Research Article Holocarboxylase Synthetase 1 Physically...

Hindawi Publishing CorporationScientificaVolume 2013 Article ID 983501 9 pageshttpdxdoiorg1011552013983501

Research ArticleHolocarboxylase Synthetase 1 Physically Interacts withHistone H3 in Arabidopsis

Xi Chen1 Hui-Hsien Chou12 and Eve Syrkin Wurtele1

1 Department of Genetics Development and Cell Biology Iowa State University Ames IA 50011 USA2Department of Computer Science Iowa State University Ames IA 50011 USA

Correspondence should be addressed to Eve Syrkin Wurtele mashiastateedu

Received 3 December 2012 Accepted 30 December 2012

Academic Editors J Koch and J J Lazaro

Copyright copy 2013 Xi Chen et alThis is an open access article distributed under the Creative Commons Attribution License whichpermits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Biotin is a water-soluble vitamin required by all organisms but only synthesized by plants and some bacterial and fungal speciesAs a cofactor biotin is responsible for carbon dioxide transfer in all biotin-dependent carboxylases including acetyl-CoA car-boxylase methylcrotonyl-CoA carboxylase and pyruvate carboxylase Adding biotin to carboxylases is catalyzed by the enzymeholocarboxylase synthetase (HCS) Biotin is also involved in gene regulation and there is some indication that histones can bebiotinylated in humans Histone proteins and most histone modifications are highly conserved among eukaryotes HCS1 is theonly functional biotin ligase in Arabidopsis and has a high homology with human HCSTherefore we hypothesized that HCS1 alsobiotinylates histone proteins in Arabidopsis A comparison of the catalytic domain of HCS proteins was performed among eukary-otes prokaryotes and archaea and this domain is highly conserved across the selected organisms Biotinylated histones couldnot be identified in vivo by using avidin precipitation or two-dimensional gel analysis However HCS1 physically interacts withArabidopsis histone H3 in vitro indicating the possibility of the role of this enzyme in the regulation of gene expression

1 Introduction

Biotin is a water-soluble B-complex vitamin that is requiredby all organisms [1] The main role of biotin is to serve as acofactor for carboxylases [2 3] Addition of biotin to carboxy-lases is catalyzed by holocarboxylase synthetase (HCS) in atwo-step ATP-dependent reaction [4] Based on the crystalstructure of BirA the E coli HCS [3] the first step producesan intermediate biotinyl-51015840-AMP (B-AMP) B-AMP is thentransferred to a specific lysine residue of the carboxylasewith the release of AMP [5] Five biotin-dependent proteinshave been characterized in plants [3] One of them is a seed-specific protein SBP65 for biotin storage [6 7] The otherfour are all carboxylases homomeric acetyl-CoA carboxy-lase heteromeric acetyl-CoA carboxylase geranoyl-CoA car-boxylase and methylcrotonyl-CoA carboxylase [8ndash11]Theseenzymes are involved in many important metabolic path-ways such as gluconeogenesis fatty acid synthesis andamino acid catabolism [3] (Figure 1)

Biotin also participates in gene regulation [12ndash15] butthe mechanisms are largely unknown Evidence for histone

biotinylation was reported in humans and this modificationwas attributed toHCS [16 17] Biotinylated histoneswere sug-gested to increase during mitotic DNA condensation het-erochromatin formation gene silencing and DNA repair[16 18 19]These data indicated that biotinmight be involvedin human gene regulation by remodeling histones Histonesand most histone modifications are highly conserved [20]thus plants may use a similar mechanism involving biotin toregulate gene expression HCS1 is the only functional enzymein Arabidopsis for biotin ligation [21] and shares a conservedcatalytic domain with humans Therefore we hypothesizedthat HCS1 also biotinylates histone proteins in plants To testthis hypothesis we used two approaches analysis of histonefor modification by biotinylation in vivo and glutathione S-transferase (GST) pull-down assays to detect whether therewas an interaction between HCS1 and Arabidopsis histoneproteins in vitro Biotinylated histones could not be identifiedin vivo by avidin precipitation or two-dimensional (2D) gelanalysis However HCS1 pull-down assays indicate thatHCS1specifically binds to histone H3 protein in vitro These resultssuggest that covalent modifications of histones by biotin may

2 Scientifica

Pimelic acid + alanine

BIO1BIO3

BIO2

Biotin

Exogenous biotin

Biocytin

Biotin sulfoxide

HCS

SBP

Fatty acids

fatty acidsElongated

BIO4

Membranes oilssignaling

Cuticle suberin

FAS

Elongase

holo-htACCase

Biot

in

Biot

inid

ase

Biot

in su

foxi

de

redu

ctas

e

trans

port

holo-MCCase

holo-GCCase

apo-htACCase

apo-SBP

apo-hmACCase

apo-MCCase

Acetyl-CoA

Malonyl-CoA

Acetyl-CoA

Malonyl-CoA

Geranoyl-CoA

Carboxyl-granoyl-CoA

MC-CoA

MG-CoA

HMG-CoA Acetyl-CoA

Propionyl-CoA

holo-hmACCase

apo-GCCase

Figure 1 Biotin network in plants Schematic map of the metabolism associated with biotin Metabolitesrsquo names are in black text Red arrowsrepresent the biotinylating actions of HCS on biotin-dependent proteins Black arrows represent other metabolic reactions characterizedin plants Enzymes identified by direct biochemical evidences are shaded in green boxes Grey-dotted arrows represent the reactionscharacterized in humans or E coli but not in plants so far Enzymes not identified in plants but characterized in humans or E coli are shadedin grey boxes

not naturally exist in Arabidopsis although some types ofphysical interaction between HCS1 and histones may occur

