NGO MAGAZINE - Nr. 3 (February 2012)
-
Upload
ngo-magazine -
Category
Documents
-
view
226 -
download
0
description
Transcript of NGO MAGAZINE - Nr. 3 (February 2012)
![Page 1: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/1.jpg)
NGO MAGAZINE – February 2012
FOUNDERS : EUROPEANCENTERSN7 & CENTER FOREDUCAT IONANDDEVELOPMENT - CED
NGO MAGAZINE
© NGO MAGAZINE - PUBLISHER: EUROPEAN CENTER SN7 & CENTER FOR EDUCATION AND DEVELOPMENT - CED
Editor-in-chief: Daut MEMETI; Editors: Metin MUAREMI, Kaltrina AZIZI, Fatos VELIU, Alma AZIRI, Astrit REXHEPI, Mensure ILJAZI
Phone: 00 389 70 523 764; E-mail: [email protected], [email protected]; Web: www.sn7.org.mk/ngomagazine.pdf
A digital edition is an online magazine or online newspaper delivered in electronic form which is formatted identically to the print version.
�A �MAGAZINE�DEDICATED�TO�THE�NGO�SECTOR�–�NR. �3 �/ �FEBRUARY�2012�
SADUDIN BAJRAMI PAGE PAGE PAGE PAGE 6666
The role of
a student
• CED, five years with you
• YATA Macedonia delegation visits Brussels
• CDI, Bona Mente Conference
![Page 2: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/2.jpg)
NGO MAGAZINE – February 2012
FACEBOOKFACEBOOKFACEBOOKFACEBOOK TIPSTIPSTIPSTIPS
FOR NGO’sFOR NGO’sFOR NGO’sFOR NGO’s
Make your Facebook page work for you. Here are some hints and tips that Facebook would recommend:
1. Be personal, educational and think about your audience – speak directly to your users, supply them with the information they require in a format that is easy to understand and suitable for your target audience
2. Create content worth sharing – by providing engaging, quality content you will ensure users return to your page and are more likely to engage with you in return
3. Join the conversation – if users are commenting on a post you made on your page, join them. This will give your brand a tangible voice and persona
4. Make the best use of relevant tools – There are more than 550,000 active applications available on the Facebook platform. Use them innovatively to make your page unique
5. Continue to grow your connections and promote your page – build relations with similar organisations where you are likely to find users interested in your organization by ‘liking’ their page and engaging with them through posting links and comments
6. Promote your page – provide links in advertising material and your company email signature
7. Make your website ‘social’ – Install our social plugins, allowing Facebook users to ‘like’ content, create recommendations and see an activity feed, amongst other features. This activity links back to the user’s personal profile page and spreads your brand further
8. Use your partners – Encourage links to your Facebook page on any supporters’ websites
9. Drive customer awareness – Utilise the Facebook ads tool to further increase your page membership. Ads can be targeted specifically by gender, age, location, language and interests meaning that your organisation can reach the right audience.
(Source: Conor Byrne's Blog)
EUROPEAN CENTER SN7 ORGANIZED REGIONAL CONFERENCE ON TOPIC
EEEuuurrrooopppeeeaaannn fffuuutttuuurrreee ooofff ttthhheee yyyooouuuttthhh
European Center SN7 organized a regional
conference on topic “European future of
the youth”. The conference was held at
the EU InfoCentre in Skopje, on February
07, 2012. The conference was attended by
representatives of the nongovernmental
sector from our country and beyond,
representatives of the public institutions,
creators and protagonists of youth
policies, representatives from the
educational institutions, researchers for
youth future etc. Daut Memeti, the
president of the European Center SN7
noted that the conference coincides with
d
the long-term strategy of the European
Center SN7. “Our organisation fully
committed on youth development,
involving young people in decision-
making and ensuring equal opportunities
between generations”, said Mr. Memeti.
Otherwise, the secretary general of the
European Center SN7, Fatos Veliu, during
the opening speech said that the topic of
the conference “European future of the
youth” presents a challenge for all
generations. “Dealing with young people
and their future is a big responsibility, but
also is a huge satisfaction", said Mr. Veliu.
2
"Coming together is a beginning, staying together is progress, and working together is success." – By: Henry Ford
![Page 3: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/3.jpg)
NGO MAGAZINE – February 2012
Before five years, motivated by the idea that
things should be changed, either in the
approach that we teach children, also in the
way of acting locally related to cultural
developments in the societies, it was found
Center for education and development
(CED). Even in that time the organization had
a clear mission and vision that there should
be institutional action in the society, so that
positive changes would be promoted,
through which young people will find their
selves and will contribute for their future.
