed PMID: 20672095; PMCID: 2894060. 133. Le Rouzic J, Vairac P, Cretin B, Delobelle P. Sensitivity optimization of the scanning microdeformation microscope and application to mechanical characterization of soft materials. Rev Sci Instrum. 2008;79(3):033707. doi: 10.1063/1.2894208. PubMed PMID: 18377015. 134. Heile A, Brinker T. Clinical translation of stem cell therapy in traumatic brain injury: the potential of encapsulated mesenchymal cell biodelivery of glucagon-like peptide-1. Dialogues Clin Neurosci. 2011;13(3):279-86. PubMed PMID: 22034462; PMCID: 3182013. 135. Karle P, Muller P, Renz R, Jesnowski R, Saller R, von Rombs K, Nizze H, Liebe S, Gunzburg WH, Salmons B, Lohr M. Intratumoral injection of encapsulated cells producing an oxazaphosphorine activating cytochrome P450 for targeted chemotherapy. Adv Exp Med Biol. 1998;451:97-106. PubMed PMID: 10026857. 136. Levit RD, Landazuri N, Phelps EA, Brown ME, Garcia AJ, Davis ME, Joseph G, Long R, Safley SA, Suever JD, Lyle AN, Weber CJ, Taylor WR. Cellular encapsulation enhances cardiac repair. J Am Heart Assoc. 2013;2(5):e000367. doi: 10.1161/JAHA.113.000367. PubMed PMID: 24113327; PMCID: 3835246. 137. Goren A, Dahan N, Goren E, Baruch L, Machluf M. Encapsulated human mesenchymal stem cells: a unique hypoimmunogenic platform for long-term cellular therapy. Faseb J. 2010;24(1):22-31. doi: 10.1096/fj.09-131888. PubMed PMID: 19726759. 138. Knippenberg S, Thau N, Dengler R, Brinker T, Petri S. Intracerebroventricular injection of encapsulated human mesenchymal cells producing glucagon-like peptide 1 prolongs survival in a mouse model of ALS. PLoS One. 2012;7(6):e36857. doi: 10.1371/journal.pone.0036857. PubMed PMID: 22745655; PMCID: 3380029. 139. Duan B, Hockaday LA, Kang KH, Butcher JT. 3D bioprinting of heterogeneous aortic valve conduits with alginate/gelatin hydrogels. J Biomed Mater Res A. 2013;101(5):1255-64. doi: 10.1002/jbm.a.34420. PubMed PMID: 23015540; PMCID: 3694360. 140. Khalil S, Sun W. Bioprinting endothelial cells with alginate for 3D tissue constructs. J Biomech Eng. 2009;131(11):111002. doi: 10.1115/1.3128729. PubMed PMID: 20353253. 141. Murphy SV, Atala A. 3D bioprinting of tissues and organs. Nat Biotechnol. 2014;32(8):773-85. doi: 10.1038/nbt.2958. PubMed PMID: 25093879.

88

142. Chang R, Emami K, Wu H, Sun W. Biofabrication of a three-dimensional liver micro-organ as an in vitro drug metabolism model. Biofabrication. 2010;2(4):045004. doi: 10.1088/1758-5082/2/4/045004. PubMed PMID: 21079286.

89

CHAPTER 3

Stiffness of Hyaluronic Acid Gels Containing Liver

Extracellular Matrix Supports Human Hepatocyte Function

and Alters Cell Morphology

Daniel B. Deegan

This chapter includes and expands upon the results of the published manuscript,

“Stiffness of Hyaluronic Acid Gels Containing Liver Extracellular Matrix Supports

Human Hepatocyte Function and Alters Cell Morphology.”

Manuscript Reference:

Deegan D.B., Zimmerman C., Skardal A, Atala A., Shupe T., Stiffness of Hyaluronic Acid Gels

Containing Liver Extracellular Matrix Supports Hepatocyte Function and Alters Cell Morphology. Journal

of the Mechanical Behavior of Biomedical Materials. 2015; pp. 87-103

90

Abstract

Tissue engineering and cell based liver therapies have utilized primary hepatocytes with

limited success due to the failure of hepatocytes to maintain their phenotype in vitro. In

order to overcome this challenge, hyaluronic acid (HA) cell culture substrates were

formulated to closely mimic the composition and stiffness of the normal liver cellular

microenvironment. The stiffness of the substrate was modulated by adjusting HA

hydrogel crosslinking. Additionally, the repertoire of bioactive molecules within the HA

substrate was bolstered by supplementation with normal liver extracellular matrix

(ECM). Primary human hepatocyte viability and phenotype were determined over a

narrow physiologically relevant range of substrate stiffnesses from 600 to 4600 Pa in

both the presence and absence of liver ECM. Cell attachment, viability, and organization

of the actin cytoskeleton improved with increased stiffness up to 4600 Pa. These

differences were not evident in earlier time points or substrates containing only HA.

However, gene expression for the hepatocyte markers hepatocyte nuclear factor 4 alpha

(HNF4α) and albumin significantly decreased on the 4600 Pa stiffness at day 7 indicating

that cells may not have maintained their phenotype long-term at this stiffness. Function,

as measured by albumin secretion, varied with both stiffness and time in culture, peaking

at day 7 at the 1200 Pa stiffness, slightly below the stiffness of normal liver ECM at 3000

Pa. Overall, gel stiffness affected primary human hepatocyte cell adhesion, functional

marker expression, and morphological characteristics dependent on both the presence of

liver ECM in gel substrates and time in culture.

91

1. Introduction

Rising incidence and cost of liver disease as well as a limited supply of

transplantable organs have increased demand for new liver treatments. Experimental

treatments currently being developed include liver cell transplant on biological scaffolds

(1-5). However, several limitations intrinsic to primary hepatocytes have slowed

development of these technologies. Challenges remain in the maintenance of viability and

cell function of primary hepatocytes outside of the normal liver microenvironment (5).

Therefore, developing substrates that support hepatocyte viability and function is critical

to maximize the efficacy of primary hepatocytes in tissue engineering and cell therapies

for liver disease.

Previous studies have identified several advantages of using tissue-specific ECM

instead of generic matrix formulations such as Matrigel for supporting primary cells (6).

Cells on natural liver ECM demonstrated increased ability to proliferate and maintain

function over extended time periods (7). Hepatocytes cultured on intact or solubilized

organ specific matrix also maintained normal cell morphologies as compared to cells

grown on tissue culture plastic or collagen (3, 8, 9). The underlying mechanisms for this

improved phenotypic stability are still unknown but likely relate to inclusion of several

components of the natural liver microenvironment, including cell and growth factor

binding sites.

For this study, decellularization of normal liver was used to isolate acellular ECM

for incorporation into hyaluronic acid (HA) hydrogels. The decellularization process

involved perfusion of the organ with detergents to remove native cellular material, while

92

preserving structural proteins and glycosaminoglycans (GAGs) (10). Removal of native

cells leaves a non-immunogenic ECM scaffold that can be seeded with hepatocytes that

remain viable for several weeks (11).

Many previous studies utilized ECM coated tissue culture plastic for growing

primary hepatocytes. However, this method is only suitable for two-dimensional culture

and is not easily translated into a three-dimensional form for use in cell based therapies

(12, 13). The current study uses a hydrogel that may be formed into three-dimensional

units suitable for transplantation. Preliminary findings indicated that solubilized ECM

combined with hyaluronic acid gel (HA) maintained a normal epithelial morphology and

strong tight junction formation with little evidence of transition to a fibroblast-like

morphology, commonly seen in traditional collagen cultures. Solubilization of the ECM

also prevented hepatocyte apoptosis induced by phagocytosis of cryomilled ECM

powders. Other studies published by our group demonstrated that HA based hydrogels

avoided an immunogenic response measured by human lymphocyte proliferation, while

other gel types such as rat tail collagen 1 induced a low level immune response (11, 14).

Better phenotype maintenance and biocompatibility upon transplantation signaled that

HA gel was the best substrate for incorporating decellularized liver in future assays.

In the development of a liver ECM substrate, the physical characteristic of

stiffness is important to cell physiology and mechanics. The general conclusions of

previous publications indicate that stiff substrates promote hepatocyte spreading,

proliferation, and dedifferentiation; while soft substrates promote maintenance of the

functional hepatocyte phenotype (15, 16). Substrate stiffness also regulates cell

aggregation, growth factor responsiveness, and cell motility with the highest cell

93

migration occurring on intermediate stiffness levels (17, 18). However, several of these

previous studies were done on stiffness ranges well above physiological liver stiffness,

which has been reported anywhere from 1.5 to 8.5 kPa (19-24).

For the current study, the crosslinker concentration was the sole variable for

adjusting gel stiffness. Crosslinking eliminated potential confounding effects found in

more complex systems where concentrations of structural compounds are altered. Gel

stiffnesses were also limited to a narrow, physiologically relevant range of 600-4600 Pa

that bracketed the stiffness of normal liver ECM at 3000 Pa. Assays were conducted to

measure overall hepatocyte function as well as the mechanisms by which substrate

stiffness affected cell phenotype. Specific tests performed in this study were designed to

explore the mechanisms by which substrate stiffness affected substrate/cell adhesion,

primary hepatocyte function, and morphology. Cell junction formation is critical for the

maintenance of epithelial cell phenotype; regulating a broad range of cellular properties

through cell-cell communication, adhesion, and diffusion of water and solutes (25, 26).

Tight junctions act as semi-permeable barriers that establish cell polarity, which is crucial

for the maintenance of bile canaliculi (27, 28). The tight junction protein, claudin-1, is

required for maintenance of the selective barrier properties between adjacent hepatocytes

(29). Occludin is not essential for maintaining tight junction structures, but plays a role in

regulating cytoskeletal organization, cell polarity, and cell migration (30-32).

The effects of substrate stiffness on intracellular signaling were also studied

through measurement of two cytoplasmic kinases: focal adhesion kinase (FAK) and

integrin-linked kinase (ILK). Cells adapt their cytoskeletal structure to specific

microenvironmental conditions through interactions between focal adhesion molecules

94

and intracellular kinases. Appropriate expression of these kinases in hepatocytes is

required for normal growth factor responsiveness, prevention of apoptosis, and normal

metabolic function (33-35). Silencing or overexpression of these factors can lead to

cellular dysfunction and, in the case of neoplasia, tumor progression (36). Increased

expression also mediates cytoskeletal reorganization and cell protrusion formation which

drives cell migration (37, 38). In other experimental systems, FAK and ILK expression

have been shown to correlate with cell junction remodeling, specifically through

interactions with occludin. FAK and ILK also act through downstream activation of Ras

homolog family member (Rho) GTPases; cell division control protein 42 (CDC42), Ras-

related C3 botulinum toxin substrate (Rac1), and Ras homolog family member A (RhoA)

(39, 40). CDC42 and Rac are the two GTPases involved in actin cytoskeletal

reorganization for cell motility, including formation of cells extensions called filopodia

and lamellipodia. RhoA expression increases focal adhesion and stress fiber formation

and is correlated with a more contractile morphology (41-44).

By studying the stiffness responsive factors that influence hepatocyte structure

and function, we have gained insights into the mechanisms through which substrate

stiffness affects the viability and phenotypic stability of primary hepatocytes. These

findings have informed the development of a transplantable gel containing liver specific

ECM at an optimal stiffness for therapeutic use in hepatocyte cell therapies.

95

2. Materials and Methods

2.1 Liver Decellularization

Intact rat livers were decellularized according to our group’s previously published

methods (10). Ten week old male F344 rats were euthanized by administering a lethal

dose of sodium pentobarbital (100 mg/kg). Livers were then cannulated and perfused by

methods previously diagrammed and reported in our cell isolation protocol (45). In brief,

a euthanized rat was pinned on a dissection board, and a mid-line incision was made

through the peritoneum starting from the diaphragm down to the groin. Visceral organs

were shifted to expose the inferior vena cava (IVC) and liver. The IVC was cannulated

with a 20-gauge catheter and tied in place with sutures. The portal vein was then cut, and

the superior vena cava (SVC) was clamped. Solutions were held in flasks at 37°C in a

water bath (Fisher Scientific, Pittsburgh, PA) and then perfused through the catheter at a

flow rate of 5 mL/minute using tubing and a Masterflex L/S peristaltic pump (Cole-

Parmer Instrument Company, Vernon Hill, IL).

100 mL of PBS was first perfused to clear residual blood. The liver was then

perfused with approximately 300 mL each of 1%, 2% and 3% Triton X-100 solutions in

PBS. A final solution of 0.1% SDS in PBS was used to clear remaining DNA and Triton

detergent. The liver was then fully excised, and overnight PBS washing was used to

remove residual SDS from the matrices. All animal procedures were approved by the

Institutional Animal Care and Use Committee (IACUC) at Wake Forest University.

96

2.2 Immunohistochemistry (IHC) on Decellularized Tissue

Following decellularization, we immunostained rat livers to assess cell clearance

and retention of structural components such as collagens and laminin. As reported in our

previous manuscript, decellularization completely removed cellular material from tissue

sections, while collagen and laminin were preserved and represented (Figure 1) (10).

For this study, Alcian blue staining for mucopolysaccharides that comprise GAGs

was performed on frozen decellularized liver sections. Tissue was frozen in OCT blocks

and cut into 5 μm slices that were then fixed in acetone on slides at 4ºC for two minutes.

Sections were then stained according to a previously established protocol (46). In short,

Fig.1) IHC of Decellularized Liver Tissue, adapted from Shupe et al (10)

A) Hematoxylin and eosin staining (H&E) shows full cellular removal. B)

Trichrome staining shows presence of structural collagens. C) Staining for

laminin and D) collagen IV indicate presence of a basement membrane.

97

sections were incubated in 0.5% Alcian blue 8G solution in 0.5% acetic acid for 30

minutes (Sigma-Aldrich, St. Louis, MO). Sections were then washed with PBS and

imaged.

2.3 GAG Function in Decellularized Tissue

To assess the ability of residual GAGs to bind growth factors following

decellularization, 5 mg samples of decellularized liver were incubated at room

temperature for one hour in PBS containing an array of concentrations of recombinant

epidermal growth factor (EGF) and human hepatocyte growth factor (HGF) up to 1000

ng/mL (Peprotech, Rocky Hill, NJ). Following pre-treatment, tissue was washed for 1

hour at 4ºC in four separate 50 mL volumes of PBS to remove unbound growth factor.

We confirmed that following the fourth wash, greater washing of up to ten washes

created no differences in bound growth factor quantity. Following lyophilization,

cryomilling, and solubilization of the tissue matrix in HCl-pepsin buffer solution, we

quantified EGF or HGF levels in each sample by ELISA (RayBiotech Inc., Norcross,

GA). Samples were normalized through measurement of total protein using the Pierce

BCA Protein Assay Kit (Thermo, Rockport, IL).

2.4 Liver ECM Solubilization

Gels with added ECM were created according to previously published protocols

from our group (8). In brief, decellularized liver tissue was frozen at -80ºC and

lyophilized using a SuperModulyo Freeze Dryer (Thermo, Waltham, MA). Samples were

maintained under vacuum at a pressure of 0.1 mbar and temperature of -80ºC for 24

hours. Tissue was then ground in liquid nitrogen using a mortar and pestle until a fine

98

powder was attained. Liver ECM was solubilized by mixing lyophilized decellularized

tissue with 0.1 N HCl and pepsin (Porcine gastric mucosa, 3400 units of protein, Fischer

Scientific, Fair Lawn, NJ). After an incubation of 48 hours at room temperature, the

solution was centrifuged and filtered with a 0.2 µm syringe filter. The pH was adjusted to

7.0 and the total protein concentration to 1.0 mg/mL.

2.5 Solubilized Liver ECM Quantitative Analysis

DNA from solubilized liver ECM solutions was isolated and purified using the

Qiagen DNeasy Kit. DNA amounts were quantified using a set of standards and the

Quant-iT PicoGreen reagent kit (Invitrogen Corp., Carlsbad, CA) that could detect lower

than 1 ng/mL of DNA in solution.

GAG levels were quantified using the Blyscan sGAG Assay kit (Biocolor,

Newtownabbey, UK). 40 μL of solubilized ECM was mixed with 160 μL of 0.2 M

sodium phosphate buffer containing 1 mg/mL of papain and incubated at 65ºC for 3

hours. Samples were then mixed with Blyscan dye, pelleted, and washed. After

dissociation reagent was added, samples and GAG standards were loaded into a 96 well

plate and measured in a SpectraMax M5 Multi-Mode Microplate Reader at an absorbance

of 656 nm (Molecular Devices, Sunnyvale, CA).