2 Results

21 The Functional Domain of HCS Proteins Is Highly Con-served HCS1 has two protein isoforms generated by alter-native splicing HCS1-T (containing a targeting signal forchloroplast and mitochondria localization) and HCS1-CY(not containing any targeting signal and accumulating incytosol) [21] HCS1-T and HCS1-CY share two proteindomains lipoate-protein ligase AB (BPL lipAB) and biotinprotein ligase C terminus (BPL C) BPL lipAB is a catalyticdomain for biotin ligation and was initially determined fromthe crystal structure of BirA [22] This catalytic domain[4 23] has a high identity (about 30) across Drosophilahumans E coli and Pyrococcus abyssi GE5 HCS proteins(Figure 2) Specifically eight residues in or around theBPL lipAB domain are highly conserved across the selectedHCS proteins (Figure 2)These eight residues directly contactbiotin [22] The BPL C domain is thought to interact withATP and the substrates [24] it is also conserved across HCSproteins (Figure 2) In this domain two motifs Leu-Tyr-Tyr-(ArgLys) and Pro-Asp-Gly-Asn-Ser-Phe-Asp have a high

homology among eukaryotic organisms but are not found inprokaryotes and archaea (Figure 2)The function of these twomotifs is still unknown Amissensemutation in Leu-Tyr-Tyr-(ArgLys) was recently reported in a patient with humanHCSdeficiency [25] thus this motif may be important to HCSfunction

22 Biotinylated Histone H3 Could Not Be Identified in Ara-bidopsis Using Avidin Precipitation Analyses To investigatewhether biotinylated histone H3 exists in Arabidopsis totalproteins were isolated from Arabidopsis and used for avidinprecipitation After avidin precipitation proteins were sep-arated by 15 SDS-PAGE and probed with I125-streptavidinand histone H3 antibody respectively The resultant westernblots showed the biotinylated protein signals in the totalprotein extract from Arabidopsis (Figure 3 left panel ldquoInputrdquoand ldquoSuprdquo lanes) and highly accumulated signals in theavidin precipitate at the locations of biotinylated proteins[21] (Figure 3 left panel ldquoAPrdquo lane) The negative control(avidin beads only) showed no positive signals (Figure 3left panel ldquoBrdquo lane) This result indicates that biotinylatedproteins were precipitated successfully However when thesame precipitates were probed with histone H3 antibody nohistone H3 proteins were detected The result means that no

Scientifica 3

ArabidopsisDrosophila

Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli

Figure 2 Multiple sequence alignments of HCS proteins The highly conserved sequences of HCS proteins among different organisms werealigned using CLUSTALX [27] Eight amino acids labeled by red boxes are required for biotin ligation according to the BirA crystal structure[22] The BPL lipAB and BPL C domains are underlined in green and orange respectively Δ is location of Y663 mutation in a patient withHCS deficiency

171110

79604735

251814

ACC1

MCCBCCP1

BCCP2

Input Sup W1 W2 W3 AP B17111079604735

251814

Input AP B

Histone H3 antibodyI125-streptavidin

Figure 3 Avidin precipitation assays The protein samples were analyzed by 15 SDS-PAGE I125-streptavidin (left panel) and histone H3antibody (right panel) were used in the western blots Input total protein extracted from Arabidopsis B blank control where avidin beadswere used only with release buffer Sup the supernatant after the avidin beads were incubated with Arabidopsis lysate overnight W123 thesupernatants for the first second and third washes separately after the incubation AP precipitation of total protein preformed with avidinbeads ACC1 homomeric acetyl-CoA carboxylase MCC methylcrotonyl-CoA carboxylase BCCP1 biotin carboxyl carrier protein1 whichis part of the heteromeric acetyl-CoA carboxylase BCCP2 biotin carboxyl carrier protein2 which is part of the heteromeric acetyl-CoAcarboxylase Experiments were conducted in triplicate

biotinylated histone H3 proteins were precipitated by avidinbeads (Figure 3 right panel ldquoAPrdquo lane) Similar experimentswere repeated under a wide variety of immunoprecipitationand western blot conditions but none detected any biotiny-lated histone [26] Taken together the data suggest thatbiotinylated histoneH3 could not be identified in an extended

precipitation analysis or the amount of biotinylated histoneH3 is too low to be detectable [16]

23 Biotinylated Core-Histones Could Not Be Identified in Ara-bidopsis Using 2D Gel Analysis 2D gel analysis was usedto investigate whether any core-histones (H2A H2B H3

4 Scientifica

70605040

30

2520

15

10

W H Ct

Coomassie blue

14

Histone H3 antibody

(a)

11079604735251814

6

pH12 pH9

Streptavidin-HRP

11079604735251814

6

pH12 pH9

Core-histones antibody

(b)

Figure 4 2D gel analysis (a) Histone proteins were enriched from Arabidopsis young seedling lysate and stained with Coomassie BlueThe same amount of total and histone-enriched proteins was separated by 15 SDS-PAGE and the western blot results showed that histoneproteinswere enriched fromArabidopsis young seedling lysateW the total isolated proteinsH the histone-enriched proteins Ct commercialcalf thymus histones (Sigma) (b) The histone-enriched proteins were analyzed by 20 SDS-PAGE with pH gradient from 9 to 12 The biotinsignals that concentrate at pH 9 versus the core-histones signals that distribute between pH 10 to 11 Experiments were conducted in triplicate

and H4) are biotinylated in Arabidopsis Histone-enrichedproteins were isolated from Arabidopsis by sulfuric acidprecipitation Compared to the same amount of total proteinextracted by using neutral lysis buffer (Figure 4(a) ldquoWrdquo lane)histone-enriched proteins were highly accumulated by usingacid buffer (Figure 4(a) ldquoHrdquo lane) Commercial calf thy-mus histones were used as control (Figure 4(a) ldquoCtrdquo lane)The histone-enriched proteins were subjected to isoelectricfocusing using a gradient of pH 9ndash12 and separated in asecond-dimension by 20 SDS-PAGE Biotin signals weredetected by streptavidin-HRP (Figure 4(b)) they are mainlydistributed on the right side (simpH 9) where the knownArabidopsis biotinylated proteins (biotin-dependent carboxy-lases) are located (all these enzymes are neutral proteins) Incontrast when probed for the location of histone proteinsusing antiserum to core-histones most signals are concen-trated in the central area (simpH 10 to 11) where histonesall basic proteins are located (Figure 4(b)) No overlap inlocations is detectable between the signals from these twoantibodies This suggests that no core-histone proteins arebiotinylated in Arabidopsis