Our projects were successful thanks to the
organizational and professional capacities
that were involved during their
implementations. It is very easy to fulfill the
project aims, when they are led by
professional, but in the same time by people
which are motivated to work with young
people. From its beginning the organization
as its target group has the young people,
and only through direct involvement them
on the education process we could promote
the excepted changes. We have never forget
to involve in our projects the teachers,
students, leaders of the different institutions
who were directly involved in different
activities. We were aware that the projects
would be accepted only if they promote skills
and if they are applicable. Always we strive to
increase the quality of our projects, the
implementation methods, monitoring and
evaluation. The different projects are based
on participative pedagogy, where learning is
understood as process, which depends from
the learner. Since 2006 the organization has
implemented more than 15 projects and
more than 50 activities. Projects and activities
were striving for education, capacity building
and initiatives for different cultural activities
in the region. The methodology that we
were using in our projects is mainly through
non formal education methods, such as:
individual work, group work, tutorials,
presentations, role plays, dance theatre,
campaigns, creative workshops, Medias and
the intercultural education. The seriousness
of our projects and different actions is seen
through the different national and
international cooperation’s with: Ministry of
education and science, Children Foundation
Pestalozzi, Switzerland programme for the
Western Balkan, Pro Helvetia, Contemporary
art centre, Centre for non formal education-
Triagolnik, New York University (Skopje),
British council. Currently the organization is
member of different coalition of organization
such: SEGA, MOF, RCC, and ADAEL. The
organization is open for everybody, so every
individual who would like to contribute to
make changes within his/her region, at the
same time to increase its capacities, might
join to us on creating a better future for the
youth. In the name of the all organizations
members, we thanks all previous members
that have contributed until now on
implementing different projects and
promoting the positive values which the
organization has built until now. We hope
that on the tenth anniversary CED would be
serious institution which functions not only
in the country but wider in the Balkans, by
promoting changes on the education system,
culture and the development in general. We
believe that only with positive energy,
sustainability and creativity, objectives might
be achieved; CED continues to live and
function.
PROJECT MANAGER!?
A project manager is the person responsible for accomplishing the stated project objectives. Key project management responsibilities include creating clear and attainable project objectives, building the project requirements, and managing the triple constraint for projects, which are cost, time, and quality (also known as scope).
FROM CULTURE TO DEVELOPMENT
Being aware that more than half of
population in Macedonia lives in rural
areas, but in the same time identifying the
needs within the communities in these
areas, CED works on the field of promoting
the cultural development in these areas.
According to the strategic plan of the
organization we work with different NGOs,
individuals and other citizens groups to
function as non formal group on solving
different cultural issues. Until now we have
implemented several activities so that the
rural region become attractive destination
for the tourists and other interested
organization. Based on this idea CED,
through the project RCC cooperates with
the Switzerland programme for the
western Balkan, through which we realize
more then 4 activities by year. In December
2011 for the first time under local
organization it was organized open debate
for the idea of declaring the Sharr
Mountain as National park. On this event
more than 40 people, leaders of NGOs in
Macedonia and Kosovo were participating.
The organization believes that only
through genuine culture events, national
protection of the beauties of the rural
regions, and the idea of brining cultural
events to the rural areas, Macedonia could
be developed country, where each
individual is valued according to what he
does, and not where he or she lives.
3
CCCCCCCCEEEEEEEEDDDDDDDD,,,,,,,, ffffffffiiiiiiiivvvvvvvveeeeeeee yyyyyyyyeeeeeeeeaaaaaaaarrrrrrrrssssssss wwwwwwwwiiiiiiiitttttttthhhhhhhh yyyyyyyyoooooooouuuuuuuu
![Page 4: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/4.jpg)
NGO MAGAZINE – February 2012
YYOOUUNNGG AATTLLAANNTTIICCIISSTTSS WWIITTHH
NNEEWW LLEEAADDEERRSSHHIIPP
The Youth of the Euro-Atlantic Council of
Macedonia on 18.01.2012 in the facilities of
the University American College Skopje held
its regular Annual Assembly. At the Assembly
the members had the opportunity to review
and adopt the Annual Report for the work of
the organization as well as the Activities of
MEACM for 2012. Regarding these two
documents the participants had a very fruitful
debate. At the Annual Assembly of MEACM a
new presidency was elected:
- President: Ilija Djugumanov
- Vice-presidents: Stefanija Madzoska and
Emir Berisha
- Secretary General: Jordan Tasev
The new presidency consists of 14 additional
young Atlanticists elected following the
criteria for gender and University balance. At
the Assembly the Executive Office of the
Euro-Atlantic Council of Macedonia was
present and the President, Lazar Elenovski,
gave a short and encouraging speech.
Delegation of YATA Macedonia on invitation
by the NATO Public Diplomacy Division, from
22nd to 25th of January 2012 visited NATO HQ
and SHAPE in Brussels and Mons, Belgium. The
youth opinion formers, in the NATO HQ, had
briefings and discussions with high
representatives of NATO. The first briefing was
dedicated to the current political issues and
forthcoming NATO Summit in Chicago, held by
Mr Alexandros Papaioannou from the Policy
Planning Unit, Office of the Secretary General.
During that one hour, the Macedonian
delegation had possibility to listen more on the
role of the new strategic concept as well as the
priority issues on Chicago Summit agenda.
Next session was dedicated on the states of
Western Balkan. Representatives of NATO
PDD were Ms. Barbora Maronkova, Regional
Coordinator for the Western Balkans and Mr.
