Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing...
-
Upload
elinor-austin -
Category
Documents
-
view
235 -
download
0
Transcript of Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing...
![Page 1: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/1.jpg)
www.grimmy.com/
![Page 2: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/2.jpg)
Transcription &
Translation
![Page 3: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/3.jpg)
•Transcription: writing again
•Translation: changing languages
![Page 4: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/4.jpg)
Today we’ll go from here... To here
Text
![Page 5: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/5.jpg)
Off to see the wizard...
• DNA replication
– both strands => new DNA
– => new cell
• Transcription– 1 strand => new RNA– => new protein
Sending ‘messages’ out from DNA
![Page 6: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/6.jpg)
20 toys• EVERY one has a blue part. Chem name?• EVERY one has a red part. Chem name?• Thus these are all…? • How many are there?
![Page 7: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/7.jpg)
Amino Acids• How are they similar?• How are they different?• What do the differences mean in
terms of “feel”?• How many are there?• Possible?
![Page 8: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/8.jpg)
Amino Acids• You & partner have an amino
acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids)
![Page 9: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/9.jpg)
Nucleic Acids• How are they similar?• How are they different?• What do the differences mean in
terms of “feel”?• Which is more diverse in terms of
shape and ‘feel’?• Which would allow for more diverse
shapes and surfaces when ‘connected’?
![Page 10: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/10.jpg)
How does a codon ‘mean’ an amino acid?
![Page 11: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/11.jpg)
The Play is the thing…
![Page 12: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/12.jpg)
The Play is the thing…Or, Fun With Blocks
![Page 13: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/13.jpg)
The Play is the thing…
• ‘Types of Bonds’– Velcro – can be easily broken/re-
made during lab– Duct tape – breaking it gets you and
zero (0) for this week’s quiz
![Page 14: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/14.jpg)
The Play is the thing…
• The Players
![Page 15: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/15.jpg)
The Play is the thing…
• The Players– tRNA
![Page 16: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/16.jpg)
The Play is the thing…
• The Players– tRNA– Ribosome
![Page 17: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/17.jpg)
The Play is the thing…
• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase
![Page 18: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/18.jpg)
The Play is the thing…
• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase– RNA polymerase
![Page 19: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/19.jpg)
The Play is the thing…
• The Players– tRNA (4 people)– Ribosome (1)– Aminoacyl tRNA synthetase (4)– RNA polymerase (1-2) * and RNA– Termination factor (1)
![Page 20: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/20.jpg)
Blinding you with Science (jargon)
RNA Polymerase: joins RNA links into a chain
mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA
tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids
ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide
aminoacyl tRNA synthetase: protein machine adds amino acid to tRNAs
Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart
![Page 21: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/21.jpg)
Learning your ‘lines’
• Handout: Each group find questions related to their role; answer them
• Lab manual, textbook, internet OK as sources
• Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts
5’ end is pointy/spiky3’ end is soft/furry
![Page 22: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/22.jpg)
DNA Template
• 5’ CTTAAATCCGAATGCCCATG 3’
5’ is “sticky”, 3’ is “fuzzy”
![Page 23: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/23.jpg)
5’ CTTAAATCCGAATGCCCATG 3’5’ is “sticky”, 3’ is “fuzzy”
![Page 24: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/24.jpg)
Wielding the Power• ‘Recall’ that ribosome assembly is
the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit
• Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!
![Page 25: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/25.jpg)
Ready…. Go!• mRNA at the central bench• ribosome assembles around it• synthetases at bench corners (or ‘diffuse’
opp. direction vs. tRNA)• tRNAs will ‘diffuse’ by following a path
through the room• When any event first happens*, action
stops, molecules involved will announce, explain
• Go until a protein happens
![Page 26: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/26.jpg)
“Who” knows what’s going on?
• What happens if a tRNA carries the wrong amino acid?
• What happens if the mRNA contains a copy error relative to DNA?
• What happens if a tRNA has a mutated anticodon
![Page 27: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/27.jpg)
Exit Condition1.) Pair up (two in a group)
2.) Write your names and SECTION at the top of the paper3.) EXPLAIN the process of TRANSLATION
Include the following in your answer:tRNAmRNA
RibosomeAUG codon
RNA polymeraseAminoacyl tRNA synthetase
Termination factordiffusion
![Page 28: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/28.jpg)
Meet your new best
friend
![Page 29: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/29.jpg)
Protocol:(1) Put a ½ inch layer of milk into a picnic
plate
(2) Add a drop of each of several food colorings at different locations towards the perimeter
(3) Touch a wooden stick to a dab of dishwashing detergent
(4) Touch the detergent to the center of the milk
(5) Observe!
![Page 30: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/30.jpg)
WHAT DID YOU SEE?
-Hypothesize: What all is going on? How can you
test your hypothesis?
![Page 31: Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.](https://reader036.fdocuments.in/reader036/viewer/2022062305/5697bfb51a28abf838c9d7c6/html5/thumbnails/31.jpg)