24 HCS1 Interacts with Arabidopsis Histone H3 Directly InVitro To identify whether HCS1 physically interacts withhistone proteins aGSTpull-down assaywas performed TotalRNA was prepared from Arabidopsis whole seedlings andthe full-length histone H3 and HCS1 RNA sequences wereobtained by amplification of histone H3 (AT1G09200) andHCS1 (AT2G25710) with transcript-specific primersThe full-length HCS1 cDNA was cloned into pGEX4T vector (GST-tagged) and the full-length cDNA of Arabidopsis histoneH3 was cloned into pDEST17 vector (His-tagged) Aftertransforming each vector into E coli GST-HCS1 and His-histone H3 protein expressions were induced by isopropyl 120573-d-thiogalactoside (IPTG) or L-arabinose (Figure 5(a))

A GST pull-down assay was used in which recombinantproteins were purified from E coli using glutathione beadsor metal affinity chromatography In this assay purified GST-HCS1 proteins were incubated with glutathione-sepharosebeads for 1 hr followed by addition of His-Histone H3 pro-tein After overnight incubation at 4∘C beads were washedextensively with assay buffer (10mM Hepes 100mMNaCland 10mM 120573-mercaptoethanol pH 70) and resuspended in

Scientifica 5

706050

40

30

25

20

C I P PC I

GST-HCS1 His-H3

Coomassie blue

(a)

70

605040302520

14

GST-HCS1

GST

Histone H3

GST antibody

Histone H3 antibody

GST-HCS1 GST Input His-H3

GST antibody

(b)

Figure 5 HCS1 interacts with Arabidopsis histone H3 directly in vitro E coli lines that contain GST-HCS1 His-H3 or GST construct wereinduced to express these genes After induction total protein was extracted from the cell lines Recombinant His-histone H3 protein waspurified from E coli by using metal affinity chromatography Recombinant GST-HCS1 or GST alone was purified from E coli by usingglutathione-sepharose beads Proteins were subjected to GST pull-down assays with GST-HCS1 or GST alone and probed by western blot todetect whether there was an interaction between HCS1 and histone H3 (a) Proteins were analyzed by 15 SDS-PAGE and stained withCoomassie Blue I total proteins extracted from E coli containing a GST-HCS1 or a His-H3 construct C total proteins extracted from controlE coli (not containing any vector) P recombinant GST-HCS1 or recombinant His-H3 proteins (b) Western blot of proteins after GST pull-down to detect whether there was an interaction between HCS1 and histone H3 GST-HSC1 fusion protein and GST were detected with GSTantibody Histone H3 was detected with corresponding antibody GST-HCS1 the proteins released from the beads coupled with GST-HCS1after being incubated with His-histone H3 proteins Histone H3 pulled down by GST-HCS1 was detected GST the proteins released from thebeads coupled with GST control after being incubated with His-histone H3 proteins no histone H3 was detected Input His-H3 10 of thetotal input recombinant His-histone H3 proteins Histone H3 was strongly detected as expected Experiments were conducted in triplicate

2X SDS loading buffer After boiling and centrifugation thesupernatant was separated by 15 SDS-PAGE The proteinsin each sample were separated by 15 SDS-PAGE and trans-ferred to a membrane The membrane was cut into twosuch that the top portion contained proteins from sim20 kDto sim110 kD and the bottom portion contained proteins fromsim6 kD to sim20 kD The top portion was probed with GSTantibody to detect any GST or the GST-fusion protein GST-HCS1 the bottom portion was probed with histone H3 anti-body The resultant western blots revealed that His-histoneH3 proteins are pulled down by GST-HCS1 fusion proteinsbut not by a GST protein control (Figure 5(b)) indicatingthat HCS1 specifically interacts with Arabidopsis histone H3in vitro

3 Discussion

Steven Stanley et al first discovered that humans may havehistones modified by biotin [16] Biotinylated sites wereidentified onH2A (lysines 9 13 125 127 and 129) H3 (lysines4 9 and 18) and H4 (lysines 8 and 12) [28ndash31] As with otherhistone modifications the levels of biotinylation of histoneschange during a variety of cellular processes [16 18 19]Histones have been reported to be biotinylated by humanHCS human biotinidase and E coli BirA in vitro [17 29 3233] but only by human HCS in vivo [17] Biotinidase is an

enzyme required for recycling biotin from biocytin (lysine-biotin complex) which is essential for animals but has notbeen identified in plants [34] In Arabidopsis HCS1 is theonly known candidate for a functional biotin ligase thatmightbiotinylate histones