Laurie Walker, Balkan Officer, Political Affairs
and Security Policy Division. Afternoon session
was dedicated to Afghanistan, on which the
youth could debate with Mr. Daniele Riggio,
Information Officer with responsibility on
Afghanistan within NATO PDD. Also meetings
were held with Ms. Joy Davis-Kirchner,
representative of the U.S. Mission to NATO
and photo exhibition held by Chez delegation
on the topic “Our security is not given” was
accessed, opened by Kolinda Graber, Deputy
Secretary General for Public Diplomacy. The
day finished with a round table on public
diplomacy and new media, followed by a
meeting with representatives of the
Macedonian Mission to NATO. The visit of
SHAPE was a high-level visit. Two sessions
were held, first one dedicated to NATO,
SHAPE and ACO, and the second one was
dedicated to NATO operations. The third
meeting which was held, was dedicated to
questions and answers, and was especially
beneficial for the young atlantists. During the
informal part, the Macedonian representatives
had an opportunity to spend time with YATA
representatives. Opportunities for the future
cooperation were considered. Previous work of
YATA Macedonia was presented and highly
remarked by the Montenegrin fellows as well
as Macedonian representatives in NATO HQ
and SHAPE. This visit was also very strong
team building tool for the new Presidency of
YATA Macedonia.
YYYYYYYYAAAAAAAATTTTTTTTAAAAAAAA MMMMMMMMaaaaaaaacccccccceeeeeeeeddddddddoooooooonnnnnnnniiiiiiiiaaaaaaaa ddddddddeeeeeeeelllllllleeeeeeeeggggggggaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn vvvvvvvviiiiiiiissssssssiiiiiiiittttttttssssssss BBBBBBBBrrrrrrrruuuuuuuusssssssssssssssseeeeeeeellllllllssssssss
TOP 10 QUALITIES OF A PROJECT MANAGER
Inspires a shared vision; good communicator; integrity; enthusiasm; empathy; competence; ability to delegate tasks; cool under pressure; team-building skills; problem solving skills.
Volunteering�
Volunteering is generally considered an
altruistic activity, intended to promote good
or improve human quality of life, but people
also volunteer for their own skill
development, to meet others, to make
contacts for possible employment, to have
fun, and a variety of other reasons that could
be considered self-serving. Volunteerism is
the act of selflessly giving your life to
something you believe free of pay. Although if
a person volunteers they may not earn
money, it produces a feeling of self-worth and
volunteers earn respect and Favors instead of
money. Volunteering takes many forms and is
performed by a wide range of people. Many
volunteers are specifically trained in the areas
they work in, such as medicine, education, or
emergency rescue. Other volunteers serve on
an as-needed basis, such as in response to a
natural disaster or for a beach-cleanup. Such
volunteers do not work for free and are given
regular pay.
4
![Page 5: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/5.jpg)
NGO MAGAZINE – February 2012
Civil Association Community Development
Institute (CDI), organized a national conference on
December 21, 2011 at the "EU Info Centre" in
Skopje under the project "BONA MENTE: Support
Committees for Inter-Community CICR" CDI that
was implemented in the past 11 months with
financial support from the European Union,
through the IPA of 2008. The conference aims at
promoting the results achieved within the project
and opening the discussion about the need to
amend the Law on Local Self-Government, in order
to strengthen the role of CICR at the local level.
Representatives of civil society, committees for
Inter-ethnic Relations between the communities of
21 municipalities, members of Parliament, and
other participants attending the conference had
the opportunity to become familiar with the
contents of CICR manual titled "Everything I want
to know about CICR" altogether with the analysis
of policies for CICR that CDI has drafted under this
project, as well as specific proposals for
amendments to the Law of Local Government that
CDI proposes for increasing the participation of
minority ethnic communities in decisions making
that affect them by strengthening the role of CICR.
In his speeches the Executive Director of CDI
Sreten Koceski, and General Secretary Damir Neziri
presented activities that were conducted as part of
the "Bona Mente: Support for CICR," while
Professor of Law Faculty in Skopje, Ms. Renata
Deskovska addressed the legal aspects of the
proposed amendments to the Local Government
and how these changes will impact on improving
the functionality of these committees in the future.
The conference presented the following activities
that CDI will implement in 2012, which will aim to
adopt the proposed amendment by the Assembly
of the Republic of Macedonia. This project
represents a continuation of a series of activities
that CDI realized in the past 6 years, and which aim
to improve the performance of CICR and increasing
their role at the local level.
BBOONNAA MMEENNTTEE:: SSuuppppoorrtt CCoommmmiitttteeeess
ffoorr IInntteerr--CCoommmmuunniittyy CCIICCRR CCoommmmuunniittyyDDeevveellooppmmeennttIInnssttiittuuttee((CCDDII))ppuubblliisshheedd““MMaannuuaallffoorrvvoolluunntteeeerrss””Community Development Institute
(CDI) within the annual programme
supported by CIVICA Mobilitas, during
the year of 2011 developed and
published the Manual for volunteers.
The purpose of this manual is to
facilitate the way towards voluntarism
for both today’s and also future
volunteers, and to show the organizers
of the volunteering activity the role of
volunteering, the contents of the Law
on volunteers and to provide answers
to the most frequently asked
questions about the ongoing
implementation of the Law which will
contribute for stimulating and
recognizing the importance of
voluntarism in Macedonia. According
to the authors of this manual who are
volunteers themselves, volunteering
include voluntary work, or activity of
people who by their own good will
invest their time, effort, knowledge
and labor, without financial
compensation for the benefit of
certain individual, group, community.