Collagen levels were quantified using the Sircol Soluble Collagen Assay kit

(Biocolor, Newtownabbey, UK). 20 μL of solubilized ECM was mixed with 130 μL of

0.5 M acetic acid containing 0.1 mg/mL pepsin and then incubated overnight at 4ºC.

Samples were then mixed with Sircol dye, pelleted, and washed. Dissociation reagent

99

was added, and samples and standards were read in a 96 well plate at an absorbance of

555 nm.

2.6 ECM Gel Formation

Liver ECM solution was combined at a 1:1 ratio with thiol modified HA gel

components (HyStem Hydrogels, ESI BIO, Alameda, CA). Components include 3,3′-

Dithiobis(propanoic hydrazide) modified HA (Glycosil or HA-DTPH, Mw 168 kDa, Mn

79 kDa, polydispersity index 2.13), chemically modified gelatin-DTPH (Gelin-S, Mw

∼50 kDa), and heparin-DTPH (Heprasil, Mw ∼17-19 kDa). Protocols for synthesis of

these proprietary compounds can be found in the literature (47, 48). HA alone does not

provide sites for attachment during cell seeding. By including gelatin, or denatured

collagen, and supplemented liver ECM, adequate binding sites for cells were supplied. At

a sufficient stiffness, these molecules enable timely and efficient cell adhesion that

resembles what is observed in seeding of tissue scaffolds or protein coated tissue culture

plastic. These additions allow the hydrogels to mimic the composition and physical

properties of a normal tissue microenvironment.

To test the effects of mechanical properties, three different gel stiffnesses were

created. For the two lower stiffnesses, 1% and 2% weight/volume polyethylene glycol

diacrylate (PEGDA/Extralink, 3.4 kDa) were added to other gel components (ESI BIO,

Alameda, CA). The stiffest gel was created with 6% weight/volume 4-arm PEG acrylate

(20 kDa) (Creative PEGWorks, Chapel Hill, NC). As controls, gels containing only

components of the HA gel kit were created without the addition of solubilized ECM.

100

Gel solutions were added to wells of chamber slides or tissue culture plates and

allowed to fully crosslink for two hours. Gels completely filled the growth area of the

wells and polymerized at a thickness of over 1.5 mm to prevent the tissue culture plastic

bottom from contributing to the stiffness of the substrate. For cell culture assays

involving immunocytochemistry (ICC), 125 μL of each gel type was layered per well into

8-well Permanox Plastic Nunc Lab-Tek Chamber Slides to fill an area 80 mm² (Thermo

Scientific, Waltham, MA). For stiffness quantification, 325 µL of gel was added to 24-

well plates to fill an area of 200 mm². For assays measuring function, viability, and gene

expression, 50 µL of each gel type was layered into 96-well plates to fill an area of 32

mm² for cell seeding (Tissue culture treated plastic, Thermo Scientific, Waltham, MA).

2.7 Stiffness Quantification

ECM-HA and HA only gels were created in 24-well plates (80 mm²) with each

crosslinker concentration (1% PEGDA, 2% PEGDA, and 6% 4-arm PEG w/v). The

Discovery Series HR-2 Rheometer (TA Instruments, New Castle, DE), a type of

rotational or shear rheometer, was used to test stiffness following creation of gel

substrates. Decellularized tissue was used as a reference control and comparison to

normal liver ECM in this study. During testing with this type of rheometer, the sample

was stabilized on the fixed stage of the rheometer. A geometry in the form of a 12 mm

flat parallel plate was subsequently lowered until it came into contact with the sample.

The rheometer performed oscillatory stress sweep tests where shear stress was

incrementally increased on the samples from 0.6 Pa up to 10.0 Pa with a constant

oscillatory frequency of 1 Hz and a normal axial force of 0.4 N, as has been previously

described (49-52).

101

From the various forces applied, an elastic modulus could be measured and

calculated by the instrument. The elastic modulus, or resistance to deformity, can be

expressed by three types of calculations; Young’s modulus, bulk modulus and shear

elastic modulus. We analyzed the shear elastic modulus, which describes how a sample

responds to opposing forces parallel to its surface and is calculated by dividing shear

stress by shear strain. Both the shear storage modulus (G’) and shear loss modulus (G’’)

were measured. The storage modulus describes the elastic properties or stored energy,

while the loss modulus describes the viscous characteristics or energy lost as heat (53).

The storage modulus (G’) from oscillatory shear was the main value utilized for reporting

stiffness characteristics of the hydrogels in our assays.

To calculate G’, measurements of phase lag (the phase shift between stress and

strain), stress, and strain are needed. The formulas listed in Table 1 were used to calculate

G’ and its different variables. Formulas were modified from the Discovery Series HR-2

Rheometer Reference Guide (TA Instruments New Castle, DE).

Table 1: Storage modulus formulas

Formulas Variables

G′ = 𝑠𝑡𝑜𝑟𝑎𝑔𝑒 𝑚𝑜𝑑𝑢𝑙𝑢𝑠 = cos(δ)σ

γ

δ = phase lag or shift, σ = oscillation stress, γ

= strain

σ = oscillation stress = Kσ∗M(sample)

Kσ = stress constant, M = oscillation torque

(on the sample)

Kσ = stress constant = 2

π∗R³

R = radius of parallel plate

γ = strain = Kγ∗Ѳ Kγ = strain constant, Ѳ = oscillation or

angular displacement

Kγ = strain constant = R

H

R = radius of parallel plate, H = gap

102

2.8 GAG Function in ECM gels

GAG function was analyzed in gel substrates of the same 600 Pa stiffness in 96

well plates either containing HA only or HA supplemented with solubilized liver ECM.

Gels were incubated in solutions containing 500 ng/mL of HGF in PBS overnight and

then washed for an hour in four separate 250 uL volumes of PBS. A HGF dependent

epithelial cell line, 4MBr-5, was seeded at 20,000 cell/well in Ham's F-12K Medium with

2 mM L-glutamine, 1.5 g/L sodium bicarbonate, and 30 ng/mL of epidermal growth

factor (ATCC, Manassas, VA). DNA synthesis of seeded cells was quantified after 48

hours in culture to assess the activity of GAG-bound HGF. Values were also standardized

by cells grown on non-growth factor treated gels of each substrate type.

2.9 Primary Hepatocyte Isolation and Seeding

In preliminary assays, primary rat hepatocytes were freshly isolated from rat

livers perfused with collagenase and calcium chloride solutions through the inferior vena

cava at 37ºC. To purify isolations, hepatocytes were passed through a 100µm nylon mesh

and centrifuged at 1000RPM as described in previous studies (102, 103).

For assays involving primary human hepatocytes, cryopreserved human

hepatocytes (Triangle Research Labs, Research Triangle Park, NC) were seeded onto gels

in Clonetics Hepatocyte Basal Medium with UltraGlutamine-1 and Hepatocyte Culture

Medium supplements (HCM; Lonza, Allendale, NJ). Supplements include ascorbic acid,

bovine serum albumin-fatty acid free, hydrocortisone, human epidermal growth factor,

transferrin, insulin, and gentamicin. 50,000 or 125,000 primary hepatocytes per well were

seeded on pre-formed gels in 96-well plates or 8-well chamber slides respectively. Cells

103

were allowed to attach to gel binding sites for 5 hours before PBS washing removed dead

or non-adherent cells. Hepatocytes were maintained in incubators (37ºC, 5% CO2), and

media was changed following PBS washing every 2 days until conclusion of the

experiment.

2 and 7 days post-seeding were used as time points in all of our cellular assays.

The majority of cell death occurs in the first 24 hours post-hepatocyte seeding (54). The

day 2 time point allows for initial cell attachment, establishment of cell viability, and

washing away of non-adherent or dead cells. Primary hepatocytes have also been

reported to take 3-6 days to stabilize metabolic functions, especially albumin production

(55). The day 7 time point allows cells to complete this adaptation period on the cell

culture substrates.

2.10 DNA Quantification

DNA was extracted from 4MBr-5 cells of each well by proteinase K digestion for

2 hours at 56ºC and purified using the Qiagen DNeasy Kit. DNA was quantified using the

Quant-iT PicoGreen reagent kit and a set of DNA standards (Invitrogen Corp., Carlsbad,

CA). Total DNA amounts were standardized by DNA levels from cells grown on non-

growth factor treated HA only or ECM containing gels.

Similar to the GAG-bound HGF assay, DNA was quantified in primary

hepatocytes to assess cell numbers retained on gels at various time points. DNA was

extracted and purified from cells of each well at the day 2 or day 7 post-seeding time

points. DNA was then quantified using the Quant-iT PicoGreen reagent kit (Invitrogen

104

Corp., Carlsbad, CA). Total DNA amounts were compared among various stiffness

groups.

2.11 Immunocytochemistry (ICC)

For ICC, cells were seeded on gels in Nunc™ Lab-Tek™ 8-well Chamber Slides.

After 7 days in culture, cells were fixed overnight in 10% neutral buffer formalin (NBF)

at 4ºC. Cells were then stained using the Actin Cytoskeleton and Focal Adhesion Staining

Kit (Millipore, Billerica, MA), or for FAK and ILK staining, the rabbit monoclonal

antibodies anti-FAK (EP695Y) and anti-ILK (EPR1592) (Abcam, Cambridge, MA) were

used. Cells were blocked for 30 minutes in 8% milk and then stained with a 1:500

dilution of the anti-Vinculin, 1:500 dilution of anti-FAK, or 1:250 dilution of anti-ILK

primary antibody for 1 hour. After washing, anti-Vinculin cells were then stained with

1:500 diluted TRITC-conjugated Phalloidin and 1:500 Goat anti-Mouse IgG (H+L)

Secondary Antibody, Alexa Fluor 488 conjugate (Life Technologies, Grand Island, NY).

Fluorescent-conjugated phalloidin stained F-actin in the microfilaments of the

cytoskeleton to assess cell structure. Cells incubated with Anti-FAK or Anti-ILK were

stained with 1:500 Goat anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor 594

conjugate. Following further washing, all cells were incubated in 1:1000 DAPI

counterstain for 5 minutes. DAPI co-staining was used to visualize individual cell nuclei

for quantification.

2.12 Cell Counting

To confirm DNA quantification methods at 7 days post-seeding, hepatocytes were

quantified by counting nuclei of stained cells per 0.25 mm² area. For each gel type and

105

stiffness, six separate 10x magnification images (1000 μm x 1000 μm) of DAPI stained

hepatocytes were captured in randomized areas of six different substrate-containing wells

of an 8-well Permanox Plastic Nunc Lab-Tek Chamber Slide (Thermo Scientific,

Waltham, MA). Images were broken down into four quarters (500 μm x 500 μm), and the

top left quarter of the image was used for counting purposes (0.25 mm² area). DAPI

stained cells were hand-counted per image and averaged to assess cell adhesion for each

substrate condition.

2.13 Calcein-AM Staining

Primary hepatocytes seeded on ECM-HA or HA only containing gels were

immunofluorescently labeled using a Live/Dead Viability Assay Kit (Life Technologies,

Grand Island, NY). Viable cells were identified by green-fluorescent Calcein-AM

positive staining.

2.14 Hepatocyte Functional Analysis

Media samples were collected at various time points from wells containing

primary hepatocytes seeded on gels of varying stiffness. The Human Serum Albumin

ELISA kit (Alpha Diagnostic International, San Antonio, TX) was used to compare

secreted albumin in experimental groups to negative controls containing medium alone.

Quantification was achieved by comparing values to a standard curve generated from

purified albumin.

106

2.15 Liver Cell Junction and Kinase Expression

Primary hepatocytes seeded on various gel types were lysed by syringe

homogenization in QIAzol solution. Solutions from triplicate wells were combined to

create a total volume of 700uL of homogenized QIAzol/cell mixture. A total of 140 µL of

chloroform was added to this solution and vortexed for 15 seconds. Solutions were then

centrifuged at 12,000 x g at 4ºC for 15 minutes. The upper aqueous layers were added to

miRNeasy spin columns, and processed RNA was used for real time PCR (Qiagen,

Germantown, MD).

Isolated RNA was quantified using a NanoDrop 2000 UV-Vis Spectrophotometer

(Thermo Scientific, Waltham, MA). A total of 200 ng RNA was used to create cDNA

using a thermocycler and the SuperScript Vilo cDNA Kit (Life Technologies, Grand

Island, NY). cDNA was mixed with the SYBR Select Master Mix (Life Technologies,

Grand Island, NY) and Eurofin primers custom created from sequences designed using

Primer-Blast (NCBI) (Table 2) or from published literature (56, 57). An Applied

Biosystems 7300 Real-Time PCR System was used to calculate samples’ Ct values for

targets, which were standardized by GAPDH. Expression was compared relative to

Human Liver Total RNA (Life Technologies, Waltham, MA).

107

Table 2: Human primers for RT-qPCR

Targets Forward Primer (5’ to 3’) Reverse Primer (5’ to 3’)

Claudin-1 CCGTTGGCATGAAGTGTATG CCAGTGAAGAGAGCCTGACC

E-Cadherin TGAGTGTCCCCCGGTATCTT AGAATCATAAGGCGGGGCTG

ILK AAGGTGCTGAAGGTTCGAGA ATACGGCATCCAGTGTGTGA

FAK (PTK2) TTATTGGCCACTGTGGATGA TACTCTTGCTGGAGGCTGGT

GAPDH (56) CCCACTCCTCCACCTTTGAC TTGCTGTAGCCAAATTCGTTGT

Integrin Beta 1

(57) GAAGGGTTGCCCTCCAGA GCTTGAGCTTCTCTGCTGTT

RhoA GTCCACGGTCTGGTCTTCAG TTTCCACAGGCTCCATCACC

CDC42 variant

1/2 GGTGGAGAAGCTGAGGTCAT CATCGCCCACAACAACACAC

Rac1/3 ATCACCTATCCGCAGGGTCT CGGATCGCTTCGTCAAACAC

HNF4α TCAACCCGAGAAAACAAACC ACCTGCTCTACCAGCCAGAA

Albumin TTGGCACAATGAAGTGGGTA AAAGGCAATCAACACCAAGG

SNAIL CCCTCAAGATGCACATCCGAA GACTCTTGGTGCTTGTGGAGCA

2.16 Statistics

Data was expressed as the mean +/−standard deviation. Statistical analysis was

performed using Student’s t test and analysis of variance (ANOVA) where noted. A p-

value of less than 0.05 was considered significant.

108

3. Results

3.1 Liver Decellularization and Solubilization Preserved ECM Components and Their

Functions

This study incorporated liver ECM into gels through the process of

decellularization and solubilization. A previous manuscript published by our group

demonstrated full cellular removal and retention of specific ECM components, including

B)

0

100

200

300

400

500

0 50 100 500 1000

pg

HG

F/g

EC

M

HGF Pretreatment Concentration (ng/mL)

Growth Factor Binding C)

0

10

20

30

40

50

60

70

HA ECM

To

tal D

NA

(n

g)

HGF Treated Gel Type

HGF-Dependent Cell Growth D)

A)

Fig.2) Solubilized Liver Composition and Activity- A) Alcian blue staining detected GAG presence in

decellularized tissue. B) Solubilized liver ECM solutions were analyzed for collagen, GAG, and DNA

content (n=3, ±SD). DNA content was non-detectable (ND) at an assay limit of <1 ng/mL. C) During

growth factor treatments to determine GAG functionality, HGF bound to isolated ECM in a dose-

dependent manner (*p<.05, Student’s t-test, n=5). D) The activity of growth factor treated gels was

tested by seeding a HGF-dependent cell line on HA gels or HA gels supplemented with solubilized ECM

after 500 ng/mL HGF pre-treatment. Cell growth was quantified by DNA (*p<.05, Student’s t-test, n=7).

109

collagen IV and laminin, in the decellularized liver tissue (Figure 1-Methods) (10).

Alcian blue staining was performed in a new IHC assay to confirm presence of GAGs in

the tissue (Figure 2A). GAG-containing decellularized matrix also demonstrated the

ability to bind HGF in a concentration dependent manner (Figure 2C). In addition, the

GAG binding growth factor HGF abound in greater quantities compared to EGF, which

only has non-specific interactions with collagens of the matrix (Supplementary Figure 1).

Following liver ECM solubilization, key molecular constituents were quantified.

DNA levels were insignificant and below detection levels (<1 ng/mL). However,

significant levels of GAGs and collagen were detected (Figure 2B). An assay was

performed to measure the ability of GAGs in solubilized liver ECM gels to bind and

present growth factor. The assay showed increased growth of a HGF-dependent epithelial

cell line on HGF pre-treated HA gels supplemented with solubilized ECM compared to

pre-treated gels only containing HA (Figure 2D).