Protein alignments show that BPL lipAB the catalyticdomain of HCS proteins is highly conserved across Ara-bidopsis Drosophila human E coli and Pyrococcus abyssiGE5 In the canonical reaction BPL lipAB catalyzes biotiny-lation on a specific lysine residue of each biotin-dependentcarboxylase [1 29] This lysine residue locates within ahighly conserved Ala-Met-Lys-Met motif [29] and eachbiotin-dependent carboxylase possesses only one specificlysine residue for biotinylation Conversely in histones thebiotinylated lysine residues are not found in a consistentregion and a histone protein usually hasmultiple biotinylatedsites [28ndash31] This suggests that a novel mechanism may beused when HCS biotinylates histones In vitro experimentsindicate that humanHCS or E coli BirA catalyzes biotin ontoAMP to form B-AMP Surprisingly B-AMP can be attachedto recombinant human H2A automatically without the needof enzymes [31] Due to the high homology in the HCScatalytic domain among Arabidopsis humans and E coliwe hypothesize that HCS1 may also biotinylate Arabidopsishistone H3 in vitro automatically Our studies indicate thatHCS1 indeed interacts with Arabidopsis histone H3 in vitro(Figure 4) partly validating our hypothesis

6 Scientifica

Table 1 Primers used for RT-PCR

Construct name Primer name Primer sequence

Histone H3 (His-tag) HistoneH3fw CACCATGGCTCGTACCAAHistoneH3re TTACAATCTTATGGTTCTAATCAAA

HCS1 (GST-tag) HCSFW GGGAATTCATGTTGTTTCTCATTTCTTHCSRE GGCTCGAGTCATATTTTTCTTCGA

Immunofluorescence studies showed that the majority ofhuman HCS localizes to the nucleus rather than the cytosolthus if it acts on histones in humans it would likely act insitu in the nucleus [17] Arabidopsis HCS1 has two proteinisoforms HCS1-T and HCS1-CY [21] HCS1-T processesa dual targeting signal for chloroplast and mitochondrialocalization whereas HCS1-CY only accumulates in cytosolwithout any characterized targeting signal [21] Thereforeif any interaction between HCSbiotin and histones occursin Arabidopsis the modification would likely occur in thecytosol before export of histone into the nucleus

The notion that humans possess biotinylated histones hasbeen questioned recently [35 36] Three independent meth-ods [3H]-biotin uptake western blot andmass spectrometryanalysis were used to recheck the occurrence of humanhistone biotinylation [35 36] Using each method biotiny-lated histones could be identified from in vitro experimentsbut were not detected in any in vivo experiment Even theresearch groupmembers that originally reported biotinylatedhistones doubted their own results finding that the avidin-HRP probe they used for validating biotinylated histonesin vivo may not be credible [35] Researchers also testedwhether BirA can biotinylate recombinant human histoneH2A in E coli by increasing the amounts of radioactive-labeled biotin that was supplied to themedium Although theradioactive signal from p-67 (a biotin-acceptor protein usedas control) was easily detected no biotinylated recombinantH2Awas identified (unpublished data)These studies suggestthat caution should be exercised in detection of biotinylatedhistones

Thus to date it has been challenging to detect biotinylatedhistones isolated from either humans [35] or Arabidopsis(in this study) However HCS1 itself does interact withArabidopsis histone H3 in vitro If HCS1biotin interacts withhistones in Arabidopsis in vivo the interaction may involvea mechanism different from the covalent biotinylation thatoccurs to carboxylases Understanding such an interactionmay provide insight as to how biotin regulates gene expres-sion rather than through biotinylated histones

4 Material and Methods

41 PlantMaterials Arabidopsis seedswere surface-sterilizedand dispensed into solid MS medium Solid MS medium inPetri dishes contains 43 gLMS (Murashige and Skoog salts)1X B5 vitamins (100 120583gmL myoinositol 1120583gmL pyridoxinehydrochloride 1120583gmLnicotinic acid and 10120583gmL thiaminehydrochloride) and 06 (wv) agar gel buffered with

256mM MES at pH 57 [37] After two-week growth Ara-bidopsis whole seedlings were collected for RNA preparationand histone-enriched protein extraction

42 Cloning of Full-Length Histone H3 and HCS1 ProteinsTotal RNA was prepared from Arabidopsis whole seedlingsAfter TRIzol (Invitrogen) extraction first-strand cDNAswere produced by Superscript II reverse transcriptase (Invit-rogen) with oligo dT primer according to the manufacturerrsquosinstruction PCR fragments corresponding to histone H3(AT1G09200) and HCS1 (AT2G25710) were amplified withthe primers listed in Table 1

43 Overexpression of Recombinant His-Histone H3 and GST-HCS1 Proteins AmplifiedPCR fragments for histoneH3werecloned first into an entry vector pENTRSDD-TOPO whichwas then recombined with a binary vector pDEST17 [38]Theconstruct of His-histone H3 was verified by sequencing andwas transformed into E coli BL21 (AI) strains (Invitrogen)After 4 hr induction by addition of L-arabinose to the E coliculture media total proteins were separated by 15 SDS-PAGE [39]

Amplified PCR fragments for HCS1 were digested withEcoRI and XhoIThey were then ligated into the correspond-ing digested sites on the pGEX4T vector The construct ofGST-HCS1 was verified by sequencing and was transformedinto E coli BL21 (DE3) strains After 4 hr induction byaddition of IPTG to the E coli culture media total proteinswere separated by 15 SDS-PAGE [39]

44 Purification of Recombinant His-Histone H3 and GST-HCS1 Proteins E coli cells BL21 (AI or DE3) were grown in1 L flasks to an absorbance of OD 05 Then cells were pel-leted washed and lysed with lysis buffer (lysozyme 100mgL10mM DTT 1mM PMSF and 1 Triton in PBS buffer) [4041] Crude lysate of GST-HCS1 was coupled to glutathione-sepharose beads (Sigma) After overnight incubation at4∘C the beads were washed extensively with PBS buffer(137mMNaCl 27mMKCl 10mM sodium phosphate diba-sic and 2mM potassium phosphate monobasic pH 75)Recombinant GST-HCS1 proteins were released with elutionbuffer (10mM Tris 150mM NaCl and 20mM reduced glu-tathione pH 75) and separated by 15 SDS-PAGE Recom-binant His-histone H3 proteins were purified with Ni-NTAbeads (Novagen) by following the manufacturerrsquos instructionand separated by 15 SDS-PAGE