The voluntary work offers a lot of
opportunities to young people that
want to help their community in any
way and at the same time to develop
their communication skills and gain
the experience they need. For these
reasons CDI works actively on
promoting voluntarism and
encouraging young people to engage
in voluntary work as many as possible.
5
10 VALUABLE TIPS FOR NGOs ON TWITTER
1. Monitor Discussions & Relevant Updates 2. Identify & Follow 3. Customize Your Account 4. Create a Relevant Voice 5. Patience, Grasshopper 6. Engage Your Audience 7. Revisit Your Tweets 8. Use a Twitter Client 9. Be Creative & Innovative 10. Checkout HashTags
BONA MENTE Conference
FRIENDS ARE LIKE GOLD. EACH ONE IS RICH AND THEY ALL LAST A LIFETIME
![Page 6: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/6.jpg)
NGO MAGAZINE – February 2012
TTTTTTTThhhhhhhheeeeeeee rrrrrrrroooooooolllllllleeeeeeee ooooooooffffffff aaaaaaaa ssssssssttttttttuuuuuuuuddddddddeeeeeeeennnnnnnntttttttt
It is amazingly interesting now day’s role of a
student. It took centuries people in this world
to come up intentionally or not and “vote” a
pathfinder that will everlastingly be a key of
exploring professions and help people survive
and live, and this is the student that seems to
be just a term. This term, as always, today
presents a youngster whose future is
enigmatic and has treasure of wisdom that is
endowed somewhere in space, waiting and
wanting this pure will of a student to explore
it. This term also has a place that is an object
where ideas enjoin the lecturer and the
searcher to illustrate a way of progress in life.
And In spite of all, the will of this youngster
and his/her purification may be restricted?
BECOMING A STUDENT
I am a student myself and becoming a student
we already know that it is a universal, unique
and authoritative term. As students, we live in
different sections of the world and all we do is
inherit the lessons of those who were
students, years, decades and centuries ago.
This seems to be that the student is the leader
of population whose country is this planet
earth, because, as students, we are all over the
world and in front of any development. It is
very much important to be cautious in our
beginning of our search and understand why
we are the leader of this planet; otherwise, we
may end up in the many theoretical
explanations that lead us toward to different
life standings people own, which move us
away of who we are supposed to be. We
usually say that “future is unpredictable”, and
this means that no one assures us if people
were aware of living this lifestyle we have
today, because our present time is what
people in the past have considered as their
future which we might like or not, and
unpredictably we happen to live this way we
do, same as our future might be for the new
generations. We start our education in our
own environmental places we live: among our
families, in our nations and with the lectures
that traditionally have been our guide. And I
think, maybe the traditional lecture of living
life this way, sometime leads us to making the
Sadudin
BAJRAMI
very famous question to ourselves: why do we
use a small percentage of our brain, and why
do we feel that we are excluded somehow
from life? And the kind of answer I have for this
is: we don’t seem to work properly to be
included to life, because the purpose of this life
is a human to be related and engaged to the
nature’s environmental creation and respect it
by being patient, tolerant and curious, but, we
do the opposite, because we segregate each-
other and study life superficially. It is necessary
to care this way and be critical when learning
what we are taught, explain it to ourselves and
foresee whether it works globally, and if it
doesn’t then we are, may be, unwontedly
manipulated. This manipulation we can
recognize if we understand that our world isn’t
only our countries that have few millions of
people, many borders that restrict our will to
explore deeper in life, but our country is our
entire world, and we’re its citizen. This way of
understanding life involves and introduces to
us the purpose of its values.
BEING A STUDENT
Being a student many people or students
understand it as just being someone who
attend some courses in state or private
universities, but in reality a student can be
anyone, (especially youngsters who might have
no chance to attend educational courses, but
work in some random jobs or just hang around
the streets, having no given opportunity to do
what many others can, but learn from being
pushed away ), because to be a student to me
means to be a researcher who looks for lessons
that adapt people easier to life. And if those of
us who are students, think by any chance that
attending the lessons and finishing the years
that we are required before we get degrees
complete our lesson that adapts us easier to
life than we are wrong, because our lesson is
our life and in different sections of our world
our lesson changes: If in one part of the world
dominate democratic means then in another
on dominate communism means or whatever
else. So, what I want to explain isn’t what
democracy or communism means, but how
people have different ways of standings and
political views which for every oncoming
generation are a wrong traditional lecture, and
that deceives our brains, by taking our will that
we are supposed to use in our normal lives,
and they make it a product to fed their
conspiracies’ theories. So, every step we take as
students we should never forget that our
role isn’t to be able to manipulate with
others or relate to different organizations,
but be a role keeper and this term, “the
student” is an organization itself, because it
includes everyone at the same time and its
means aren’t to agree with whatever
foolishness we realize or comes out, but to
study it and see whether it is a problem for
us and our future. I personally disagree with
the way that we as students accept life, and
I also irritate those washed brain people
who institutionally use their positions to
manipulate with us and pretend like they
are doing something that makes them
exceptional in their careers, but in reality
they are the screwier. We attend our
courses in our universities, and we can see
that state universities have people who
usually have nationalistic views whose
lectures are a total lie when teaching a
student to learn how to be against one
another’s nations, instead of leaving us live
life and respect it as it is, and the second
one are also our private universities where
we can realize how materialistic minds
work. These aren’t reasons to be against
professors, because there are good
professors who knew what it meant to be a
student and who clearly know what they
should teach students, but are against the
concepts that institutional laws allow to
happen. This is or isn’t the way to teach and
study, but a best way to tell ourselves what
kind of students we are is to learn how to
earn our lifetime grade which is very deep
in life. These life perceptions might look
quite idealistic which stand away of realism,
but, nevertheless, the idea is a title that
beneath it stands the providence of a
predictable future according to factious
reasons. And these reasons may look
complicated, but life connections are
unlimited, and the complicated
mathematical number connections from
zero to nine can tell us what our life is all
about. So if we want to know and get rid of
our psychological and physical pain then
we should always ask ourselves: why our
will is restricted?
