Sequencing

Informatics

Gabor T. Marth

Department of Biology, Boston Collegemarth@bc.edu

BI420 – Introduction to Bioinformatics

The nuclear genome (chromosomes)

The genome sequence

• the primary template on which to outline functional features of our genetic code (genes, regulatory elements, secondary structure, tertiary structure, etc.)

Completed genomes

~1 Mb~100 Mb

>100 Mb

~3,000 Mb

Main genome sequencing strategies

Clone-based shotgun sequencing

Whole-genome shotgun sequencing

Human Genome Project Celera Genomics, Inc.

Hierarchical genome sequencing

BAC library construction

clone mapping

shotgun subclone library construction

sequencing

sequence reconstruction (sequence assembly)Lander et al. Nature 2001

Clone mapping – “sequence ready” map

Hierarchical genome sequencing

BAC library construction

clone mapping

shotgun subclone library construction

sequencing/read processing

sequence reconstruction (sequence assembly)Lander et al. Nature 2001

Shotgun subclone library construction

BAC primary clone cloning vector

sequencing vector

subclone insert

Hierarchical genome sequencing

BAC library construction

clone mapping

shotgun subclone library construction

sequencing/read processing

sequence reconstruction (sequence assembly)Lander et al. Nature 2001

Sequencing

Robotic automation

Lander et al. Nature 2001

Base calling

GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT

Base calling

PHREDbase = AQ = 40

Vector clipping

Hierarchical genome sequencing

BAC library construction

clone mapping

shotgun subclone library construction

sequencing/read processing

sequence reconstruction (sequence assembly)Lander et al. Nature 2001

Sequence assembly

PHRAP

Repetitive DNA may confuse assembly

Sequence completion (finishing)

CONSED, AUTOFINIS

H

gapregion of low sequence coverage and/or quality

New sequencing technologies

From familiar ABI traces …

… and Solexa reads.… to 454 pyrograms …

100 x 1,000 bp

100 thousand x 100 bp50 million x 20 bp