45 Avidin Precipitation Assays Arabidopsis whole seedlingswere homogenized in extraction buffer (20mM pH 80

Scientifica 7

Tris-HCl 10mM EDTA 1mM EGTA 150mM NaCl 2mMNa3VO4 02 Triton X-100 02 NP-40 and 1mM phenyl-

methylsulfonyl fluoride)Themixture solution was sonicatedthree times and then centrifuged at 16000 g for 10 minutes at4∘C 250120583L supernatant was incubated with the NeutrAvidinbeads (Thermo Scientific) which had been washed before twotimes with wash buffer A (1 NP-40 01 SDS in PBS) andtwo times with PBS [42] After each incubation or washingstep the resin was pelleted by centrifugation at 100 g for30 s After overnight incubation at 4∘C the supernatant wasremoved and the resin was washed one time with wash bufferA one additional time with wash buffer B (04MNaCl inwash buffer A) and one final time with 50mM Tris-HClpH 75 To elute biotinylated proteins 50120583L release buffer(2 SDS 30mM biotin 50mM phosphate 100mMNaCl6mM urea 2M thiourea) were added to the resin whichwas then incubated for 15min at RT and another 15min at96∘C Afterwards the resin was pelleted by centrifugationfor 5min at 16000 g and the resulting supernatant wascollected and separated by 15 SDS-PAGE When the mem-brane was probed by primary antibody of histone H3 (IowaState University) the antibody was diluted 1 500 and thesecondary antibody was diluted 1 5000 Signal bands weredetected with the Western Lightning chemiluminescencereagent (Perkin Elmer Inc) After the membrane was probedby I125-streptavidin (80 times 105 cpm) the radiolabeled signalwas subsequently detected using the Typhoon scanner (GE)

46 Preparation of Histone-Enriched Proteins from Arabidop-sis Whole Seedlings After two-week growth Arabidopsiswhole seedlings were excised and homogenized in homog-enization buffer (1M pH 95 Tris-HCl 05M pH 80 EDTA1MKCl 1M sucrose 01 (vv) 2-mercaptoethanol and 1Mspermine) [43] The homogenized solution was then filteredthrough gauze After Triton X-100 was added to a final con-centration of 1 (vv) the filtrate was set on ice for 10minAfter centrifugation at 1800 g for 10min at 4∘C the pelletwas kept and resuspended in 5 mL homogenization bufferAfter centrifugation at 1800 g for 8min at 4∘C the pelletwas kept and resuspended in 5mL lysis buffer (10mM pH79 HEPES 15mM MgCl

2 10mM KCl 05mM DTT and

15mM PMSF PMSF and DTT were added prior to use)2MH

2SO4was added to the lysate drop-by-drop to a final

concentration of 04M After incubation on ice for 1 hr themixture solution was centrifuged at 13000 rpm for 10minat 4∘C The supernatant was extracted and precipitated withtrichloroacetic acid to a final concentration of 20 After seton ice for 30min the samples were centrifuged at 13000 rpmfor 20min at 4∘C and the pellet was washed with chilledacetone and dried overnight at 4∘C

47 2D Gel Electrophoresis Histone-enriched proteins(150 120583g) were mixed with rehydration buffer (8M Urea 2CHAPS 20mM DTT 05 IPG buffer and trace amountof bromophenol blue) to a final volume of 250 120583L andloaded onto 13 cm pH strips (pH 9ndash12) The strips were thenrehydrated for 2 hr at 20∘C and first-dimension isoelectricfocusing was performed by using the IPGphor IEF System

(Amersham-Pharmacia Biotech) 20V for 10 hr 100Vfor 1 hr 500V for 1 hr 1000V for 1 hr 2500V for 1 hrand finally 8000V until the total V hr reached at least80000 Before second-dimension electrophoresis the stripswere equilibrated for 30min with gentle shaking in SDSequilibration buffer (50mM pH 80 Tris-HCl 6M urea 3(wv) SDS 20 (vv) glycerol and 0125 (vv) concentratedtributylphosphine) After equilibration the strips were puton the top of 20 SDS-PAGE gels and sealed with agarosesealing solution (05 (wv) agarose in SDS buffer plus afew grains of Bromphenol Blue) For western blot analysisprimary antibodies of streptavidin-HRP (Biosignaling) andcore-histones (Abcam) were diluted 1 100 and 1 1000respectively Secondary antibodies were diluted 1 5000Signal bands were detected with the Western Lightningchemiluminescence reagent (Perkin Elmer Inc)

48 GST Pull-Down Assays Purified GST-HCS1 proteinswere first incubated with glutathione-sepharose beads for1 hr at 4∘C and then 5120583g His-Histone H3 proteins wereadded After overnight incubation at 4∘C beads were washedextensively with assay buffer (10mM Hepes 100mMNaCland 10mM 120573-mercaptoethanol pH 70) and resuspended in2X SDS loading buffer After boiling and centrifugation thesupernatant was separated by 15 SDS-PAGE For westernblot analysis primary antibodies of GST and histone H3(Santa Cruz Biotech) were diluted 1 1000 and secondaryantibodies were diluted 1 5000 Signal bands were detectedwith the Western Lightning chemiluminescence reagent(Perkin Elmer Inc)

