Transcription and Translation - Lemon Bay High School vs. Translation Review On your Check Point...

Transcription and Translation

From DNA Code to ProteinsChapter 13 Lesson 2

Learning Goals:

We will identify the types of RNA and their role in protein synthesis.

Standard: SC.912.L.16.5 Explain the basic processes of transcription and translation and how they result in the expression of genes.

Recall: DNA vs. RNA

DNA

1. Strands?

2. Sugar?

3. Bases?

RNA

1. Strands?

2. Sugar?

3. Bases?

Both contain a sugar, phosphate, and base.

Recall: DNA vs. RNA

DNA

Double stranded

Deoxyribose sugar

Bases: C,G A,T

RNA

1. Strands?

2. Sugar?

3. Bases?


Recall: DNA vs. RNA

DNA

Double stranded

Deoxyribose sugar

Bases: C,G A,T

RNA

Single stranded

Ribose sugar

Bases: C,G,A,U


Recall: DNA & the Genetic Code

DNA contains a genetic code, the instructions to make an organism function.

DNA strands contain the nitrogen bases Cytosine, Guanine, Adenine, and Thymine.

DNA is able to replicate itself prior to cell division to ensure both new cells have the same DNA.

DNA code can be used in Protein Synthesis.

What are Proteins?

Made up of amino acids.

Polypeptide- string of amino acids.

Assembled at the ribosome.

20 amino acids are arranged in different orders to make a variety of proteins.

What is Protein Synthesis?

Process by which DNA codes are turned into proteins for the body to use.

2 Steps:

Transcription - Creating mRNA with DNA’s code

Translation – Using mRNA’s code & ribosomes to create proteins.

Recall: Transcription

Transcription is the first step in Protein Synthesis.

Occurs in the nucleus.

Segments of DNA code serve as templates to produce messenger RNA (mRNA) molecules.

mRNA contains the nitrogen bases Cytosine, Guanine, Adenine, and Uracil instead of Thymine.

Check Point Question:

If a template DNA strand is TACGATACGAT, what is the mRNA code?

Check Point Question:

If a template DNA strand is TACGATACGAT, what is the mRNA code?

AUGCUAUGCUA

mRNA Processing

DNA sequence has coding regions (exons) and non-coding regions (introns)

Introns must be removed before mRNA and can leave

nucleus

Newly made mRNA strand

Intron Exon Intron Exon Intron

Intron Exon Intron Exon Intron

Modified mRNA strand

Prior to leaving the nucleus, the mRNA must be modified

Transcription to Translation

Once the mRNA has been modified, it can then leave the nucleus to be used by the ribosome to make proteins.

Translation is the process by which a ribosome uses the mRNA message to produce a specific amino acid chain (polypeptide protein).

Occurs outside the nucleus in the cytoplasm.

Translation – Codons & Amino Acids

The ribosome reads the code three letters at a time. These three letters are called codons.

Each codon codes for a particular amino acid.

Check Point Question

How many codons are in this particular sequence:

AUGAACUCUGCCUAAGCGUAU

Check Point Question

How many codons are in this particular sequence:

Seven:

AUG AAC UCU GCC UAA GCG UAU

Translation - Codons

Codons code for particular amino acids, those amino acids are the building blocks of _______.


Codons code for particular amino acids, those amino acids are the building blocks of Proteins.


We can use codon charts to determine which codons code for which particular amino acids.

Ribosomes

Ribosomes read codons without codon charts

They use the sequence of codons on mRNA and the assistance of tRNA to assemble amino acids into polypeptide chains.

Recall Question: What is the role of the tRNA?

Welcome Transfer RNA (tRNA)!

tRNA brings the amino acids to the ribosome.

An Anticodon on the other end matches with the mRNA’s code.

Three different views:

Translation: The Finale

The polypeptide chain grows until it reaches a stop codon, the polypeptide chain is released and folded into a protein.

Transcription and Translation: Review

Transcription vs. Translation ReviewOn your Check Point Paper, answer the following

blanks:

Transcription

Process by which genetic information encoded in 1.___ is copied onto messenger RNA

Occurs in the 2. ______

DNA is used to create 3. ______

Translation

Process by which information encoded in mRNA is used to assemble a chain of 4. ______ at a ribosome


mRNA is used to create 6. ______


blanks:

Transcription

Process by which genetic information encoded in 1.DNA is copied onto messenger RNA



Translation





blanks:

Transcription


Occurs in the 2. Nucleus


Translation





blanks:

Transcription



DNA is used to create 3. mRNA

Translation





blanks:

Transcription




Translation

Process by which information encoded in mRNA is used to assemble a chain of 4.amino acids at a ribosome




blanks:

Transcription




Translation


Occurs in the 5. cytoplasm



blanks:

Transcription




Translation


Occurs in the 5. cytoplasm

mRNA is used to create 6. proteins

How to read a Codon Chart

Two kinds:

Square table Round Chart

Using the Codon AUG (start codon)

Locate the first letter of your codon using the left side of the table.

Look for the A

How to Read a Codon Chart/Table

Codon: AUG

The second letter of your codon is ‘U’

Look at the top of the table where you see the title ‘2nd letter’

Find the letter ‘U’ and follow it down until it intersects with the letter ‘A’.

Look to the right for the third letter, “G”

Move your finger from the ‘G’ on the left over to the left and you should land on ….. Methionine (start codon)

Yes you did it! Now, try another codon

Codon: AUG

Try the codon CAC – Write your Answer on your sheet

Try the codon CAC – Write your Answer on your sheet

Answer:Histidine

Transcription and Translation - Lemon Bay High School vs. Translation Review On your Check Point...

Documents

Transcript of Transcription and Translation - Lemon Bay High School vs. Translation Review On your Check Point...