Download - Changi light book 2017_

Transcript
Changi light book 2017_111116.inddNO . 30,31&32, Block-L,
North Oakalapa, Yangon, Myanmar.
Weatherlux T5
NEA- CLL
Octopus
A Fine Collection of
Authorised Agents / Distributors For:
History Changi-Light Pte Ltd grew progressively over the past decades to become probably one of the major and leading lighting fixture supplier for Residential, Industrial and Commercial projects in Singapore.
Started off in a two-storey factory in Eunos industrial estate, we have through the years, gained precious support from our valued customers. With the growth of the economy and the industry,the company was re-located to its present 4-storey factory in Kaki Bukit View in 1999.
With a paid-up capital of $1.5 million and an annual sales turnover of more than $10 million locally, the company now employs more than 40 staffs comprising of technical sales managers, auto-cad lighting designers, engineers, administration and logistics officers as well as store assistants and general workers.
CHANGI-LIGHT Myanmmar was subsequently set up in 2013 in Yangon to cater for the growing needs and demands for this fast developing country. Within a short span of time, Changi-Light Myanmar has grown to become one of the leading lighting suppliers in Myanmmar with an impressive annual sales turnover of more than $2 million. This office now employs more than 15 staffs with Sales Managers and Lighting Designers to provide lighting proposal, technical supports and quality lighting products for the customers in Myanmmar.
Services
Changi-Light Pte Ltd was established in Singapore in 1993 with the objective of providing quality lighting fixtures and prompt deliveries to the construction industry. With this as our core mission, we had also introduced other value-added services to serve our customers better. Services like: lighting design, lux level calculation, technical consultation and customization of products, etc were introduced to help our customers make the suitable and correct choice for their projects and construction requirements.
Our huge premises at Kaki Bukit View also allow us to hold ample stocks of Simes, Adamlite, Aerolite, IImas, Lamp Poles, Lamps as well as wide varieties of control gears and accessories to meet the urgentdeliveries requested by some customers.
We are committed to be your preferred specialised lighting supplier by providing you with the best level of quality services and excellent products.
We are the authorized agents / distributors for many ranges of products as shown below:- • Adamlite
• Aerolite • Citylight • Citymatic • Deco-Lite • Endo
• EWO • Faeber Lighting System • Galvapole • Iimas • Kingsun • Light Systems (Australia)
• Lite-Ace • Lival • Opple • Philips (Lamps & Gears) • Reel-Autolifter • Rida-Lux
• SBP • Simes • Super-Light • Tec-Mar • Unilamp • Zeilicht
Year 1995 1. Amenity Centre at Tuas 2. Bukit Panjang Secondary School 3. School of Arts, Fort Road 4. Geylang Polyclinic 5. Bukit Batok Polyclinic 6. A&A for South Bouna Vista Swimming Complex 7. Trinity Church, Adam Road 8. Jurong Hill Viewing Tower Year 1996 1. Amenity Centre at Loyang 2. A&A to Marriott Hotel 3. Upgrading of Lighting at HDB, Margaret Drive 4. Kim Keat Community Club 5. Maris Stella High School 6. Seafood Centre at East Coast Park 7. Bukit Batok Interim Upgrading (HDB) 8. Teck Whye Interim Upgrading (HDB) Year 1997 1. Shopping Centre at Balestier Road 2. Signature Park Condominium 3. Lagoi Bay Resort, Bintan 4. St Hilda’s Primary School at Tampines 5. Institute of Health Building (I.O.H) 6. Amenity Centre at Business Park 7. Singapore Polytechnic Staff Housing 8. IMA Building at NUS 9. Amenity Centre at Serangoon North Ave 6 10. Balestier Hill Secondary School Year 1998 1. Mayspring Condominium 2. Shangri-La Service Apartments 3. Canopy Lighting at City Hall MRT Station 4. Gateway Hotel at Joo Chiat 5. Burlington Square 6. Popular Warehouse at Toh Guan Road 7. Railway Station at Woodlands 8. Exterior Floodlighting for Great World City 9. Singapore Godown Building at Tagore Lane 10. Tanjong Katong Girls’ School 11. Whitesands Primary School Year 1999 1. High-Tech Factory at Eunos TechPark II 2. Evergreen Park Condominium 3. Tiong Bahru Electric City 4. Alexandra Community Club 5. Crawford Community Club 6. Telok Blangah Community Club 7. NUS 6-Storey Research Building 8. National Library at Ngee Ann City 9. St Thomas Walk Condominium 10. Food Court at Ngee Ann Polytechnic 11. Police Coastal Guard at Pioneer Place Year 2000 1. Yong Nam Warehouse 2. Raffl es Hospital at North Bridge Road 3. Springdale Condominium 4. The Bencoolen Building 5. MINDS School at St Margaret Drive 6. Singapore Science Centre-Kinetic Park 7. Sengkang Fire Station
Year 2004 1. Waterplace Condominium 2. Immigration & Check Point at Jervois Road 3. 3-storey Building for Republic Polyclinic at Kay Siang Road 4. Ahmad Ibrahim Secondary School 5. Dalvey Estate Condominium 6. Warren Condominium 7. High Masts & Floodlights for ITE Campus, Simei 8. Living Hope Methodist Church at Tampines 9. Lakeholmz Condominium at Boon Lay 10. High Masts for Sentosa Golf Course & Driving Range 11. Southern Sentosa Cove 12. Boulevard Residence at Cuscaden Walk 13. Keppel FELs at 50 Gul Road 14. Kuo Chuan Primary School 15. Waterlina Condominium, Guillemard Road 16. People Mover System, Changi Airport 17. Park Green Condominium 18. Changi Airport Police Station 19. Calarasi Condominium at Kim Keat Lane 20. VIP Complex, Changi Airport 21. The Esparis Condominium at Pasir Ris Drive 4 22. 1 Francis Thomas Drive Condominium 23. Mandai Crematorium & Columbarium Complex Year 2005 1. Yishun Fire Station 2. Upgrading of Chinese Swimming Club 3. Alexandra Park Connector 2 (Tanglin Rd to Zion Rd) 4. Arriving Plaza at Sentosa 5. Majestic Hotel at Bukit Pasoh 6. The Linc Condominium at Lincoln Road 7. Grandeur 8 Condominium at Ang Mo Kio 8. Dalvey Road Condominium at 70-76 Dalvey Road 9. Offi ce cum Factory Building at 413 Tagore Industrial Ave 10. Singapore Management University (Victoria Campus) 11. SCDF Basic Rescue Training Centre at Jalan Bahar 12. The Berth - Condominium at Ocean Drive Sentosa Cove 13. Budget Terminal at Changi Airport 14 . Meditation Hall at Kong Meng San Monastery
Year 2006 1. Yardley Condominium 2. Law Enforcement Academy at Choa Chu Kang 3. Broadrick Secondary School 4. 5-storey Light Industrial Factory at Kaki Bukit Road 1 5. Kovan Melody at Kovan Height 6. Club House & Golf Course High Masts at Marine Bay 7. High Masts / Street Light for PSA Container Yards 8. SIA Clubhouse at Upper Changi Road East 9. Bukit Panjang Plaza Upgrading 10. St James Powerstation at Gateway Avenue 11. Upgrading of Tennis Court Lighting at Raffl es City 12. Novena Medical Central at Sinaran Drive 13. Changi Airport Terminal 3 (Decorative Wall Light) 14. Giant Departmental Building at Tampines 15. Service Apartment at Holland Park 16. Yuan Ching Secondary School 17. Whitley Secondary School 18. Industrial Development at Commonwealth Ave 19. Warehouse Development at Tai Seng Street
8. Bishan Fire Station 9. Singapore Power Training Institute, Braddell Road 10. Ubi Industrial Techpark 11. St Patrick’s Secondary School 12. Gan Eng Seng Secondary School Year 2001 1. Bukit Gombak Indoor Stadium 2. Ministry of Foreign Affairs Building, Camp Road 3. Ju Eng Home For Senior Citizens 4. Yew Tee Community Club 5. Fernvale Primary School at Sengkang 6. Multi-Storey (Stack-up) Factories at Jalan Buroh 7. National Cancer Centre, SGH 8. Katong Community Club 9. Tropical Spring Condominium at Simei 10. Columbarium Complex at Chua Chu Kang Road Year 2002 1. Changi Water Treatment Plant 2. Fuchun Community Club 3. Anglo Chinese School at Barker Road 4. Singapore Soka Association at Senja Road 5. Caterpillar Asia at Tractor Road 6. APP Enterprise Building at Toh Guan Road East 7. Esplande Theatre On The Bay 8. Good Shepherd Church 9. High Masts for Meridian Junior College 10. Upgrading of Hougang Sports Hall 11. NUS Care Centre at Penjuru Road 12. Life Science Building at Science Drive 13. UMCI at Pasir Ris 14. Moulmein Rise Condominium 15. Changi Prison Staff Housing Complex 16. The Chapel of The Resurrection at Alexandra Road 17. East Coast Park, Cycling & Jogging Track
Year 2003 1. Amoy Street Food Centre 2. Sengkang Methodist Church 3. Jalan Besar Stadium & Swimming Complex 4. Victoria Secondary School and Hostel 5. Beverly Hill Condominium 6. The Teneriffe Condominium 7. Robertson Quay Condominium 8. Delfi , Cocoa Factory in Johor 9. HDB Upgrading (MUP) at Telok Blangah 10. Nee Soon Camp, Music and Drama Centre 11. ASEF Building at Heng Mui Keng Terrace 12. PCI Factory at Ahmad Ibrahim 13. Sunshine Terrace Condominium at Upper Seragoon Road 14. The Belleforte Condominium 15. Mega Warehouse at Penjuru Lane 16. 5-storey Logistic HUB at Aerogistic Promenade 17. Factory Development at 46, Gul Ave 18. Spelling Stables at Singapore Racecourse 19. COTE D’AZUR Condominium at Marine Parade 20. Sanctuary Green Condominium 21. JTC Multi-Storey Stack-up at Factory at Woodlands 22. Balmoral 8 Condominium at Balmoral Crescent 23. Adam Park Condominium 24. CISCO Building at Corporate Road 25. Trent Overhaul Engine Complex at Calshot Road 26. High Mast & Floodlight for Temasek Polytechnic Swimming Pool 27. High Masts for Keppel Club Golf Course 28. High Masts & Floodlights for Soccer Fields, Sentosa
Please note this list does not include all small size projects and Military Projects undertaken
Above Information Is Correct At Time Of Print
Projects undertaken by Changi-Light Pte Ltd
20. Micron Data Centre at Changi 21. A&A Works to Hwa Chong Institute 22. A&A Works to Jurong Bird Park 23. Interior Design Centre at Temasek Poly 24. A&A Works to ST. Andrew’s Cathedral 25. Simei NPark Connector 26. The Linear at Upper Bukit Timah Road 27. Food Court at Bugis Junction 28. Factory Development at Penjuru Lane 29. A&A Works to Fu Lu Shou Complex 30. Kum Yan Church at Queen Street 31. Majestic Hotel at Bukit Pasoh 32. New Block at Ngee Ann Polytechnic 33. N-Parks Building at Balmoral 34. PPl Shipyard at Tuas 35. Sentosa Cove Conduminmum at Sentosa Year 2007 1. Azure at Sentosa Cove 2. Calrose at Yio Chu Kang / Ang Mo Kio Ave 4 3. Orchard Scotts Improvement Works 4. Redevelopment of Changi-Prison Complex 5. A&A Working to Singapore Power Building 6. Warehouse Development at Pandan Crescent 7. Hi-Tech Factory at Tractor Road 8. Logistics HUB at Tuas West Drive 9. Halliburton at Tuas Ave 1 10. Warehouse Development at Penjuru Close 11. Warehouse Development at 19 Pandan Ave 12. Logistics HUB Development at Changi North Rise 13. ACS International School 14. Warehouse for UPS at Loyang 15. Anchorvale Community Club at Anchorvale Road 16. Singapore Air Traffi c Control Centre II at Biggin Hill Road 17. Tuas Warehouse at Tuas South 18. Eunos Technolink One at Kaki Bukit Road 1 19. Food Court at Great World City 20. Extension to Church of The Blessed Sacrament 21. AMD Factory at Chai Chee 22. Bluewaters at Jln Loyang Besar 23. Fu Guang Shan Temple at Punggol 24. Vanadium at Hertford / Novelty Road 25. Incinerator Plant at Tuas South Ave 26. Condominium at Shanghai Road 27. Mera East Condominium at East Coast Road 28. High Masts for Jurong Point 29. Factory Development at Pulay Seraya 30. High Masts for NUS-Sport Club 31. HDB Development at Punggol West - C6 32. BP Warehouse at Tuas South 33. A&A Works to Orchard Plaza 34. Hortpark at Alexandra Road
