1
Mutations & DNA Repair
I. What are Mutations?II. Mutagenesis: Process of producing
a mutationIII. Testing MutagenityIV. Repair of Mutations
2
Mutation(G47R)inthexpdgenewithintheNterminusoftheprotein-Xerodermapigmentosum:LackexcisionrepairmechanismandcellssufferfromUVlightdamage,resultinginphotosensitivity,photodamage,andpigmentation,theearlydevelopmentofcutaneousmalignancies
http://www.nature.com/jid/journal/v125/n1/full/5603240a.htmlhttp://www.sciencedaily.com/releases/2008/05/080529120718.htm
I. What are mutations?A. Classes of mutations:
Spontaneous mutation - occurs in nature without the addition of amutagen
Induced mutation – Point mutation –
Transition = pyrimidine for pyrimidine, or purine for purine Transversion = pyrimidine for purine, or purine for pyrimidine
Insertion/Deletion – base added or deleted Frameshift mutation – loss or addition of a nucleotide alters the codon
reading frame Forward mutation – converts wild type to mutant Reverse mutation – converts mutant back to wild type Loss of function mutation (null mutation) Gain of function mutation Adaptive mutation - provides a selective advantage to the organism Deleterious - harmful to the organism
3
Base substitutions/Point mutations
• Transitions– Purine replaced by a purine…
or pyrimidine replaced by apyrimidine
• Transversions– Purimidine replaced by a
purine, or vise versa– Less common… why?
Additional mutational categories:
Lethal mutation – results in death Conditional mutation – expression depends on the environment
i.e. temperature sensitive mutations Somatic mutation – not transmitted to future generations Germinal/gametic mutation –
4
B. Mutational outcomes
1) Silent substitution – function of theprotein product of gene isunaltered
2) Missense mutation – alters codonso that it encodes a differentamino acid
3) Nonsense mutation – alters geneso that it creates a nonsensecodon (no normal tRNA exists)causing termination of translation
Geneticists Use Mutations to IdentifyGenes and Study Gene Function
• Mutation is usually a non-adaptiveprocess -
• (table 16.2)
5
WaysMutationscanoccur:
-Damagetonucleicacids-Mobileelements
II.Mutagenesis:Processofproducingamutation
A.Spontaneous mutations• Spontaneous mutations arise from replication errors &
base modifications, due to natural/biological chemicalprocesses.
1) DNA Replication errors– Replication slippage – one strand loops out and becomes
displaced during replication– DNA pol stuttering– Occurs frequently in repeat regions: each of the bases can appear in one of several forms called
tautomers (isomers)2) Tautomeric Shifts - Tautomerization – isomerization of a
nitrogen base to an
6
Tautomerization–Knownasatautomericshift“rare”formsresultinmispairing,.
Spontaneous Mutations continued:
3) Spontaneous lesions– Depurination -– Deamination = ie deamination of C yields U, which
will pair w/A leading to a– Oxidative damage – superoxide radicals (byproducts
of metabolism) alter bases to cause mispairing… 8-oxidG or GO pairs with A
4) Transposable elements– significant part of the genome consists of “nomadic”
DNA sequences that are present at differentlocations
Spontaneous mutation rate various among organisms (table 16.1)
7
B. Induced MutationMechanisms
1) Base replacement2) Base alteration3) Base damage
1. Base replacement• Base analogs (chemicals that are similar to
nucleotides) substitute themselves for thenucleotide
• Result =• Examples:
5-Bromocuracil (T analog),2-Aminopurine (A analog)
8
Mispairingresultsinreplicationerrors–
9
5BU(derivativeofuracil)behavesasathymineanalog,if5BUisincorporated
2. Base alterationChemicals cause the shape
– Depurination (loss of nitrogenous base) & Deamination(amino group converted to keto group)
Alkylation – addition of alkyl group (CH3 or CH3CH2)to bases• EMS (ethylmethane sulfonate)
Intercalation – planer molecules that mimic base pairsand slip themselves between the stacked nitrogenbases at the core of the helix• Ethidium bromide• Proflavin• Acridine orange
10
EMSalkylatestheketogroupsofGandT
Intercalatingagentsslipbetweenthenitrogenousbases,whichcanleadtoinsertion/deletions.