Conflict of Interests

The authors declare no competing interests in the conductand report of this work

References

[1] D A Bender Nutrition and Biochemistry of the Vitamins Aca-demic Press New York NY USA 1992

[2] J R Knowles ldquoThe mechanism of biotin-dependent enzymesrdquoAnnual Review of Biochemistry vol 58 pp 195ndash221 1989

[3] B J Nikolau J B Ohlrogge and E S Wurtele ldquoPlant biotin-containing carboxylasesrdquo Archives of Biochemistry and Bio-physics vol 414 no 2 pp 211ndash222 2003

[4] A Chapman-Smith and J E Cronan ldquoThe enzymatic biotinyla-tion of proteins a post-translationalmodification of exceptionalspecificityrdquo Trends in Biochemical Sciences vol 24 no 9 pp359ndash363 1999

[5] J Zempleni and T Kuroishi ldquoBiotinrdquoAdvances in Nutrition vol3 no 2 pp 213ndash214 2012

[6] MDuval C Job C Alban RDouce andD Job ldquoDevelopmen-tal patterns of free and protein-bound biotin duringmaturationand germination of seeds of Pisum sativum characterizationof a novel seed-specific biotinylated proteinrdquo The BiochemicalJournal vol 299 no 1 pp 141ndash150 1994

[7] L Dehaye M Duval D Viguier J Yaxley and D Job ldquoCloningand expression of the pea gene encoding SBP65 a seed-specific

8 Scientifica

biotinylated proteinrdquo Plant Molecular Biology vol 35 no 5 pp605ndash621 1997

[8] T Konishi and Y Sasaki ldquoCompartmentalization of two formsof acetyl-CoA carboxylase in plants and the origin of their toler-ance toward herbicidesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 91 no 9 pp 3598ndash3601 1994

[9] C Alban P Baldet and R Douce ldquoLocalization and char-acterization of two structurally different forms of acetyl-CoAcarboxylase in young pea leaves of which one is sensitive to ary-loxyphenoxypropionate herbicidesrdquo The Biochemical Journalvol 300 no 2 pp 557ndash565 1994

[10] M D Anderson P Che J Song B J Nikolau and E SWurteleldquo3-Methylcrotonyl-coenzyme A carboxylase is a component ofthe mitochondrial leucine catabolic pathway in plantsrdquo PlantPhysiology vol 118 no 4 pp 1127ndash1138 1998

[11] X Guan T Diez T K Prasad B J Nikolau and E S WurteleldquoGeranoyl-CoA carboxylase a novel biotin-containing enzymein plantsrdquo Archives of Biochemistry and Biophysics vol 362 no1 pp 12ndash21 1999

[12] H Daniel and J ZempleniMolecular Nutrition CABI Publish-ing Oxfordshire UK 2003

[13] R Rodrıguez-Melendez and J Zempleni ldquoRegulation of geneexpression by biotinrdquo The The Journal of Nutritional Biochem-istry vol 14 no 12 pp 680ndash690 2003

[14] R S Solorzano-Vargas D Pacheco-Alvarez and A Leon-Del-Rıo ldquoHolocarboxylase synthetase is an obligate participant inbiotin-mediated regulation of its own expression and of biotin-dependent carboxylases mRNA levels in human cellsrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 99 no 8 pp 5325ndash5330 2002

[15] P Che L M Weaver E Syrkin Wurtele and B J NikolauldquoThe role of biotin in regulating 3-methylcrotonyl-coenzyme acarboxylase expression in Arabidopsisrdquo Plant Physiology vol131 no 3 pp 1479ndash1486 2003

[16] J Steven Stanley J B Griffin and J Zempleni ldquoBiotinylation ofhistones in human cells effects of cell proliferationrdquo EuropeanJournal of Biochemistry vol 268 no 20 pp 5424ndash5429 2001

[17] M A Narang R Dumas L M Ayer and R A GravelldquoReduced histone biotinylation in multiple carboxylase defi-ciency patients a nuclear role for holocarboxylase synthetaserdquoHuman Molecular Genetics vol 13 no 1 pp 15ndash23 2004

[18] N Kothapalli G Sarath and J Zempleni ldquoBiotinylation ofK12 in histone H4 decreases in response to DNA double-strand breaks in human JAr choriocarcinoma cellsrdquo Journal ofNutrition vol 135 no 10 pp 2337ndash2342 2005

[19] L Rios-Avila V Pestinger and J Zempleni ldquoK16-biotinylatedhistoneH4 is overrepresented in repeat regions and participatesin the repression of transcriptionally competent genes in humanJurkardquo The Journal of Nutritional Biochemistry vol 23 no 12pp 1559ndash1564 2012

[20] J Fuchs D Demidov A Houben and I Schubert ldquoChro-mosomal histone modification patternsmdashfrom conservation todiversityrdquo Trends in Plant Science vol 11 no 4 pp 199ndash2082006

[21] J Puyaubert L Denis and C Alban ldquoDual targeting of Ara-bidopsis holocarboxylase synthetase1 a small upstream openreading frame regulates translation initiation and protein tar-getingrdquo Plant Physiology vol 146 no 2 pp 478ndash491 2008

[22] K P Wilson L M Shewchuk R G Brennan A J Otsukaand B W Matthews ldquoEscherichia coli biotin holoenzyme syn-thetasebio repressor crystal structure delineates the biotin- and

DNA-binding domainsrdquo Proceedings of the National Academy ofSciences of the United States of America vol 89 no 19 pp 9257ndash9261 1992

[23] E Campeau and R A Gravel ldquoExpression in Escherichia coliof N- and C-terminally deleted human holocarboxylase syn-thetase Influence of the N-terminus on biotinylation and iden-tification of a minimum functional proteinrdquo Journal of Biologi-cal Chemistry vol 276 no 15 pp 12310ndash12316 2001