Year 2008 1. Visioncrest Condominium at Oxley Rise 2. Grange Garden Condominium 3. ST. Michael’s Condominium at ST. Michael Road 4. Infi niti at West Coast Park 5. Greenridge Secondary School 6. PSA Container Yards at Pasir Panjang 7. Industrial Park at Jalan Punggol Timor 8. ESTA Condominium at Amber Road 9. IHUB Building at Jurong Town Hall Road 10. Pulau Brani Dormitory 11. SAFRA Resort at Boon Lay Way 12. Residential Development at 8 Balmeg Hall
13. 2-Storey Factory at 52 Tuas Ave 1 14. A&A Works at KK Hospital 15. Seng Kang Sports Recreational Centre at Anchorvale Road 16. Factory Development at Tuas Road 17. Factory Development at Tuas Ave 18. Bishan Family Sports Hub at Bishan 19. Park Connector at Macpherson 20. Mera Springs Condominium at Norfolk Road 21. Maylea Condominium at Pasir Pajang Road 22. Watermark Condominium at Robertson Quay 23. One Leicester at Woodsville Close 24. Paterson Residence at Paterson Road 25. Keppel Shipyard at Pioneer Sector 26. Beaufort Condominium at Nassim Road 27. Fernhill Place at Fernhill Road 28. Food Court at Lot One, Choa Chu Kang 29. ACS Primary School at Winstedt Road 30. Atrium Condominium at Geylang 31. Church at Gilstead Road 32. Cold Storage at Anchor Point 33. DBS Treasure at Upper East Coast Road 34. FAB Factory at Attap Valley 35. Inter Roller Factory at Jalan Boon Lay 36. James Cook University at Upper Thomson Road 37. JFE Factory at Tuas South Ave 1 38. Jurong Point 2, Residental & Shopping Complex 39. Lereve Condominium at Kampong Eunos 40. 7-Storey Commercial Building at Changi Business Park 41. 4-Storey Commercial Building Offi ce Bldg at Upper Changi Road 42. Platinum Edge at Leicester Road 43. Sims Dorado at Geylang 44. Logistics HUB at Changi North Way 45. Factory Development at Loyang Way 46. A&A to Assumption Vocational Institute 47. A&A to Ministry of Manpower Building 48. The ARC Condominium at Claymore Road 49. Netting High Masts for Sembawang Shipyard 50. A&A to Bukit Panjang Community Centre 51. Hotel Re! at Chin Swee Road 52. One Jervois Condominium at Jervois Road 53. New Extension to Keppel Fels Building 54. Cold Room Warehouse at Pasir Panjang 55. New Sports Halls for Hougang / Anderson School 56. Industrial Development at Lorong 3, Toa Payoh
Year 2009 1. Condominium At Devonshire Road 2. Regency Condominium At Chay Yan Street 3. Parc Condominium At West Coast Road 4. Clementi Woods Condominium At West Coast Road 5. Safra Club At Boon Lay Way 6. Seletar Airport-Runway Extension 7. Industrial Park At Pulau Punggol Timor 8. A&A Works To Food Centre At Smith Street 9. A&A Works For Ginza Plaza 10. A&A Works For Mount Faber Cable Car Station 11. Pathlight School At Ang Mo Kio Ave 10 12. Condominium At Loyang Besar 13. Church At Playfair Road 14. Condominium At Loyang Terrace 15. Facade Floodlighting For Pico-Art Building 16. Condominium At Dunsfold Drive
17. Bible College At Gilstead Road 18. My Saviour’s Church At Prince Charles Crescent 19. Condominium At Dorset Road 20. Condominium At Lim Ah Woo Road 21. Medallion Condominium At Braddell Road 22. Condominium At Telok Kurau Lor. L. 23. Factory Development At Ang Mo Kio Ave 5 24. Inter-Roller factory At International Road 25. LSC Factory Development Changi South Street 26. A&A To Royal Plaza Hotel At Scotts Road 27. Factory Development At Kranji Crescent 28. Factory Development At Sungei Kadut 29. Factory Development At Penjuru Lane 30. A&A Works To Ngee Ann Polytechnic Block 52 31. A&A Works To Cedar Girls Sec School 32. Sub-Station Building At Tuas 33. A&A Works To Block 9 Of IMH 34. Condominium At Haigsville Drive 35. A&A To Seu Teck Sean Tong Temple, Toa Payoh 36. The Tate Residences At Claymore Road 37. The Infi niti Condominium At West Coast Park 38. One Jervois Condominium At Jervois Road 39. The Esta Condominium At Amber Garden 40. Greenridge Sec. School At Bukit Panjang Road 41. Residential Apartment At Margate Road 42. A&A Works At Changi Prisons 43. A&A Works To Mediacorp Training School, Andrew Road 44. Jurong Bus Interchange, Jurong Point 45. 4-Storey Factory Development At Hoy Fatt Road 46. VIDA Condominium At Peck Hay Road 47. A&A Works To Hougang Polyclinic 48. Viewing Deck Bridge At Floating Island, Punggol 49. Upgrading Of Lighting, Fort Canning Park 50. Cluster Condominium At Joo Chiat Terrace 51. A&A Works At Old Birdcage Walk Sub-Station 52. PUB Substation At Tampines Road 53. PUB Substation At Choa Chu Kang 54. SBG Nassim Residences At Evans Road 55. BEA Bank At No. 60, Robinson Road 56. Factory Development At Changi North Way
Year 2010 1. Commercial Development At Level 7, 8, 11, 12 Orchard Central 2. Commercial Development At Mistri Road 3. A&A Works At St. Hilda Sec School 4. Retro-Fitting Works At Treasure Resort Hotel, Sentosa 5. Freeport Logistics At Changi North Crescent 6. A&A Works At ACS International School, Dover Road 7. IBM Building At Tampines Industrial Ave 5 8. Offi ce Development At No 35, Tai Seng Street 9. Logistics Warehouse At No 50, ALPS Avenue 10. Warehouse Development At Changi North Street 2 11. Industrial Building At Ubi View 12. A&A Works To Wards 81, 82 At K. K. Hospital 13. Factory Building At No 81, Tech Park Crescent 14. A&A Works To Block 1, Changi General Hospital 15. Church Of The Divine Mercy At Pasir Ris St. 72 16. Exterior Lighting Paterson Suites At Paterson Road 17. ST Kinetic Testing Centre At Jalan Boon Lay 18. Hillvista Condominium At Elizabeth Drive 19. MBFC Residential Building (Phase 1) 20. City Vista Residences At Peck Hay Road 21. Changi Cove Hotel At Cranwell Road
Please note this list does not include all small size projects and Military Projects undertaken
Above Information Is Correct At Time Of Print
Projects undertaken by Changi-Light Pte Ltd
18. Volari Condominium at Balmoral Road 19. Hamilton Scotts at Orchard 20. A&A Works to Airport Budget Terminal 21. Vermont Condominium at Cairnhill Rise 22. Splendour Condominium at Bukit Batok 23. Flamingo Condominium at Siglap Road 24. A&A Works for BCA Building at Braddell Road 25. Offi ce and Incinerator Plant at 21 Tuas View Circuit 26. Punggol Primary School at Hougang 27. NTUC Learning Hub at Benoi Road 28. Factory at 107, Defu Lane 29. Condominium at Sing Joo Walk 30. Zen Building at Geylang Lorong 25 31. Tresalveo at Marymount Terrace 32. Raffl es Institution Hostel at Bishan 33. UE Bizhub at Changi Biz Park 34. 8 @ Woodleigh Condominium 35. A&A Works to Singapore Botanic Gardens 36. Industrial Building at Pioneer Road North 37. Esparina Residences at Buangkok Drive 38. D’mira Condominium at Boon Teck Road 39. Freightlink Building at Changi South 40. New Teaching Block for Tanglin Trust School 41. Centro Residences at Ang Mo Kio Ave 8 42. A&A Works to Braddell Heights Community Centre 43. Singapore Police Force at Punggol East 44. Zeon Factory at Banyan Drive 45. Workers’ Dormitory at Tuas South Lane 46. A&A Works to Singapore Polytechnic, Block 24A/202 47. Home Team Academy at Old Choa Chu Kang Road 48. Star Vista at North Buona Vista Road 49. PUB Substation at Tembusu Road 50. 6-storey Ramp-up Factory at Soon Lee Street 51. 10-storey Ramp-up Factory at Bukit Batok Crescent 52. CWT Logistics Warehouse at 20, Gul Way 53. A&A Works to Admin Block, Singapore Turf Club 54. ATTC at Seletar Aerospace 55. Punggol East Police Centre 56. A&A Works to Macpherson Community Centre 57. Extension Block to Freemasons’ Hall at Coleman Street 58. National Heart Centre, SGH 59. The Lush Condominium at Holland Hill 60. Air Traffi c Control Centre at Seletar Airbase 61. Residences Botanique at Sirat Road
Year 2013 1. ILIV Condominium At 74 Grange Road 2. A&A to OUB Centre At Raffl es Place 3. Disco Hi-Tech Building At Ubi Ave 4. Greenwich Mixed Development At Seletar Road 5. 21, Angullia Park Condominium 6. Yamazaki Mazak Factory At Joo Koon 7. A&A TO KK Hospital, NICU Tower 8. Signalling Depot Lighting For SMRT Stations 9. Upgrading of Shaw Centre, Scotts Road 10. Singapore Warehouse At Paya Lebar 11. Beacon Heights Residential At Mar Thoma Road 12. Altez Condominium At Enggor Street 13. Tuas (Eco) Warehouse At Tuas View 14. Elitist Condominium At Bukit Batok 15. 21-Storey Residential Building At Kim Keat Road
14. Miro Condominium at Novena/Newton 15. Condominium at 15, Butterworth Lane 16. Residence Development at 881, East Coast Road 17. Residential Development at No. 20, Irrawaddy Road 18. Signature Condominium at Lewis Road 19. Condominium at Florida Road 20. Development at 33, Senoko South 21. Hi-tech Factory at Gul Circle 22. A&A Works at Tower 3, Connection One 23. Rochester Hotel/Residential at Buona Vista 24. Clementi Police Headquarters 25. A&A Works at Ngee Ann Polytechnic (Block 5 - 8) 26. BMW Workshop at Teban Gardens 27. A&A Works at Paya Lebar Methodist Church 28. Visa Offi ce at Singpost Building 29. Lincoln Residences at Surrey Road 30. Park Lighting at MacRitchie Reservoir 31. Factory at No.17, Tractor Road 32. Condominium at Leng Kee Road 33. A&A works at KK Hospital (Wards 85 & 86) 34. Balcon East Condominium at Upper East Coast Road 35. Condominium at 27, Queen Astrid Park 36. A&A Works at Bedok Community Centre 37. OLA Building at Mountbatten 38. The Verve Condominium at 23, Jalan Rajah 39. Warehouse at Fishery Port 40. Ivan Chin’s Residence at Sentosa Cove 41. Bungalow Development at Kovan Road 42. Geylang West Community Club at Upper Boon Keng Road 43. A&A Works at Traffi c Police Headquarter at Ubi Road 44. Condominium at Marymount Terrace 45. Factory Development at Kranji Link 46. SAF Holiday Chalets at Changi Road 47. Tampines Community Club at Tampines Ave 3 48. Jones Lang Laselle Institute 49. SIA Hangar at Changi 50. Outdoor Lanterns at Toa Payoh Central 51. T2 Airport Terminal Lounge at Changi 52. Residential Development at 12A, Cable Road 53. Marina South Lighter Wharf 54. An-Nur Mosque at Admiralty Road 55. Mee Toh School at Edgedale Plains 56. De La Salle Primary School at Choa Chu Kang 57. Factory Development at 249 Jalan Boon Lay 58. Woodsville 28 at Woodsville Close Year 2012 1. The Peak at Toa Payoh 2. Tour Bus Terminal at Sentosa 3. TCC Cafe at 29 Scott Road 4. SUTD University at Dover Road 5. Riverdale Residence at 348 River Valley Road 6. Vivace Condominium at Tong Watt Road 7. Apartment at 15 Upper Circular Road 8. Logistic Warehouse at Jurong Pier 9. Parvis Condominium at Holland Hill 10. New Cathay Building at 22 Martin Road 11. Fedex Building at Upper Changi Coast Road 12. Jurong Swimming Complex at Jurong West 13. Applied Materials Factory at Changi North 14. Fire Station at Prince Edward Road 15. Condominium at Hume Heights 16. Residential Development at 42 Florida Road 17. Verdure Condominium at Holland Park
