ONLINE SUPPORTING MATERIALS

Materials and Methods

Human ES cell and somatic cell culture. Human ES cell lines and somatic cell lines were

cultured as previously reported (10,11) (http://www.atcc.org) and

(http://www.mcb.harvard.edu/melton/hues).

Generation of transgenic cell lines. To generate the transgenic hES cell lines, cells were

electroporated with 10-30 ug of linear DNA encoding the green fluorescent protein (GFP),

puromycin, hygromycin, or neomycin resistance genes. Cells were plated on drug resistant

MEFs and cultured for 48 hours before the initiation of drug selection with the appropriate

antibiotic (Neomycin 50 ug/mL), Hygromycin (25 ug/mL), Puromycin (5 ug/ml). Ten days

following drug selection, individual colonies were picked and expanded into lines. To

generate drug resistant somatic cells, BJ fibroblasts or TE 76.T cells were transduced with a

replication incompetent lentiviral vector carrying a puromycin resistance gene. 48 hours

after viral transduction, puromycin was added to the culture media at a concentration of

5ug/ml. Transduced cells were cultured en masse for 96 hours and then expanded for cell-

fusion.

Generation of cell-hybrids by cell fusion. To induce cell-fusion, 5x107 hES cells and

5x107 somatic cells were mixed in presence of polyethylene glycol (PEG) (Roche, Nutley

NJ) as directed by the manufacturer’s instructions. Cell fusion efficiency was determined

by trypsenizing cells, resuspending BJ fibroblasts at a concentration of 1X106 cells/mL in

serum-free culture medium, adding 5 uL/mL Vybrant DiD (Invitrogen, Carlsbad,

California) to the cell suspension and incubating for 20 minutes at 37 degrees Celsius.

Labeled cells were then washed twice and mixed with hES cells in the presence of PEG. To

obtain hybrids cells, cell fusion mixtures were plated on drug resistant mouse embryonic

fibroblasts, after PEG treatment, under standard conditions for the maintenance and

propagation of hES Cells. 48 hours after PEG treatment, cell culture media was

supplemented Puromycin (2 ug/ml), or Neomycin (50 ug/mL) and Hygromycin (25

16

ug/mL). Ten days following drug selection, ES cel-like colonies were picked and expanded

under standard conditions. For live cell-analysis of GFP expression, cells were trypsinized,

passed through a mesh filter and analyzed on a fluorescence activated cell sorter (FACS).

To genotype somatic cell lines for the presence of the lentiviral vector, PCR was carried out

using the following primers: CCCGGTTAATTTGCATATAATATTTC;

CATGATACAAAGGCATTAAAGCAG.

Phenotypic analysis of hybrid cells. For analysis of DNA, Cells were washed in

phosphate buffered saline with 1% glucose, fixed with 75% ethanol, stained with 50 ug/ml

propidium iodide and analyzed by FACS. To detect alkaline phosphatase activity, cells

were fixed with 4% paraformaldehyde and stained using the Alkaline Phosphatase

Substrate Kit I (Vector labs, Burlingame, California). For immunostaining, cells were fixed

with 4%PFA and stained with anti-OCT4 (mouse monoclonal Oct-4 C-10, Santa Cruz

biotechnology, Inc., Santa Cruz, California.), SSEA3 (rat monoclonal, Developmental

Hybridoma Studies Bank ), SSEA4 (mouse monoclonal, Developmental Hybridoma

Studies Bank ), TRA1-60 (mouse monoclonal, Chemicon International, Temecula,

California ), TRA1-81 (mouse monoclonal, Chemicon). Imaging of alkaline phosphatase

and antibody staining was performed with a confocal imaging system (Carl Zeiss Inc,

Thornwood, New York). Telomerase activities assays were carried out using the TRAPEZE

(Chemicon) assay system. Bisulfite modification of DNA was carried out with the EZ-

DNA methylation kit (Zymogenetics Inc., Seattle Washington).