[24] A Chapman-Smith T DMulhern FWhelan J E Cronan andJ C Wallace ldquoThe C-terminal domain of biotin protein ligasefrom E coli is required for catalytic activityrdquo Protein Science vol10 no 12 pp 2608ndash2617 2001

[25] J L K VanHove S Josefsberg C Freehauf et al ldquoManagementof a patient with holocarboxylase synthetase deficiencyrdquoMolec-ular Genetics and Metabolism vol 95 no 4 pp 201ndash205 2008

[26] X ChenThe analysis of HCS1 in arabidopsis [PhD thesis] IowaState University 2011

[27] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[28] G Camporeale E E Shubert G Sarath R Cerny and JZempleni ldquoK8 and K12 are biotinylated in human histone H4rdquoEuropean Journal of Biochemistry vol 271 no 11 pp 2257ndash22632004

[29] K Kobza G Camporeale B Rueckert et al ldquoK4 K9 and K18 inhuman histone H3 are targets for biotinylation by biotinidaserdquoThe FEBS Journal vol 272 no 16 pp 4249ndash4259 2005

[30] Y C Chew G Camporeale N Kothapalli G Sarath andJ Zempleni ldquoLysine residues in N-terminal and C-terminalregions of human histone H2A are targets for biotinylation bybiotinidaserdquoThe Journal of Nutritional Biochemistry vol 17 no4 pp 225ndash233 2006

[31] G Camporeale C C Yap A Kueh G Sarath and J ZemplenildquoUse of synthetic peptides for identifying biotinylation sites inhuman histonesrdquo Methods in Molecular Biology vol 418 pp139ndash148 2008

[32] K Kobza G Sarath and J Zempleni ldquoProkaryotic BirA ligasebiotinylates K4 K9 K18 and K23 in histone H3rdquo Biochemistryand Molecular Biology Reports vol 41 no 4 pp 310ndash315 2008

[33] SHealy T DHeightman LHohmannD Schriemer andR AGravel ldquoNonenzymatic biotinylation of histone H2Ardquo ProteinScience vol 18 no 2 pp 314ndash328 2009

[34] C Alban D Job and R Douce ldquoBiotin metabolism in plantsrdquoAnnual Review of Plant Physiology and Plant Molecular Biologyvol 51 pp 17ndash47 2000

[35] S Healy B Perez-Cadahia D Jia M K McDonald J R Davieand R A Gravel ldquoBiotin is not a natural histone modificationrdquoBiochimica et Biophysica Acta vol 1789 no 11-12 pp 719ndash7332009

[36] L M Bailey R A Ivanov J C Wallace and S W Polyak ldquoArti-factual detection of biotin on histones by streptavidinrdquo Analyt-ical Biochemistry vol 373 no 1 pp 71ndash77 2008

[37] L Li C M Foster Q Gan et al ldquoIdentification of the novelprotein QQS as a component of the starch metabolic networkin Arabidopsis leavesrdquo Plant Journal vol 58 no 3 pp 485ndash4982009

[38] M Karimi D Inze and A Depicker ldquoGATEWAY vectors forAgrobacterium-mediated plant transformationrdquo Trends in PlantScience vol 7 no 5 pp 193ndash195 2002

[39] U K Laemmli ldquoCleavage of structural proteins during theassembly of the head of bacteriophage T4rdquo Nature vol 227 no5259 pp 680ndash685 1970

Scientifica 9

[40] J Ke J K Choi M Smith H T Horner B J Nikolau and E SWurtele ldquoStructure of the CAC1 gene and in situ characteriza-tion of its expression the Arabidopsis thaliana gene coding forthe biotin-containing subunit of the plastidic acetyl-coenzymea carboxylaserdquo Plant Physiology vol 113 no 2 pp 357ndash365 1997

[41] B L Fatland B J Nikolau and E S Wurtele ldquoReverse geneticcharacterization of cytosolic acetyl-CoA generation by ATP-citrate lyase in Arabidopsisrdquo The Plant Cell vol 17 no 1 pp182ndash203 2005

[42] J N Rybak S B Scheurer D Neri and G Elia ldquoPurification ofbiotinylated proteins on streptavidin resin a protocol for quan-titative elutionrdquo Proteomics vol 4 no 8 pp 2296ndash2299 2004

[43] C R Xu C Liu Y L Wang et al ldquoHistone acetylation affectsexpression of cellular patterning genes in the Arabidopsis rootepidermisrdquo Proceedings of the National Academy of Sciences ofthe United States of America vol 102 no 40 pp 14469ndash144742005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology

2 Scientifica

Pimelic acid + alanine

BIO1BIO3

BIO2

Biotin

Exogenous biotin

Biocytin

Biotin sulfoxide

HCS

SBP

Fatty acids

fatty acidsElongated

BIO4

Membranes oilssignaling

Cuticle suberin

FAS

Elongase

holo-htACCase

Biot

in

Biot

inid

ase

Biot

in su

foxi

de

redu

ctas

e

trans

port

holo-MCCase

holo-GCCase

apo-htACCase

apo-SBP

apo-hmACCase

apo-MCCase

Acetyl-CoA

Malonyl-CoA

Acetyl-CoA

Malonyl-CoA

Geranoyl-CoA

Carboxyl-granoyl-CoA

MC-CoA

MG-CoA

HMG-CoA Acetyl-CoA

Propionyl-CoA

holo-hmACCase

apo-GCCase

Figure 1 Biotin network in plants Schematic map of the metabolism associated with biotin Metabolitesrsquo names are in black text Red arrowsrepresent the biotinylating actions of HCS on biotin-dependent proteins Black arrows represent other metabolic reactions characterizedin plants Enzymes identified by direct biochemical evidences are shaded in green boxes Grey-dotted arrows represent the reactionscharacterized in humans or E coli but not in plants so far Enzymes not identified in plants but characterized in humans or E coli are shadedin grey boxes

not naturally exist in Arabidopsis although some types ofphysical interaction between HCS1 and histones may occur