22. Condominium At No 5, Joo Chiat Lane 23. Balcon-East Condominium At Upper East Coast Road 24. Factory At No 36, Changi North Crescent 25. Factory At Tuas Avenue 11 26. Exterior Lighting For NUH, Hospital 27. Commercial Development At Buona Vista 28. A&A to Chung Cheng High School 29. Zen Meditation Centre At Geylang, Lorong 25 30. Interior Works For DBS Asia Hub, Changi Business Park 31. Food Factory At Jalan Tepong 32. A&A Works For Horse Stables, Kranji Turf Club 33. A&A Works For Toa Payoh Polyclinic 34. A&A Works For NUS Building At Prince George Road 35. A&A Works For NUS, Hon Sui Sen Auditorium 36. Condominium Development At Pasir Panjang Road 37. Floodlighting Of Basketball/ Tennis Courts, NUS 38. Latitude Condominium At Jalan Mutiara 39. Offshore Supply Base Development, Loyang Crescent 40. A&A Works To Raffl es Hall, NUS 41. Food/ Hawker Centre At Haig Road 42. De Centurion Condominium At Tanjong Rhu Road 43. Assumption Pathway School At Chestnut Drive 44. Garden By The Bay (Interim Park) 45. Bluwaters Condominium At Loyang Besar 46. A&A To Market/ Food Centre At Ang Mo Kio Block 226D 47. A&A To Market / Food Centre At Blk 38, Beo Crescent 48. Mega ZIP Adventure Park, Sentosa 49. PSA Marine Building At West Coast Road 50. Tribeca Condominium At Kim Seng Road 51. One St. Michael’s Condominium At St. Michael’s Road 52. One Amber Condominium At Amber Garden 53. Bartley Christian Church, Bartley Road 54. PUB, 66kv Substation At Bedok South 55. Apron High-Mast Floodlighting For CAAS, Seletar West 56. Factory Development at Ubi Ave 4 57. Factory Development at No. 8 Burn Rd 58. A&A Biopolis at One North Lab 59. JTC 2-Storey Factory At Loyang Avenue 60. DSO Marina Laboratory At Stockport Road 61. Gymnastic Sports Hall At Raffl es Institution 62. A&A Works To Alfa Romeo Building, Teban Gardens Crescent Year 2011 1. 4-Sty Ramp-up Factory at Loyang Crescent 2. SAF Changi Chalet 3. Wharf At Loyang Crescent 4. Jurong Island Micro Grid Hi-tech Factory 5. Boon Lay Community Centre 6. Changi Airport Panlang Bay 7. No.8, Claymore Service Apartment 8. Residential Development at 36 Gentle Road 9. Changi Airport High Masts 10. Martin Place Residences at Kim Yam Road 11. Greenwich Condominium at Yio Chu Kang 12. Dazhong Primary School 13. Waterfront Key Condominium at Bedok Reservoir
Please note this list does not include all small size projects and Military Projects undertaken
Above Information Is Correct At Time Of Print
Projects undertaken by Changi-Light Pte Ltd
7. Bus Depot @ St Michaels 8. Pathway and Façade along Stadium Boulevard 9. Dnata @ Changi 10. Factory @ 32 Joo Koon Road 11. DHL Building @ Greenwich Drive 12. Katong 883 Hotel @ East Coast Road 13. Cairnhill Community Club @ 1 Anthony Road 14. Leng Kee C.C @ Leng Kee Road 15. Shipyard at Tuas South Boulevard ( Phase 2) 16. BCA Academy at 200 Braddell Road 17. SSO at Corporation Drive @ Taman Jurong 18. National Heart Centre, Level 3 @ SGH 19. MSF at Bedok North, Commonwealth, Rivervale 20. MSF at Jurong East, Champions Way, Tampines 21. MSF @ 141 Red Hill Road 22. Twin Waterfall E.C. At Punggol Walk 23. Commercial Capital Building at Buroh Lane 24. 66KVA Sub-Station @ Sims Avenue 25. Façade RGB Lighting at Icon Building International Business Park 26. N Park at Changi Coast Road 27. Factory at 61 Gul Drive 28. 13 Sty Worker’s Dormitory at Woodlands Ave 10 29. Gambir Ridge Condominum at Gambir Walk 30. Tropika East Condominium at Foo Kim Lim Road 31. Three Balmoral Condominium at 3 Balmoral Road 32. Imaginarium at Eunos Avenue 3 33. Yishun Sports Centre at Yishun Central 1 34. The Cristallo at No. 70 & 72 Telok Kurau, Lorong K 35. Lian Soon Building at 21A Senoko Loop 36. Eastress Terrace at 3 East Coast Driver 37. Luxus Hills Phase 2 &3 Terrace at AMK Ave 5 38. Singa Hills Condominium at 33 Jalan Singa 39. The Ebony Condominium at 35 Lor Marican 40. 8M Residence at 8 Margate Road 41. 26 Newton Condominium at 26 Newton Road 42. Nursing Home at 55 Quennsway 43. 28 RC Suites at 28 Race Course Lane 44. Meridian 38 Condominium at 38 Lor M Telor Kurau 45. Istana House Offi ce Building 46. Oasis at Sakra, Jurong Island 47. Mandai Connection at 7 Mandai Link 48. Soo Kee Jewellery at Changi Business Park 49. Permai Residences at 524 Kg Bahru Rd 50. The Quinn Condominium at 13 Bartley Road 51. Westwood Condominium at Orchard Boulevard 52. Bright Chambers at 108 Middle Road 53. Mapex at 37 Jalan Pemimpin 54. One Dusun Residences @ 1 Jalan Dusun 55. YCK Telephone Exchange @ Seletar Road 56. Remarking Our Heartland Project At Chai Chee Avenue / Bedok North 57. Hills Two One Condominium At Hillview Terrace 58. Suties Condominium At 1 Surrey Road 59. The Promenade @ Pelikat At 183 Jln Pelikat
Year 2016 1. Matt Fatt Lam Buddhist Temple @ Bedok Road 2. Calvary Bible Church @ Tao Ching Road 3. Scotts Tower @ Scotts Road 4. Tuas West Bus Interchange 5. Boystown @ Queenstown 6. Gateway Condominium @ Jurong Gateway 7. Lake Ville Condominium @ Boon Lay Way 8. St Joseph Nursing Home at Jurong West 9. 4 Sty Substation @ Kaki Bukit 10. 4 Sty Substation @ Loyang 11. Data Centre at Defu Ave 1
16. Keppel Shipyard At Pioneer Sector One 17. Hijanan Condominium At Cavengah Road 18. 6-Storey Multiple-Users Industrial Building At Soon Lee Road 19. Regal Centre At Jalan Bukit Merah 20. Residential Development At 262, Joo Chiat Road 21. Bungalow At Sentosa Cove Drive 22. PSA Container Berth At Pasir Panjang 23. Cameron Offshore Marine Centre At Tuas South 24. Aims Offi ce Building At Defu Lane 10 25. Breadtalk Building At Tai Seng 26. OCWS Transhub Logistics At Jalan Tepong 27. Senior Care Centre At Serangoon Central 28. Princess Elizabeth Primary School At Bukit Batok 29. Bukit Panjang Primary School At Cashew Road 30. A&A to KK Hospital, Ward 75,76 31. Malay Language Centre At Bishan St.14 32. MRT Depot At Tai Seng 33. Canberra Condominium At Sembawang 34. Waterfront Gold Condominium At Bedok 35. Belysa Condominium At Pasir Ris 36. Sembcorp Factory At Banyan Avenue 37. Haniffa Condominium At Leng Kee Road 38. Industrial Development At Shipyard Crescent 39. Flora Drive Condominium 40. Factory Building At 32, Joo Koon Road 41. DES Building At Toh Guan Road 42. IDA, Mapletree Business City, Alexandra 43. Residential Building At Chevron Road 44. Warehouse Development At Tuas Bay Drive 45. The Kendall Building At Science Park Drive 46. Satay by The Bay At Marina Bay 47. Upgrading Of Lecture Theatres At NYP 48. Starlite Condominium At River Valley Road 49. Tampines Executive Condominium 50. Galmon Building At Tuas 51. LRT Stations At Pasir Panjang 52. Framework Building At Aljunied Avenue 1 53. Factory Development At Gul Lane 2 54. Factory Development At Tuas Basin Close 55. An Nur Mosque At Admiralty Road 56. Multi-Tenant Factory At Tanjong Kling 57. Factory Building At Tuas South Street 58. Viento Condominium At Lorong 30, Geylang 59. MSVS Building At Chua Chu Kang 60. Kuo Chuan Primary School At Bishan 61. Condominium Development At Hertford Road 62. Residential Building At Amber Road Year 2014 1. Vector Aerospace At Seletar 2. Phoenix Park EUP At Tanglin Road 3. Haite Building At Changi Business Park 4. A&A To Hwa Chong International School 5. Sennett Residence At Pheng Geck Avenue 6. South View Primary School At Chua Chu Kang Central 7. Ai Tong School At Brighthill Drive 8. Warehouse Cum Offi ce Building At Playfair Road 9. ENT Department At KK Hospital 10. A&A To Ward 9B At NUS Hospital 11. Lanai Condominium At Hillview 12. Lakefront Condominium At Lakeside Drive 13. China Culture Centre At Queen Street 14. Dawson HDB Development At Dawson Road 15. One KM Residential & Shopping Mall (Former Lion City Hotel) 16. Workers Dormitory At 23, Kian Teck Road
17. ABC Water Works Along Kallang River 18. Marina Staging Grounds At Fort Road 19. High Masts For Changi Airport Terminal 3 20. A&A To Ward 71, KK Hospital 21. Sorrento Condominium At West Coast Road 22. Jurong Gateway Pedestrian Mall 23. Hokkien Huay Kuan Building At Sennett Road 24. CWT Logistics Warehouse (Phase 3) At 20, Gul Way 25. 8-Storey Industrial Building At 38, Jalan Pemimpin 26. CWT Cold Hub At Jalan Tepong 27. Warehouse Cum Offi ce Building At Pioneer Sector 3 28. 5-Storey Industrial Building At 81, Tagore Lane 29. Workers Dormitory At 21B, Senoko Loop 30. Schlumberger Building At Benoi Crescent 31. 3-Storey Substation At Jalan Bukit Merah 32. Holland NRP At Bukit Panjang Ring Road 33. Changi-Simei Community Centre At Simei 34. Aggreko Offi ce Cum Warehouse At Jalan Buroh 35. Factory Cum Offi ce Building At Eunos Avenue 3 36. Landscape Lighting For One Dusun Residence 37. 2-Storey Dance Annex Building At Nanyang Hill 38. A&A Works To Level-6, URA Centre 39. Seastrand Condominium At Pasir Ris 40. Terasse Condominium At Hougang 41. Factory Cum Offi ce Building At Shipyard Road 42. Palms Condominium At 6th Avenue 43. Nursing Home At Bukit Batok St.52 44. Woodlands MRT Substation 45. A&A Works To Riverview Hotel 46. A&A Works For Jones Lang Offi ce, Republic Plaza 47. Sports Facilities Building At Stadium Boulevard 48. A&A Works To Lecture Theatres, Singapore Polytechnic 49. Condominium Development At Lorong 28, Geylang 50. A&A Works To Applied Material Building, Upper Changi 51. A&A Works To Changi Terminal 3 52. Zion Bible Presbyterian Church At Bishan Street 13 53. JTC Factory At Ayer Rajah Crescent 54. Executive Condominium At Yuan Ching Road 55. American School At Woodlands 56. A&A Works To St.Luke Hospital 57. Condominium Development At Lorong 26, Geylang 58. i-Space Building At Soon Lee Street 59. ARK Building At Kaki Bukit 60. Leedon Height At Farrer Road 61. ARK Building At Gambas 62. Condominium Development At Haig Road 63. Ness Condominium At Lorong 32, Geylang 64. Condominium Development At 38, Ipoh Lane 65. Workers Dormitory At Toh Guan Road East 66. Bethesda Church At Ang Mo Kio 67. Factory Development At Mandai Link 68. Belvia Condominium At Bedok Reservoir 69. Regent Residence At Serangoon 70. Spazio Condominium At Kovan 71. 8, Admore Park Condominium At Draycott Drive Year 2015 1. Recreation Centre @ Jalan Papan 2. Recreation Centre @ Tuas South Street 13 3. Sentosa Golf Club / Driving Range 4. Merden Singapore @ JalanPasawat 5. Blue Scope Coated Factory 6. Mediapolis @ Ayer Rajah