–generatedatgapsproducedinDNAduringreplication
11
3. Base damageChemicals, oxidation, radiation cause the
nucleotide to become modifiedUV light
• Results in
Radiation• Causes ionization of molecules• Creates substitutions• Breaks
12
III. Testing mutagenicityA. The Ames Test
Test to determine if a chemicalis a mutagen
suspension of a histidine-requiring (His-) strain ofSalmonella typhimurium platedwith a mixture of rat liverenzymes on agar lackinghistidine
mutagenic effect (reversemutation) of the chemical cancause bacteria to regain theability to grow without histidine,forming the colonies seenaround the disk
13
B. Using transgenic mice to testpossible mutagens
• Big Blue mice are transgenic for a segment of DNA thatcontains:• Lambda phage DNA used as a vector
• 3 genetic elements from the lac operon of E. coli• the lacI gene• the operator of the operon• the beta-galactosidase (lacZ) gene
• The transgenic mice are given repeated doses of thesuspected carcinogen for a week or two. If the chemical ismutagenic, it will cause random mutations throughout thegenome of each mouse cell. If a mutation occurs in either
• the lacI gene (which encodes the lac repressor) or theoperator, the gene
• Mouse DNA then extracted and assayed
14
IV. Repair of mutations
1. Direct Reversal of damage2. Excision repair3. Proofreading4. Mismatch repair5. Post-replication repair & SOS6. Double-strand break repair
15
1. Direct reversal of damagePhotoreactivation repair: reversal of UV damage
Photolyase splits
Photolyase• The two bind together in dark to T-dimer• When light shines on cell
O6-mGua DNA methyltransferase
Alkyltransferase – one time repair enzyme thatremoves ethyl or methyl groups from guanine
16
2. Excision repair
Involved in repair of deamination anddepurination
Enzymes recognize an abnormal base andcleave the bond between in and the sugar inthe DNA backbone.
1) Uracil N-glycosylase removes uracil
2) AP endonuclease cuts 5’ side of damaged site on apurinic bases
3) Phosphodiesterase Removes sugar-phosphate residue
AGTGACTTAGTCAUTGAATC
AGTGACTTAGTCA TGAATC
AGTGACTTAGTCA TGAATC
AGTGACTTAGTCACTGAATC
deamination
U
17
•BER involves:recognition of theerroneous base byDNA glycosylase•cutting of the DNAbackbone by APendonuclease
NER: repairs bulkylesions and involvesthe uvr genes
18
3. Proofreading
DNA Pol III error rate:• Proofreading ability: Pol II can
recognize
• 3’ to 5’ exonuclease ability,
4. Mismatch repair
• Mismatch repair – after proofreading,mismatches identified, improper baseexcised and replaced w/correct base– Adenine methylase recognizes parent
strand and adds methyl group to A’s
19
Mismatch repair-
5. Post-replicational repair &SOS
Post-replicational repair (aka recombination repair ):• Damaged DNA cause Pol III to “stutter” and skip past
damaged site• Replication restarts downstream and a gap is left• Gap is repaired by retrieving sequence from the
normal copy and then the subsequent gap is repaired
20
SOS response• Severe damage due to alkylating agents
or cross-linking agents (UV radiation beststudied) triggers this response– Translesional polymerases (POL II, IV, V)
can replicate over damaged regions
21
6. Double strand break repair
• Repairs DSBs by reannealing the two DNAsegments - protein aligns the broken ends of DNAfor rejoining
• Recombination repair mechanism– Homologous recombination repair –
– Nonhomologous recombination repair – uses non-homologous region for replacement
• Errors in direct joining may be a cause of translocations
Top Related