2 Results

21 The Functional Domain of HCS Proteins Is Highly Con-served HCS1 has two protein isoforms generated by alter-native splicing HCS1-T (containing a targeting signal forchloroplast and mitochondria localization) and HCS1-CY(not containing any targeting signal and accumulating incytosol) [21] HCS1-T and HCS1-CY share two proteindomains lipoate-protein ligase AB (BPL lipAB) and biotinprotein ligase C terminus (BPL C) BPL lipAB is a catalyticdomain for biotin ligation and was initially determined fromthe crystal structure of BirA [22] This catalytic domain[4 23] has a high identity (about 30) across Drosophilahumans E coli and Pyrococcus abyssi GE5 HCS proteins(Figure 2) Specifically eight residues in or around theBPL lipAB domain are highly conserved across the selectedHCS proteins (Figure 2)These eight residues directly contactbiotin [22] The BPL C domain is thought to interact withATP and the substrates [24] it is also conserved across HCSproteins (Figure 2) In this domain two motifs Leu-Tyr-Tyr-(ArgLys) and Pro-Asp-Gly-Asn-Ser-Phe-Asp have a high

homology among eukaryotic organisms but are not found inprokaryotes and archaea (Figure 2)The function of these twomotifs is still unknown Amissensemutation in Leu-Tyr-Tyr-(ArgLys) was recently reported in a patient with humanHCSdeficiency [25] thus this motif may be important to HCSfunction

22 Biotinylated Histone H3 Could Not Be Identified in Ara-bidopsis Using Avidin Precipitation Analyses To investigatewhether biotinylated histone H3 exists in Arabidopsis totalproteins were isolated from Arabidopsis and used for avidinprecipitation After avidin precipitation proteins were sep-arated by 15 SDS-PAGE and probed with I125-streptavidinand histone H3 antibody respectively The resultant westernblots showed the biotinylated protein signals in the totalprotein extract from Arabidopsis (Figure 3 left panel ldquoInputrdquoand ldquoSuprdquo lanes) and highly accumulated signals in theavidin precipitate at the locations of biotinylated proteins[21] (Figure 3 left panel ldquoAPrdquo lane) The negative control(avidin beads only) showed no positive signals (Figure 3left panel ldquoBrdquo lane) This result indicates that biotinylatedproteins were precipitated successfully However when thesame precipitates were probed with histone H3 antibody nohistone H3 proteins were detected The result means that no

Scientifica 3


Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli


171110

79604735

251814

ACC1

MCCBCCP1

BCCP2

Input Sup W1 W2 W3 AP B17111079604735

251814

Input AP B






4 Scientifica

70605040

30

2520

15

10

W H Ct

Coomassie blue

14

Histone H3 antibody

(a)

11079604735251814

6

pH12 pH9

Streptavidin-HRP

11079604735251814

6

pH12 pH9


(b)





Scientifica 5

706050

40

30

25

20

C I P PC I

GST-HCS1 His-H3

Coomassie blue

(a)

70

605040302520

14

GST-HCS1

GST

Histone H3

GST antibody

Histone H3 antibody


GST antibody

(b)



3 Discussion




6 Scientifica
















Scientifica 7













References








8 Scientifica



































Scientifica 9












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Scientifica 3


Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli


Human

ArchaeaE coli


171110

79604735

251814

ACC1

MCCBCCP1

BCCP2

Input Sup W1 W2 W3 AP B17111079604735

251814

Input AP B






4 Scientifica

70605040

30

2520

15

10

W H Ct

Coomassie blue

14

Histone H3 antibody

(a)

11079604735251814

6

pH12 pH9

Streptavidin-HRP

11079604735251814

6

pH12 pH9


(b)





Scientifica 5

706050

40

30

25

20

C I P PC I

GST-HCS1 His-H3

Coomassie blue

(a)

70

605040302520

14

GST-HCS1

GST

Histone H3

GST antibody

Histone H3 antibody


GST antibody

(b)



3 Discussion




6 Scientifica
















Scientifica 7













References








8 Scientifica



































Scientifica 9












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

4 Scientifica

70605040

30

2520

15

10

W H Ct

Coomassie blue

14

Histone H3 antibody

(a)

11079604735251814

6

pH12 pH9

Streptavidin-HRP

11079604735251814

6

pH12 pH9


(b)





Scientifica 5

706050

40

30

25

20

C I P PC I

GST-HCS1 His-H3

Coomassie blue

(a)

70

605040302520

14

GST-HCS1

GST

Histone H3

GST antibody

Histone H3 antibody


GST antibody

(b)



3 Discussion




6 Scientifica
















Scientifica 7













References








8 Scientifica



































Scientifica 9












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Scientifica 5

706050

40

30

25

20

C I P PC I

GST-HCS1 His-H3

Coomassie blue

(a)

70

605040302520

14

GST-HCS1

GST

Histone H3

GST antibody

Histone H3 antibody


GST antibody

(b)



3 Discussion




6 Scientifica
















Scientifica 7













References








8 Scientifica



































Scientifica 9












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

6 Scientifica
















Scientifica 7













References








8 Scientifica



































Scientifica 9












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Scientifica 7













References








8 Scientifica



































Scientifica 9












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

8 Scientifica



































Scientifica 9












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Scientifica 9












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Research Article Holocarboxylase Synthetase 1 Physically...

Documents

Transcript of Research Article Holocarboxylase Synthetase 1 Physically...