Please note this list does not include all small size projects and Military Projects undertaken
Above Information Is Correct At Time Of Print
Projects undertaken by Changi-Light Pte Ltd
12. Data Centre at Tampines St. 92 13. Swv-Cafe at Cold Hub 2 ( Fishy Port) 14. Muthu’s Curry Heritage at Dempsey Road 15. Radin Mas CC at Telok Blangah Rise 16. 5 Sty Residential at 16E Duku Lane 17. Multi Function Building at Tuas South Boulevard 18. Jurong East 66KV Substation 19. Skypark E.C. at Sembawang Crescent 20. Kim Keat NRP at Kim Keat Avenue 21. The Index at Tuas South Avenue 3 22. Teck Whye & West View Primary School 23. A&A Work at Aries Building, Science Park 24. Spottiswoode Suites at 16 Spottiswoode Park Road 25. Belgravia Villas at Ang Mo Kio Ave 5 26. 16 Sty Offi ce and Retail Development at Lavender Street / Jalan Besar 27. Reworking Our Heartland (ROH) at Hougang N1NC and N2NC (HDB) 28. Mandai Estate at 5 Mandai Link 29. Shan Court Condominium at 12 Shan Road 30. Ascent at 456 Balestier Road 31. Singpost @ Eunos 32. LIV On Sophia Condominium at 14 Ardis Road 33. Luxus Hills Phase 8 &9 Terrace at AMK Ave 5 34. Dunman Regency at 485 Dunman Rd 35. Terra Villas at Kembangan, 19 Jalan Sayang 36. Onze Condominium at 11 Kee Seng Street 37. Lotus Ville at 142 Lor L,Telok Kurau 38. The Line Condominium at Tanjong Rhu 39. Factory at 3 Joo Koon Circle 40. Community Club at Keat Hong 41. Factory at 6 Jalan Lembah Kallang 42. Social Service Centre at Commonwealth Dr 43. LOGHUB Singpost at 37 Greenwich Drive 44. MOE Headquarter at Marlan Road 45. Dairy Farm Nature Park 46. Grace Haven at Lor Napiri 47. Bungalow at 23 Rebecca Road 48. Nanyang Girl’s High School @ 2 Linden Drive 49. LF Logistic @ 10 Bulim Ave 50. Kwong Wai Shui Hospital @ Bendemeer 51. Tampines Industrial Park A Blk 9001- 9008 52. Temple at 31 Marsling Ind Estate Road 3 53. St. John Headquarter at 420 Beach Road 54. High Mast @ 15 Pandan Road 55. The ARMORE EC @ 623 Punggol Central 56. The Alana @ Sunrise Terrace 57. 705 Woodlands Sport Park 58. Yangkee Warehouse @ Jurong West St. 23 59. Oxley Tower @ 138 Robinson Road 60. JTC Launchpad (Phase 2) at One North 61. The Flow Shopping Mall at East Coast Road 62. NRP Batch 8 at Jurong East Street 24 63. Sing Long Foodstuff at 12 Woodlands Line 64. Social Service Offi ce at 662 Hougang Ave 65. Loft 33 Condominium At Geylang Lor 32 66. DCD Clinic at KKH @ 156 Riveral Crescent 67. SGH at Blk 1, Level 1 68. Sri Siva Durga Indian Temple at 8 Potong Pasir Ave 2 69. A&A Works of Laguna National Golf Club 70. A&A Works of Concord Cancer Hospital at 19 Adam Road 71. PCG Mega Childcare Centre at Woodlands 72. Linkways @ Sentosa
Please note this list does not include all small size projects and Military Projects undertaken
Above Information Is Correct At Time Of Print
Projects undertaken by Changi-Light Pte Ltd
Year 1996 1. Sedona Hotel, Yangon
Year 2006 1. Yangon International Airport, Yangon
Year 2012 1. Junction Square Shopping Mall, Yangon
Year 2013 1. Landscape Lighting For Jade Villa At Nay Pyi Taw
Year 2014 1. Prime Hill Business Square At Shwedagon Pagoda Road, Yangon 2. Dagon City Show Flat At Zoological Road, Yangon 3. Landscape Lighting For Sanctum Inle Resort At Inle Lake 4. Secret Garden At Junction Square Shopping Mall, Yangon 5. URC Myanmar Factory At Mingalardone Industrial Zone, Yangon 6. Illustra Condominium Showfl at At Mingalar Taung Nyunt, Yangon 7. Coolgate Head Offi ce At 39th Street, Yangon
Year 2015 1. Loik Kaw Hospital, JICA 2. Lashio Hospital, JICA 3. Showa Glove Factory, Thilawa Special Economic Zone 4. Taungoo College At Taungoo, JICA 5. Tang Jong Factory At Hlaing Tharyar Industrial Zone 6. Physical Rehabilitation Centre At Myitkyinar 7. Golden Duck Restaurant At Mandalay 8. Kyun Shwe Myaing Residence, Yangon 9. Golden Valley Residence, Yangon 10. Pin Lone Residence, Yangon 11. IIDA Electronic Factory At Mingalardone Industrial Zone 12. CB Bank Head Offi ce At UFC, Yangon 13. Offi ce Lighting At Star City, Thanlyin (A3 Wing A,B&C) 14. Swimming Pool & Bar At Star City, Thanlyin 15. Strengthening Human Development Institution In Agriculture At Yay Sin, JICA 16. Rajah & Tann Nk Legal (Myanmar) At HAGL, Yangon 17. Ray Residence At Mon Myat Myint Tar Housing, Yangon 18. SMBC Bank At Strand Road, Yangon 19. Landscape Lighting For Mediland Hospital At Dawei
Year 2016 1. Junction City (Retails), Yangon 2. Vegas Hotel At Nay Pyi Taw 3. OJITEX Factory ,Thilawa Special Economic Zone 4. Taw Win Residence ,Yangon 5. Street Lantern At Thilawa Special Economic Zone (MTSH) 6. Kubota Factory At Thilawa Special Economic Zone 7. Upgrading Work At Golden Hill Tower 8. SUZUKI Car Showroom At Wai Zayan Dar Road 9. Isuzu Car Showroom At Mingalardone Industrial Zone 10. Huawei Head Offi ce At Myanmar Plaza 11. Mandalay International Airport Improvement Work 12. Senko Warehouse At Insein 13. SKD Ford Assembly Factory At East Dagon 14. Premier Coffee Warehouse At Hlaing Thar Yar Industrial Zone-3 15. Landscape Lighting At Capital Shopping Mall, Tharkayta 16. Paul And Shark At Yangon International Airport 17. Coccinelle At Yangon International Airport 18. Versace Collection At Yangon International Airport 19. Toyota Tsusho Offi ce At Myanmar Plaza 20. Mitui Offi ce At Myanmar Plaza 21. Puma Energy At Thilawa Port 22. National Prosperity Co.,Ltd Head Offi ce At Hmawbi 23. Matsunaga Factory At Thilawa Special Economic Zone 24. New Link Offi ce Building At North Dagon 25. State Bank Of India At UFC Building 26. Pizza Hut @ GMP 27. Coca Cola Factory @ Hmawbi 28. Ooredoo offi ce at Mandalay 29. Shwe Pin Lone Factory 30. Pyin Sar Meditation Centre at Pyin Oo Lwin 31. Shwe Me’ Head Offi ce at Shwe Zabu Htate Condo
Projects undertaken in Myanmar
Contents STREETLIGHT LANTERN 1 - 9 • Greenmarker (LED) 1 • Greenspacer (LED) 2 • Tec-Mar LED Lantern 3 • Kingsun Apollo 2 (LED) 4 • Caribbean (LED) 5 • Ronaldo 6 • Legacy 7 • Myra 12 8 • Eric 9 OUTDOOR POST TOP LANTERN 10 - 25 • Skyline (LED) 10 • Octopus 11 • Poler (LED), Magnum 12 • Nicole 13 • EWO Linea-UL 14 • Vega 15 • Supreme 16 • Chelsea 17 • Olympic 18 • Alaska 19 • Imperial 20 • Jupiter 21 • Firenze Traditional 22 • Rida-Lux Classic-I 23 • Philips Smart LED 24 • Philips City Spirit Cone 25 SIMES ARCHITECTURAL 26 - 31 FLOODLIGHT 32 - 46 • Football 1kw/2kw Precision Floodlight 32 • Tec-Mar LED Floodlight 33 • Pico-Master 34 • Picofl ood Medium, Mini 35 • Picofl ood Standard 36 • Adamlite Ultraslim 37 • Philips BVP161 LED 38 • Tec-Mar 8002/SM/AS, Ultralux 39 • Radarfl ood Circular 40 • Technofl ood Superior 41 • Maxifl ood,Pico-LED 42 • Studiofl ood 43 • Citymatic LED Floodlight, Mini Focal 44 • TennisPac Floodlight 45 • Area-Liter 46 GARDEN SPOTLIGHT 47 - 50 • Spot-Liter 47 • Ultra-Spot 48 • Gina, Tina, Pardo, Ricco 49 • Zeilicht LED Spotlight/Wall Light 50 LOW-HEIGHT BOLLARD 51 - 55 • Square Bollard 51 • Cisko, Gamma, Solar, Parkland 52 • Garden Bollard 53 • Cityscape Bollard 54 • LED Garden Bollard 55 SECURITY / WALL LIGHT 56 - 69 • Dolma, G-Lite, Matrix, Roxy 56 • Palma 57 • Noor 58 • Link-Lite 59 • Arena 60 • Virgo-Round 61 • Virgo-Square, Virgo-Star, Virgo Pizza 62 • Quarter One, Memi 63 • Luna 64 • Circulo 65 • Ovalo 66 • Unilamp Recessed Wall, Post-Top, Underwater 67 • City-Guard 68 • Rida-Lux-Classic-II 69 CEILING LIGHT 70 - 78 • Supernova LED Ceiling Fixture 70 • Lite-Ace Surface LED Downlight 71 • Lite-Ace Ultraslim LED Fixture 72 • Adam-Light ST701, ST702, ST705 73 • Oyster 74 • Cirlina 75 • Circa, Retro Pendant 76 • Reiss SQL 200/300 77 • City-Square 78 HIGHBAY & LOWBAY 79 - 91 • Evergreen LED 79 • Aerolite LED 80 • Tec-Mar LED Hi-Bay 81 • Kingsun LED Hi-Bay / Low Bay 82
• Everton LED Hi-Bay (IP65) 83 • Ilmaslux, Vanda 84 • Aerolite Hi-Bay 85 • Ilmas Hi-Bay 86 • Aerolite Low Bay, Circular Low Bay 87 • Europa 88 • Philips LED Hi-Bay 89 • Autolifter for Hi-Bay (CSI-12, CDI-15) 90 • Autolifter -Wireless/Multi-Contact 91 FLUORESCENT FITTING 92 - 111 • T8 Batten, Wireguard, Refl ector 92 • T5 Batten, Wireguard, Refl ector 93 • Oscar T8 94 • Oscar T5 95 • Secure-Tec 96 • Trevoslux 97 • Aerolite ASP, ASM, ASW, ASL 98 • Aura T5 99 • Double Parabolic (ARP) 100 • Low Brightness Louvre / Prismatic (ALM,ALP) 101 • Direct/Indirect (ARI, ARW) 102 • Cleanseal (IP54), V-Shaped LED (RXV) 103 • Recessed Curved LED (CRV), LED Panel 104 • Ultraslim LED Panel 105 • Silverline, Lexus, Lotus, Garnet 106 • Decolite Ovale, Tondo, Nikon, T5 Slim Batten 107 • Decolite Latte T5, Tec-Mar Berillo 108 • Decolite LED Latte, Texas, Tondo 109 • Decolite LED Pendant 110 • Euroasia LED, Tivoli-M, RM 111 WEATHERPROOF FLUORESCENT 112 - 119 • Aerolite Slim LTP 112 • Weatherlite T5/T8 113 • Weatherlux T8 114 • Weatherlux T5 115 • Perlux 116 • Liberty 117 • Tivoli-R, Tivoli-S, Tivoli-L 118 • Reiss Weatherproof Batten 119 DOWNLIGHT 120 - 139 • Adamlite SRK, RX LED Downlight 120 • Adamlite SME, RME, SLED, HLED Downlight 121 • Adamlite ALR, ALS LED Downlight 122 • Lite-Ace LED 9188/R, 9188/S Downlight 123 • Lite-Ace LED 3028, 4028, 5028, 4026, 5026, 8008, 2008 124 • Lite-Ace LED 2529, 2536, 2539, 9228 Downlight 125 • Adamlite ( Halogen/LED), HA-408, HA-108, WD-108 126 • Micro, Medi, Mini, Maxi, Compact, Mini-GL 127 • Compact-Diamond, Compact-GL, Rino, Halo-Round 128 • Turbo-RS, Crossline-RS, Diamond-RL, Venus-RM 129 • Mega-P, Mega-M, Atlantis, Ricardo 130 • Turbo-SP, Crossline-SP, Galaxy-SP, Diamond-SP 131 • Celica 132 • Halo-Square, Tilt, Wash, Triple 133 • Maxi-Squre, Medi-Square, Mini-Square 134 • Lite-Ace With Aluminium Trims 135 • Lite-Ace With Trims or Trimless 136 • Lite-Ace LED 131/R, 151/R, 191/R, 131/S,118 STP 137 • Lite-Ace LED 1630, 6830, 3018, 6068, RS-80 138 • Vision-Lite Downlight / Wall Washer 139 FLAMEPROOF, EXPLOSION-PROOF FIXTURES 140 - 141 TRACK-LIGHT 142 - 143 • Opera-Spot, Drama-Spot, Cherry, Connie, Dolly 142 • Picasso TLED 208, 298, 303, 313, 348 143 LED STRIP, LED NEON 144 LED LAMPS & TUBES 145 - 147 • Citymatic Green-Label LED 145 • Philips LED Tube, LED Batten 146 • Philips LED Bulb, LED Candle 147 OPPLE PROFESSIONAL LED 148 - 152 SUNNY PIPE SYSTEM 153 ILMASLUX AIRCRAFT OBSTRUCTION LIGHTS 154 STAINLESS STEEL BOLLARD, WALL-LIGHT, 155 UNDERWATER POLE AND HIGH MAST 156 - 162 • 3.5m/4m Round Pole 156 • Street Light Pole 157 • Floodlight Pole 158 • 3.5m Octagonal Pole 159 • Mid-Hinged Pole 160 • Base-Hinged Pole 161 • Lowering/Raising High Mast 162 INDEX 163
50
270
90
90
luminaires constructed with strong aluminium housings and 5mm thick tempered glass covers.