In cell culture experiments with rat hepatocyte, substrates with solubilized ECM

improved viability compared to gels containing cryomilled tissue (Figure 3).

Incorporation of decellularized liver tissue into HA cell culture substrates also showed

benefits over single protein coatings or unmodified gel substrates. Preliminary studies

showed greater hepatocyte aggregation on HA gels containing liver ECM versus basic

collagen I gels (Figure 4). Compared to cells grown on gels containing solely HA,

primary hepatocytes seeded on HA gels supplemented with solubilized ECM attached in

greater numbers and showed greater E-cadherin expression (Figure 4E and 4F).

110

Fig.3) Primary rat hepatocytes were seeded for 7 days on gel coatings with

A+C) powdered or B+D) solubilized liver ECM. Ethidium bromide levels stained

dead cells red, while calcein-AM stained live cells green. Cell viability was A) low

on gels with powdered ECM and B) high on solubilized ECM gels. Phase contrast

images showed C) vacuolization and development of lamellar bodies in

hepatocytes grown on powdered ECM. D) Hepatocytes on solubilized ECM gels

maintained normal cell morphologies.

111

Fig.4) Primary rat hepatocytes were seeded for 7 days on either A+C) pure collagen I gels or

B+D) HA gels containing solubilized liver ECM. Phase contrast imaging and cytochrome

P450 staining with a DAPI counterstain show greater cell aggregation on liver ECM gels.

ECM gels also initiated greater E) cell attachment and F) E-cadherin expression (*p<.05,

**p<.01, Student’s t test, DNA n=10, E-cadherin n=3).

112

3.2 Crosslinker Concentration Altered ECM Gel Stiffness

1% PEGDA, 2% PEGDA, and 6% 4-arm PEG (w/v) crosslinker formed three

different ECM gel stiffness groups for stiffness testing. Oscillatory stress rheometry

quantified the storage modulus (G’) to compare each crosslinked gel’s stiffness to the

stiffness of normal liver ECM. Gels formed by 6% 4-arm PEG had a mean G’ of 4600

Pa. This value was higher than the mean stiffness of normal liver ECM, which fluctuated

around 3000 Pa, but fell within the standard deviation of the data set. The stiffnesses of

gel groups formed by 1% and 2% PEGDA at 600 and 1200 Pa respectively were

signifcantly lower than the storage moduli of both the 6% 4arm PEG crosslinked gels and

normal liver ECM. The 600 and 1200 Pa gel groups were also signicantly different from

each other (Figure 5).

Fig.5) HA-ECM Gel Stiffnesses Formed by Varying Crosslinker Concentrations-

HA-ECM gels were formed with 1% PEGDA, 2% PEGDA, or 6% 4-arm PEG (20kDa). All gel

stiffness values were significantly different from each other. Decellularized liver tissue had a

significantly higher stiffness than 1% and 2% PEGDA, however, it was not significantly

different compared to the 6% 4-arm PEG stiffness. (*p<.05, Student’s t test, n=4,)

0

1000

2000

3000

4000

5000

6000

7000

PEGDA (3.4kDa) 1% PEGDA (3.4kDa) 2% 4-arm PEG (20kDa) 6% Decellularized Liver

G' (P

a)

Crosslinker Concentration % (w/v)

HA-ECM Gel Stiffness

113

3.3 ECM Supplementation and Stiffness Affected Viable Hepatocyte Attachment and

Morphology

Calcein-AM, which is only metabolized in the cytoplasm of live cells, was used to

stain hepatocytes to assess the role of ECM gel stiffness in cell viability and morphology.

An increase in viable human hepatocytes was observed on ECM containing gels with

increased stiffness at day 7 post-seeding. Hepatocytes also survived on ECM gels in

greater numbers than cells grown on gels containing HA alone (Figure 6).

Cell morphology varied among substrate groups. No obvious differences were

observed between cells seeded on varying stiffnesses of gels containing only HA (Figure

6A, 6C, and 6E). However, cells on ECM supplemented gels of 4600 Pa developed

organized, polyhedral morphologies compared to irregularly-shaped cells on the lower

stiffnesses of 600 and 1200 Pa. Increased cytoplasmic protrusions or filopodia formation

at day 7 post-seeding was demonstrated with Calcein-AM staining on 600 and 1200 Pa

ECM gels (Figure 6B and 6D).

114

Fig.6) Cell Viability and Filopodia Formation- Green-fluorescent Calcein-AM staining was

used to visualize primary hepatocyte viability and morphology at Day 7 post-seeding at 4x

magnification. Mean gel stiffnesses were; A+B) 600 Pa, C+D) 1200 Pa, or E+F) 4600 Pa.

Gels were composed of only HA (A,C,E) or were supplemented with liver ECM (D,B,F).

Filopodia were highlighted with white arrows.

115

Fig.7) Cytoskeletal Staining- Phalloidin and DAPI staining was used to visualize F-actin

filaments and nuclei of primary hepatocytes at day 7 post-seeding at 10x and 20x

magnification. Mean gel stiffnesses were; A+B) 600 Pa, C+D) 1200 Pa, or E+F) 4600 Pa.

Gels were composed of only HA (A,C,E) or were supplemented with liver ECM (D,B,F). Actin

stress fibers were highlighted by white arrows.

116

More detailed immunocytochemistry was then used to analyze hepatocyte

attachment and cytoskeletal structure of the hepatocytes. Clear differences were observed

in phalloidin staining of the hepatocytes’ actin cytoskeletons on varying ECM gel

stiffnesses. Increased gel stiffness correlated with increased attachment and cytoskeletal

organization, evidenced by greater actin microfilament presence and stress fiber

formation (Figure 7F). ECM supplemented gels of 600 and 1200 Pa stiffnesses generated

lower cell densities and less actin staining (Figure 7B and 7D). Differences in

cytoskeletal structure were less obvious in cells seeded on HA only gels but in general,

cells on the 4600 Pa gel stiffness experienced greater stress fiber formation than cells on

the 600 and 1200 Pa stiffnesses (Figure 7E).

From the DAPI staining, cells were counted by number of nuclei per mm² of gel.

Results showed a significant increase in cell attachment with increased ECM gel

stiffness. Stiffness did not significantly influence cell number on gels composed of only

HA. The data also indicated significant differences in attachment between ECM-

containing and HA-only gels at 600 Pa and 4600 Pa. Human hepatocytes attached with

greater efficiency on HA gels at 600 Pa. At 4600 Pa, a more physiologically normal

stiffness, hepatocytes attached best to gels containing ECM (Figure 8A).

An additional assay was used to validate these findings. In this assay, DNA was

isolated and quantified from different stiffness groups at two different time points. ECM

gels at day 2 did not show significant differences. However, by day 7, 4600 Pa ECM gels

showed significantly greater DNA levels (Figure 8B).

117

3.4 ECM Gel Stiffness Altered Human Hepatocyte Marker Expression and Functionality

over Time

Expression levels of the hepatocyte markers HNF4α and albumin on gels of varying

stiffnesses were measured and normalized to native human liver expression. There were

no significant differences in HNF4α expression at the day 2 time point (Supplementary

Figure 2A). However, at day 7 post-seeding, cells expressed both HNF4α and albumin at

significantly lower levels on the 4600 Pa gel stiffness, while cells on the 1200 Pa stiffness

demonstrated increased expression of these genes (Figure 9). SNAIL expression was also

quantified to determine if any stiffness-induced epithelial-mesenchymal transition was

0

100

200

300

400

500

600

700

800

900

600 1200 4600

Ce

lls

/mm

²

Gel Stiffness (Pa)

Cell Attachment on Varying Gel Types

HA

ECM

A)

0

10

20

30

40

50

60

70

80

600 1200 4600

DN

A p

er

we

ll (

ng

)

Gel Stiffness (Pa)

DNA Quantification on ECM Gels

Day 2

Day 7

B)

Fig.8) Stiffness and Substrate Dependent Cell Attachment- A) Cell attachment was

assessed at 7 days post-seeding on HA gels of various stiffnesses, with or without ECM

supplementation. Cell number increased with stiffness in ECM gels. There were also

significant differences in cell numbers between simple HA gels and HA gels containing liver

ECM at the 600 and 4600 Pa stiffness levels. B) DNA of cells attached to ECM containing

HA gels was quantified to confirm cell counting methods and to test an earlier time point of 2

days post-seeding. A significant decrease in DNA was measured on the 1200 Pa stiffness

between day 2 and 7 of culture. However, at the 4600 Pa ECM gel stiffness, no loss in

viable cells was observed over this same period of time. (*p<.05, **p<.01, ***p<.001,

Student’s t test, n=6)

118

occurring. No significant differences were seen at either time point (Supplementary

Figure 2B and 2D).

ELISA for albumin production was used as a measure of human hepatocyte

function, and to determine if functional output matched hepatocyte marker expression. A

significant increase in albumin production was seen with increasing gel stiffness at day 2

post-seeding. This increase remained significant when albumin was normalized to total

DNA (Figure 10A). By day 7, albumin production improved in cells seeded on all gel

stiffnesses, but cells on the 4600 Pa gel stiffness no longer produced albumin at a

significantly higher rate. Cells on the 1200 Pa stiffness created albumin at a significantly

higher rate than the lowest stiffness and appeared to overtake the functional rate of cells

on the 4600 Pa stiffness (Figure 10B).

0

0.1

0.2

0.3

0.4

0.5

0.6

600 1200 4600

Fo

ld C

ha

ng

e (

Re

lati

ve

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human ALB Expression B)

0

0.1

0.2

0.3

0.4

0.5

0.6

600 1200 4600

Fo

ld C

ha

ng

e (

Re

lati

ve

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human HNF4α Expression A)

Fig.9) Hepatocyte Phenotypic Marker Expression- RT-qPCR measured expression of the

hepatic markers A) HNF4α and B) albumin in primary human hepatocytes on liver ECM

supplemented HA gels of varying gel stiffnesses relative to normal liver expression. Cells on the gel

stiffness of 4600 Pa had significantly lower expression of both markers compared to the 600 and

1200 Pa stiffnesses at day 7 post-seeding (**p<.01, ***p<.001, Student’s t test, n=3).

119

3.5 Stiffness Affects Cell Morphology and Structure through Cytoplasmic Kinase

Expression

To further characterize underlying mechanisms of primary hepatocyte

organization and morphology on various ECM gel stiffnesses, cell junction maintenance

was determined by RT-qPCR. Data was again normalized to expression in normal human

liver. Claudin-1 is an important protein in tight junction formation and maintenance in

epithelial cells. Primary hepatocytes grown on the 4600 Pa stiffness for 7 days expressed

the highest levels of claudin-1. Hepatocytes on all stiffnesses expressed claudin-1 at

levels greater than those measured in normal liver (Figure 11A).

Expression of occludin, another constituent of tight junctions, also proved to be

dependent on substrate stiffness, but in an inverse manner. Expression of occludin

decreased relative to stiffness, although all values were at or above levels of expression

seen in normal liver (Figure 11B). Taken together, the expression patterns of occludin

Fig.10) Hepatocyte Functional Output- ELISA measured albumin secretion of primary human

hepatocytes per well on ECM containing HA gels of varying stiffnesses at A) day 2 and B) day 7

post-seeding. Quantities were standardized for cell number by DNA quantity per well (*p<.05,

**p<.01, Student’s t test, n=12,).

0

0.5

1

1.5

2

2.5

600 1200 4600

g A

lbu

min

/g D

NA

Gel Stiffness (Pa)

Albumin Secretion- Day 2 A)

0

2

4

6

8

10

12

600 1200 4600

g A

lbu

min

/g D

NA

Gel Stiffness (Pa)

Albumin Secretion- Day 7 B)

120

and claudin-1 have alternative roles in adapting primary hepatocyte phenotype and

structure to substrate stiffness.

To determine the relationship between cell junction gene expression and integrin

sensing, RT-qPCR was used to analyze cytoplasmic kinase activation on varying

substrate stiffnesses. At early time points, cells expressed FAK and ILK similarly

regardless of substrate stiffness (data not shown). However, at 7 days post-seeding, the

highest expression levels of FAK and ILK were measured on the 600 Pa substrates

0

0.5

1

1.5

2

2.5

600 1200 4600Fo

ld C

ha

ng

e (

Re

lati

ve

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human Occludin Expression B)

0

1

2

3

4

5

6

7

8

600 1200 4600Fo

ld C

ha

ng

e (

Re

lati

ve

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human Claudin-1 Expression A)

0

1

2

3

4

5

600 1200 4600

Fo

ld C

ha

ng

e (

Rela

tive

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human ILK Expression D)

0

0.5

1

1.5

2

600 1200 4600Fo

ld C

ha

ng

e (

Rela

tive

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human FAK Expression C)

Fig.11) Expression of Cell Junction Molecules and Focal Adhesion Regulators- RT-qPCR

measured expression of A) Claudin-1, B) Occludin, C) FAK, and D) ILK in primary hepatocytes

grown on ECM containing HA gels of varying stiffnesses at 7 days post-seeding. Expression was

standardized relative to normal liver expression (*p<.05, Student’s t test, n=3).

121

Fig.12) A,C,E) FAK and (D,B,F) ILK staining was performed on primary

hepatocytes at day 7 post-seeding at 20x magnification. Mean ECM gel

stiffnesses were; A+B) 600 Pa, C+D) 1200 Pa, or E+F) 4600 Pa. FAK and

ILK stained in red, along with autofluorescent nuclei of dead cells. DAPI

counterstaining stained all nuclei in blue.

(Figure 11C-D). Hepatocytes grown on the 4600 Pa gels expressed FAK and ILK at

levels similar to and greater than physiological liver levels, respectively. On 600 and

1200 Pa stiffnesses, both kinases were expressed at higher than normal liver levels.

122

To correlate gene expression with protein expression, ICC for FAK and ILK was

performed on cells seeded in the same conditions and ECM gel stiffnesses. FAK staining

was most prominent at the leading edge of cells at the 600 Pa gel stiffness (Figure 12A).

Staining was also seen on the 1200 Pa stiffness (Figure 12B). Cell staining for ILK was

less specific, but showed increases on the 600 and 1200 Pa stiffness gels (Figure 12B and

Figure 12D).

3.6 Rho GTPase Expression Correlates with Cytoplasmic Kinase Overexpression and

Hepatocyte Morphology

Next, we quantified expression of vital downstream targets of FAK and ILK that

are responsible for initiating actin polarization and polymerization to alter cell

morphology. RT-qPCR was performed on ECM gels of varying stiffness to measure the

Rho GTPases; Rho, Rac, and CDC42. Similar to FAK and ILK, CDC42 expression was

highest in hepatocytes seeded on the 600 Pa gel stiffness (Figure 13A). In contrast, cells

on the 4600 Pa substrates expressed Rho at the highest levels (Figure 13B). Rac

expression was not altered with stiffness (Figure 13C).

123

4. Discussion

The challenge of maintaining primary hepatocyte phenotype in vitro has led to the

development of more advanced culture systems. Traditional cell culture methods utilizing

collagen coated tissue culture plastic experienced loss of primary hepatocyte viability and

function by 7 days post-seeding (16). Cells grown on substrates supplemented with

natural liver ECM maintain viability and function for extended time periods as compared

to these traditional substrates that contain a limited number of matrix proteins (6).

However, studies have yet to completely optimize methods for incorporating ECM into

culture substrates and the mechanical properties of these substrates. Development of liver

specific gels supplemented with ECM has been slowed by the lack of a reliable method

0

0.5

1

1.5

2

2.5

600 1200 4600Fo

ld C

ha

ng

e (

Re

lati

ve

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human CDC42 Expression A)

0

0.5

1

1.5

2

2.5

600 1200 4600Fo

ld C

ha

ng

e (

Rela

tive

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human Rac1 Expression C) Fig.13) Expression of the Cytoskeleton-

Regulating Rho GTPases- RT-qPCR

measured expression of the Rho GTPases;

A) CDC42, B) RhoA, and C) Rac1 in primary

hepatocytes grown on ECM containing HA

gels of varying stiffnesses at 7 days post-

seeding. Expression was standardized relative

to normal liver expression (*p<.05, Student’s t

test, n=3).

0

0.5

1

1.5

2

2.5

600 1200 4600Fo

ld C

ha

ng

e (

Re

lati

ve

to

Liv

er

Ex

pre

ss

ion

)

Gel Stiffness (Pa)

Human RhoA Expression B)

124

for purifying ECM that retained all of the bioregulatory properties of the native matrix.

