Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 ·...
Transcript of Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 ·...
![Page 1: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/1.jpg)
1
Mutations & DNA Repair
I. What are Mutations?II. Mutagenesis: Process of producing
a mutationIII. Testing MutagenityIV. Repair of Mutations
![Page 2: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/2.jpg)
2
Mutation(G47R)inthexpdgenewithintheNterminusoftheprotein-Xerodermapigmentosum:LackexcisionrepairmechanismandcellssufferfromUVlightdamage,resultinginphotosensitivity,photodamage,andpigmentation,theearlydevelopmentofcutaneousmalignancies
http://www.nature.com/jid/journal/v125/n1/full/5603240a.htmlhttp://www.sciencedaily.com/releases/2008/05/080529120718.htm
I. What are mutations?A. Classes of mutations:
Spontaneous mutation - occurs in nature without the addition of amutagen
Induced mutation – Point mutation –
Transition = pyrimidine for pyrimidine, or purine for purine Transversion = pyrimidine for purine, or purine for pyrimidine
Insertion/Deletion – base added or deleted Frameshift mutation – loss or addition of a nucleotide alters the codon
reading frame Forward mutation – converts wild type to mutant Reverse mutation – converts mutant back to wild type Loss of function mutation (null mutation) Gain of function mutation Adaptive mutation - provides a selective advantage to the organism Deleterious - harmful to the organism
![Page 3: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/3.jpg)
3
Base substitutions/Point mutations
• Transitions– Purine replaced by a purine…
or pyrimidine replaced by apyrimidine
• Transversions– Purimidine replaced by a
purine, or vise versa– Less common… why?
Additional mutational categories:
Lethal mutation – results in death Conditional mutation – expression depends on the environment
i.e. temperature sensitive mutations Somatic mutation – not transmitted to future generations Germinal/gametic mutation –
![Page 4: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/4.jpg)
4
B. Mutational outcomes
1) Silent substitution – function of theprotein product of gene isunaltered
2) Missense mutation – alters codonso that it encodes a differentamino acid
3) Nonsense mutation – alters geneso that it creates a nonsensecodon (no normal tRNA exists)causing termination of translation
Geneticists Use Mutations to IdentifyGenes and Study Gene Function
• Mutation is usually a non-adaptiveprocess -
• (table 16.2)
![Page 5: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/5.jpg)
5
WaysMutationscanoccur:
-Damagetonucleicacids-Mobileelements
II.Mutagenesis:Processofproducingamutation
A.Spontaneous mutations• Spontaneous mutations arise from replication errors &
base modifications, due to natural/biological chemicalprocesses.
1) DNA Replication errors– Replication slippage – one strand loops out and becomes
displaced during replication– DNA pol stuttering– Occurs frequently in repeat regions: each of the bases can appear in one of several forms called
tautomers (isomers)2) Tautomeric Shifts - Tautomerization – isomerization of a
nitrogen base to an
![Page 6: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/6.jpg)
6
Tautomerization–Knownasatautomericshift“rare”formsresultinmispairing,.
Spontaneous Mutations continued:
3) Spontaneous lesions– Depurination -– Deamination = ie deamination of C yields U, which
will pair w/A leading to a– Oxidative damage – superoxide radicals (byproducts
of metabolism) alter bases to cause mispairing… 8-oxidG or GO pairs with A
4) Transposable elements– significant part of the genome consists of “nomadic”
DNA sequences that are present at differentlocations
Spontaneous mutation rate various among organisms (table 16.1)
![Page 7: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/7.jpg)
7
B. Induced MutationMechanisms
1) Base replacement2) Base alteration3) Base damage
1. Base replacement• Base analogs (chemicals that are similar to
nucleotides) substitute themselves for thenucleotide
• Result =• Examples:
5-Bromocuracil (T analog),2-Aminopurine (A analog)
![Page 8: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/8.jpg)
8
Mispairingresultsinreplicationerrors–
![Page 9: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/9.jpg)
9
5BU(derivativeofuracil)behavesasathymineanalog,if5BUisincorporated
2. Base alterationChemicals cause the shape
– Depurination (loss of nitrogenous base) & Deamination(amino group converted to keto group)
Alkylation – addition of alkyl group (CH3 or CH3CH2)to bases• EMS (ethylmethane sulfonate)
Intercalation – planer molecules that mimic base pairsand slip themselves between the stacked nitrogenbases at the core of the helix• Ethidium bromide• Proflavin• Acridine orange
![Page 10: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/10.jpg)
10
EMSalkylatestheketogroupsofGandT
Intercalatingagentsslipbetweenthenitrogenousbases,whichcanleadtoinsertion/deletions.