LED
Model 9006 / LED
Dimensions (mm)
180° 120°
Angoli Gamma
- Available in 4000K (Cool White) or 5000K (Cool Daylight) as standards
PHOTOMETRIC DATA
45°
60°
75°
90°
105°
45°
60°
75°
90°
105°
180° 120°
180° 120°
Description
Features
Light weight, elegant appearance Modular design, easy installation and maintenance Accurate light distribution to enable high utilization of light High performance, long lifespan Low-glare, high uniformity
Apollo-2 Series LED Street Light adopts superior light source. It integrated IP66 lamp modular design ensures good heat dissipation. The body is of light weight and made of durable composite material. The street light provides optimum light distribution for various roadway applications.
Luminous Intensity Unit cd/klm
4
Caribbean/S
Suitable for many lighti ng applicati ons
such as general roads, building perimeters,
gardens, shopping complexes, residenti al
buildings, schools and many others.
The Caribbean can be either side-mounted or
top-suspended and is incorporated with very
effi cient 40W, 80W and 120W hi-powered
LED lamps with internal power unit.
The superb quality, long life LED lamps are
available in cool white (4000k) or daylight
(6000k) colour appearance.
Electronic Lamp
Model Wattage Weight(kg)
Model Wattage Weight(kg)
Now available with 36W LED
8
9
60
Ø60
20
800
500
500
APPLICATIONS
The Skyline LED lanterns are very attractive and well-designed with a slim 28mm thick solid round aluminum main housing which can be incorporated with 40W, 60W or 90W LED modules.
These lanterns can be inversely mounted with a decorative curved bracket, post- top mounted or side-mounted to suit many applications such as gardens, open carparks, walkways, driveways, residential precincts and many others.
The Skyline uses superb, long life of 100 Lumens/Watt and are integrated with very reliable Drivers.
The Skyline lanterns are designed for the low to medium height installation of 3 to 6 meters.
CONSTRUCTION
The Skyline LED lantern is constructed with high quality die-cast aluminum housing with clear 4mm thick heat-resistant tempered glass cover.
The control gear (driver) is integral at the base portion of main round housing.
The Skyline lantern is supplied
standard.
Polar diagram Skyline /60W (60W)/Cone measurement Intensity[cd/1000lm] Polar diagram
10
suitable for use in many parks, gardens and driveways. Specially
designed in modular forms for ease of installation and maintenance.
The OCTOPUS uses superb quality LED lamps with high
efficiency of 90 lumen/watt.
SpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSpeSppeSpeSpeSpSpeSpeSpSpeSpeSpSpeSpeSpeSpeSpeSpeepep cificificificificificificificificificificificificificificificificificificificificificificifificifiififiificififiifificicific catcatcatcatcatcatcatcatatcatcatcatatcatcatcatcatcatccatcatatatacatcatcatcatcacatcatcatcatccc ionionionionionionionionionionionionioniononiiononionionioonionionionnoiononnionns as as as as a s as as ass as as as as as as as as as as as a ass aas aaas as aas as aare re re re rere rere reereererererere rererere rererererereerrerreee subsubsubsubsubsubsubsubsubsubsubsubsubsubsubsubsububsubububsububbubububbsubsusubbssubssu jecjecjecjecjecjecjecjecjecjecjecjecjececjecjecjejjecjecjecjecjecjecjecjecjecjecjecececjecejj ttt tt ttt tt tt tt tt tt ttt tt ttt ttt tt tt tt tt ttt ttt tttt ttt ttt o co co co co co co co co co co cco co co co co co coo co co co cco ccco ccccc hanhanhanhanhanhanhanhanhanhanhanhanhananhananhanhanhanhanhanhanhanhanhanhannh gesgesgesgesgesgesgesgesgesgesgesgesgesgesgesgesgesgesgegeegesesggegesgeggg wiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiiwiwiwiwiwiwithothothothothothothothothothothothothohothothothothothohhthhthoh ut uut ut ut utut ut uttututut ut tt ututut utut pripripripripripripriprpripripripripripripripripripripripripriprppprpp or or or or or oror or or ororor oror or oror orrrrorrr nnotnotnonotnotnotnotnotnotnotnotnotnotnotnotnotnotnotnnotnononotnoo iceiceiceiceiceiceiceceiceiceiceiceiceiceiceiiceceeiccceic .........
OCTO-FIVE (100W)
OCTO-FOUR (80W)
OCTO-THREE/R (60W)
OCTO-TWO (40W)
IP 65
OCTO-THREE (60W)
50 2
52 6
Available with 30W LED lamp to replace 60W electronic lamp
Av LE 60W
Available with 30W LED lamp to replace 60W electronic lamp
30w, LED
Available with 30W LED lamp to replace 60W electronic lamp
Available with tapered top cover and canopy upon request
mp mp
PHOTOMETRIC DATA
15
APPLICATIONS The SUPREME is a well designed post-top mounted lantern suitable for many outdoor applications where appearance and high light output are important, such as:-
• Shopping Precincts • Resident Areas • Walkways • Leisure and Shopping Centres • School and Polytechnics • Public Parks and Gardens • Hospitals and Industrial Premises
CONSTRUCTION The SUPREME is constructed with three exterior parts, namely the die-cast aluminium base support, the conical prismatic diffuser and a spinned aluminium top canopy.
The solid die-cast aluminium base support is suitable for use with 60mm O.D. columns or wall brackets. Attached to it internally are four centre spines which support the internal aluminium refl ector, gear and lampholder.
The precision-made impact-resistant acrylic prismatic diffuser is injection-moulded and designed for ultimate light output. This diffuser may also be produced with UV- stablised polycarbonate material upon request
The spinned aluminium top canopy is produced with top quality aluminium material, chemically treated and fi nish with polester powder coating. This canopy is rigidly secured to the diffuser with a top decorative knob via a internal bracket supported by the four centre spines.
Specifi cations are subject to changes without prior notice.
Now Available with 3 NOS / 4 NOS Par 30, 12W LED or 1x30W LED
NNo 3 N 2
Model Lamp Type Wattage Weight (kg)
SUP 310 L 3 x Par 30, 12W LED 36 w 4.1
SUP 410 L 4 x Par 30, 12W LED 48 w 4.3
SUP 130 L 1 x 30 w LED 30 w 3.8
SUP 226 F 2 x PLC 26 w Compact Fluorescent 2 x 26 w 3.9
SUP 80 M 80 w Mercury, HPM 80 w 5.1
SUP 125 M 125 w Mercury, HPM 125 w 5.2
SUP 70 H 70 w Metal Halide, MH 70 w 5.2
SUP 150 H 150 w Metal Halide, MH 150 w 5.4
SUP 70 S 70 w Sodium, HPS 70 w 5.3
SUP 150 S 150 w Sodium, HPS 150 w 5.6
16
Specifi cations are subject to changes without prior notice.
This post-top luminaire is designed for use with 30W LED or with 70W or 150W metal halide lamp and the remote control gear can be installed at the service door compartment of the lighting pole or under the spigot section directly below the luminaire.
The anodised high purity aluminium lamp reflector provides high light output and good lighting distribution.
30W LED 70W/150W MH
30W LED 70W/150W MH
This elegant and appealling post-top luminaire is constructed with die-cast aluminium housing and 3-piece solid arms to mount the white oval-shaped aluminium reflector. This luminaire is incorporated with 30W LED or 70W/150W metal halide lamp and remote control gear. The control gear is installed at the service door compaetment of the lamp pole or directly beneath the base of the luminaire at the top of pole.
17
environments with its simple and practice design.
The Olympic range of light fittings is designed for medium to
low height installation from 3 to 5.5 meters for a maximum
lamp wattage of 150w sodium or metal halide.
Exceptionally suitable for use in walkways, parks, building
perimeters / facades and landscaping.
chemically treated die cast aluminium and is attached to a
PMMA Methacrylate optical diffuser with parametric seal.
A symmetrical or asymmetrical emission circular optical
reflector in highly anodized, polished aluminium, provides
high uniformity downward light throw and optimum optic
performance.
A removable built in gear tray is specifically fabricated for
ease of maintenance.
Specifi cations are subject to changes without prior notice.
th mp
Photometric Data
Anti-Glare Post-Top LanternsALASKA
APPLICATION The ALASKA lanterns have an eye-catching and attractive design suitable for Walkways, Residential Areas, Parks and Gardens as well as Shopping Centres.
The ALASKA-I and ALASKA-II come with High Performance optical system for Anti-Glare control and can be incorporated with a replaceable 36W LED lamp or HID lamps of up to 250W sodium and metal halide lamp to suit many different applications.
The ALASKA-III lantern is supplied with high quality LED modules either in 24W, 48W or 72W as standard. These LED modules are available in warm white (3000K) or cool white (4000K) or daylight (6500K) colour appearances. These lanterns are suitable for use with 3.5 metres to 6 metres height lamp poles.
CONSTRUCTION The ALASKA lanterns are constructed with High Quality Die-Cast Aluminium Material, Chemically treated and then finish with top grade Weather-Resistant Polyester Power-Coating.
The ALASKA lanterns are incorporated with Heat-resistant toughened clear flat or curved glass diffuser. Lamps and Control Gears are easily accessible from the removable top canopies.
Standard production is with Matt Black Finish (RAL 9005). However, special colours are also available upon request.
IP54 IP54 IP55
150W Sodium Lamp 36W LED 70W Sodium Lamp
250W Mercury Lamp
0
40
20
60
80
100
1 2 3 4 5 6 7 8 9 10 11m
24W LED 48W LED 72W LED
511
538
650
900
76
445
990
76
ALASKA-IIALASKA-I
0
40
20
60
80
100
1 2 3 4 5 6 7 8 9 10 11m
LUX 120
0
40
20
60
80
100
1 2 3 4 5 6 7 8 9 10 11m 12m
(Data taken at 3.5m height) 150W Sodium Lamp 36W LED 70W Sodium Lamp
250W Mercury Lamp (Data taken at 3.5m height)
(Data taken at 3.5m height)
ALASKA-IIALASKA-I ALASKA-III
Available with 30W LED lamp to replace 60W electronic lamp
Av LE 6
Specifi cations are subject to changes without prior notice.
