Supplementary figure 2

2
Supplementary figure 2 a. b. +/+ +/m kb 12 8 M +/+ +/m m/m 2 kb 540bp 387bp c. d. Supplementary figure 2. Generation of Unc5b mutant mice a. Schematic representation of UNC5B. Arrowhead indicates site of gene targeting into the first Ig-domain of the Unc5b gene. IG: immunoglobulin domain, TSP: thrombospondin repeat, TM: transmembrane domain, ZU5: ZU5 domain, DB: domain required for DCC binding, DD: death domain. b. Top: wild-type Unc5b locus. Bottom: targeted allele harboring the ‘secretory gene trap cassette’ 34 . The black bars indicate exons. Domains encoded by individual exons are indicated on top. SS, signal sequence; SA, splice acceptor; ß-geo, ß-galactosidase and neomycin phosphotransferase fusion; IRES, internal ribosomal entry site, PLAP, human placental alkaline phosphatase. c. Southern analysis of ES cell DNA to identify the targeted clones. +, wild-type allele; m, mutant allele. The probe and the detected DNA fragments are indicated in b. d. PCR genotyping of unc5b mutant mice. +, wild-type allele; m, mutant allele. The PCR fragments amplified from the two alleles are indicated by arrows in b. The following primers were used: Unc5b: ACTAGAATGCTGTCCAGAC/AGAGGAGAGCAACGGATG, Plap: TGCACATGCTTTACGTGTG/CGCGTGTCGTGTTGCAC.

description

Supplementary figure 2. +/+ +/m. kb. 12. 8. M +/+ +/m m/m. 2 kb 540bp 387bp. a. b. c. d. Supplementary figure 2. Generation of Unc5b mutant mice - PowerPoint PPT Presentation

Transcript of Supplementary figure 2

Page 1: Supplementary figure 2

Supplementary figure 2a.

b.

+/+ +/mkb

12

8

M +/+ +/m m/m

2 kb

540bp387bp

c. d.

Supplementary figure 2. Generation of Unc5b mutant micea. Schematic representation of UNC5B. Arrowhead indicates site of gene targeting into the first Ig-domain of the Unc5b gene. IG: immunoglobulin domain, TSP: thrombospondin repeat, TM: transmembrane domain, ZU5: ZU5 domain, DB: domain required for DCC binding, DD: death domain.b. Top: wild-type Unc5b locus. Bottom: targeted allele harboring the ‘secretory gene trap cassette’34. The black bars indicate exons. Domains encoded by individual exons are indicated on top. SS, signal sequence; SA, splice acceptor; ß-geo, ß-galactosidase and neomycin phosphotransferase fusion; IRES, internal ribosomal entry site, PLAP, human placental alkaline phosphatase. c. Southern analysis of ES cell DNA to identify the targeted clones. +, wild-type allele; m, mutant allele. The probe and the detected DNA fragments are indicated in b. d. PCR genotyping of unc5b mutant mice. +, wild-type allele; m, mutant allele. The PCR fragments amplified from the two alleles are indicated by arrows in b.The following primers were used:Unc5b: ACTAGAATGCTGTCCAGAC/AGAGGAGAGCAACGGATG,Plap: TGCACATGCTTTACGTGTG/CGCGTGTCGTGTTGCAC.

Page 2: Supplementary figure 2

Supplementary figure 2e.

Supplementary figure 2 (continued). Generation of Unc5b mutant micee. Northern blot analysis of total RNA from E10.5 embryos using the probes indicated. Wild-type transcripts were not detected in the mutant. +, wild-type allele; m, mutant allele.f. Real-time RT-PCR analysis of total RNA from E10.5 embryos. The coding regions amplified by different primer pairs are indicated on the left. Expression levels in wild-type are set to 100 percent. Expression levels in the mutants on average are less than 3 percent of wild-type for all coding regions 3’ to the site of gene targeting. +, wild-type allele; m, mutant allele.The following primer pairs were used:Unc5b: ACAGGCACTCCCTCCGGTGG/ATCGTCTATGTGAATGGAGG

TTGCACCACCGTGTGCCCAG/TGCCATGCACTCGCGGCTGCATCAGAGAACTCTAAACGAC/ACCGCTACCACCACAAAGACCAAGGCCCAACAACCCGCAG/TGTCGGCGGAGTCCTGCAGGAGCCTGTTGGTACCAAATGG/TTCTGAAAGTGGGAGGGTGCACTGGGAGGAGGTGGTGACC/AGCTGGTCCAGCAGGATGTGACACACCTGTAGCACTGAAG/GTAGGTTGTGGTAACTGTCCTGGCCAAGTACCAGGAGATTC/TCCGTGGAGGCCAGGCTATGTTGGCCGAGACGCCTGCTGG/TATCTTGAAGGCATAGGGTCCAGAAGCTGTCCATGGACCG/TCATCCTGTTGCCGAGCTTC

Transferrin receptor:TGGGAACAGGTCTTCTGTTG/TGCAGTCCAGCTGGCAAAGA.

18S rRNA

+/+ +/m m/mkb

9.497.46

4.40

2.37 Probe: exons 1-17

9.497.46

4.40

2.37 Probe: exons 5-17

+/+ +/m m/m

5,6

6,7

8,9

9,10

11,12

12,13

13,14

14,15

15,16

16,17

exonsamplified:

0 50 100% normalized expression level

f.