6
![Page 7: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/7.jpg)
NGO MAGAZINE – February 2012
The European Youth Information and
Counselling Agency (ERYICA) was
established on 17 April 1986 in Madrid, in
accordance with a recommendation adopted
by the first European Colloquium of Youth
Information Centres organised in April 1985
in Marly-le-Roi (France). This Colloquium,
which brought together some 200 youth
information and counselling professionals
from 18 countries, was an initiative of the
Paris Youth Information and Documentation
Centre (CIDJ), with support from the French
Ministry for Youth and Sport and from the
Commission of the European Communities.
ERYICA is composed of national bodies
(non-governmental or governmental) which
seek to guarantee the right of young people
to full and reliable information, which helps
them make the choices they face in their
lives, and which promotes their autonomy
and their active participation in a democratic
society.
MISSION
ERYICA is an independent European
organisation, composed of national youth
information co-ordination bodies and
networks. It works to intensify European co-
operation in the field of youth information
work and services. It aims to develop,
support and promote quality generalist
youth information policy and practice at all
levels, in order to meet the information
needs of young people in Europe and to
apply the principles of the European Youth
Information Charter.
AIMS
As stated in the Agency's Constitution,
ERYICA has three aims: to promote respect
for the principles of the European Youth
Information Charter, and to work for their
implementation; to ensure European co-
ordination and representation in the field of
youth information and counselling; to
promote the establishment of a European
arena in this field, especially by developing a
European Network of youth information and
counselling structures. (Source: eryica.org)
processes and recent EU policy
development.
BACKGROUND
AGE was set up in January 2001 following a
process of discussion on how to improve
and strengthen cooperation between older
people's organizations at EU level.
Membership of AGE is open to European,
national and regional organizations, and to
both organizations of older people and
organizations for older people.
Organizations of older people will have the
majority of votes in AGE's decision-making
bodies. Membership is open only to non-
profit-making organizations. AGE is co-
financed by its members and by the
European Commission.
AGE AND THE EU INSTITUTIONS
This section is designed to introduce
visitors to the European institutions and to
increase their knowledge and
understanding of the main interactions
between AGE and the major European
institutions. It will serve as a useful tool for
better understanding the main legislative
instruments of the EU and to explain how
organisations of and for people aged 50+
can get involved in AGE’s work to influence
the political outcomes of such instruments
through its policy work and lobbying
activities. (Source: age-platform.eu)
AGE Platform Europe is a European
network of around 165 organisations of
and for people aged 50+ representing
directly over 30 million older people in
Europe. Its work focuses on a wide range
of policy areas that impact on older and
retired people. These include issues of
anti-discrimination, employment of older
workers and active ageing, social
protection, pension reforms, social
inclusion, health, elder abuse,
intergenerational solidarity, research,
accessibility of public transport and of the
build environment, and new technologies
(ICT). The Platform takes also active part in
several EU projects. The majority of these
projects are funded by the 7th Framework
Programme. The purpose of its work is to
voice and promote the interests of the 150
million inhabitants aged 50+ in the
European Union and to raise awareness of
the issues that concern them most. AGE
seeks to give a voice to older and retired
people in the EU policy debates, through
the active participation of their
representative organisations at EU,
national, regional and local levels, and
provides a European platform for the
exchange of experience and best
practices. It also aims to inform older
people on their rights as EU citizen or
resident and on EU policy making
7
CommunityBuildingMitrovica(CBM)CBM is a local non-governmental organisation (NGO) operating in the field of peace and
community building in the wider region of Mitrovica in northern Kosovo. The overall aim of CBM
is to facilitate contact and dialogue between citizens in the whole of Mitrovica municipality.
CBMs staff consists of devoted citizens – both Serbs and Albanians – who grew up in this region
and want to restore the previous confidence and even friendship that war and politics have
destroyed. By supporting many concrete projects which address the direct needs of the local
communities, CBM contributes in a modest way to this aim. The work of the past years has
gained the organization a strong reputation on both sides of the Ibar. Fields in which CBM works
are: media, culture, youth, women, minorities, dialogue, and return of refugees and IDPs
(Internally Displaced Persons). CBMs projects are open to members of all communities living in
Mitrovica, and wider. CBM often cooperates with other NGOs, helps out with local initiatives and
works with local governmental institutions and international organizations in order to initiate, to
develop and to implement activities, for the benefit of the communities, in Mitrovica, and wider.