Optional Lamp Type: 1 X 30W LED, 1 X HPSV70, 1 X HPMV80
1 X EL 24W, 1 X PLC-T32W, 1 X PLC-T42W
Now available with 30W LED lamp
21
22
Model No. Lampholder Electronic Lamp LED Lamp IP Rate Material
A0136B2 E27 2x15W,20W,24W 2 x 6W,9W IP44 Aluminium
A0136B3 E27 3x15W,20W,24W 3 x 6W,9W IP44 Aluminium
A0135 E27 15W,20W,24W 6W,9W IP44 Aluminium
A0134 E27 15W,20W,24W 6W,9W IP44 Aluminium
A0131 E27 15W,20W,24W 6W,9W IP44 Aluminium
23
Benefits
• High product quality and robust design; long maintenance-free lifetime
• Compact, modern appearance ensures freedom of design for urban planners
Suggested application
Technical specifications
Type BGP161
Power Consumption* 27W
2500lm @4000K CCT
> 92lm/w @4000K CCT
and finishing Optical cover: Polycarbonate, Anti-UV
Color: Dark Grey RAL7043 / Light Grey
RAL9006
Affordable lighting solution offering reliable quality Smart LED Post-top is an affordable LED lighting fixture that combines reliability and good light distribution. With its pleasing proportions and well-sculpted lines, it blends in seamlessly with its surroundings.
Lifetime 50K hours
Mounting Pole
Luminaire
Operating
Controls ON/OFF
24
• Good design. Sleek and stylish, fits into any urban landscape
• Long-lasting. Long lifetime of 50,000 hours
• Versatility. Its symmetrical, asymmetrical and road configuration light distribution meet requirements of different lightning applications
Suggested application
Technical specifications
Type BDS470
Optic TS: Symmetrical
NW>4,000lm; low lumen version:
Natural white NW>2,600lm
Aluminum body Light, durable and impact- resistant.
Color options Available in warm white (3000K) and neutral white (4000K).
UV-resistant transparent lampshade Day: Integrates well with the landscape; Night: Consistent light quality.
Philips CitySpirit Cone is an energy-saving LED lighting solution that does not compromise on aesthetics. It’s luminaire, mast, and bracket carry an integrated and stylish design that beautifully blends into any urban landscape. Various combinations of optical components generate lighting effects that meet different lighting requirements and ensure visual comfort at the right light level.
Professional lighting
25
Superior LED Products
S 3100W, 55W, 3000K, 5000lm, 10°BEAM S 3101W, 55W, 3000K, 5000lm, 30°BEAM
S 6307W, 12W, 900mm x 120mm x 120mm, 970lm S 6347W, 45W, 1350mm x 240mm x 240mm, 3880lm
S 3172W, 18W, 3000K, 1800lm S 3151W, 9W, 3000K, 900lm
S 3155W, 18W, 3000K, 1800lm S 3150W, 9W, 3000K, 900lm
S 6340W, 45W, 240mm x 240mm x 240mm, 3880lm S 6346W, 45W, 580mm x 240mm x 240mm, 1099lm
S 1510W, 16W, 3000K, 1180lm, 10°BEAM S 1511W, 16W, 3000K, 1180lm, 24°BEAM S 1513W, 16W, 3000K, 1180lm, 12°x 40°BEAM
OUTLINE KEEN
KUBE BOLLARD
Made in ITALY
Superior LED Products Made in ITALY
L 9211W, 12.5W, 580mm x 220mm x 66mm, 3000K, 970lm L 9206W, 12.5W, 220mm x 220mm x 66mm, 3000K, 970lm
C 8026W, 18W, 260mm x 210mm x 140mm, 3000K, 542lm C 8022W, 9W, 100mm x 290mm x 115mm, 3000K, 305lm C 8024W, 7W, 350mm x 75mm x 135mm, 3000K, 360lm
C 8105W, 13.5W, 450mm x 335mm x 105mm, 3000K, 1090lm C 8100W, 13.5W, 250mm x 335mm x 105mm, 3000K, 1090lm
C 8150W, 13W, 3000K, 800lm,17°BEAM C 8155W, 26W, 3000K, 2000lm, 24°BEAM
L 9260W, 12.5W, 200mm x 200mm x 33mm, 3000K , 970lm (Also available in recessed version)
L 9231W, 13.5W, 3000K, 1090lm
LOOK WOOD
CONCRETE UPLIGHT
CONCRETE GHOST
CONCRETE BOLLARD
SKILL WOOD
COOL WOOD
IP65 IP65
LL LL 80808008026262626WWWW LL LL 80808008 222222222 WWWW LLLLLLL L 8080808080808080800242442442424224242424WWWWWWWWWWWW
Ø2 40
27
COOL SQUARE
HIGH QUALITY LED PRODUCTS FROM ITALY
Specifications are subjected to changes without prior notice.
All dimensions shown are in millimeters (mm)
MOVIT RECTANGULAR MOVIT SQUARE
MINI COOL
MINI COOL
MINI LOOK DOUBLE
VIT SQUAREVIT RECTANGULAR
S.7215W, 33x220x220mm(H), 25W
MINI LOOKMINI COOL
MOV MOV
66
33
MINI SKILL ROUND
11 5
Depth 28mm
S 6250 S 628 S 6270IP 65 IP 65 IP 65 IP 65
The SKILL and MINI SKILL are suitable for both surface or recessed mounting
0W, 6WS.6270IP 65
LOBBY BASIC
0W, 6WS.6250IP 65
LOOK APPLIQUE
COOL WALL
270
IP 65 IP 65
29
30
31
32
TEC-MAR ®
TEC-MAR ®
High quantity range of floodlights constructed with strong aluminium housings and 5mm thick tempered glass covers. Supply with 4000K (cool white) or 5000K (cool daylight) LED lamps as standards.Available with asymmetrical reflector upon request.
LED
960W (113527lm) 660mm (L) x 585mm (H) x 200mm (D)
8097/LED
480W (57439lm) 635mm (L) x 280mm (H) x 150mm (D)
8096/LED
380W (48133lm) 320W (41432lm) 635mm (L) x 280mm (H) x 150mm (D)
8095/LED
120W (14674lm) 185W (21040lm) 315mm (L) x 280mm (H) x 150mm (D)
8094/LED
80W (9337lm) 150W (12778lm) 315mm (L) x 280mm (H) x 150mm (D)
8060/LED
30W (3388lm) 50W (5366lm) 155mm (L) x 280mm (H) x 100mm (D)
8002/LED
42W (4200lm) 84W (7000lm) 425mm (L) x 500mm (H) x 160mm (D)
8001/LED
24W (2400lm) 48W (4000lm) 250mm (L) x 395mm (H) x 155mm (D)
m (H) x 200mm (D)
35.5 kg
11.5 kg
13.5 kg
6.5 kg
6.5 kg
8kg 4kg
2.3 kg
6.5 k
mm (D)
PICO-M/200W
PICO-M/120W
PICO-M/50W PICO-M/30W PICO-M/10W
Dimensions(mm) H1 H2 L1 L2
Type 7016 Lumens(lm)
PICO-M/120W
PICO-M/400W
Remote Hand-held Con
7Colour Quick Change
Available with “ On / Off ” Built-In PIR Motion SensorAvailable with “ On / Off ” Built-In PIR Motion Sensor
Available In RGB Colour ChangingAvailable In RGB Colour Changing
34
Please replace PICO / MS with PICO / MA if Asymmetrical refl ector is required
Mercury Lamps Model Weight (kg)Wa age
PICO / MS 125M 6.2125W
PICO / MS 70H 6.6
PICO / MS 100H 6.8100W
PICO / MS 70S 6.2 6.9
70W PICO / MS 150S150W
PICO / MS 36 LED 5.936W
ORDERING CODE - Medium
With Symmetrical Refl ector
35
Please replace PICO/S with PICO/A if Asymmetrical refl ector is required
ORDERING CODE LED Lamps
Sodium Lamps Model Weight (kg)Wa age
PICO/S 70S 7.970W PICO/S 150S 9.7150W PICO/S 250S 9.9250W PICO/S 400S 11.7400W
Metal Halide Lamps Model Weight (kg)Wa age
PICO/S 70H 8.570W PICO/S 100H 8.8100W PICO/S 150H 9.0150W PICO/S 250H 9.3250W
PICO/S 400H 10.2400W
Via Risorgimento, 4
• Long-lasting performance in tough environment
• Up to 60% in energy saving
• Versatile and meets multiple requirements
Suggested application
Outdoor and indoor sports hall, carparks, warehouses, factories, public spaces.
Technical specifications
(mm) (w) (lm)
BVP161 193.2 x 142.2 x 40.9 30 2300 (WW)/2600 (NW, CW)
269.4 x 201.2 x 40.4 50 3900 (WW)/4300 (NW, CW)
315.4 x 232.9 x 40.9 70 5500 (WW)/6000 (NW, CW)
315.4 x 232.9 x 40.9 100 8100 (WW)/9000 (NW, CW)
Reliable savings, lasting brightness Philips Essential SmartBright LED Floodlight is a versatile flood light engineered to deliver significant energy savings. In addition, its robust construction with toughened and shatter-proof quality lens meets IP65 and IK07 requirements, making it an ideal solution for diverse flood lighting applications.
Essential SmartBright
LED Floodlight
38
Made in Italy
39
Also available with integral 250W / 400W gear box
1000W Radar / L 1000M 12.8kg
(1000W Remote gear only)
40
41
42
43
44
45
50W
35W, 70W
75W, 150W
6W
16W
12W
47
A sleek and aesthetically appealing range of die-cast aluminium outdoor LED spotlights available with round wall/ceiling mounting plates or with strong anti-corrosion polycarbonate earth-spikes for many garden, landscape and perimeter lighting applications.
The ultra-spot housings are constructed with high-quality die-cast aluminium, chemically treated and then finished with weather-resistant polyester pow er coating. The toughened front glass cover is fully gasketed to provide maximum seal against ingress of dust and moisture.
These ultra-spot outdoor fixtures are available in three different sizes and are incorporated with replaceable par 16, par 30 and par 38 LED lamps to suit various brightness requirements. The ultra-spot comes in black finish (RAL 9005) and pre-wired with a 1.5 metre outdoor double-insulated neoprene cable
WITH REPLACEABLE PAR LED LAMPS
IP 65
WITH EARTH SPIKE
48
Specifi cations are subject to changes without prior notice. 50
Now available in 7W LED ( 15W Electronic Lamp)
EEEEEEEEEEEEDDDDDDDDDDDDDDDDDDDDDDDDDDDDD p)
Aerolite Decorative Bollards
CISKO-LED CROWN-LED GAMMA-LED LED 7W
CISKO-SLE CROWN-SLE GAMMA-SLE SLE, Compact Fluor.(Electronic) 20W
CISKO-PLC CROWN-PLC GAMMA-PLC PLC, Compact Fluorescent 18W
CISKO-MBF80 CROWN-MBF80 GAMMA-MBF80 MBF, Mercury Vapour 80W
CISKO-SON CROWN-SON GAMMA-SON SON-I, High Pressure Sodium 70W
Now available in 7W LED ( 15W Electronic Lamp)
160
s Now N (
DESCRIPTION The Aerolite range of bollards are practical and decorative solution to amenity lighting.
It is particularly suitable for lighting entrances to buildings, building perimeters, gardens, parks, paths and walkways.
CONSTRUCTION The Cisko has a formed UV-stablised polycarbonate top bowl which offers excellent impact resistance and uses aluminium louvres to achieve high light output and to re-direct light onto the ground so as to reduce glare from the lamp.
The Gamma bollards have die-cast aluminium decorative bollard head units with multiple louvres to minimise glare and to direct light downwards onto the ground. The bollards / posts are constructed with rigid extruded aluminium and all aluminium parts are fi nished with polyester powder coating.
RANGE AND ORDERING CODE
LAMP-TYPE WATTAGE FLAT TOP ROUND TOP
BL/7 LED /ST BL/7 LED /RT LED LAMP 7W BL/8 E/ST BL/8 E/RT ELECTRONIC LAMP 8W BL/15 E/ST BL/15 E/RT ELECTRONIC LAMP 15W BL/20 E/ST BL/20 E/RT ELECTRONIC LAMP 20W
All bollards are supplied with white louvres as standard unless specifi ed
The Garden-Bollards are robust and stylish in design which make them suitable for installation in public parks, gardens, building perimeters, linkways and pavements.