–generatedatgapsproducedinDNAduringreplication
![Page 11: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/11.jpg)
11
3. Base damageChemicals, oxidation, radiation cause the
nucleotide to become modifiedUV light
• Results in
Radiation• Causes ionization of molecules• Creates substitutions• Breaks
![Page 12: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/12.jpg)
12
III. Testing mutagenicityA. The Ames Test
Test to determine if a chemicalis a mutagen
suspension of a histidine-requiring (His-) strain ofSalmonella typhimurium platedwith a mixture of rat liverenzymes on agar lackinghistidine
mutagenic effect (reversemutation) of the chemical cancause bacteria to regain theability to grow without histidine,forming the colonies seenaround the disk
![Page 13: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/13.jpg)
13
B. Using transgenic mice to testpossible mutagens
• Big Blue mice are transgenic for a segment of DNA thatcontains:• Lambda phage DNA used as a vector
• 3 genetic elements from the lac operon of E. coli• the lacI gene• the operator of the operon• the beta-galactosidase (lacZ) gene
• The transgenic mice are given repeated doses of thesuspected carcinogen for a week or two. If the chemical ismutagenic, it will cause random mutations throughout thegenome of each mouse cell. If a mutation occurs in either
• the lacI gene (which encodes the lac repressor) or theoperator, the gene
• Mouse DNA then extracted and assayed
![Page 14: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/14.jpg)
14
IV. Repair of mutations
1. Direct Reversal of damage2. Excision repair3. Proofreading4. Mismatch repair5. Post-replication repair & SOS6. Double-strand break repair
![Page 15: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/15.jpg)
15
1. Direct reversal of damagePhotoreactivation repair: reversal of UV damage
Photolyase splits
Photolyase• The two bind together in dark to T-dimer• When light shines on cell
O6-mGua DNA methyltransferase
Alkyltransferase – one time repair enzyme thatremoves ethyl or methyl groups from guanine
![Page 16: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/16.jpg)
16
2. Excision repair
Involved in repair of deamination anddepurination
Enzymes recognize an abnormal base andcleave the bond between in and the sugar inthe DNA backbone.
1) Uracil N-glycosylase removes uracil
2) AP endonuclease cuts 5’ side of damaged site on apurinic bases
3) Phosphodiesterase Removes sugar-phosphate residue
AGTGACTTAGTCAUTGAATC
AGTGACTTAGTCA TGAATC
AGTGACTTAGTCA TGAATC
AGTGACTTAGTCACTGAATC
deamination
U
![Page 17: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/17.jpg)
17
•BER involves:recognition of theerroneous base byDNA glycosylase•cutting of the DNAbackbone by APendonuclease
NER: repairs bulkylesions and involvesthe uvr genes
![Page 18: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/18.jpg)
18
3. Proofreading
DNA Pol III error rate:• Proofreading ability: Pol II can
recognize
• 3’ to 5’ exonuclease ability,
4. Mismatch repair
• Mismatch repair – after proofreading,mismatches identified, improper baseexcised and replaced w/correct base– Adenine methylase recognizes parent
strand and adds methyl group to A’s
![Page 19: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/19.jpg)
19
Mismatch repair-
5. Post-replicational repair &SOS
Post-replicational repair (aka recombination repair ):• Damaged DNA cause Pol III to “stutter” and skip past
damaged site• Replication restarts downstream and a gap is left• Gap is repaired by retrieving sequence from the
normal copy and then the subsequent gap is repaired
![Page 20: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/20.jpg)
20
SOS response• Severe damage due to alkylating agents
or cross-linking agents (UV radiation beststudied) triggers this response– Translesional polymerases (POL II, IV, V)
can replicate over damaged regions
![Page 21: Mutations & DNA Repairlms.bums.ac.ir/.../attachment/7650/mutation_andrepair.pdf · 2014-02-24 · Mutations & DNA Repair I. ... Mutagenesis: Process of producing a mutation III. Testing](https://reader030.fdocuments.in/reader030/viewer/2022041019/5ecd284b4f9bc27073195539/html5/thumbnails/21.jpg)
21
6. Double strand break repair
• Repairs DSBs by reannealing the two DNAsegments - protein aligns the broken ends of DNAfor rejoining
• Recombination repair mechanism– Homologous recombination repair –
– Nonhomologous recombination repair – uses non-homologous region for replacement
• Errors in direct joining may be a cause of translocations