Perfusion decellularization solved this problem by allowing selective removal of all of

the cellular components of a tissue, while leaving the remaining acellular material

relatively unperturbed and functional as characterized in Figure 1 and Figure 2 (10).

Initial attempts to incorporate cryomilled ECM into substrates yielded suboptimal

results. Powders accumulated in endosomes and compromised the health of the cells

(Figure 3). This build-up of phagocytosed matrix likely caused congestion of intracellular

lysosomes, vacuolization, and induction of apoptosis in highly endocytic hepatocytes (58-

60). Solubilization of the ECM allowed for easy integration into HA hydrogel substrates

and circumvented the negative effect that particulate ECM had on primary hepatocytes

(Figure 3). HA-based gels have also proven to be non-immunogenic following

implantation into experimental animals (11, 14), opening up the possibility to use these

substrates in future cell based therapies.

Preliminary studies with rat hepatocytes also showed greater viability, cell

aggregation, and expression of E-cadherin on ECM supplemented HA gels compared to

standard gels containing only collagen I gels or HA (Figure 4). These features are

especially important in primary hepatocytes, which rely on cell contacts and junction

formation for functional maintenance and cell polarity (61-63). E-cadherin (E-Cad) is a

calcium-dependent glycoprotein vital in epithelial intercellular adhesion, liver tissue

architecture, and hepatocyte functional maintenance (64, 65). This glycoprotein has also

been correlated with reduction in anoikis, or detachment related apoptosis, during culture

of primary hepatocytes (66) . Increased E-cadherin expression on our ECM gels indicates

the abilities of these substrates to support proper hepatocyte phenotype.

125

In our chief study with human cells, ECM supplementation of HA gels was shown

to positively affect primary hepatocyte attachment and viability. Inclusion of solubilized

ECM increased cell coverage of the gels at two of the three stiffnesses tested (Figure 8).

ECM contains several different molecules that promote cell adhesion. Many of these cell

attachment proteins interact with cell membrane integrins through Arg-Gly-Asp (RGD)

motifs. RGD-containing molecules include laminin, fibronectin, vitronectin, and several

of the collagen sub-types. (67). RGD peptides support survival of hepatocytes via the

beta1-integrin-ILK-pAkt pathway (68). The results of the current study indicate that a

strong correlation exists between supplementation of HA substrates with ECM and

integrin beta-1 expression, which may explain why liver ECM mediates efficient

hepatocyte attachment (Supplementary Figure 3) (68). Several other ligands or cell

adhesion molecules contribute to cell-ECM interactions, but promotion of integrin

expression clearly represents a key factor in forming and maintaining cell/substrate

attachment.

The mechanical properties of gel substrates also play a significant role in the

preservation of hepatocyte cell viability and function. Previous studies on hepatocellular

carcinoma cell lines showed increased proliferation on stiff polyacrylamide gels (defined

as 12 kPa) as compared to soft gels (1kPa) (24). A study on primary rat hepatocytes

compared growth on what was defined as soft (11 kPa), medium (27 kPa), and stiff (116

kPa) heparin gels (69). In that study, the softest gel was well above the stiffness of

normal liver, which has been reported by various groups as ranging anywhere from 1.5 to

8 kPa (19-24). The study concluded that “soft” gels promoted greater cell attachment,

better morphology, higher albumin output, and more robust cell aggregation (69).The

126

lack of consensus on normal liver stiffness likely arises from variations in tissue

preparation, instrumentation, and how the measurement was obtained. Similar

discrepancies exist in the reported stiffness of fibrotic livers, which have varied from 8

kPa to 75 kPa (20, 70-73). The variance in definitions of soft and stiff gel substrates

complicate the direct comparison of results among various studies. An internal control of

normal liver ECM was used in the current study, allowing for a point of reference that

takes into account the equipment and methods used.

The gels employed in the current study use different crosslinker formulations to

adjust gel stiffness, rather than varying the matrix concentration. This minimizes

potential confounding effects such as the number of bioactive sites, diffusion rates, and

gel swelling properties. The study’s goal was to determine an optimal stiffness range for

maintaining the viability and function of primary hepatocytes in the presence of normal

liver ECM. The two lower crosslinker concentrations produced sub-normal stiffnesses at

600 and 1200 Pa, which would be representative of matrix undergoing remodeling in

scenarios such as recovery from injury or during development. The highest gel stiffness

at 4600 Pa was marginally higher than what was measured as the average stiffness of

decellularized liver ECM (3000 Pa), but not significantly different. Intact liver tissue had

a significantly higher stiffness, which can be attributed to the presence of cells organized

within the structure. The decellularization process could potentially soften the isolated

liver ECM causing lower values than non-processed ECM (74). However, histological

analysis confirmed the presence of all major structural molecules, suggesting that any

difference in stiffness should be minimal (10). A more precise measurement of the

contribution of ECM to the total stiffness of specific tissues would be beneficial to organ

127

bioengineering strategies that use decellularized natural scaffolds. The three stiffnesses

used in the current study provide a good indication of interactions of primary human

hepatocytes cultured within a narrow, physiologically relevant stiffness range.

In the ECM supplemented gels, primary hepatocyte attachment and growth was

maximized at the 4600 Pa gel stiffness level. Attachment not only correlated with

increased presence of ligand sites, but also the stiffness of the substrate. Stiffer substrates,

in general, provide more stable attachment sites for cells (15). They also provide good

traction for cell motility, but hamper cell detachment. Soft substrates allow cells to detach

more easily, although they provide lower traction for cell migration (75, 76). Cells sense

stiffness through mechanosensing of strain on their cytoskeletons by “outside in

signaling” mechanisms (40, 77). These forces exerted on their cell structure trigger

changes in morphology and phenotype (78-80). Human hepatocytes on the two softer

ECM stiffnesses of 600 and 1200 Pa developed long protrusions and a disorganized

structure. Hepatocytes seeded on 4600 Pa gels exhibited an organized microstructure and

cuboidal morphology. These cells also developed actin stress fibers by day 7, which are

required for cell adhesion, cell junctions, and mechanotransduction (Figure 7). However,

a significant accumulation of stress fibers can eventually lead to phenotypic changes (79,

81). Cells seeded on HA gels without ECM did not display these same stiffness

dependent variations. It is possible that components of the ECM could affect the

activation state of cells and responsiveness to physical cues. In a time dependent manner,

results indicate that ECM supplementation and substrate stiffness both affect primary

hepatocyte attachment and morphology; the latter of which is determined by cytoskeletal

actin organization.

128

Increases in gel stiffness led to early increases in hepatocyte function on the ECM

gels. Greater stiffness improved total and normalized albumin secretion at day 2.

Normalized function of hepatocytes increased across all stiffness groups by day 7 post-

seeding. However, secretion on the 4600 Pa stiffness now matched albumin levels

measured on 1200 Pa gels. This correlated with a decrease on the 4600 Pa stiffness and

increase on 600 and 1200 Pa stiffnesses in gene expression of the hepatocyte markers

albumin and HNF4α. Cells may require time to establish themselves on a substrate before

modifying their gene expression levels and functional output. These data support the

notion that the highest metabolic function occurs on 4600 Pa gels, as shown by

hepatocyte plasma protein secretion at the earliest time point. However, over time a

slightly higher than physiological stiffness can lead to loss of phenotypic marker

expression, and function is surpassed by cells on a more intermediate stiffness. 600 and

1200 Pa stiffnesses could also promote active remodeling of the matrix to better suit

phenotypic maintenance after a certain period of time on the ECM substrates. These

alterations in cell function directly correlated with previously observed changes in

morphology. This association informed the design of experiments to study the

mechanisms of mechanosensing-induced cell signaling and the expression of cell junction

components.

As discussed previously, cell junction maintenance is vital for primary

hepatocytes function and polarity. Tight junctions are types of cell junctions that act as

chemical and electrical barriers, transduce cell/cell signals, and control permeability

across cell layers (82, 83). Claudin-1 is an integral component of epithelial tight

junctions. It has been shown to be critical to the maintenance of biliary function and the

129

prevention of epithelial-to-mesenchymal transition (EMT) (28, 82, 84, 85). Disruption of

claudin-1 expression can cause diseases such as neonatal sclerosing cholangitis, while

overexpression can restore tight junctions in fibrotic cells, resulting in restoration of cell

function (29, 86-88). The 4600 Pa gel stiffness promoted the greatest claudin-1

expression at the 7-day timepoint, correlating with more stable hepatocyte morphology.

Another component of tight junctions, occludin, responded to substrate stiffness

in a different manner. Cells expressed increased levels of occludin relative to normal liver

at all stiffness studied. However, in contrast to claudin-1 expression, occludin levels

decreased with increased gel stiffness. A threshold occludin level is required for

maintenance of cell polarity and morphology (89). Increased expression of occludin

promotes focal reorganization of tight junctions that leads to the formation of cell

protrusions which are critical for directional migration (30). The observed cell elongation

and increased occludin expression profiles at the 600 and 1200 Pa gel stiffnesses suggest

adoption of a pro-migratory phenotype observed previously at low substrate stiffnesses.

Two cytoplasmic kinases linked to cell junction organization and integrin-

mediated signaling, FAK and ILK, were also studied (90). FAK and ILK regulate cell

cytokine responses, cell growth, and cell viability (36, 91-93). They also modulate focal

adhesion turnover and formation of cell protrusion, which affect cell motility and

migration, by regulating the expression of the Rho GTPases: CDC42, Rac1, and RhoA

(30, 40, 77, 94, 95). Both ILK and FAK demonstrated increased gene expression at all

stiffness levels as compared to normal liver, while expression showed an inverse

correlation to gel stiffness. Expression levels were sufficient to allow survival at all

stiffness levels, but ICC showed marked increases in FAK expression and localization at

130

the leading edge of hepatocytes on the 600 Pa gel stiffness (Figure 12A). This result

reinforces previous studies which suggested FAK is required for assembly and direction

of the leading edge of motile cells (96). Greater expression of FAK, ILK, and occludin all

suggest adoption of a migratory phenotype at the lower stiffnesses of 600 and 1200 Pa.

This notion is further supported by measured upregulation of filopodia-initiating CDC42.

Decreases in FAK and increases in RhoA on 4600 Pa gels suggest favorable signaling for

establishment of focal adhesions, stress fiber formation, and cytoskeletal contraction (97).

Taken together, these results indicate stronger attachment and greater cytoskeleton

organization occur on gels at the 4600 Pa stiffness, while greater ability to detach and

move occurs on the softer gels of 600 and 1200 Pa. It is likely that the 1200 Pa gel

stiffness would allow for efficient hepatocyte migration, as both traction and

adhesion/release are in good balance. Understanding how cell morphology, attachment,

and migration are influenced by substrate stiffness and gel formulation are integral to the

design of cell substrates for cell based therapies and tissue engineering. Some

applications would require a static cell component, while others would benefit from

increased migratory potential for promoting cell organization and microarchitecture

remodeling.

Hepatocyte function was maximized at a specific stiffness depending on time in

culture. Future experiments could determine how longer time points or additional liver

cell types impact hepatocyte function in vitro at these particular ECM gel stiffnesses.

Additionally, regional variance in stiffness within a single organ should be taken into

account depending on the requirements of specific applications. There are also

implications for stiffness in models for aging and diseases, as these organs demonstrate

131

an accumulation of certain matrix components. Studies conducted by our group including

data in Figure 2 show that natural liver matrix has the potential to bind beneficial growth

factors such as hepatocyte growth factor (HGF) which can compensate for deficiencies

induced by inappropriate substrate stiffness and regulate function. A preliminary study

using isolated primary rat hepatocytes showed increased viability and cell junction

expression on 600 Pa ECM gels pretreated with EGF and HGF (Supplementary Figure 4).

Cell junction protein expression and localization vary according to cell type,

substrates stiffness, and growth factor microenvironment. Cadherins, integrins, and

growth factor receptors are transmembrane structures that form an interdependent

network of adaptor proteins, effector molecules, and cytoskeletal elements to regulate

signal transduction (98). Mechanical forces sensed by integrins of focal adhesion sites

lead to assembly or disassembly of cytoskeletal structures. Tension on the cytoskeleton

initiates conformational changes in cell-cell adhesions and growth factor receptors to

either promote or block cellular responses (99).

Many downstream cytoplasmic elements are also conserved between the various

transmembrane structures. In the case of HGF signaling, β-catenin complexes with both

the HGF receptor c-Met and E-cadherin. Results have varied on the effects of HGF

binding on E-cadherin expression. HGF induced E-cadherin loss and EMT in liver cells

during development and hepatocellular carcinomas leading to cell scattering or increased

tumor invasiveness (100-102). Studies which cultured primary hepatocytes showed

positive influences of HGF on E-cadherin expression and fibrosis prevention (103-105).

It has been theorized that polarized cells behave differently than other cell types because

of variances in the utilization and localization of β-catenin following HGF binding (106,

132

107). HGF-induced dissociation of β-catenin from c-Met could actually bolster the

formation of independent E-cadherin-β-catenin complexes and cell junctions in

hepatocytes seeded on certain substrate compositions and stiffnesses, which our data

possibly indicated (108).

Separate preliminary assays using human hepatic stellate cells demonstrated the

ability of stiffness to affect growth factor secretion and GAG production. Greater

stiffness led to increased GAG production by HSCs, while cells on lower stiffness levels

released higher quantities of HGF at day 2 post-seeding (Supplementary Figure 5). This

suggests that further refinement of both stiffness and substrate biochemical formulation

may be used to fine tune control of cell phenotype for specific therapeutic applications

and tissue engineering. Other factors such as substrate hydration kinetics and solute/ion

diffusion properties might also be modulated to control cell phenotype. A greater

understanding of how substrates and scaffolds influence cell phenotype would maximize

the efficacy of cell based therapies and would provide greater control of cells in tissue

engineering strategies.

5. Conclusions

HA substrates supplemented with solubilized liver ECM supported improved

growth factor binding capabilities, increased hepatocyte attachment and viability, and

increased phenotypic maintenance. These gels served as a solid foundation for studies of

liver interactions and cell function. Recreating the natural liver microenvironment in HA

hydrogels through supplementation with liver ECM revealed that hepatocyte function and

morphology changed over time based on substrate stiffness. Hepatocyte morphology and

133

expression profiles on sub-physiological stiffnesses of 600 and 1200 Pa were consistent

with cytoskeletal reorganization and filopodia formation. Gels at a higher stiffness of

4600 Pa had high metabolic and functional rates at early time points, but later developed

stress fibers and demonstrated a loss of hepatocyte gene expression. The optimal stiffness

for maintenance of long term primary hepatocyte function, in vitro, and in gel substrates

intended for the delivery of therapeutic cells is an intermediate stiffness between 1200

and 4600 Pa at the lower end of liver physiological limits.

6. Supplementary Figures

Supplementary Fig. 1) Growth factor binding comparison- Decellularized tissue was

incubated with EGF and HGF at a concentration of 500 ng/mL, and ELISAs quantified

growth factor binding. Residual growth factor amounts measured in non-treated samples

were subtracted. Sample measurements were standardized by DNA amount (**p>.01,

Student’s t test, n=6)

134

Supplementary Fig.2) RT-qPCR measured expression of A) HNF4α, B) SNAIL, and C) Claudin-1

in primary hepatocytes grown on ECM containing HA gels of varying stiffnesses at 2 days post-

seeding. No significant differences were found. D) SNAIL expression was also measured at day 7

post-seeding. Expression decreased from day 2, but no differences were found between stiffnesses.

Expression was standardized relative to normal liver expression (p>.05, Student’s t test, n=3).

135

Supplementary Fig. 3) A) RT-qPCR measured expression of integrin beta-1 in primary hepatocytes

grown on ECM containing HA gels of varying stiffnesses at 2 days post-seeding (n=3, Student’s t test,

*p<.05). B) Expression was also measured at day 7 post-seeding, averaged between all stiffnesses,

and compared between gels containing only HA and gels supplemented with ECM (n=9, Student’s t

test, *p<.05). All expression values were standardized relative to normal liver expression.