Now available in 7W LED ( 15W Electronic Lamp) (
53
CBL/20 E/FT CBL/20 E/RT ELECTRONIC LAMP 20W
CBL/70 MH/FT CBL/70 MH/RT METAL HALIDE 70W
CBL/100 MH/FT CBL/100 MH/RT METAL HALIDE 100W
CBL/70 SON/FT CBL/70 SON/RT HIGH PRESSURE SODIUM 70W
CBL/80 MV/FT CBL/80 MV/RT MERCURY VAPOUR 80W
CBL/125 MV/FT CBL/125 MV/RT MERCURY VAPOUR 125W
Specifi cations are subject to changes without prior notice
Now available in 7W LED ( 15W Electronic Lamp) N (
54
RADORADO
IP 54 IP 54
3W LED 3W LED
A beautiful range of outdoor garden and footpath bollards with high quality ‘EPISTAR’ LED lamps. These LED lamps are available in warm white (3000K), cool white (4000K) and daylight (6000K) colour appearance.The corrosion resistant aluminium bollards are available in Black or Metallic Grey fi nish as standard and shorter heights are available upon request.
ACESACES
165
100
1000
50
20W, 40W LED
Well-designed and compact range of die- cast aluminium wall and security luminaires suitable for many indoor or outdoor applications such as schools, linkways, perimeter lighting, countryards, staircases and residential buildings. Supplied in bronze fi nish as standard. LED colour temperature : 5000K (Cool Daylight).
LED Lamps
40W mm lux m
12W mm lux m
RE
135mm
Specifi cations are subject to changes without prior notice.
Now Available with 2 X Par 30, 12W Replaceable LED Lamps
12W LED
th
am
th
amps
56
Now Available with 2 X Par 30, 12W Replaceable LED Lamps
th
am
h
mps
57
58
59
Now Available with 2 X 9W LED for single-side or 4 X 9W LED for double- side distribution
de le-
60
VIRGO-LT 2 x PAR 38 80W, 120W 2 x 16W, 20W Electronic 2 x 16W LED
VIRGO-LS 1 x PAR 38 80W, 120W 1 x 16W, 20W Electronic 1 x 16W LED
VIRGO-MT 2 x PAR 30 75W, 100W 2 x 8W, 12W Electronic 2 x 12W LED
VIRGO-MS 1 x PAR 30 75W, 100W 1 x 8W, 12W Electronic 1 x 12W LED
VIRGO-ST 2 x PAR 20 50W 2 x 8W Electronic
2 x 8W LED
VIRGO-SS 1 x PAR 20 50W 1 x 8W, 12W Electronic
1 x 8W LED
61
2 x PAR 30, 75W, 100W 2 x 8W, 12W, 15W Electronic 2 x 8W LED
2 x PAR 20, 50W 2 x 8W, 12W Electronic 2 x 8W LED
1 x PAR 20, 50W 1 x 8W, 12W Electronic 1 x 8W LED
1 x PAR 30, 75W, 100W 1 x 8W, 12W, 15W Electronic 1 x 8W LED
62
63
64
MINI-CIRCULO LAMPS
65
MINI-OVALO LAMPS
66
100
• High quality die-cast aluminium body • Polyester powder coating • Corrosion-resistant • Diffuser: Opal Polycarbonate • E27 lampholder • Suitable for 15W, 20W energy-saving electronic lamp & 9W LED lamp
• High quality die-cast aluminium body • Polyester powder coating • Corrosion-resistant • Diffuser: Opal Polycarbonate • E14 lampholder • Suitable for 5W, 8W energy-saving electronic lamp & 6W LED lamp
68
LED LAMP
2 x 6W, 9W 6W, 9W 6W, 9W 6W, 9W 6W, 9W 6W, 9W
69
20W LED
An attractive yet affordable range of LED ceiling/wall luminaires suitable for both indoor or outdoor installation.
These energy-saving LED luminaires are incorporated with reputable EPISTAR LED lamps and are suitable for use in many applications such as residential buildings, commercial
The circular housing is constructed of precision injection moulded technopolymer material of robust construction. The impact-resistant UV-stabilised Opal polycarbonate diffusers are hingeable for ease of installation and maintenance. The diffusers are rigidly mounted to the housings by means of strong ‘snap-on’ mounting clips for IP 65 dust and water protection.
The high-quality EPISTAR LED lamps are available in 3000k (warm white), 4000k (cool white) and 6500k (daylight) colour appearances.
Applications
Construction
125mm
787 lux
49 lux
87 lux
197 lux
2620 mm
10480 mm
7860 mm
5240 mm
SUPERNOVA / L SUPERNOVA / S 20W LED30W LED Specially designed with hingeable diffuser for ease of installation and maintenance.
Specifications are subject to changes without prior notice.
70
HIGH QUALITY COMPACT DECORATIVE SURFACE-MOUNTED LED DOWNLIGHTS
The LITE-ACE COMPACT DECORATIVE surface-mounted LED downlights are constructed with high quality aluminium housings with anodised aluminium reflectors and protected by thick semi - Frosted glass covers. The high intensity and reliable LED lamps have an average life of 35,000 Hours and are available in 3000K (warm white), 4000k (cool white) or 6000k (daylight) lamp colours.
Available in 3 Different Sizes and Wattages
LED 3818S
LED 3812S
LED 3807S
LED 3812R
LED 3807R
828250
55000
18W LED Lamp 2 x PLC 13W 18W LED Lamp 2 x PLC 13W
12W LED Lamp 1 x PLC 18W 12W LED Lamp 1 x PLC 18W
7W LED Lamp 1 x PLC 13W 7W LED Lamp 1 x PLC 13W
Specifications are subjected to changes without prior notice.
80 mm
156 mm
1534 744 1
LL or 6000k (daylighto 6000k daylight
W12 lux mmmmm
2750 384 1
HIGH QUALITY ULTRASLIM SURFACE-MOUNTED LED FIXTURES
The LITE-ACE ‘ULTRASLIM’ surface-mounted wall/ceiling LED fixtures are constructed with high quality aluminium trims and UV-stablished polycarbonate diffusers. The high intensity LED lamps have an average life of 35,000 hours and are available in 3000K (warm white), 4200k (cool white) or 6000K (daylight) lamp colours.
UCE ‘UULTRASLIM’ su plished ppolycarbon wK (warm wwhite), 420
ce-murfac diffusersd
The ) or 6000e) o
able in rs and a
Available in 3 Different Sizes and WattagesAvailable in 3 Different Sizes and Wattages * IP 44
LAQ-22
LAQ-15
LAQ-08
LAR-11
LAR-08
15W mm lux m
11W mm lux m
8W mm lux m
8W mm lux m
999984 9 3 118° 29
22W LED Lamp 2 x PLC 18W 15W LED Lamp 1 x PLC 26W
15W LED Lamp 1 x PLC 26W 11W LED Lamp 1 x PLC 18W
15W LED Lamp 1 x PLC 26W
8W LED Lamp 1 x PLC 13W 8W LED Lamp 1 x PLC 13W
* IP44 protection from the ceiling side on flat surfaceSpecifications are subjected to changes without prior notice.
22 0 m
3328 528 1
66566 132 2
72
Specifi cations are subject to changes without prior notice. 73
Lamp Type Polycarbonate Housing Aluminium Housing 1 x 9W LED OY/109 LED/PC OY/109 LED/AL 2 x 9W LED - OY/209 LED/AL 1 x PLC 18W OY/118/PC OY/118/AL 2 X PL 9W OY/209/PC OY/209/AL 1 x PLC 26W OY/126/PC OY/126/AL 2 X PL 11W OY/211/PC OY/211/AL 2 x PLC 18W OY/218/PC OY/218/AL 1 x 2D 28W OY/128/PC OY/128/AL
Available in black or white housing as standard. Other colours available upon request.
74
Lamp Type Polycarbonate Housing Aluminium Housing 1 x 9W LED CIR/109 LED/PC CIR/109 LED/AL 2 x 9W LED - CIR/209 LED/AL 1 x PLC 18W CIR/118/PC CIR/118/AL 2 X PL 9W CIR/209/PC CIR/209/AL 1 x PLC 26W CIR/126/PC CIR/126/AL 2 X PL 11W CIR/211/PC CIR/211/AL 2 x PLC 18W CIR/218/PC CIR/218/AL 2 x PLC 26W - CIR/226/AL 1 x 2D 28W CIR/128/PC CIR/128/AL
Available in black or white housing as standard. Other colours available upon request.
ORDERING CODE
DPL-6
DPL-2
DPL-5
DPL-3
DPL-7
DPL-8
DPL-9
DPL-2
DPL-3
Specifi cations are subject to changes without prior notice. 77
Available with 1 x 9w/2 x 9w LED Lamps
2 x 9W LED
1 x 9W LED
CS / P / 209 LED
CS / P / 109 LED
CS / O / 209 LED
CS / O / 109 LED
HD-HB02-100W 100W 12,600 4.6
HD-HB02-150W 150W 18,800 4.8
HD-HB02-200W 200W 25,200 5.4
100W - To replace 150W Metal Halide 150W - To replace 250W Metal Halide 200W - To replace 400W Metal Halide
LUUMIMINANANCNCE E DIDISTSTRIRIBUBUTTTTITT ONNNN
APPPPPPLPLPLICICI ATATTIOIOION A A A coocompmpmpacacactt ananand well-desigi ned d yey t t econnnnomooo icicalal rangege oof LLED D LoLoLoow-BaBBB y/ Hi-BaB y lulummminanaanairirri esse sssuuitable for mmmounting heights of
3.3.3 55 memeteters tto o 12 meters. TThhesee llumu inaires s arararreee inincocorprpororrorratatatatedede wwiti h hhiighg -quaualilityty LLLED modulees ss wiww th an excellentt luu-
men ouo tptput offf 130 lm/W andd goooodd CoCololourururru RRRRRenendeedeeririringng IIndndexexex ooofff momom rerere tttthahahh nn 80808 , mamaakikikiingngngng tttthehehemmm sususuititititabababablelee fffforroror mmmanananyy y y appapplplplicicicatatatioioioonsnnss
susuchch aas s fofor r waw rehousses, shhoppppipipingngng aaatrtrtriuiuuuiuummsmsms,, bububusss termmiinin lalals,ss, ppprorodud ctcttctiooiionnn ararareaeeaeasss, sssupupuuperrerermmamam rkrkrketete s,, sportrtrtssss hahahalllllll s, rrresesestatataurururananantsts aa dndnd
many others.
serves as superb heat-sink ffor tthhe LLEDED llamamps aandnd mmododululeses. ThThee LELEDD lalampmps/s/ mmododululeses aarere ww lelellll prpr tototeccecteteteddd iwiwi hthth aa sstrtronongg
UV-stabilised polycarbonate diffuser which is rigidly sealed with thick rubber gasket to prevent dust and moisture.
This luminaire comes with a highly reliable built-in driver which is mounted at the top of the housing and enclosed
by a die-cast aluminium cover. Optional Prismatic or Aluminium reflector is also available upon request.
The LED lamps/ modules are available in 3000k (warm white) or 4000k (cool white) or 6500k (daylight) colour appearances.
The luminaire comes in black finish as standard.
DIMENSIONS (mm)
H(m) Luminance (Ix)
TM21 listed
Anti-rust stainless steel screws
Special designed heat sink
Die-cast aluminium housing with cooling fins Suitable for 3.5m - 12m mounting height 3mm thick tempered glass Nichia LED from Japan Meanwell driver from Taiwan Stainless steel screws Color rendering: Ra>80 Color temp: 3000K, 4000K, 6000K In standard black finish
Features
IP65 dust-tight and water-jet proof IK08 impact resistance Nichia LED: LM80 LED Modules safety IEC 62031 Photobiological safety IEC 62471 Approval marks: CE,UL,ENEC Beam angle 60° or 120°
Compliances and approvals
6
4
12m
120o
18m
24m
30m
36m
12m
120o
18m
24m
30m
36m
Optional
H
D
80
Three elegant and well-designed die-cast aluminium LED Hi-bay luminaires with a high heat resistant safety tempered clear glass covers to suit many applications such as
(IP 65)
cd/klm
8095.SU/LED
The housings are constructed with high quality die-cast aluminium, chemically treated and coated with polyester anti-corrosion powders.
The reflectors are made of high quality pressed aluminium, chemically anodised for added protection and provide good light distribution.
These hi-bay luminaires are dust-proof and waterproof to IP 65 specification by means of the 4mm thick clear tempered heat-resistant glass covers which are attached to the reflectors by strong stainless steel clips and durable rubber gaskets.
The high powered LED lamps are supplied as standand COOL-White (4000K) or COOL Daylight (5000K) colour temperatures to suit most applications.