Vision of CBM: Mitrovica, a safe place where accountable institutions and strong civil society
cooperate in developing a democratic society, where there is an appreciation for diversity and
opportunity for citizens to make choices.
Mission of CBM:Local organization that identifies and advances joint interests of citizens
through facilitation of interethnic dialogue and advocacy, as well as strengthening civil society
against accountable institutions. (Source: cbmitrovica.org)
![Page 8: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/8.jpg)
NGO MAGAZINE – February 2012
The European Youth Forum is the Platform of
the Youth Sector of Civil Society in Europe.
Independently established by youth
organisations it is made up of more than 90
National Youth Councils and International Non-
Governmental Youth Organisations, which are
federations of youth organisations in
themselves. It brings together tens of millions
of young people from all over Europe,
organised in order to represent their common
interests. Representation, internal democracy,
independence, openness and inclusion are
among the main principles for the functioning
of the European Youth Forum and its Member
Organisations.
OUR VISION
Be the voice of young people in Europe, where
young people are considered as equal citizens,
and are supported and encouraged to achieve
their fullest potential as citizens of the World.
The European Youth Forum represents and
advocates for the needs and interests of all
young people in Europe, through their positive
and active participation.
OUR AIMS
● Increase the participation of young people
and youth organisations in society, as well as in
decision-making processes;
● Positively influence policy issues affecting
young people and youth organisations, by
being a recognized partner for international
institutions, namely the European Union, the
Council of Europe and the United Nations;
● Promote the concept of youth policy as an
integrated and cross-sectoral element of overall
policy development;
● Facilitate the participation of young people
through the development of sustainable and
independent youth organisations at the
national and international level;
● Foster the exchange of ideas and experience,
mutual understanding, and equal rights and
opportunities among young people in Europe;
● Uphold intercultural understanding,
democracy, respect, active citizenship and
solidarity;
● As the biggest regional youth platform in the
world, we work to deepen European integration
while at the same time contributing to the
development of youth work in other regions of
the world. (Source: youthforum.org)
SALTO:Why?What?Where?When?Who?SALTO-YOUTH stands for Support, Advanced Learning and Training Opportunities within the
European YOUTH programme. What is the history and scope of this network of SALTO-
YOUTH Resource Centres?
WWHHAATT IISS SSAALLTTOO--YYOOUUTTHH??
SALTO-YOUTH.net is a network of 8 Resource Centres working on European priority areas
within the youth field. It provides youth work and training resources and organises training and
contact-making activities to support organisations and National Agencies within the frame of
the European Commission's Youth in Action programme and beyond. SALTO-YOUTH's history
started in 2000 and is part of the European Commission’s Training Strategy within the Youth in
Action programme and works in synergy and complimentarity with other partners in the field.
SSAALLTTOO PPAARRTTNNEERRSSHHIIPPSS && CCOOOOPPEERRAATTIIOONN
SALTO-YOUTH does not take over the work of other actors in the field - on the contrary -
SALTO strives to complement existing initiatives or build synergies between them.
• SALTO provides mutilateral Training Courses, in cooperation with National Agencies /
Coordinators, about European Priority Topics and according to NAs needs.
• SALTO works together with the Partnership on European Youth Worker Training between
the Council of Europe and the European Commission on publications like Coyote and T-Kits,
through interlinking between their websites and by co-organising Trainer Meetings
• The SALTO EuroMed Resource Centre is a partner in the EuroMed Partnership agreement
between the Council of Europe and the European Commission
• SALTO cooperates with the European Youth Forum and lists their Pool of Trainers
members in TOY. (Source: salto-youth.net)
8
order to implement our ideas in our local
groups and in joint activities. Within
international actions, we intend to raise
public awareness and to put pressure on
enterprises and politicians.
YEE'S EUROPEAN ACTIVITIES FALL INTO
TWO MAIN AREAS:
1) Supporting the work of the member
organisations by promoting the widest
possible exchange of information, ideas
and experience among them, through
publications and European training courses
(e.g.: sustainable development, landscape
management, ecology and economy,
sustainable tourism, energy, climate
change…)
2) Coordination of the activities of the
member organisations by promoting direct
cooperation between individuals on topics
of mutual interest through European
working groups and by organizing joint
actions and campaigns on environmental
issues of European importance. Such
campaigns are: Climate Campaign, Green
Energy Go Campaign, Sustainability
Campaign, Ozone Campaign. (Source: yeenet.eu)
ABOUT YEE
Youth and Environment Europe (YEE) is
a platform of many European youth
organisations that study nature or are
active in environmental protection. These
member organisations come together
from 28 countries. The aim of YEE is to
encourage youth to be involved in
environmental protection and to provide a
platform where these organisations can
work together. YEE gives an opportunity
to contact other European organisations,
to exchange experiences and ideas and to
work together. All our activities are
organised and carried out by young
people under 30. YEE organises and
encourages all activities that can increase
the knowledge, understanding and
appreciation of nature and the awareness
of environmental problems among young
people in Europe. Its aim is to promote
the commitment of youth to the principles
of environmental conservation. Therefore,
young people's voluntary actions have to
be stimulated for the protection and the
rational use of the Earth's resources. Since
environmental problems do not accept
any borders, we act together within YEE in
![Page 9: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/9.jpg)
NGO MAGAZINE – February 2012
•
WHO WE ARE
The amazing work that YouthNet does
wouldn’t be possible without the people
who work and volunteer here. YouthNet is
based in offices in central London, and we’re
grouped into a number of directorates that
all work towards achieving our
organisation’s mission.