136

Supplementary Fig. 4) Primary rat hepatocytes were seeded for 2 days on 600 Pa HA gels

supplemented with liver ECM that were untreated or pretreated with combined solutions of

EGF and HGF. Calcein AM stained live cells green, or ethidium homodimer stained dead cells

red. Viability staining on A) untreated or B) pretreated ECM gels showed increased cell

viability with growth factor treatment. C) Cell attachment and D) E-cadherin expression also

increased on growth factor pretreated ECM gels (*p<.05, ***p<.001, DNA n=5, RT qPCR n=3)

137

Supplementary Fig. 5) Human HSCs were seeded for 2 days on HA gels supplemented with liver

ECM at mean stiffnesses of 600, 1200, and 4600 Pa. A) HGF levels per well were measured in the

media by ELISA. B) Total GAG production per well was measured by a colorimetric assay (*p<.05,

**p<.01, ***p<.001, HGF n=3, GAG n=5)

138

Works Cited

1. Atala A. Principles of regenerative medicine. 2nd ed. Amsterdam ; Boston: Elsevier, Academic Press; 2011. xix, 1182 p. p. 2. Bajaj P. Liver-assisting devices. Indian journal of anaesthesia. 2009;53(6):635-6. PubMed PMID: 20640088; PMCID: 2900070. 3. Baptista PM, Siddiqui MM, Lozier G, Rodriguez SR, Atala A, Soker S. The use of whole organ decellularization for the generation of a vascularized liver organoid. Hepatology. 2011:n/a-n/a. doi: 10.1002/hep.24067. 4. Ding YT, Shi XL. Bioartificial liver devices: Perspectives on the state of the art. Frontiers of medicine. 2011;5(1):15-9. doi: 10.1007/s11684-010-0110-x. PubMed PMID: 21088931. 5. Joly A, Desjardins JF, Fremond B, Desille M, Campion JP, Malledant Y, Lebreton Y, Semana G, Edwards-Levy F, Levy MC, Clement B. Survival, proliferation, and functions of porcine hepatocytes encapsulated in coated alginate beads: a step toward a reliable bioartificial liver. Transplantation. 1997;63(6):795-803. PubMed PMID: 9089217. 6. Hansen KC, Kiemele L, Maller O, O'Brien J, Shankar A, Fornetti J, Schedin P. An In-solution Ultrasonication-assisted Digestion Method for Improved Extracellular Matrix Proteome Coverage. Mol Cell Proteomics. 2009;8(7):1648-57. doi: DOI 10.1074/mcp.M900039-MCP200. PubMed PMID: WOS:000267960300015. 7. Zhou P, Lessa N, Estrada DC, Severson EB, Lingala S, Zern MA, Nolta JA, Wu JA. Decellularized Liver Matrix as a Carrier for the Transplantation of Human Fetal and Primary Hepatocytes in Mice. Liver Transplant. 2011;17(4):418-27. doi: Doi 10.1002/Lt.22270. PubMed PMID: WOS:000289004000009. 8. Skardal A, Smith L, Bharadwaj S, Atala A, Soker S, Zhang Y. Tissue specific synthetic ECM hydrogels for 3-D in vitro maintenance of hepatocyte function. Biomaterials. 2012;33(18):4565-75. doi: 10.1016/j.biomaterials.2012.03.034. PubMed PMID: 22475531; PMCID: 3719050. 9. Nakamura S, Ijima H. Solubilized matrix derived from decellularized liver as a growth factor-immobilizable scaffold for hepatocyte culture. J Biosci Bioeng. 2013;116(6):746-53. doi: DOI 10.1016/j.jbiosc.2013.05.031. PubMed PMID: WOS:000329087800016. 10. Shupe T, Williams M, Brown A, Willenberg B, Petersen BE. Method for the decellularization of intact rat liver. Organogenesis. 2010;6(2):134-6. PubMed PMID: 20885860; PMCID: 2901817. 11. Mirmalek-Sani SH, Sullivan DC, Zimmerman C, Shupe TD, Petersen BE. Immunogenicity of decellularized porcine liver for bioengineered hepatic tissue. Am J Pathol. 2013;183(2):558-65. doi: 10.1016/j.ajpath.2013.05.002. PubMed PMID: 23747949; PMCID: 3730770. 12. Zhang Y, He Y, Bharadwaj S, Hammam N, Carnagey K, Myers R, Atala A, Van Dyke M. Tissue-specific extracellular matrix coatings for the promotion of cell proliferation and maintenance of cell phenotype. Biomaterials. 2009;30(23-24):4021-8. doi: 10.1016/j.biomaterials.2009.04.005. PubMed PMID: 19410290. 13. DeQuach JA, Mezzano V, Miglani A, Lange S, Keller GM, Sheikh F, Christman KL. Simple and high yielding method for preparing tissue specific extracellular matrix coatings for cell culture. PLoS One. 2010;5(9):e13039. doi: 10.1371/journal.pone.0013039. PubMed PMID: 20885963; PMCID: 2946408. 14. Murphy SV, Skardal A, Atala A. Evaluation of hydrogels for bio-printing applications. J Biomed Mater Res A. 2013;101(1):272-84. doi: 10.1002/jbm.a.34326. PubMed PMID: 22941807. 15. Wells RG. The role of matrix stiffness in regulating cell behavior. Hepatology. 2008;47(4):1394-400. doi: 10.1002/hep.22193. PubMed PMID: 18307210.

139

16. Hansen LK, Wilhelm J, Fassett JT. Regulation of hepatocyte cell cycle progression and differentiation by type I collagen structure. Current topics in developmental biology. 2006;72:205-36. doi: 10.1016/S0070-2153(05)72004-4. PubMed PMID: 16564336. 17. Semler EJ, Ranucci CS, Moghe PV. Mechanochemical manipulation of hepatocyte aggregation can selectively induce or repress liver-specific function. Biotechnol Bioeng. 2000;69(4):359-69. PubMed PMID: 10862674. 18. Zaman MH, Kamm RD, Matsudaira P, Lauffenburger DA. Computational model for cell migration in three-dimensional matrices. Biophys J. 2005;89(2):1389-97. doi: 10.1529/biophysj.105.060723. PubMed PMID: 15908579; PMCID: 1366623. 19. Fung J, Lee CK, Chan M, Seto WK, Wong DK, Lai CL, Yuen MF. Defining normal liver stiffness range in a normal healthy Chinese population without liver disease. PLoS One. 2013;8(12):e85067. doi: 10.1371/journal.pone.0085067. PubMed PMID: 24386446; PMCID: 3873442. 20. Mueller S, Sandrin L. Liver stiffness: a novel parameter for the diagnosis of liver disease. Hepatic medicine : evidence and research. 2010;2:49-67. PubMed PMID: 24367208; PMCID: 3846375. 21. Arena U, Vizzutti F, Corti G, Ambu S, Stasi C, Bresci S, Moscarella S, Boddi V, Petrarca A, Laffi G, Marra F, Pinzani M. Acute viral hepatitis increases liver stiffness values measured by transient elastography. Hepatology. 2008;47(2):380-4. doi: 10.1002/hep.22007. PubMed PMID: 18095306. 22. Klatt D, Friedrich C, Korth Y, Vogt R, Braun J, Sack I. Viscoelastic properties of liver measured by oscillatory rheometry and multifrequency magnetic resonance elastography. Biorheology. 2010;47(2):133-41. doi: 10.3233/BIR-2010-0565. PubMed PMID: 20683156. 23. Millonig G, Reimann FM, Friedrich S, Fonouni H, Mehrabi A, Buchler MW, Seitz HK, Mueller S. Extrahepatic cholestasis increases liver stiffness (FibroScan) irrespective of fibrosis. Hepatology. 2008;48(5):1718-23. doi: 10.1002/hep.22577. PubMed PMID: 18836992. 24. Schrader J, Gordon-Walker TT, Aucott RL, van Deemter M, Quaas A, Walsh S, Benten D, Forbes SJ, Wells RG, Iredale JP. Matrix stiffness modulates proliferation, chemotherapeutic response, and dormancy in hepatocellular carcinoma cells. Hepatology. 2011;53(4):1192-205. doi: 10.1002/hep.24108. PubMed PMID: 21442631; PMCID: 3076070. 25. Vinken M, Papeleu P, Snykers S, De Rop E, Henkens T, Chipman JK, Rogiers V, Vanhaecke T. Involvement of cell junctions in hepatocyte culture functionality. Crit Rev Toxicol. 2006;36(4):299-318. doi: 10.1080/10408440600599273. PubMed PMID: 16809101. 26. Lee NP, Luk JM. Hepatic tight junctions: from viral entry to cancer metastasis. World journal of gastroenterology : WJG. 2010;16(3):289-95. PubMed PMID: 20082472; PMCID: 2807947. 27. Balda MS, Matter K. Tight junctions at a glance. J Cell Sci. 2008;121(Pt 22):3677-82. doi: 10.1242/jcs.023887. PubMed PMID: 18987354. 28. Kojima T, Sawada N. Expression and function of claudins in hepatocytes. Methods in molecular biology. 2011;762:233-44. doi: 10.1007/978-1-61779-185-7_16. PubMed PMID: 21717360. 29. Gunzel D, Yu AS. Claudins and the modulation of tight junction permeability. Physiol Rev. 2013;93(2):525-69. doi: 10.1152/physrev.00019.2012. PubMed PMID: 23589827; PMCID: 3768107. 30. Du D, Xu F, Yu L, Zhang C, Lu X, Yuan H, Huang Q, Zhang F, Bao H, Jia L, Wu X, Zhu X, Zhang X, Zhang Z, Chen Z. The tight junction protein, occludin, regulates the directional migration of epithelial cells. Dev Cell. 2010;18(1):52-63. doi: 10.1016/j.devcel.2009.12.008. PubMed PMID: 20152177.

140

31. Rao R. Occludin phosphorylation in regulation of epithelial tight junctions. Ann N Y Acad Sci. 2009;1165:62-8. doi: 10.1111/j.1749-6632.2009.04054.x. PubMed PMID: 19538289. 32. Van Itallie CM, Fanning AS, Holmes J, Anderson JM. Occludin is required for cytokine-induced regulation of tight junction barriers. J Cell Sci. 2010;123(Pt 16):2844-52. doi: 10.1242/jcs.065581. PubMed PMID: 20663912; PMCID: 2915885. 33. Ilic D, Almeida EA, Schlaepfer DD, Dazin P, Aizawa S, Damsky CH. Extracellular matrix survival signals transduced by focal adhesion kinase suppress p53-mediated apoptosis. J Cell Biol. 1998;143(2):547-60. PubMed PMID: 9786962; PMCID: 2132850. 34. Dedhar S, Williams B, Hannigan G. Integrin-linked kinase (ILK): a regulator of integrin and growth-factor signalling. Trends Cell Biol. 1999;9(8):319-23. PubMed PMID: 10407411. 35. Su JM, Wang LY, Liang YL, Zha XL. Role of cell adhesion signal molecules in hepatocellular carcinoma cell apoptosis. World journal of gastroenterology : WJG. 2005;11(30):4667-73. PubMed PMID: 16094707. 36. Persad S, Attwell S, Gray V, Delcommenne M, Troussard A, Sanghera J, Dedhar S. Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTEN-mutant prostate cancer cells. Proc Natl Acad Sci U S A. 2000;97(7):3207-12. doi: 10.1073/pnas.060579697. PubMed PMID: 10716737; PMCID: 16217. 37. Wu C, Dedhar S. Integrin-linked kinase (ILK) and its interactors: a new paradigm for the coupling of extracellular matrix to actin cytoskeleton and signaling complexes. J Cell Biol. 2001;155(4):505-10. doi: 10.1083/jcb.200108077. PubMed PMID: 11696562; PMCID: 2198863. 38. Fabry B, Klemm AH, Kienle S, Schaffer TE, Goldmann WH. Focal adhesion kinase stabilizes the cytoskeleton. Biophys J. 2011;101(9):2131-8. doi: 10.1016/j.bpj.2011.09.043. PubMed PMID: 22067150; PMCID: 3207160. 39. Mitra SK, Hanson DA, Schlaepfer DD. Focal adhesion kinase: in command and control of cell motility. Nat Rev Mol Cell Biol. 2005;6(1):56-68. doi: 10.1038/nrm1549. PubMed PMID: 15688067. 40. Li S, Guan JL, Chien S. Biochemistry and biomechanics of cell motility. Annu Rev Biomed Eng. 2005;7:105-50. doi: 10.1146/annurev.bioeng.7.060804.100340. PubMed PMID: 16004568. 41. Nobes CD, Hall A. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell. 1995;81(1):53-62. PubMed PMID: 7536630. 42. Mayor R, Carmona-Fontaine C. Keeping in touch with contact inhibition of locomotion. Trends Cell Biol. 2010;20(6):319-28. doi: 10.1016/j.tcb.2010.03.005. PubMed PMID: 20399659; PMCID: 2927909. 43. Schneider S, Weydig C, Wessler S. Targeting focal adhesions:Helicobacter pylori-host communication in cell migration. Cell Commun Signal. 2008;6:2. doi: 10.1186/1478-811X-6-2. PubMed PMID: 18684322; PMCID: 2517590. 44. Takai Y, Sasaki T, Matozaki T. Small GTP-binding proteins. Physiol Rev. 2001;81(1):153-208. PubMed PMID: 11152757. 45. Shupe TD, Piscaglia AC, Oh SH, Gasbarrini A, Petersen BE. Isolation and characterization of hepatic stem cells, or "oval cells," from rat livers. Methods in molecular biology. 2009;482:387-405. doi: 10.1007/978-1-59745-060-7_24. PubMed PMID: 19089369; PMCID: 3130598. 46. Lison L. Alcian blue 8 G with chlorantine fast red 5 B.A technic for selective staining of mycopolysaccharides. Stain Technol. 1954;29(3):131-8. PubMed PMID: 13156798. 47. Zheng Shu X, Liu Y, Palumbo FS, Luo Y, Prestwich GD. In situ crosslinkable hyaluronan hydrogels for tissue engineering. Biomaterials. 2004;25(7-8):1339-48. PubMed PMID: 14643608.

141

48. Shu XZ, Ahmad S, Liu Y, Prestwich GD. Synthesis and evaluation of injectable, in situ crosslinkable synthetic extracellular matrices for tissue engineering. J Biomed Mater Res A. 2006;79(4):902-12. doi: 10.1002/jbm.a.30831. PubMed PMID: 16941590. 49. Skardal A, Devarasetty M, Kang HW, Mead I, Bishop C, Shupe T, Lee SJ, Jackson J, Yoo J, Soker S, Atala A. A hydrogel bioink toolkit for mimicking native tissue biochemical and mechanical properties in bioprinted tissue constructs. Acta Biomater. 2015. doi: 10.1016/j.actbio.2015.07.030. PubMed PMID: 26210285. 50. Skardal A, Zhang J, McCoard L, Oottamasathien S, Prestwich GD. Dynamically crosslinked gold nanoparticle - hyaluronan hydrogels. Adv Mater. 2010;22(42):4736-40. Epub 2010/08/24. doi: 10.1002/adma.201001436. PubMed PMID: 20730818. 51. Skardal A, Zhang J, McCoard L, Xu X, Oottamasathien S, Prestwich GD. Photocrosslinkable hyaluronan-gelatin hydrogels for two-step bioprinting. Tissue Eng Part A. 2010;16(8):2675-85. doi: 10.1089/ten.TEA.2009.0798. PubMed PMID: 20387987; PMCID: 3135254. 52. Skardal A, Zhang J, Prestwich GD. Bioprinting vessel-like constructs using hyaluronan hydrogels crosslinked with tetrahedral polyethylene glycol tetracrylates. Biomaterials. 2010;31(24):6173-81. Epub 2010/06/16. doi: S0142-9612(10)00561-2 [pii]

10.1016/j.biomaterials.2010.04.045. PubMed PMID: 20546891. 53. Meyers MA, Chawla KK. Mechanical behavior of materials. Upper Saddle River, N.J.: Prentice Hall; 1999. xv, 680 p. p. 54. Swift B, Brouwer KL. Influence of seeding density and extracellular matrix on bile Acid transport and mrp4 expression in sandwich-cultured mouse hepatocytes. Mol Pharm. 2010;7(2):491-500. doi: 10.1021/mp900227a. PubMed PMID: 19968322; PMCID: 3235796. 55. Khetani SR, Bhatia SN. Microscale culture of human liver cells for drug development. Nat Biotechnol. 2008;26(1):120-6. doi: 10.1038/nbt1361. PubMed PMID: 18026090. 56. D'Costa ZJ, Jolly C, Androphy EJ, Mercer A, Matthews CM, Hibma MH. Transcriptional repression of E-cadherin by human papillomavirus type 16 E6. PLoS One. 2012;7(11):e48954. doi: 10.1371/journal.pone.0048954. PubMed PMID: 23189137; PMCID: 3506579. 57. Dingemans AM, van den Boogaart V, Vosse BA, van Suylen RJ, Griffioen AW, Thijssen VL. Integrin expression profiling identifies integrin alpha5 and beta1 as prognostic factors in early stage non-small cell lung cancer. Molecular cancer. 2010;9:152. doi: 10.1186/1476-4598-9-152. PubMed PMID: 20565758; PMCID: 2895598. 58. Pol A, Calvo M, Lu A, Enrich C. The "early-sorting" endocytic compartment of rat hepatocytes is involved in the intracellular pathway of caveolin-1 (VIP-21). Hepatology. 1999;29(6):1848-57. doi: 10.1002/hep.510290602. PubMed PMID: 10347129. 59. Wall DA, Hubbard AL. Receptor-mediated endocytosis of asialoglycoproteins by rat liver hepatocytes: biochemical characterization of the endosomal compartments. J Cell Biol. 1985;101(6):2104-12. PubMed PMID: 2866191; PMCID: 2114009. 60. Cao H, Krueger EW, McNiven MA. Hepatocytes internalize trophic receptors at large endocytic "Hot Spots". Hepatology. 2011;54(5):1819-29. doi: 10.1002/hep.24572. PubMed PMID: 21793030; PMCID: 3205295. 61. Treyer A, Musch A. Hepatocyte polarity. Compr Physiol. 2013;3(1):243-87. doi: 10.1002/cphy.c120009. PubMed PMID: 23720287; PMCID: 3697931. 62. Theard D, Steiner M, Kalicharan D, Hoekstra D, van Ijzendoorn SC. Cell polarity development and protein trafficking in hepatocytes lacking E-cadherin/beta-catenin-based adherens junctions. Mol Biol Cell. 2007;18(6):2313-21. doi: 10.1091/mbc.E06-11-1040. PubMed PMID: 17429067; PMCID: 1877101.