Transcriptional profiling. 5x106 cells were lysed in RNeasy lysis buffer (Qiagen,

Valencia, California), RNA was purified, cRNA was labeled and fragmented as per the

manufacturers protocols (Affymetrix SanFrancisco, California). Labeled cRNA was

hybridized to the U133 2.0 plus Affymetrix human gene chips, which were scanned using

an Affymetrix GeneChip Analyzer. Data were analyzed using the dChip software package.

The average correlation coefficient between BJ replicates was 0.990 (0.985-0.993, n=3), for

HUES6-GFP was 0.994 (0.993-0.995, n=3) and for the two hybrid cell lines was 0.991

17

(0.988-0.997, n=3) and 0.991 (0.988-0.995, n=3), which attests to the quality and

reproducibility of the data (see Table S1).

Cell-hybrids formed by Fusion of independent somatic and hES cell lines.

We induced cell fusion between hygromycin resistant H9 hES cells (10) and puromycin

resistant TE 76.T somatic cells, derived from human pelvic bone (ATCC). These

experiments generated hybrid, hES cell-like colonies at frequencies similar to those

observed in experiments with HUES6 hES cells and BJ fibroblasts.

Determination of Cell fusion efficiency after PEG treatment. To determine the

efficiency of cell fusion, we pretreated BJ fibroblasts with the fluorescent dye 1, 1’-

dioctadecyl-3, 3, 3’, 3’ tetramethylindodicarbocyanine (DiD) and then determined the

number of GFP, DiD double positive cells by fluorescence activated cell sorting (FACS).

FACS analysis showed that cell fusion occurred at a low but appreciable frequency

following PEG treatment ((0.95% +/- 0.03%, double positive cells with PEG (n=3 of

200,000 events) and 0.15% +/- 0.05% in the absence of PEG (n=2 of 200,000 events)).

Supplemental figure legends:

Fig. S1. Hybrid cells are tetraploid. Chromosomal analysis (A) demonstrated the hybrid

cells carried 92 chromosomes within a single nucleus (B). Scale bars, 3µm.

Fig. S2. Expression of embryonic antigens in hybrid cells. GFP positive (green) hES cells

and hybrid cells expressed Alkaline phosphatase activity (AP, red) (A), SSEA-4 (red) (B),

TRA1-60 (red) (C) and TRA1-81 (red) (D), while the GFP negative BJ fibroblasts and

mouse embryonic fibroblasts feeder cells did not. Scale bars, 50µm.

Fig. S3. Hybrid cells possess an hES cell phenotype and express embryonic genes.

Analysis of telomerase activity by TRAP assay demonstrated that like hES cells, hybrid

cells expressed high levels of this enzyme (A). Immunostaining of embryoid bodies derived

18

from hybrid cells revealed the presence of various cell types including neurons that

expressed a neural specific tubulin (Tuj1, red) (B), skeletal muscle expressing myosin

heavy chain (MF20, red) (C) and intestinal endoderm expressing the alpha fetal protein

(AFP, red) (D). Sequencing of genomic DNA from the BJ fibroblasts and HUES6 cells

showed that the fibroblasts contained a unique single nucleotide polymorphism that was not

present in the HUES6 cell genome (E). DNA sequencing of cDNAs isolated from hybrid

cells (F) revealed that the hybrid cells contained TDGF1 transcripts that originated from the

somatic chromosomes. Scale bars, 50µm.

