Supplemental Data. Supplemental Figure 1a-e. Supporting MALDI-TOF/TOF MS information for primary peptide amino acid sequence assignments. In some cases,
Hypogonadism and testosterone replacement part 2
Supplemental Figure 1: Genomic region targeted in lemurs Schematic of the candidate human X inactivation center region is shown below the chromosome ideogram.
1 CLIMATE Do we know where we are headed? Karen A. Harbert Institute for 21 st Century Energy 29 May 2009.
Supplemental Figure 1. 1000 cells/ well DLD-1 ALDH+/CD133+ DLD-1 ALDH- /CD133- Supplemental Figure 2.
Supplemental Figures. Supplemental Figure 1. Top two canonical pathways clustering the potential predictive biomarkers. The Ingenuity IPA tool was used.
12307_2010_48_MOESM1_ESM
Human-Mouse Cross Reactive
Primer Sequence miRNAsCloning (Forward)Cloning (Reverse) miR-7-1TAATACGACTCACTATAGGGTTGGATGTTGCTGTAGAGGCATGGCCTGTGC miR-7-2TAATACGACTCACTATAGGGCTGGATACAGTGCGATGGCTGGCACCATTAG.
Watsonwyatt.com 2007 ALI-ABA Executive Compensation Course of Study: Strategy, Design, and Implementation What Does Accounting Bring to the Table? Nick.
Supplemental Figure 1.
Supplemental Figure 3