142

63. Giepmans BN, van Ijzendoorn SC. Epithelial cell-cell junctions and plasma membrane domains. Biochim Biophys Acta. 2009;1788(4):820-31. doi: 10.1016/j.bbamem.2008.07.015. PubMed PMID: 18706883. 64. Miyoshi A, Kitajima Y, Sumi K, Sato K, Hagiwara A, Koga Y, Miyazaki K. Snail and SIP1 increase cancer invasion by upregulating MMP family in hepatocellular carcinoma cells. British journal of cancer. 2004;90(6):1265-73. doi: 10.1038/sj.bjc.6601685. PubMed PMID: 15026811; PMCID: 2409652. 65. Brieva TA, Moghe PV. Functional engineering of hepatocytes via heterocellular presentation of a homoadhesive molecule, E-cadherin. Biotechnol Bioeng. 2001;76(4):295-302. PubMed PMID: 11745156. 66. Luebke-Wheeler JL, Nedredal G, Yee L, Amiot BP, Nyberg SL. E-cadherin protects primary hepatocyte spheroids from cell death by a caspase-independent mechanism. Cell transplantation. 2009;18(12):1281-7. doi: 10.3727/096368909X474258. PubMed PMID: 20003757; PMCID: 2920600. 67. Ruoslahti E. RGD and other recognition sequences for integrins. Annual review of cell and developmental biology. 1996;12:697-715. doi: 10.1146/annurev.cellbio.12.1.697. PubMed PMID: 8970741. 68. Pinkse GG, Jiawan-Lalai R, Bruijn JA, de Heer E. RGD peptides confer survival to hepatocytes via the beta1-integrin-ILK-pAkt pathway. J Hepatol. 2005;42(1):87-93. doi: 10.1016/j.jhep.2004.09.010. PubMed PMID: 15629512. 69. You J, Park SA, Shin DS, Patel D, Raghunathan VK, Kim M, Murphy CJ, Tae G, Revzin A. Characterizing the effects of heparin gel stiffness on function of primary hepatocytes. Tissue Eng Part A. 2013;19(23-24):2655-63. doi: 10.1089/ten.TEA.2012.0681. PubMed PMID: 23815179; PMCID: 3856597. 70. Kim M, Lee JY, Jones CN, Revzin A, Tae G. Heparin-based hydrogel as a matrix for encapsulation and cultivation of primary hepatocytes. Biomaterials. 2010;31(13):3596-603. doi: 10.1016/j.biomaterials.2010.01.068. PubMed PMID: 20153045; PMCID: 2837121. 71. Foucher J, Chanteloup E, Vergniol J, Castera L, Le Bail B, Adhoute X, Bertet J, Couzigou P, de Ledinghen V. Diagnosis of cirrhosis by transient elastography (FibroScan): a prospective study. Gut. 2006;55(3):403-8. doi: 10.1136/gut.2005.069153. PubMed PMID: 16020491; PMCID: 1856085. 72. Wong VW, Vergniol J, Wong GL, Foucher J, Chan HL, Le Bail B, Choi PC, Kowo M, Chan AW, Merrouche W, Sung JJ, de Ledinghen V. Diagnosis of fibrosis and cirrhosis using liver stiffness measurement in nonalcoholic fatty liver disease. Hepatology. 2010;51(2):454-62. doi: 10.1002/hep.23312. PubMed PMID: 20101745. 73. Ganne-Carrie N, Ziol M, de Ledinghen V, Douvin C, Marcellin P, Castera L, Dhumeaux D, Trinchet JC, Beaugrand M. Accuracy of liver stiffness measurement for the diagnosis of cirrhosis in patients with chronic liver diseases. Hepatology. 2006;44(6):1511-7. doi: 10.1002/hep.21420. PubMed PMID: 17133503. 74. Evans DW, Moran EC, Baptista PM, Soker S, Sparks JL. Scale-dependent mechanical properties of native and decellularized liver tissue. Biomech Model Mechanobiol. 2013;12(3):569-80. doi: 10.1007/s10237-012-0426-3. PubMed PMID: 22890366. 75. Solon J, Levental I, Sengupta K, Georges PC, Janmey PA. Fibroblast adaptation and stiffness matching to soft elastic substrates. Biophys J. 2007;93(12):4453-61. doi: 10.1529/biophysj.106.101386. PubMed PMID: 18045965; PMCID: 2098710. 76. Lo CM, Wang HB, Dembo M, Wang YL. Cell movement is guided by the rigidity of the substrate. Biophysical Journal. 2000;79(1):144-52. PubMed PMID: WOS:000088048500011.

143

77. Discher DE, Janmey P, Wang YL. Tissue cells feel and respond to the stiffness of their substrate. Science. 2005;310(5751):1139-43. doi: 10.1126/science.1116995. PubMed PMID: 16293750. 78. Engler AJ, Sweeney HL, Discher DE, Schwarzbauer JE. Extracellular matrix elasticity directs stem cell differentiation. J Musculoskelet Neuronal Interact. 2007;7(4):335. PubMed PMID: 18094500. 79. Engler AJ, Sen S, Sweeney HL, Discher DE. Matrix elasticity directs stem cell lineage specification. Cell. 2006;126(4):677-89. doi: 10.1016/j.cell.2006.06.044. PubMed PMID: 16923388. 80. Yeung T, Georges PC, Flanagan LA, Marg B, Ortiz M, Funaki M, Zahir N, Ming W, Weaver V, Janmey PA. Effects of substrate stiffness on cell morphology, cytoskeletal structure, and adhesion. Cell Motil Cytoskeleton. 2005;60(1):24-34. doi: 10.1002/cm.20041. PubMed PMID: 15573414. 81. Kumar S, Maxwell IZ, Heisterkamp A, Polte TR, Lele TP, Salanga M, Mazur E, Ingber DE. Viscoelastic retraction of single living stress fibers and its impact on cell shape, cytoskeletal organization, and extracellular matrix mechanics. Biophys J. 2006;90(10):3762-73. doi: 10.1529/biophysj.105.071506. PubMed PMID: 16500961; PMCID: 1440757. 82. Martin TA, Jiang WG. Loss of tight junction barrier function and its role in cancer metastasis. Biochim Biophys Acta. 2009;1788(4):872-91. doi: 10.1016/j.bbamem.2008.11.005. PubMed PMID: 19059202. 83. Maly IP, Landmann L. Bile duct ligation in the rat causes upregulation of ZO-2 and decreased colocalization of claudins with ZO-1 and occludin. Histochemistry and cell biology. 2008;129(3):289-99. doi: 10.1007/s00418-007-0374-7. PubMed PMID: 18197414. 84. Kojima T, Takano K, Yamamoto T, Murata M, Son S, Imamura M, Yamaguchi H, Osanai M, Chiba H, Himi T, Sawada N. Transforming growth factor-beta induces epithelial to mesenchymal transition by down-regulation of claudin-1 expression and the fence function in adult rat hepatocytes. Liver Int. 2008;28(4):534-45. doi: 10.1111/j.1478-3231.2007.01631.x. PubMed PMID: 18031476. 85. Osanai M, Nishikiori N, Murata M, Chiba H, Kojima T, Sawada N. Occludin expression inhibits tumorigenicity and metastasis. Faseb J. 2006;20(4):A223-A. PubMed PMID: WOS:000236206501489. 86. Hadj-Rabia S, Baala L, Vabres P, Hamel-Teillac D, Jacquemin E, Fabre M, Lyonnet S, De Prost Y, Munnich A, Hadchouel M, Smahi A. Claudin-1 gene mutations in neonatal sclerosing cholangitis associated with ichthyosis: a tight junction disease. Gastroenterology. 2004;127(5):1386-90. PubMed PMID: 15521008. 87. Grosse B, Cassio D, Yousef N, Bernardo C, Jacquemin E, Gonzales E. Claudin-1 involved in neonatal ichthyosis sclerosing cholangitis syndrome regulates hepatic paracellular permeability. Hepatology. 2012;55(4):1249-59. doi: Doi 10.1002/Hep.24761. PubMed PMID: WOS:000302069900028. 88. Ikenouchi J, Matsuda M, Furuse M, Tsukita S. Regulation of tight junctions during the epithelium-mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. Journal of Cell Science. 2003;116(10):1959-67. doi: DOI 10.1242/jcs.00389. PubMed PMID: WOS:000183098900011. 89. Ando-Akatsuka Y, Yonemura S, Itoh M, Furuse M, Tsukita S. Differential behavior of E-cadherin and occludin in their colocalization with ZO-1 during the establishment of epithelial cell polarity. J Cell Physiol. 1999;179(2):115-25. doi: 10.1002/(SICI)1097-4652(199905)179:2<115::AID-JCP1>3.0.CO;2-T. PubMed PMID: 10199550.

144

90. Dorfel MJ, Huber O. Modulation of tight junction structure and function by kinases and phosphatases targeting occludin. Journal of biomedicine & biotechnology. 2012;2012:807356. doi: 10.1155/2012/807356. PubMed PMID: 22315516; PMCID: 3270569. 91. Hehlgans S, Haase M, Cordes N. Signalling via integrins: implications for cell survival and anticancer strategies. Biochim Biophys Acta. 2007;1775(1):163-80. doi: 10.1016/j.bbcan.2006.09.001. PubMed PMID: 17084981. 92. Horowitz JC, Rogers DS, Sharma V, Vittal R, White ES, Cui Z, Thannickal VJ. Combinatorial activation of FAK and AKT by transforming growth factor-beta1 confers an anoikis-resistant phenotype to myofibroblasts. Cell Signal. 2007;19(4):761-71. doi: 10.1016/j.cellsig.2006.10.001. PubMed PMID: 17113264; PMCID: 1820832. 93. Frisch SM, Schaller M, Cieply B. Mechanisms that link the oncogenic epithelial-mesenchymal transition to suppression of anoikis. J Cell Sci. 2013;126(Pt 1):21-9. doi: 10.1242/jcs.120907. PubMed PMID: 23516327; PMCID: 3603508. 94. Hsia DA, Mitra SK, Hauck CR, Streblow DN, Nelson JA, Ilic D, Huang S, Li E, Nemerow GR, Leng J, Spencer KS, Cheresh DA, Schlaepfer DD. Differential regulation of cell motility and invasion by FAK. J Cell Biol. 2003;160(5):753-67. doi: 10.1083/jcb.200212114. PubMed PMID: 12615911; PMCID: 2173366. 95. Hildebrand JD, Taylor JM, Parsons JT. An SH3 domain-containing GTPase-activating protein for Rho and Cdc42 associates with focal adhesion kinase. Mol Cell Biol. 1996;16(6):3169-78. PubMed PMID: 8649427; PMCID: 231310. 96. Tilghman RW, Slack-Davis JK, Sergina N, Martin KH, Iwanicki M, Hershey ED, Beggs HE, Reichardt LF, Parsons JT. Focal adhesion kinase is required for the spatial organization of the leading edge in migrating cells. J Cell Sci. 2005;118(Pt 12):2613-23. doi: 10.1242/jcs.02380. PubMed PMID: 15914540. 97. Ren XD, Kiosses WB, Sieg DJ, Otey CA, Schlaepfer DD, Schwartz MA. Focal adhesion kinase suppresses Rho activity to promote focal adhesion turnover. J Cell Sci. 2000;113 ( Pt 20):3673-8. PubMed PMID: 11017882. 98. Weber GF, Bjerke MA, DeSimone DW. Integrins and cadherins join forces to form adhesive networks. J Cell Sci. 2011;124(Pt 8):1183-93. doi: 10.1242/jcs.064618. PubMed PMID: 21444749; PMCID: 3115772. 99. Ingber DE. Cellular mechanotransduction: putting all the pieces together again. Faseb J. 2006;20(7):811-27. doi: 10.1096/fj.05-5424rev. PubMed PMID: 16675838. 100. Ogunwobi OO, Liu C. Hepatocyte growth factor upregulation promotes carcinogenesis and epithelial-mesenchymal transition in hepatocellular carcinoma via Akt and COX-2 pathways. Clinical & experimental metastasis. 2011;28(8):721-31. doi: 10.1007/s10585-011-9404-x. PubMed PMID: 21744257; PMCID: 3732749. 101. Nagai T, Arao T, Furuta K, Sakai K, Kudo K, Kaneda H, Tamura D, Aomatsu K, Kimura H, Fujita Y, Matsumoto K, Saijo N, Kudo M, Nishio K. Sorafenib inhibits the hepatocyte growth factor-mediated epithelial mesenchymal transition in hepatocellular carcinoma. Molecular cancer therapeutics. 2011;10(1):169-77. doi: 10.1158/1535-7163.MCT-10-0544. PubMed PMID: 21220499. 102. Mangold S, Wu SK, Norwood SJ, Collins BM, Hamilton NA, Thorn P, Yap AS. Hepatocyte growth factor acutely perturbs actin filament anchorage at the epithelial zonula adherens. Current biology : CB. 2011;21(6):503-7. doi: 10.1016/j.cub.2011.02.018. PubMed PMID: 21396819. 103. Jones CN, Tuleuova N, Lee JY, Ramanculov E, Reddi AH, Zern MA, Revzin A. Cultivating hepatocytes on printed arrays of HGF and BMP7 to characterize protective effects of these

145

growth factors during in vitro alcohol injury. Biomaterials. 2010;31(23):5936-44. doi: 10.1016/j.biomaterials.2010.04.006. PubMed PMID: 20488537; PMCID: 2893270. 104. Liu Y. Hepatocyte growth factor in kidney fibrosis: therapeutic potential and mechanisms of action. American journal of physiology Renal physiology. 2004;287(1):F7-16. doi: 10.1152/ajprenal.00451.2003. PubMed PMID: 15180923. 105. Yang J, Dai C, Liu Y. A novel mechanism by which hepatocyte growth factor blocks tubular epithelial to mesenchymal transition. Journal of the American Society of Nephrology : JASN. 2005;16(1):68-78. doi: 10.1681/ASN.2003090795. PubMed PMID: 15537870. 106. Monga SP, Mars WM, Pediaditakis P, Bell A, Mule K, Bowen WC, Wang X, Zarnegar R, Michalopoulos GK. Hepatocyte growth factor induces Wnt-independent nuclear translocation of beta-catenin after Met-beta-catenin dissociation in hepatocytes. Cancer Res. 2002;62(7):2064-71. PubMed PMID: 11929826. 107. Balkovetz DF, Pollack AL, Mostov KE. Hepatocyte growth factor alters the polarity of Madin-Darby canine kidney cell monolayers. J Biol Chem. 1997;272(6):3471-7. PubMed PMID: 9013593. 108. Apte U, Zeng G, Muller P, Tan X, Micsenyi A, Cieply B, Dai C, Liu Y, Kaestner KH, Monga SP. Activation of Wnt/beta-catenin pathway during hepatocyte growth factor-induced hepatomegaly in mice. Hepatology. 2006;44(4):992-1002. doi: 10.1002/hep.21317. PubMed PMID: 17006939.