CONSTRUCTION
510
500
12.5kg
120W LED (11576 lm) 150W LED (16159 lm)
8095.SU/LED 120W LED (14674 lm) 150W LED (17464 lm) 185W LED (21040 lm)
8032/LED 160W LED (17536 lm) 230W LED (28087 lm)
280 230
cd/klm
Dimension
Application
Description
Features
High quality Aluminum, excellent heat dissipation; light weight good for transportation.
Low glare, more than 60% energy saving, can replace 250W, 400W metal halide.
Different installation methods available.
BY1E series High-Bay adopting high edge technology which enhance heat dissipation and lighting efficiency. It can be widely used in commercial center, clothes shop, and indastry.
CRI
70
70
70
70
3100 5800 8800 12300 15500 18500 21600 24600 27700 30800
BY1E series High-Bay adopts a high edge technology which enhance heat dissipation and lighting effi ciency. It can be widely used in commercial center, retail shops, and industrial buildings.
Specifi cations are subject to changes without prior notice.
82
Model Number HB100W-LED HB200W-LED HB300W-LED HB400W-LED
Power (W) 100w 200w 300w 400w
Working Voltage AC 85V - 265V AC 85V - 265V AC 85V - 265V AC 85V - 265V
Frequency Range 50 - 60Hz 50 - 60Hz 50 - 60Hz 50 - 60Hz
Beam Angle 120o 120o 120o 120o
Colour Appearance
473
460320
510370
510370
Average LED lamp light 35,000 hrs 35,000 hrs 35,000 hrs 35,000 hrs
Lumens 8000 16000 24000 32000
Warranty 2 years 2 years 2 years 2 years
Chip EPISTAR EPISTAR EPISTAR EPISTAR
Weight 8.3 kg 10.9 kg 12.8 kg 14.6 kg
333
140
ø500
83
Wattage Model Nominal Weight 150W HBI 150H 8.4 kg 250W HBI 250H 8.9 kg 400W HBI 400H 9.5 kg
Wattage Model Nominal Weight 250W HBI 250H 7.6 kg 400W HBI 400H 8.5 kg
SODIUM LAMPS Wattage Model Nominal Weight
150W HBI 150S 8.9 kg 250W HBI 250S 9.4 kg 400W HBI 400S 10.5 kg
Wattage Model Nominal Weight 70W HBI 70L 7.6 kg 90W HBI 90L 8.2 kg
MERCURY LAMPS
METAL HALIDE LAMPS
/
W
84
The Aerolite Hi-Bay luminaire uses metal halide, mercury and high pressure sodium lamp from 70W up to 1000W. Now also available with 70W and 90W replaceble LED lamps.
The Hi-Bay gear housing is manufactured principally with solid gauge electro-galvanised steel sheet which is chemically treated with superb quality polyester powder coating for durability and high resistance to corrosion.
The control gears are neatly and rigidly fi tted into the well-ventilated gear housing for speedy installation and ease of maintenance.
The well designed refl ector is constructed with high quality anodised aluminium and is available in either plain polished fi nish for 70W to 1000W or reeded pattern for 70W - 400W range.
METAL HALIDE LAMPS Wattage Model Weight
150W ABH 150PR 8.2kg
250W ABH 250PR 8.7kg
400W ABH 400PR 9.3kg
1000W ABH 1000PR 16.2kg
150W ABM 150PR 7.4kg
250W ABM 250PR 8.3kg
400W ABM 400PR 14.8kg
1000W ABM 1000PR 15.9kg
150W ABS 150PR 8.7kg
250W ABS 250PR 9.2kg
400W ABS 400PR 10.3kg
1000W ABS 1000PR 16.3kg
70W ABL 700PR 7.2kg
90W ABL 90PR 7.8kg
Available with 70W / 90W LED Lamps to replace 150W / 250W Metal Halide Lamps
W
85
250W HB 250M
400W HB 400M
700W HB 700M
1000W HB 1000M
Available with 70W / 90W LED Lamps to replace 150W / 250W Metal Halide Lamps
SODIUM LAMPS
WATTAGE MODEL
86
Specifi cations are subject to changes without prior notice.or notice
· Die-cast aluminium housing · Corrosion-resistant polyester powder coating · UV-stablished impact-resistant polycarbonate diffuser · Lamps - 30W LED lamp, 24W, 60W Electronic lamp - 70W sodium, metal halide lamp
Available with 36W, 54W directional LED lamps
54W directional amps
Available with 30W LED lamp
A series of versatile LOW BAY LUMINARIES available with LED sodium, metal halide and mercury lamps in ratings from 36w to 400w at affordable price.
LED Lamps
LBL 36
LBL 54
36w LED
54w LED
SODIUM, HPS SODIUM, HPS SODIUM, HPS
150W 250W 400W
150W 250W 400W
Hinged trim and lens frame with high effi ciency refl ector
36W LED ( 2 X PLC 26W )
72W LED ( 150W METAL HALIDE ) 108W LED ( 250W METAL HALIDE )
With Flat Clear or Frosted ClassWith Flat Clear or Frosted Class
EURO 36 LED EURO 54 LED EURO 72 LED EURO 108 LED
36W LED 54W LED 72W LED
108W LED
88
Features and benefits
• High energy savings. System efficacy @ 130lm/W, saving up to 65% comparing to HPI-P system
• Superb light quality. Low UGR (NB/20 - WB/26) and accurate color (CRI > 80)
• Safe and reliable. This luminaire has an IP65/IK07 rating and lifetime 50,000 hours@L70B50
• Easy installation and maintenance. Super slim design and suits for hook, pipe and bracket mounting
Suggested application
Technical specifications
Operation temperature -30°C < Ta < 50°C
IP/IK rating IP65/IK07
Classification Class I
Installation Pendant (pole/hook/bracket)
Pipe, hook, and bracket mounting options Luminaire can be used for a wide range of applications.
Die-cast heat sink Air circulates throughout the luminaire for superior heat management and light quality. The design also prevents dust from accumulating on the surface.
Slim and light design It is easier to install and maintain the luminaire.
CRI > 80 Colors are rendered consistently and accurately.
Excellent light quality, maximum energy savings Designed with high-quality optics and a long lifetime, GreenPerform LED Highbay luminaire generates up to 65% more energy savings compared to HPI-P lighting systems. Greenperform Highbay also delivers superior light quality, improved optical choices to enable optimum lighting design for different industrial applications.
Indoor Lighting
89
5-10 KGS 7-15 KGS
Specifi cations are subject to changes without prior notice. 91
92
93
94
95
mm
9090
68
APPLICATION A very strong and high-impact resistant range of linear luminaires suitable for use in prison cells, detention areas, police
stations, train stations, underpasses, tunnels and many other areas that are prone to vandalism.
CONSTRUCTION The main housing is constructed with very sturdy 3mm thick one-piece aluminium extrusion and coated with high
quality polyester powder coating. The front diffuser is constructed with 4mm thick and strong UV-stablised polycarbonate
extrusion with ribbed lining for good wide-spread lighting distribution. The front diffuser is rigidly mounted to the
main housing with firm rubber gasket and secured by 4 numbers of special anti-theft stainless steel screws at both ends
enclosed by robust aluminium cappings.
ORORORORDEDEDED RIRIRIR NGNGNG CCCODODODDEEE
MOMOMOMOODEDEDED LLL LALALAMPMPMP TTTYPYPY EE NONONOOMIMIM NANAL L L LELELENGNGNGNGTHTHTHTH (((L)L)LL)L NONONONORMRMRMR ININININALALALLA WWWWEIEIEIGHGHGHG TTTT
ST - 218 PLC 2 x PLC 18w 300 mm 1.8 kg
ST - 20 LED 2 x w LED 300 mm 1.8 kg
ST - 114 T5 1 x 14w T5 600 mm 3.1 kg
ST - 214 T5 2 x 14w T5 600 mm 3.2 kg
ST - 128 T5 1 x 28w T5 1200 mm 6.1 kg
ST - 228 T5 2 x 28w T5 1200 mm 6.2 kg
ST - 109 LED 1 x 9w T8-LED 600 mm 3.1 kg
ST - 209 LED 2 x 9w T8-LED 600 mm 3.2 kg
ST - 118 LED 1 x w T8-LED 1200 mm 6.1 kg
ST - 218 LED 2 x w T8-LED 1200 mm 6.2 kg
Built-in asymmetrical reflector is available upon request.
Specifications are subject to changes without prior notice.
0
Recessed square LED panel with decorative V-shaped opal diffusers
bulidings.
as standard. Dimmable drivers are also available upon request. The LED lamps are available in Warm White (3000K) or Cool White (4000K) or Daylight (6000K) colour.
CLEANSEALCLEANSEAL Cleanseal is a high specification yet economical recessed luminaire which is sealed to IP54 for mounting in various types of suspended ceiling. It is suitable for use in areas where a high degree of sealing is required to prevent water and dust from the work space penetrating the luminaire or vice-versa.
Cleanseal is available in both non-discolouring prismatic or opal diffuser and is ideal for use in the food industry, hospitals, sterilized room, pharmaceutical and aseptic laboratories.
The housing is constructed of 0.8mm celectro-galvanised steel sheet manufactured with precise tolerance using computerized machine. It is then chemically treated and finished with tough, good reflective white powder-coating. The perimetrical aluminium frame is hingeable with several strong wishbone springs. It is powder-coated, fully rubber gasketed and it houses the prismatic or opal diffuser.
Illuminance at a Distance
2m m6.5m2.01310 LUX
4m m2.11m4.0278 LUX
6m m8.61m6.0334 LUX
595
595
95
Width (mm) Nominal
Length (mm) Nominal
Height (mm)
SEAL - 122P SEAL - 122O 2 x 18 W 300 600 95
SEAL - 223P SEAL - 223O 3 x 18 W 600 600 95
SEAL - 224P SEAL - 224O 4 x 18 W 600 600 95
SEAL - 142P SEAL - 142O 2 x 36 W 300 1200 95
SEAL - 242P SEAL - 242O 2 x 36 W 600 1200 95
SEAL - 243P SEAL - 243O 3 x 36 W 600 1200 95
SEAL - 244P SEAL - 244O 4 x 36 W 600 1200 95 Also available in surface-mounted version, add ‘sm’ to the prefi x when ordering.
Specifi cations are subject to changes without prior notice.
103
2m m6.5m2.01XUL 58.092
4m m2.11m4.02XUL 17.27
6m m8.61m6.03XUL 23.23
8m m4.22m8.04XUL 81.81
10m m0.82m0.15XUL 36.11
12m m6.33m2.16XUL 80.8
40W 80W 48W 24W
CRI Dimensions(mm)
CRI Dimensions(mm)
Model: CRV-22/40W
Recessed LED Luminaires with decorative curved diffusers
In Candela (cd)
‘EPISTAR’ LED
36W 50W 50W 65W
2520 3500 3500 4550
CRI ≥ 80 595 x 295 x 11
595 x 595 x 11 1195 x 295 x 11 1195 x 595 x 11
SLIM. 22/50W
SLIM. 41/50W
1.0m
2.0m
3.0m
4.0m
924.66
57.79
102.74
231.16
Dist (m) 3500 Lumens Average (Lux)
1.0m
2.0m
3.0m
4.0m
1321.06
82.57
146.78
330.27
LED T8 TUBE
105
Specifications are subjected to changes without prior notices
Aerolite A beautiful range of decorative pendant luminaires constructed with aluminium housings for use in many applications such as restaurants, hotel lobbies, meeting rooms,shopping complexes, classrooms etc.
SILVERLINE-R
300mm 30 mm
XUS-SCR
50W LED - Diameter (OD) - 600mm, ID - 380mm, 4750lm 60W LED - Diameter (OD) - 750mm, ID - 530mm, 5700lm 80W LED - Diameter (OD) - 900mm, ID - 680mm, 7600lm
50W LED - Diameter (OD) - 600mm, 4750lm 60W LED - Diameter (OD) - 750mm, 5700lm 80W LED - Diameter (OD) - 900mm, 7600lm
80mm 80mm
TUS
Also available with white or blue glass reflectors
9W LED 20W EL 30W, 40W LED
or 2 x 16W LED
te rs
SILVERLINE - E
8
Aerolite
106
107
108
A decorative range of suspended or surface-mounted luminaires with high quality aluminium housings and acrylic frosted opal diffusers. These luminaires use high quality LED Lamps which are available in warm-white(3000K),cool-white(4000K) or daylight(6000K) colour appearance.
TEXAS/T-LED
availabvailaabbai e(3000K),cool-white(40(e(3000K),c00K),cool-K),cool-whil-white(hite(40(4(4white(K),cool-we