CENTRAL SERVICES AND CEO
Central to everything we do, our Central
Services team ensures the smooth running,
effectiveness and excellent administration of
the organisation. The team supports the
Chief Executive and Board of Trustees with
charity administration, assists the senior
management team to ensure good
organisational management and provides
human resources leadership on the
management of staff, volunteers and
external freelancers and consultants. Our
Chief Executive provides leadership and
guidance, and is crucial in shaping the
organisations vision and strategy.
DEVELOPMENT AND MARKETING
The Development and Marketing team raises
money to ensure that YouthNet is a well-
resourced charity and awareness of what our
organisation does. A team of skilled
fundraisers build and manage relationships
with funders from companies, government
and charitable trusts and foundations to
ensure that YouthNet is a social business
that can meet and exceed its objectives.
Contact the Development team if you would
like to discuss a funding partnership or want
to support us through individual giving. Our
experienced researcher provides intelligence
and research to support YouthNet, while
marketing and communications
professionals support internal teams and
provide a consistent perception of YouthNet
and its brands across all stakeholders and
beneficiaries. Contact our press team if you
are a journalist or the marketing team if you
would like to discuss a marketing
opportunity.
OPERATIONS
The operations team manages our websites
and partnership work on a day-to-day basis.
They are focused on working with partners
to create engaging, useful services and
editorial content for visitors to the sites.
The team includes experienced journalists,
online community experts and project
managers, who work tirelessly to manage
ongoing relationships with key partners
and content providers. They also recruit
content providers such as national
charities, youth organisations, government
bodies and not-for-profit organisations.
Contact the operations team if you would
like to discuss opportunities to work
collaboratively with YouthNet, or get
involved as a contributor or have any
suggestions about improving our sites
and services.
TECHNICAL
YouthNet is committed to harnessing
technology for the delivery of valuable
user services. This relies on having a sound
IT infrastructure and a collection of people
skilled in building and maintaining this
infrastructure. Our technical team includes
software programmers, technical project
managers, IT support staff and systems
specialists, who together, create a solid
platform on which we can build our
services. They also support our partners
with their technical needs. Contact the
technical team if you think you could help
us improve our systems.
BOARD OF TRUSTEES
YouthNet’s Trustees are collectively
responsible for setting the strategic
direction and objectives of our
organisation. They ensure that YouthNet
operates within the legal and financial
guidelines set out by law and are fulfilling
the charity’s objectives as set out in its
constitution. They work closely with the
Chief Executive and other senior staff in
defining overall policy, setting targets and
monitoring performance. (Source: youthnet.org)
HHHHHHHHOOOOOOOOWWWWWWWW TTTTTTTTOOOOOOOO WWWWWWWWRRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE AAAAAAAA PPPPPPPPRRRRRRRROOOOOOOOJJJJJJJJEEEEEEEECCCCCCCCTTTTTTTT
PPPPPPPPRRRRRRRROOOOOOOOPPPPPPPPOOOOOOOOSSSSSSSSAAAAAAAALLLLLLLL!!!!!!!!????????
A project proposal is a document that is written
with a specific purpose in mind: to convince
someone that a project can and should be
completed. Although there isn't a universal format
for project proposals, many elements in proposals
are important, and often, mandatory. Above all
else, you must remember that a project proposal is
an argument. If you don't present a viable and
logical argument, your proposal will likely be
rejected.
INSTRUCTIONS
1. Analyze your audience. Decide who will be
reading the document and how they will be
interacting with the document. The simplest way
to conduct an audience analysis is to write down
what prior knowledge the audience may have
about the topic. This will help you determine how
much detail to include in the proposal.
2. Write an introduction and place it under a
header labeled "Introduction." This should be a
brief description of the overall project and a
statement about why it is a relevant and
important project.
3. Include a section about previous or related
work. Place this under a header labeled
"Background." If there is research or other similar
projects related to your own proposal, you must
include this information. Including this shows the
reader that you have done your homework and are
knowledgeable about your topic.
4. Write out the specific proposal under a header
labeled "Proposed Work." This includes the entire
scope of the project and the details related to each
component of the project. Include a list of project
outcomes. This allows the reader to see tangible
results from your project.
5. Include a project timeline, which can fall under
"Proposed Work." Alternatively, you can add a
new section entitled "Project Timeline." The
timeline should be based on each component of
the project. Include information about how long a
component of a project will take, who will be
responsible for completing the task and the
specific dates associated with a task. Present this
data in a table. To insert a table in Microsoft Word,
click the "Insert" tab and select "Table." Enter the
number of rows and columns you want to include
in the table.
6. Write out a budget and place it under a header
labeled "Budget." Present the expenses that the
project requires. Write out a brief explanation for
each budget item.