146

CHAPTER 4

Conclusions and Future Work

Daniel B. Deegan

147

The field of regenerative medicine uses a variety of tools, technologies, and

advanced models to gain knowledge of disease mechanisms and to develop new therapies

and treatments. Each approach has a set of advantages and disadvantages depending on

the field of research. Three-dimensional liver spheroids, or organoids, recreate entire

organ systems on a miniature scale (1-5). Spheroids can be maintained in a variety of

substrates like hydrogels. In microfluidic devices, organoids are arranged in a circuit and

interact in a way that mimics how organ systems work together (6, 7). Consequently, they

are a great platform for toxicology and drug testing. Because of their longevity and long

term maintenance of function, testing can be carried out in vitro without the need for

complex in vivo models. However, organoids are not always suitable for ECM based

studies. These cell structures form tight junctions which prevent manipulation of ECM

composition and mechanical properties at the core of the organoids. Since cells only

sense ECM composition and mechanical forces in adjacent areas, these cell centers would

be relatively unaffected by substrate alterations.

Decellularized tissue is an excellent biomaterial for tissue engineering. Optimized

decellularization methods preserve ECM components in their native architecture and

maintain physiological proportions in the tissue. This scaffold material enables cells to

home to specific sites of the matrix and either sustain function or, in the cases of stem

cells, differentiate into appropriate cell phenotypes (8-10). However, challenges remain

in producing consistent decellularized products. The success of cell removal or the

remaining composition of the decellularized tissue can vary because of differences

between animals and differences in the size or vascularity of the organ. When designing

studies on small tissue segments, it can be hard to control for structural variances in the

148

tissue that may exist even within the same organ. Matrix samples used for cellular assays

that are excised from different regions of the organ, certain areas that are not fully

decellularized, or sections damaged by the perfusion process can create error or deviation

in the results. It is also difficult to precisely manipulate physical and chemical properties

of the intact matrix. Without a complete analysis and mapping of the tissue, methods to

initiate these changes could be unpredictable.

Hydrogel substrates are viable alternatives to intact decellularized tissue

constructs. Although no longer possessing the native microarchitecture, gels enable better

control and manipulation of individual substrate properties. The concentration of specific

molecules in the hydrogels can be controlled and altered. In the case of this thesis study,

ECM from decellularized tissue was solubilized and incorporated into HA gel substrates

to replicate a natural liver microenvironment. Since the matrix of the entire organs was

solubilized in a homogenous solution, there was little variability within the material. All

regions of the ECM and multiple liver samples were combined, stored, and utilized

across multiple assays, allowing for consistent composition of the substrates. ECM

molecules were also quantified to ensure that all assays used the same total concentration

of solubilized material, and there were similar ratios of structural and bioregulatory

molecules. This ability standardized substrate production and resulted in more consistent

results and less experimental error.

This thesis work demonstrates that HA gels supplemented with ECM provided

some of the same functional advantages for seeded cells as fully intact matrix scaffolds.

Use of ECM containing gels in past studies were shown to greatly improve long term

viability and function of culture of cells, as compared to traditional in vitro methods (11,

149

12). Our human hepatocyte assays showed increases in viability, adhesion, and cell

junction formation. To determine the mechanism for some of the improvements seen in

primary hepatocyte attachment and viability, expression of integrin β-1 was analyzed in

cells seeded on ECM supplemented gels versus cells on HA only gels. At day 7,

hepatocyte expression increased on gel substrates with the addition of liver matrix.

Although only one integrin class was measured, integrin β-1 may be the most

critical type for maintenance of cell function. Integrin β-1 is the most highly expressed

beta-integrin, dimerizing with more than 10 alpha-integrin subunits (13). These integrin

complexes directly interact with the actin cytoskeleton (14). Integrin β-1 expression

likely correlates with overall integrin expression in the presence of liver ECM and

explains the increases in hepatocyte attachment and viability relative to cells seeded on

simpler substrates. To establish this conclusion, expression of a greater variety of integrin

types could be analyzed. Varying concentrations of solubilized liver matrix could also be

used in substrate formation to determine if concentration dependent changes were

observed. As controls, certain integrins could also be blocked with increasing

concentrations of integrin-specific antibodies or RGD peptides in order to measure

reduction in binding or survival of the hepatocytes. Manipulations of the cells and the

adaptable gel substrate could help determine the most likely mechanisms for differences

observed.

Greater control of the composition of the substrate also correlates with better

control of the chemistry and physical properties of the material. These characteristics can

be adjusted by adding chemically-modified compounds to the substrate preparation.

Thiol-modified HA, heparin, and collagen were used for gel formation in our study. PEG-

150

acrylate crosslinker reacted with these moieties to solidify hydrogels and alter stiffness

within a narrow range. Uniform composition of our ECM supplemented gels allowed

creation of sample replicates at equivalent stiffness levels. Different concentrations and

configurations of the crosslinker also generated adjustable degrees of stiffness to

establish separate experimental groups. Crosslinking can vary the property of stiffness

without modifying the concentration of functional elements in the ECM substrates. These

advantages make ECM supplemented gels optimal for use in cell culture assays to

identify the effects of substrate stiffness variations.

Following the development and creation of liver ECM supplemented gels, this

thesis evaluated the effects of substrate stiffness on primary hepatocyte function. Results

revealed hepatocyte gene marker expression and the functional output of albumin varied

with stiffness and time in culture. In early time points, higher gel stiffness stimulated

greater metabolic activity and albumin output. However, after metabolic functions

stabilized for 7 days, hepatocytes grown on an intermediate stiffness of 1200 Pa produced

albumin at the greatest rate. This observation was correlated to a significant drop off in

gene expression of hepatic markers by cells on the highest stiffness of 4600 Pa. To test

the hypothesis that the highest 4600 Pa stiffness causes a loss in long term phenotype,

experiments could utilize time points past day 7. These assays would indicate if observed

variances in function and gene expression widen between cells seeded on the different

stiffnesses in the long term. It would also be relevant to examine if markers for EMT like

SNAIL were upregulated by cells on the highest stiffness group.

The balance between EMT and MET is vital in liver development and could

possibly have an integral role in liver repair and regeneration. It is theorized that

151

following injury, epithelial cells undergo EMT and travel to the mesenchyme to

proliferate and produce ECM molecules. These cells then differentiate into hepatocytes or

cholangiocytes to repopulate and restore the liver parenchyma (15). Imbalances in this

process can lead to increases in fibroblasts and a progression of disease (16). During liver

disease, many experts theorize that the stiffening ECM microenvironment promotes

additional EMT of hepatocytes and contributes to worsening fibrosis and eventual organ

failure (16). Our work has helped delineate a proper substrate stiffness for long term

maintenance of hepatocyte phenotype as well as a stiffness range where EMT could be

initiated. Future experiments could be designed using the liver ECM gels to further

replicate events of liver repair or liver disease in culture and study the delicate balance

between EMT and MET.

While studying the effects of stiffness on hepatocyte phenotype, assays were

designed to study the mechanisms behind observed changes in attachment, viability, and

morphology. Experiments monitored gene and protein expression of FAK and ILK, two

integrin-localized kinases with vital roles in mechanotransduction and cytoskeletal

remodeling. As previously discussed, hepatocytes on all gel stiffness expressed the FAK

and ILK genes at levels higher than cells of normal liver tissue. However, at day 7 post-

seeding, FAK and ILK gene and protein expression levels were highest in the lower

stiffness levels, with FAK concentrated at the leading edge of epithelial cell layers.

Although FAK and ILK have been shown to have effects on viability, trends we observed

seemed to correlate most closely with morphological changes in the hepatocytes,

specifically with formation of cellular projections.

152

Previous studies have shown FAK and ILK expression stimulates pathways

controlling cytoskeletal structures. In addition, overexpression of these kinases has been

observed in migrating cells. With this knowledge, expression of the downstream targets

and actin regulating Rho GTPases were measured to determine if differences in

cytoskeleton activation and regulation were occurring in human hepatocytes seeded on

ECM gels of varying stiffnesses. Cells expressed RhoA, which controls stress fiber

formation and contractility, on stiffer ECM gels and exhibited greater attachment and

assembly of actin fibers. CDC42, which initiates polarization and filopodia formation,

decreased with substrate stiffness. This result demonstrated how FAK, ILK, and CDC42

overexpression correlates with lower substrate stiffness, morphological changes, and

most likely, cell migration.

Further experimentation could help confirm detected morphological and

migratory trends and help strengthen our hypotheses. Determining exact mechanisms and

sites of FAK and ILK phosphorylation induced by substrate stiffness could help explain

the numerous functions of these kinases. Previous studies have shown blocking FAK and

ILK in cell culture assays may not be ideal because deficiencies in FAK and ILK lead to

reductions in viability. However, plasmid transfections could be used to upregulate FAK,

ILK, or CDC42 in primary hepatocytes, as has been successful in previous studies (17).

Site specific mutations could also be used to pinpoint the importance of specific

phosphorylation sites. RhoA could also be upregulated to determine if increased

expression initiates development of a more anchored phenotype with greater actin

expression. Induction of morphological effects similar to what was observed on the

varying gel stiffnesses would support our hypotheses and further implicate FAK, ILK,

153

and the Rho GTPases in the changes we observed. Hepatocyte culture experiments and

imaging specifically designed to track and map cell motility and migration throughout

time points past 7 days would also more definitively validate our theories.

In addition to analyzing the expression and localization of FAK, ILK, and the

Rho GTPases, additional targets related to mechanotransduction could be included. Src

tyrosine kinase binds to and phosphorylates various FAK sites. Several adaptor proteins

including PI3K, CAS, GRB7, and N-WASP associate with FAK and act as intermediates

between FAK and the Rho GTPases. Similar to FAK, ILK also stimulates the PI3K

pathway. Unique adaptor proteins of ILK include PINCH1 and ELMO2 which aid in

cellular polarization. Other focal adhesion components important to mechanosensing,

integrin attachment, and actin modification include talin, vinculin, and paxillin. Assays

testing expression and localization of all these proteins would provide a clearer

understanding of the interactions between ECM gel stiffness, substrate sensing, and the

regulation of the hepatocyte cytoskeleton and focal adhesion formation.

ECM composition and substrate stiffness play important roles in hepatocyte

phenotype; however, growth factor presence also represents a factor in determining the

fates of cells. Thesis studies have shown the ability of ECM gel substrates to bind active

growth factor for cellular use (Chapter 3- Figure 2). Future assays like phospho-labeling

will be required to pinpoint exact binding and interaction sites in the gels. Nevertheless,

the presented studies demonstrate the ability to manipulate the growth factor

concentration in the liver cell substrates. With these ECM supplemented gels, future

assays could be designed to measure how stiffness intensifies or reduces growth factor

effects on liver cells.

154

Preliminary studies exhibited the ability of HGF to bind to our liver hydrogels and

improve cell junction formation and hepatocyte function on low stiffness gels (Chapter 3-

Supplementary Figure 4). A previous publication showed similar results with HGF and

EGF-treated hepatocytes seeded on Matrigel of varying stiffnesses. Growth factor co-

stimulation improved aggregation and function on the lower stiffness, while the converse

occurred at the higher stiffness level (18). Additional experiments on HGF and EGF

stimulated epithelial cells implicated stiffness in cell polarization and migratory

responses (19-22). Other research has also shown the direct effects of substrate stiffness

on transforming growth factor beta (TGF-β)-induced dedifferentiation of hepatocytes and

possible EMT (23). Studies could be conducted to determine if these same changes occur

on our liver ECM gels. Further data could define the exact stiffness ranges that induce

these responses and the molecular mechanisms behind these behaviors.

Opportunities exist to improve both the complexity and overall function of the

hepatocyte cell culture system we have developed. Other cell types could be individually

seeded on the ECM supplemented substrates to test effects of stiffness on different cells

of the liver, or co-culture of multiple cell types could determine how they interact and

function in varied mechanical environments. Hepatic stellate cells (HSCs) are one of

most important liver cell types involved in ECM production and maintenance. HSCs exist

in either a quiescent or myofibroblast form. In vivo these cells are vital to both hepatocyte

and stem cell mediated regeneration and repair. They secrete and assemble ECM

molecules including fibronectin, collagens, and GAGs (24, 25). During a fibrotic disease

state, hepatic stellate cells deposit excess amounts of collagen, a process worsened by

myofibroblastic activation and proliferation on stiffening ECM. Several fields from

155

cancer biology to regenerative medicine also explored their ability to secrete growth

factors. Assays revealed HSCs produce HGF, EGF, TGFα, and multiple insulin-like

growth factor binding proteins within the liver (26-28).

Previous studies have shown the abilities of stiff substrates to stimulate

myofibroblastic differentiation of HSCs (29, 30). Less is known about the function of

quiescent cells in the normal liver state and the exact stiffness range where

myofibroblastic activation occurs. Results on the liver ECM gels determined that hepatic

stellate cell production of GAGs and HGF were time and stiffness dependent. HGF

production was highest in the lowest gel stiffness, while ECM production was greatest on

the highest gel stiffness (Chapter 3- Supplementary Figure 5). More detailed studies

would reveal if these cells could substantially modify the composition or physical

properties of the substrate microenvironment. Co-culture with primary hepatocytes

should improve long term viability of the cells and provide insight into the relationships

between cell types and certain substrate properties. In addition, modeling a fibrotic

stiffness and determining methods of controlling excess ECM production and

maintenance of hepatocyte function could help in the understanding and treatment of

liver diseases like cirrhosis.

Besides increasing diversity of cell types grown on the substrate, increasing the

three dimensionality of this system could improve capabilities to model disease states and

enable advances in tissue engineering. Hepatocytes are arranged in epithelial sheets in the

liver. 2D systems replicate individual cell layers, but not the complex interactions of the

entire tissue. New 3D bioprinting technology could provide a method of creating these

3D structures. This tool enables careful layering of cells and gel substrate. Using

156

knowledge gained from this thesis, a bioprinter could alternate printing cell sheets and

ECM gel layers at a set stiffness level to produce a tissue-like system. In this way, in

vitro modeling could better mimic an in vivo environment, while still providing an

adjustable platform to study specific ECM properties and mechanisms.

Despite the advantages of a fully 3D gel system, new challenges and

complications are created that are non-existent in 2D culture. Gel swelling, pore size, and

the flow of cell nutrients through the substrate all become important. Crosslinking affects

stiffness on a gel layer, but could have confounding effects in 3D. Substrate fabrication

and multiple gel properties would need to be monitored, tested, and studied to prevent the

introduction of unwanted variables. Although several areas still need to be addressed, the

abilities and flexibility of ECM gel substrates provide a promising future.

Overall, liver ECM gels improve long term cell function and allow isolation and

testing of single substrate-related properties. This thesis work elucidated specific

mechanisms of mechanotransduction and cytoskeletal regulation and determined stiffness

ranges where hepatocyte function was optimized in vitro. Future advances and

development of this substrate system could further clarify molecular interactions and

produce more accurate disease models. Liver ECM gels could also be utilized in cell

encapsulation technologies or cell therapies to repair liver injuries or disorders. The thesis

established methods to integrate a natural liver ECM microenvironment in gel substrates

at a physiological stiffness range. This new knowledge and innovation has facilitated

numerous possibilities to pursue and can ultimately lead to future advances and practical

therapies or treatments.