19

Table S1 Variance in transcriptional profiles between cell-lines. Cell lines/ replicates compared Pearson correlation coefficient BJa vs. BJb 0.993192843BJa vs. BJc 0.989497022BJb vs. BJc 0.985813875HUES6a vs. HUES6b 0.995517397HUES6a vs. HUES6c 0.993074263HUES6b vs. HUES6c 0.993994747Hybrid1a vs. Hybrid1b 0.988061956Hybrid1a vs. Hybrid1c 0.988676815Hybrid1b vs. Hybrid1c 0.997182504Hybrid2a vs. Hybrid2b 0.988584931Hybrid2a vs. Hybrid2c 0.989424668Hybrid2b vs. Hybrid2c 0.995896499BJa vs. HUES6a 0.780113998BJa vs. HUES6b 0.783036581BJa vs. HUES6c 0.777684475BJb vs. HUES6a 0.775574204BJb vs. HUES6b 0.777159461BJb vs. HUES6c 0.768892567BJc vs. HUES6a 0.788160554BJc vs. HUES6b 0.783330285BJc vs. HUES6c 0.789551854HUES6a vs. Hybrid1a 0.985106622HUES6a vs. Hybrid1b 0.987711238HUES6a vs. Hybrid1c 0.987835323HUES6b vs. Hybrid1a 0.986198747HUES6b vs. Hybrid1b 0.987454291HUES6b vs. Hybrid1c 0.989156158HUES6c vs. Hybrid1a 0.979331587HUES6c vs. Hybrid1b 0.980132796HUES6c vs. Hybrid1c 0.983813233HUES6a vs. Hybrid2a 0.985215616HUES6a vs. Hybrid2b 0.983615228HUES6a vs. Hybrid2c 0.988515551HUES6b vs. Hybrid2a 0.985814214HUES6b vs. Hybrid2b 0.983742876HUES6b vs. Hybrid2c 0.989432206HUES6c vs. Hybrid2a 0.980753157HUES6c vs. Hybrid2b 0.978194057HUES6c vs. Hybrid2c 0.98447334BJa vs. Hybrid1a 0.790637823BJa vs. Hybrid1b 0.79328967BJa vs. Hybrid1c 0.79715334BJb vs. Hybrid1a 0.788816206BJb vs. Hybrid1b 0.791418124BJb vs. Hybrid1c 0.793628529BJc vs. Hybrid1a 0.79413977

20

BJc vs. Hybrid1b 0.799152853BJc vs. Hybrid1c 0.801022877BJa vs. Hybrid2a 0.785943279BJa vs. Hybrid2b 0.795160469BJa vs. Hybrid2c 0.796298791BJb vs. Hybrid2a 0.783867626BJb vs. Hybrid2b 0.794416133BJb vs. Hybrid2c 0.793826462BJc vs. Hybrid2a 0.788075491BJc vs. Hybrid2b 0.794183407BJc vs. Hybrid2c 0.799337756HUES1a vs. H2b* 0.984479464HUES1a vs. H2c* 0.976024017HUES1b vs. H2c* 0.989124914HUES1a vs. H2b* 0.986568582HUES1a vs. H2c* 0.942357736HUES1b vs. H2c* 0.974081347HUES1a vs. H2a* 0.97814981HUES1a vs. H2b* 0.970728278HUES1a vs. H2c* 0.942003485HUES1b vs. H2a* 0.973740557HUES1b vs. H2b* 0.950496363HUES1b vs. H2c* 0.89679701HUES1c vs. H2a* 0.969536314HUES1c vs. H2b* 0.941426819HUES1c vs. H2c* 0.887338919HSF-6b vs. HSF-6c** 0.9963HSF-6b vs. HSF-1b** 0.9728*Cowan and Melton, unpublished data, as assessed over 22284 probes sets.

**( M.J. Abeyta et al, Hum Mol Genet. 13, 601 (2004).)

21

Table S2 Transcripts up-regulated in hybrid cells and BJ fibroblasts relative to hES cells. Gene name

Chr.

