Protein Synthesis
description
Transcript of Protein Synthesis
What is a nucleotide??
What are the base pairing rules in DNA??
In RNA??
What is the structure of the DNA?
Protein synthesis is the process by which genes within DNA are decoded into instructions for protein production in the cells.
This process takes place in three steps:
-Step 1→ Transcription -Step 2→ Translation -Step 3 → Amino Acid Formation
Is a nucleic acid Consist of a long chain of nucleotides Three types of RNA:
-mRNA: serves as messengers from DNA to the rest of the cell
-rRNA: makes up the ribosomes, clamps on to mRNA and uses its information to
assemble amino acids
-tRNA: transports amino acids to the ribosomes to be assembled into proteins.
Sugar in RNA →ribose Sugar in DNA→ deoxyribose RNA → single-stranded DNA → double stranded RNA contains uracil DNA contains thymine
In the nucleus, enzymes make an RNA copy of a portion of DNA
Requires an enzyme called RNA polymerase
During transcription, RNA polymerase binds to DNA and separates the DNA strands.
RNA polymerase then uses one strand of DNA as a template strand to form RNA
DNA unwinds, becomes single stranded. Serves as template for synthesizing mRNA
mRNA molecules move to nucleus where specific codes are transcripted and carried into cytoplasm
A(from DNA)U(RNA)C (from DNA) GT(from DNA)A
Results of Transcription-one single-stranded RNA molecule
is formed-mRNA is produced
http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__mrna_synthesis__transcription___quiz_1_.html
AATGCCATTAATCGCCGGATGACT
What is the structure of RNA?
What are the results of transcription?
What is the enzyme that is required for transcription?
language of the mRNA is translated into the language of proteins
Takes place in the ribosomes tRNA transfers amino acids to the site
of the growing protein chain (polypeptide).
3 steps initiation, elongation, termination
Translation begins at the start codon AUG Each tRNA molecule recognizes a specific,
three base-pair mRNA code or codon Anti-codon:
A sequence of three adjacent nucleotides located on one end of transfer RNA
Translation Video
When trying to find the amino acid sequence it is important to remember that you are only reading from the mRNA codons NOT the tRNA anti-codons
Stop codons are present. UAA, UGA, UAG is the stop codon that signals for the termination of the protein synthesis process. DOES NOT CODE FOR AN AMINO ACID
The nucleotide sequence transcribed from DNA to RNA acts as a genetic message
protein synthesis video
What is a code?-A system of words, letters, figures, or
other symbols used to represent others
Living organisms have their own code called the genetic code
the language of the mRNA instructions
it is read three letters at a time
Ex: UCGCACGGU ↓
UCG-CAC-GGU ↓
Serine-Histidine-Glycine
Codons represent the different amino acids
Genetic Code Video