157

Works Cited

1. Sato T, Stange DE, Ferrante M, Vries RG, Van Es JH, Van den Brink S, Van Houdt WJ, Pronk A, Van Gorp J, Siersema PD, Clevers H. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 2011;141(5):1762-72. doi: 10.1053/j.gastro.2011.07.050. PubMed PMID: 21889923. 2. Nguyen-Ngoc KV, Cheung KJ, Brenot A, Shamir ER, Gray RS, Hines WC, Yaswen P, Werb Z, Ewald AJ. ECM microenvironment regulates collective migration and local dissemination in normal and malignant mammary epithelium. Proc Natl Acad Sci U S A. 2012;109(39):E2595-604. doi: 10.1073/pnas.1212834109. PubMed PMID: 22923691; PMCID: 3465416. 3. Mroue R, Bissell MJ. Three-dimensional cultures of mouse mammary epithelial cells. Methods in molecular biology. 2013;945:221-50. doi: 10.1007/978-1-62703-125-7_14. PubMed PMID: 23097110; PMCID: 3666564. 4. Alcaraz J, Xu R, Mori H, Nelson CM, Mroue R, Spencer VA, Brownfield D, Radisky DC, Bustamante C, Bissell MJ. Laminin and biomimetic extracellular elasticity enhance functional differentiation in mammary epithelia. EMBO J. 2008;27(21):2829-38. doi: 10.1038/emboj.2008.206. PubMed PMID: 18843297; PMCID: 2569873. 5. Whitehead RH, Robinson PS, Williams JA, Bie W, Tyner AL, Franklin JL. Conditionally immortalized colonic epithelial cell line from a Ptk6 null mouse that polarizes and differentiates in vitro. J Gastroenterol Hepatol. 2008;23(7 Pt 1):1119-24. doi: 10.1111/j.1440-1746.2008.05308.x. PubMed PMID: 18205771; PMCID: 3005200. 6. Bhatia SN, Ingber DE. Microfluidic organs-on-chips. Nat Biotechnol. 2014;32(8):760-72. doi: 10.1038/nbt.2989. PubMed PMID: 25093883. 7. Khademhosseini A, Eng G, Yeh J, Kucharczyk PA, Langer R, Vunjak-Novakovic G, Radisic M. Microfluidic patterning for fabrication of contractile cardiac organoids. Biomed Microdevices. 2007;9(2):149-57. doi: 10.1007/s10544-006-9013-7. PubMed PMID: 17146728. 8. Park JS, Chu JS, Tsou AD, Diop R, Tang Z, Wang A, Li S. The effect of matrix stiffness on the differentiation of mesenchymal stem cells in response to TGF-beta. Biomaterials. 2011;32(16):3921-30. doi: 10.1016/j.biomaterials.2011.02.019. PubMed PMID: 21397942; PMCID: 3073995. 9. Gattazzo F, Urciuolo A, Bonaldo P. Extracellular matrix: a dynamic microenvironment for stem cell niche. Biochim Biophys Acta. 2014;1840(8):2506-19. doi: 10.1016/j.bbagen.2014.01.010. PubMed PMID: 24418517; PMCID: 4081568. 10. Malinen MM, Kanninen LK, Corlu A, Isoniemi HM, Lou YR, Yliperttula ML, Urtti AO. Differentiation of liver progenitor cell line to functional organotypic cultures in 3D nanofibrillar cellulose and hyaluronan-gelatin hydrogels. Biomaterials. 2014;35(19):5110-21. doi: 10.1016/j.biomaterials.2014.03.020. PubMed PMID: 24698520. 11. Skardal A, Smith L, Bharadwaj S, Atala A, Soker S, Zhang Y. Tissue specific synthetic ECM hydrogels for 3-D in vitro maintenance of hepatocyte function. Biomaterials. 2012;33(18):4565-75. doi: 10.1016/j.biomaterials.2012.03.034. PubMed PMID: 22475531; PMCID: 3719050. 12. Nakamura S, Ijima H. Solubilized matrix derived from decellularized liver as a growth factor-immobilizable scaffold for hepatocyte culture. J Biosci Bioeng. 2013;116(6):746-53. doi: DOI 10.1016/j.jbiosc.2013.05.031. PubMed PMID: WOS:000329087800016. 13. Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 1992;69(1):11-25. PubMed PMID: 1555235. 14. Burridge K, Chrzanowska-Wodnicka M. Focal adhesions, contractility, and signaling. Annual review of cell and developmental biology. 1996;12:463-518. doi: 10.1146/annurev.cellbio.12.1.463. PubMed PMID: 8970735.

158

15. Choi SS, Diehl AM. Epithelial-to-mesenchymal transitions in the liver. Hepatology. 2009;50(6):2007-13. doi: 10.1002/hep.23196. PubMed PMID: 19824076; PMCID: 2787916. 16. Wells RG. The epithelial-to-mesenchymal transition in liver fibrosis: here today, gone tomorrow? Hepatology. 2010;51(3):737-40. doi: 10.1002/hep.23529. PubMed PMID: 20198628; PMCID: 3247701. 17. Cary LA, Chang JF, Guan JL. Stimulation of cell migration by overexpression of focal adhesion kinase and its association with Src and Fyn. J Cell Sci. 1996;109 ( Pt 7):1787-94. PubMed PMID: 8832401. 18. Semler EJ, Ranucci CS, Moghe PV. Mechanochemical manipulation of hepatocyte aggregation can selectively induce or repress liver-specific function. Biotechnol Bioeng. 2000;69(4):359-69. PubMed PMID: 10862674. 19. Chan AY, Bailly M, Zebda N, Segall JE, Condeelis JS. Role of cofilin in epidermal growth factor-stimulated actin polymerization and lamellipod protrusion. J Cell Biol. 2000;148(3):531-42. PubMed PMID: 10662778; PMCID: 2174812. 20. Tanimura S, Nomura K, Ozaki K, Tsujimoto M, Kondo T, Kohno M. Prolonged nuclear retention of activated extracellular signal-regulated kinase 1/2 is required for hepatocyte growth factor-induced cell motility. J Biol Chem. 2002;277(31):28256-64. doi: 10.1074/jbc.M202866200. PubMed PMID: 12032150. 21. Ridley AJ, Hall A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell. 1992;70(3):389-99. PubMed PMID: 1643657. 22. He W, Rose DW, Olefsky JM, Gustafson TA. Grb10 interacts differentially with the insulin receptor, insulin-like growth factor I receptor, and epidermal growth factor receptor via the Grb10 Src homology 2 (SH2) domain and a second novel domain located between the pleckstrin homology and SH2 domains. J Biol Chem. 1998;273(12):6860-7. PubMed PMID: 9506989. 23. Godoy P, Hengstler JG, Ilkavets I, Meyer C, Bachmann A, Muller A, Tuschl G, Mueller SO, Dooley S. Extracellular matrix modulates sensitivity of hepatocytes to fibroblastoid dedifferentiation and transforming growth factor beta-induced apoptosis. Hepatology. 2009;49(6):2031-43. doi: 10.1002/hep.22880. PubMed PMID: 19274752. 24. Wang P, Liu T, Cong M, Wu X, Bai Y, Yin C, An W, Wang B, Jia J, You H. Expression of extracellular matrix genes in cultured hepatic oval cells: an origin of hepatic stellate cells through transforming growth factor beta? Liver international : official journal of the International Association for the Study of the Liver. 2009;29(4):575-84. doi: 10.1111/j.1478-3231.2009.01992.x. PubMed PMID: 19323784. 25. Zhu NL, Asahina K, Wang J, Ueno A, Lazaro R, Miyaoka Y, Miyajima A, Tsukamoto H. Hepatic stellate cell-derived delta-like homolog 1 (DLK1) protein in liver regeneration. J Biol Chem. 2012;287(13):10355-67. doi: 10.1074/jbc.M111.312751. PubMed PMID: 22298767; PMCID: 3322997. 26. Mullhaupt B, Feren A, Fodor E, Jones A. Liver expression of epidermal growth factor RNA. Rapid increases in immediate-early phase of liver regeneration. J Biol Chem. 1994;269(31):19667-70. PubMed PMID: 7519599. 27. Bachem MG, Meyer D, Melchior R, Sell KM, Gressner AM. Activation of rat liver perisinusoidal lipocytes by transforming growth factors derived from myofibroblastlike cells. A potential mechanism of self perpetuation in liver fibrogenesis. The Journal of clinical investigation. 1992;89(1):19-27. doi: 10.1172/JCI115561. PubMed PMID: 1729271; PMCID: 442814.

159

28. Pinzani M, Abboud HE, Aron DC. Secretion of insulin-like growth factor-I and binding proteins by rat liver fat-storing cells: regulatory role of platelet-derived growth factor. Endocrinology. 1990;127(5):2343-9. PubMed PMID: 1699746. 29. Olsen AL, Bloomer SA, Chan EP, Gaca MD, Georges PC, Sackey B, Uemura M, Janmey PA, Wells RG. Hepatic stellate cells require a stiff environment for myofibroblastic differentiation. Am J Physiol Gastrointest Liver Physiol. 2011;301(1):G110-8. doi: 10.1152/ajpgi.00412.2010. PubMed PMID: 21527725; PMCID: 3129929. 30. Guvendiren M, Perepelyuk M, Wells RG, Burdick JA. Hydrogels with differential and patterned mechanics to study stiffness-mediated myofibroblastic differentiation of hepatic stellate cells. J Mech Behav Biomed Mater. 2014;38:198-208. doi: 10.1016/j.jmbbm.2013.11.008. PubMed PMID: 24361340.

160

Daniel Deegan

1310 Brookstown Ave. Apt. 4 (908)-627-2216

Winston-Salem, NC 27101 ddeegan@wakehealth.edu

Education

Wake Forest University Graduate School of Arts and Sciences

Winston-Salem, NC

Doctorate of Philosophy in Molecular Medicine and Translational Sciences (December

2015)

Area of Specialization: Regenerative Medicine

Dissertation: “Functional Effects of Liver Specific ECM Stiffness on Primary

Hepatocytes in Culture”

Faculty Advisor: Thomas Shupe

GPA: 3.67

Virginia Polytechnic Institute and State University (Virginia Tech)

Blacksburg, VA

Bachelor of Science in Biological Sciences, Minor in Economics (May 2009)

GPA: 3.9

Research Experience

Wake Forest Institute of Regenerative Medicine - PhD Thesis Lab

Research Advisor: Dr. Thomas Shupe (2010-Present)

- Researched the recellularization of decellularized kidneys and livers for transplant

- Involved in protein analysis of the ECM and cell culture on ECM gels

- Analyzed influences of ECM bound growth factors on primary hepatocyte culture

- Analyzed effects of altered substrate stiffness on cell culture

- Experience in submitting grants, poster presentations, and seminar lecturing

- Author on publications

Wake Forest University- Molecular Medicine and Translational Science - 1st Year

Rotations

Research Advisors: Dr. Peter Antinozzi, Dr. Richard Loeser (2009 – 2010)

- Translational research performed on topics including diabetes, molecular pathways of

osteoarthritis

- Experience shadowing clinicians related to fields of research

- Abstract for American Society of Nephrology

Virginia Tech - Plant Pathology Lab, Honors Undergraduate Research

Research Advisor: Dr. John McDowell (2007 – 2009)

- Assisted graduate student and professor with research on plant disease in Arabidopsis

- Focused on GUS and trypan blue staining of plants to see when auxin responses and

cell death are triggered after infection of Hyaloperonospora parasitica

- Pictures of microscope slides used for publication

161

Rutgers University - Research Experience for Undergraduates Program, Camden, NJ

Research Advisor: Dr. Heike Bücking (Summer

2008)

- Ten week program sponsored by the National Science Foundation involved research,

reporting of findings, creating a professional poster, and writing a paper

- Explored uptake of nutrients by mycorrhizal fungi under sterile conditions using

radioactive isotopes

- Lab skills and techniques were also presented and taught through several seminars

Laboratory and Computer Skills

Real-time PCR; DNA/RNA analysis; gel electrophoresis; Western blotting; protein

quantification; ELISA; organ collection and perfusion; decellularization; surgical

techniques; immunohistochemistry; microscopy; primary human cell culture; 3D

organoid culture

Microsoft Word, Excel, Powerpoint; GraphPad

Graduate School Positions

Student Representative of the Molecular Medicine and Translational Sciences Executive

Committee

Member of Wake Forest University Honors Council

Honors and Awards

Outstanding Poster at North Carolina Tissue Engineering and Regenerative Medicine

Annual Conference and Innovation Summit, 2013

Member of Phi Sigma Biology Honors Society

Graduated summa cum laude with degree in biological sciences

Honors Scholar at Virginia Tech

Graduated with an additional 18 credit hours of coursework and research

Member of the University Honors Program at Virginia Tech (Freshman through Senior

years)

Virginia Tech Dean’s List (every semester as undergraduate)

Member of the Biological Life Sciences Community at Virginia Tech

- Freshman year program where Biology majors lived together in student housing on

campus, interacted

socially and academically, participated in seminars, and completed a community

service project

- Service project included Stroubles Creek watershed clean-up

162

Publications:

Manuscripts:

Deegan D.B., Zimmerman C., Skardal A., Atala A., Shupe T., Stiffness of Hyaluronic

Acid Gels Containing Liver Extracellular Matrix Supports Hepatocyte Function and

Alters Cell Morphology. Journal of the Mechanical Behavior of Biomedical Materials.

2015; pp. 87-103 (online)

Ko IK, Peng L., Peloso A., Smith C.J., Dhal A., Deegan D.B., Zimmerman C., Clouse C.,

Zhao W., Shupe T.D., Soker S., Yoo J.J., Atala A., Bioengineered transplantable porcine

livers with re-endothelialized vasculature. Biomaterials. 2015 Feb; 40:72-9.

Sullivan D.C., Mirmalek-Sani S.H., Deegan D.B., Aboushwareb T., Baptista P.M., Atala

A., Yoo J.J., Decellularization Methods of Porcine Kidneys for Whole Organ

Engineering Using a High-Throughput System. Biomaterials. 2012 Nov 28;

33(31):7756-64.

Antinozzi P.A., Barnes B.C., Deegan D., Ma L., Freedman B.I., Murea M. Digital

deconstruction of heterogeneous renal cell preparations with high-content imaging and

cell specific biomarkers [abstract]. Journal of the American Society of Nephrology.

2010; 21(Suppl):409A.

McDowell J.M., Hoff, T., Anderson, R., Deegan, D., Propagation, Storage, and Assays

with Hyaloperonospora arabidopsidis, a model oomycete pathogen of Arabidopsis,

Methods in Molecular Biology. 2011; 712:137-51.

Book Chapter:

Dhal, A., Vyas, D., Moran, E.C., Deegan, D.B., Soker, S., Baptista, P.M. (2014). Hepatic

Systems. In Anthony Atala (Ed.), Translational Regenerative Medicine (pp. 469-479).

Boston, MA: Academic Press.

Presentations:

Deegan D., “Effects of Liver Specific Extracellular Matrix Gels of Varying Stiffnesses

and Growth Factor Presence on Primary Hepatocyte Function.” Molecular Medicine

Seminar. Wake Forest University, Winston-Salem. 19 Sep. 2014.

Deegan D., “Effects of ECM Bound Growth Factors on Primary Hepatocyte Culture.”

Molecular Medicine Seminar. Wake Forest University, Winston-Salem. 9 Sep. 2013.

Deegan D., "Effects of ECM Bound Growth Factors on Liver Cell Function." Molecular

Medicine Seminar. Wake Forest University, Winston-Salem. 1 Mar. 2013.

Deegan D., "Growth Factor Retention on Decellularized Liver Scaffolds." Molecular

Medicine Seminar. Wake Forest University, Winston-Salem. 11 May 2012.

Deegan D., "Characterization of a Decellularized Porcine Kidney Scaffold for Cellular

Reattachment." Molecular Medicine Seminar. Wake Forest University, Winston-Salem.

25 Mar. 2011.

163

Deegan D., "Effects of SOD1 and MKK7 Expression on IGF Induced AKT and MAPK

Signaling." Molecular Medicine Seminar. Wake Forest University, Winston-Salem. 7

May 2010.

Deegan D., "Development of a High Content Cell Based Assay for Renal Disease."

Molecular Medicine Seminar. Wake Forest University, Winston-Salem. 13 Nov. 2009.

Lectures:

Guest lecture, Winthrop University, BIOL523X: Stem Cell Biology. Liver

Bioengineering. April 10, 2015.

Posters:

Deegan D., Zimmerman C., Shupe T., Effects of Liver Specific Extracellular Matrix

Hyaluronic Acid Gels of Varying Stiffnesses on Primary Hepatocyte Function. Wake

Forest Institute for Regenerative Medicine, 2015

Deegan D., Zimmerman C., Shupe T., Effects of Increased Hydrogel Crosslinking and

ECM Bound Growth Factors on Primary Hepatocyte Culture. Wake Forest Institute for

Regenerative Medicine Retreat, 2013

Deegan D., Zimmerman C., Shupe T., Effects of Extracellular Matrix Bound Growth

Factors on Primary Hepatocyte Culture. North Carolina Tissue Engineering and

Regenerative Medicine Annual Conference and Innovation Summit, 2013

Deegan D., Zimmerman C., Brown

A., Petersen

B., Shupe T., Growth factor retention on

decellularized liver matrices derived from varying growth states and serum treatment.

Wake Forest Institute for Regenerative Medicine Retreat, 2012

Deegan D.B., Sullivan D.C., Mirmalek-Sani S.H., Atala A., Yoo J.J., Aboushwareb T.,

Effects of Detergent Concentrations on Decellularized Porcine Kidney Scaffold, Wake

Forest Institute for Regenerative Medicine Retreat, 2011