Accession #

Locus link

Avg. fold change in Hybrid vs. HUES6

Avg. fold change in

BJ vs. HUES6

Hypothetical protein LOC205251 2 AW182614 205251 7.86 25.84 Insulin-like growth factor binding protein 5 2 R73554 3488 6.82 122.61 Insulin-like growth factor binding protein 5 2 AW007532 3488 3.24 22.02 Insulin-like growth factor binding protein 5 2 BM128432 3488 2.86 24.12 Phosphoserine phosphatase 7 NM_003832 5723 2.77 3.84 Similar to RIKEN cDNA 2610524G09 9 AL555612 389792 3.13 5.58 Glutathione S-transferase theta 1 22 NM_000853 2952 21.45 47.22 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3 Y NM_004660 8653 22.41 22.53 Jumonji, AT rich interactive domain 1D Y NM_004653 8284 8.55 9.88 Ubiquitin specific protease 9 Y AV681765 8287 5.58 5.84 Eukaryotic translation initiation factor 1A Y BC005248 9086 5.39 3.57 Ribosomal protein S4 Y NM_001008 6192 4.08 5.71

22

Table S3 Transcripts down-regulated in hybrid cells and BJ fibroblasts relative to hES cells. Gene name

Chr.

Accession #

Locus link

Avg. fold Change in Hybrid vs. HUES6

Avg. fold change in BJ vs. HUES6

Hypothetical protein FLJ40434 1 AI223281 163742 -3.38 -53.74 RAP1A, member of RAS oncogene family 1 AB051846 5906 -2.77 -20.35 RAP1A, member of RAS oncogene family 1 AB051846 5906 -2.44 -125.27 Major histocompatibility complex, class II, DQ beta 1

6 AI583173 3119 -9.18 -700

Major histocompatibility complex, class II, DQ beta 1

6 AW276186 3119 -8.26 -1267.77

Major histocompatibility complex, class II, DQ beta 1

6 M16276 3119 -6.91 -17.56

Major histocompatibility complex, class II, DQ beta 1

6 M17565 3119 -4.49 -59.98

Major histocompatibility complex, class II, DQ beta 1

6 M32577 3119 -4.28 -931.28

Major histocompatibility complex, class II, DQ beta 1

6 M17955 3119 -2.98 -764.84

Embryonal stem cell specific gene 1 6 AI365263 340168 -3.6 -475.13 Chromosome 6 ORF 62 6 AW972292 - -2.3 -2.82 Similar to DKFZP566O084 protein (LOC201140), mRNA

17 AI741629 201140 -4.33 -12.84

Polymerase (DNA directed), gamma 2, accessory subunit

17 NM_007215 11232 -3.28 -12.78

Paternally expressed 3 19 AL042588 5178 -11.89 -15.53 Chromosome 20 ORF 54 20 AA903862 113278 -4.38 -255.1 DNA (cytosine-5-)-methyltransferase 3-like 21 NM_013369 29947 -5.52 -572.59 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B

22 NM_004900 9582 -2.9 -3.56

Glutathione S-transferase theta 2 22 NM_000854 2953 -2.48 -7.5 Monoamine oxidase A X NM_000240 4128 -3.05 -9.15 CDNA clone IMAGE:6101827, partial cds X AK026566 203413 -2.28 -12.13

23

Table S4 Expression of pluripotency associated genes in hES cells and hybrids cells relative to BJ cells. Gene Chr. Locus

link Avg. fold change in

HUES6 vs BJ

Avg. fold change in

Hybrid vs BJ SRY (sex determining region Y)-box 2 (SOX2) 3 6657 561.51 616.34

Teratocarcinoma-derived growth factor 1 (TDGF1) 3 6997 320.42 323.82

Developmental pluripotency associated 4 (DPPA4) 3 55211 106.42 105.15

Zinc finger protein 42 (REX1) 4 132625 34.38 27.15

POU domain, class 5, transcription factor 1 (OCT4) 6 5460 6099.75 5963.07

Undifferentiated embryonic cell transcription factor 1(UTF1) 10 8433 25.8 22.04

Nanog 12 79923 3662.53 3403.35

Bone morphogenetic protein 2 (BMP2) 20 650 1251.4 1546.19

24