MUTATIONS Mutations can occur in DNA replication Protein Synthesis.
DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA?...
-
Upload
paulina-atkinson -
Category
Documents
-
view
221 -
download
0
description
Transcript of DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA?...
![Page 1: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/1.jpg)
DNA Mutations
![Page 2: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/2.jpg)
What if this DNA…
CACGTGGACTGAGGACTCCTC
…was changed to this DNA?
CACGTGGACTGAGGACACCTC
![Page 3: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/3.jpg)
What if this DNA…
CACGTGGACTGAGGACTCCTC
…was changed to this DNA?
CACGTGGACTGAGGACACCTC
What does it matter???
![Page 4: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/4.jpg)
CACGTGGACTGAGGACTCCTCCodon for CTC =
glutamate
CACGTGGACTGAGGACACCTCCodon for CAC =
valine
What does it matter???
![Page 5: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/5.jpg)
Mutation = any change in a DNA sequence- usually happens during DNA replication- in sex cells, it may affect individual’s
offspring/children- in body cells, it may affect the individual
![Page 6: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/6.jpg)
Mutations can:- be bad, leading to cancer, aging, birth
defects, self-aborted embryos
![Page 7: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/7.jpg)
- be good, making an organism survive better in its environment- Example: bacteria becoming antibiotic-resistant
The ability to drink milkas an adult is a helpfulmutation.
![Page 8: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/8.jpg)
![Page 9: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/9.jpg)
- have no effect- Example:
- CAC = valine
- CAT = valine
![Page 10: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/10.jpg)
Types of Mutations1. gene mutations – only affects one gene
a. point mutation - a substitution of a single base pair - changes only one amino acid (if any!)
![Page 11: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/11.jpg)
![Page 12: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/12.jpg)
Types of Mutationsb. frameshift mutation
- a single base is added or deleted- changes every amino acid after mutation site
- also called a nonsense mutation
http://highered.mcgraw-hill.com/sites/0072552980/student_view0/chapter9/animation_quiz_5.html
![Page 13: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/13.jpg)
Types of Mutations2.Chromosomal mutation – may affect
more than one geneExamples: nondisjunction, deletion, insertion, inversion, translocation
![Page 14: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/14.jpg)
What can cause a mutation?***A mutation can be inherited, caused by
environmental agents, or happen spontaneously
Mutagen – anything environmental that can cause a change in DNA
![Page 15: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/15.jpg)
Mutagens
Radiation – UV, X-rays, nuclear
![Page 16: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/16.jpg)
Mutagens
Chemicals – asbestos, formaldehyde, chemicals in tobacco products
(many mutagens are also carcinogens – cancer causing)
![Page 17: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/17.jpg)
Mutation Repair
Note: Our DNA mutates all the time, but our cells have repair mechanisms. It is the overexposure to a mutagen that causes the worst problems, because the cell cannot repair all of it in time. Also, repair effectiveness reduces with age.
![Page 18: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/18.jpg)
![Page 19: DNA Mutations. What if this DNA CACGTGGACTGAGGACTCCTC was changed to this DNA? CACGTGGACTGAGGACACCTC.](https://reader036.fdocuments.in/reader036/viewer/2022062317/5a4d1b6d7f8b9ab0599b4296/html5/thumbnails/19.jpg)
What’s Happening in Japan