7. Conclude by stating the significance of the
project. Tell the reader how your project will
directly impact or improve the reader's life.
By: Art Corvelay , eHow Contributor
9
�
PROJECT PLANING
• Pay close attention to the human factor • Involve your team in the planning process • Iterate your plan • Move tasks that involve risks closer to the start of your project • Leverage technology to save time
![Page 10: NGO MAGAZINE - Nr. 3 (February 2012)](https://reader034.fdocuments.in/reader034/viewer/2022052403/568c34221a28ab02358f47c9/html5/thumbnails/10.jpg)
NGO MAGAZINE – February 2012
10
11
The Association of Local Democracy Agencies - ALDA
ABOUT ALDA
The Association of Local Democracy Agencies
is a non-governmental organisation dedicated
to the promotion of good governance and
citizen participation at the local level. ALDA in
particular focuses on activities that facilitate
cooperation between local authorities and civil
society. It works in Europe (27 members state)
to promote citizens' participation in the public
and European Policies and in the
Neighbouring countries to promote local
democracy from below, with the engagement
of citizens and multilevel stakeholders. ALDA
was established in 1999 at the initiative of the
Council of Europe's Congress of Local and
Regional Authorities to coordinate and
support a network of Local Democracy
Agencies which was established in the early
1990es. It remains one of its supporting
programmes. It is the umbrella organisation of
the Local Democracy Agencies which are self-
sustainable, locally registered NGOs that act
as promoters of good governance and local
self-government. ALDA is a membership
based organisation gathering more than 150
members (including Local Authorities,
Associations of Local Authorities and non-
governmental organisations) coming from
more than 30 countries. ALDA is funded
through membership fees and project funding
from the European Commission, the Council
of Europe and other public and private
donors.
WHAT IS UNIQUE ABOUT ALDA?
Most of ALDA's work is based on the method
of multilateral decentralized cooperation. This
method involves a multi-stakeholder approach
which focuses on strong partnerships between
Local Authorities and non-governmental
organisations. These partnerships create
positive synergy and ensure that common
goals are reached in a successful way.
WHAT WE DO?
In the framework of promoting good
governance and citizen participation at the
local level ALDA focuses on various themes,
such as European integration, civic initiatives,
youth involvement, human rights,
immigration, equal opportunities, sustainable
economic development, decentralization and
volunteering. ALDA conducts its activities
through different forms of action:
●Coordinating and supporting the 12 Local
Democracy Agencies in their activities
●Developing and implementing projects
based on ALDA's expertise in the field of
good governance and citizen participation at
the local level
●Providing technical assistance to Local
Authorities as project partner using ALDA's
knowledge, network and experience in the
regions where ALDA and the Local Democracy
Agencies are working.
WHERE WE WORK?
ALDA works in most of Europe and the
European neighbourhood countries. Activities
in the European Union focus in particular on
the promotion of Active European Citizenship.
Activities in the Western Balkans and
European Neighbourhood focus on good
governance, citizen participation, European
integration and decentralisation. Most of the
Local Democracy Agencies are located in the
Western Balkans, which gives a natural focus
on that area. But ALDA is also becoming more
and more active in the European
neighbourhood. In 2006 a Local Democracy
Agency was established in Kutaisi in Georgia
and ALDA is currently working towards
opening agencies in Armenia and Azerbaijan.
ALDA is also leading several other projects
and developing partnerships in other
European neighbourhood countries, such a
Belarus, Algeria, Morocco, Tunisia and Turkey.
(Source: alda-europe.eu)
BEST, Board of European Students of
Technology is an international non-profit
and non-political student organization,
organized and run entirely by students.
BEST connects students from 89 technical
universities in 30 countries in a network that
is maintained through numerous joint
projects, interests and friendships. Every
year it organizes over 120 international
courses, seminars and conferences in which
students from different countries learn and
exchange experiences and ideas. Our priority
is to offer quality and to assist students in
Europe, and to do everything we can
combine the triangle "students - university -
companies. As a result of the need for
greater exchange of students, introduction
and operation of domestic students with
colleagues from other universities and
obtaining further education in their studies
was established Board of European Students
of Technology - Skopje.
BEST - Skopje is a full member of the great
European family BEST. Thus, students of Sts.
"Cyril and Methodius" in Skopje have the
right to use the services of BEST, including
the participation of free academic events
organized by other local BEST groups. This is
one of the privileges, but on the other hand
there are obligations. One of those is
committed each year to organize at least
one BEST event that will be attended by
around 30 students from across Europe,
which BEST - Skopje will cover all costs
associated with their stay in Macedonia.
BEST - Skopje this responsibility successfully
meets for seven years, and last year was able
to organize the biggest international seminar
for training and motivation within the BEST -
BalkanJAM, which will have about 400
participants, and the fifth fair. Labour and
many other events. The hard work of
members, who sacrificed much of their free
time, resulted in the successful organization
of these events.
STAY TUNED! SEE YOU NEXT ISSUE!
ALDA CONTACT INFORMATION
The Strasbourg Headquarters
Council of Europe; 1, avenue de l'Europe
F-67075 Strasbourg, France
Phone: +33 3 90 21 45 93
Fax: +33 3 90 21 55 17
Email: [email protected]