Biomedical Challenges at Skolkovo• What type of science will be done? What is leading-edge?• Systems medicine offers unique potential—for understanding

disease mechanisms, the need for intimate integration of diagnosis and therapy as well as new strategies for drug target discovery.

• Include non-profit (academic) as well as for profit? How can you enable company creation? How can you attract existing companies? What are appropriate non-profit models?

• Will you try and recruit back Russian scientists from abroad—or will you do it will resident Russian scientists?

• Will the Skolkovo money compete with that for other Russia sciences (or the National Academy)? If so, expect resistance.

• Will you employ strategic partnerships to jump start the creation of Skolkovo? If so, resources will have to go to strategic partners.

• Will you reform your current academic science in keeping with the bold Skolkovo initiative? Two keys: give young scientists an opportunity and resources to direct their own science at an early age and realize the essential nature of good peer review in the allocation of science resources.

Systems Biology and Systems

Medicine: Leading-Edge Science and

Technology, Healthcare, Strategic

Partnerships and Commercialization

Lee Hood

Institute for Systems Biology, Seattle

I Participated in Four Paradigm Changes in

Biology Leading to P4 Medicine

• Bringing engineering to biology (high throughput biology)

• The human genome project

• Cross-disciplinary biology

• Systems biology

Predictive, Preventive, Personalized, and Participatory medicine (P4 Medicine)

• Each fundamentally changed how we think about biology and medicine.

• Each was met initially with enormous skepticism.

• Each new idea needed new organizational structure.

The Grand Challenge of the 21st Century in

Science and Technology Is Complexity

• New concepts, strategies and technologies permit biologists to successfully begin to attack biological complexity

– View biology as an informational science– Systems approaches permit one to attack complexity

effectively– Evolving current and emerging technologies permit the

exploration of new areas of data space (and improve the old)

– Computation and mathematical tools permit one to acquire, store, transmit, integrate, mine and create predictive models.

• These approaches will allow us to effectively attack some of society’s most vexing challenges—healthcare (P4 medicine), global health, environment, energy, nutrition, agriculture, etc.

The Foundations of Systems Biology and

Systems Medicine – Four Pillars

1. View medicine as an informational science

2. Systems approaches allow one to understand wellness and disease—holist rather than atomistic

3. Emerging technologies will allow us to explore new dimensions of patient data space

4. Transforming analytic tools will allow us to decipher the billions of data points for the individual--sculpting in exquisite detail wellness and disease

Biology and Medicine are Information

Sciences

• The digital information of the genome

Human Phenotypes are Specified by Two Types of Biological Information

• Theenvironmental information that impinges upon and modifies the digital information

Two General Biological Structures Connect

the Genotype/Environment and Phenotype

• Biological networks capture, transmit, process and pass on information

• Simple and complex molecular machines execute biological functions

DNA

RNA

Protein

Protein interactions and biomodules

Protein and gene networks

Cells

Organs

Individuals

Populations

Ecologies

All Hierarchical or MultiscaleLevels of Biological

Information—Are Modified by Environmental

Signals

The Foundations of Systems Biology and

Systems Medicine–Four Pillars

1. View medicine as an informational science

2. Systems approaches allow one to understand wellness and disease—holist rather than atomistic (systems biology and systems medicine)

3. Emerging technologies will allow us to explore new dimensions of patient data space

4. Transforming analytic tools will allow us to decipher the billions of data points for the individual--sculpting in exquisite detail wellness and disease

Agenda: Use biology to drive technology and computation. Need to create a cross-disciplinary culture.

COMPUTATION TECHNOLOGY

BIOLOGY

Biological Information

Cross-DisciplinaryCulture

Team ScienceTraining

• Biology

• Chemistry

• Computer Science

• Engineering

• Mathematics

• Physics

Essentials of Systems Biology

• Create model from extant data—formulate hypotheses to test model through experimental perturbations of system--hypothesis-driven and hypothesis-generating

• Data– Global data acquisition– Integrate multi scale data types– Delineate biological network dynamics—temporal and

spatial– Dealing with biological noise and technical noise in large

data sets

• Formulate models that are predictive and actionable—descriptive, graphical or mathematical.

• Discovery science is key

Institute for Systems BiologyFounded 2000—10th Anniversary

ISB has 12 faculty and 300 staff

ISB’s description of systems biologyin 2000 is virtually identical to that ofthis National Academy of Sciences 2010 report entitled the “New Biology”.

ISB was the first Systems Biology organization in 2000—today there are more than 70 world wide

Report predicted that systems approaches would drive biology and medicine of the future

ISB

CNRS

Chinese Academy of Science

Russian Academy of Sciences

SangerInst. Nat. dePhysique Nucleaire

CSHLSSM Cardinal GlennonChildren’s Hospital

RockefellerMIT

WHO HHMI

Salk

MSFTHarvard

FHCRC

Brigham andWomen’s Hospital

IBM

Harbin EngineeringUniversity

TianjinUniversity

National Academy ofSciences of Ukraine

Research Institute ofPetroleum Processing

ParcMediterranide laTecnología

Centro deInvestigaciónPríncipeFelipe

Institut Catalad’InvestigacioQuimica

International Agency forResearch on Cancer Kaiser Permanente

ISB 1st in US and 3rd in World for Impact of Papers

SCImago Institutions Rankings: http://www.scimagoir.com/

A Systems View of Disease

A Systems View of Medicine Postulates that Disease Arises from Disease-Perturbed Networks

Non-Diseased Diseased

dynamics ofpathophysiology

diagnosis

therapy

prevention

A Systems Approach to a

Neurodegenerative Disease (prion

disease) in Mice

• Do the disease-perturbed networks in brain cells explain the pathophysiology of prion disease? Yes

Global and Subtractive Brain Transcriptome Analysis—

Differentially Expressed Genes (DEGs)

Uninfected brain

Prion infected brain

Inoculate w/ Prions

Time-course array analysis:subtrative analyses to DEGs

Mouse Genome array:45,000 probe sets

~22,000 mouse genes.

RNA

from brain

homogenate

Prion strains:• RML• 301V

Mouse strains: C57BL/6J FVB/NCrBL6.I FVB/B4053

C57BL/6J-RML: 12 time points

FVB/NCr-RML: 11 time points

BL6.I-301V: 9 time points

FVB/B4053-RML: 8 time points

7400 DEGs to 333DEGs—signal to noise issues---biological/technical

Neuropathology Identifies 4 Networks

PrP accumulation Microglia / Astrocyteactivation

Synaptic Degeneration

Normal Infected

Nerve cell death

Dynamics of a Brain Network in PrionNeuroddegenerative Disease in Mice

Prion accumulation network

Prionaccumulation

GlialActivation

SynapticDegeneration

Neuronal Cell Death

Cholesteroltransport

Sphingolipidsynthesis

Lysosomeproteolysis

ReactiveAstrocytes

Leukocyteextravasation

Na+

channels

Cargotransport

Caspases

*Arachidonatemetab./Ca+ sig.

Clinical Signs

Sequential Disease-Perturbation of the Four Networks of Prion Disease

0 wk 18~20 wk 22 wk

Making Blood A Window Distinguishing

Health and DiseaseOrgan-specific Blood Proteins

Blood Vessel

110 brain-specific blood proteins/80 liver-specific blood proteins

Why Systems-Driven Blood Diagnostics Will Be

the Key to P4 Medicine

• Early detection

• Disease stratification

• Disease progression

• Follow therapy

• Assess reoccurances

Integrated Diagnostics

Disease Stratification – HerceptinWhy Diagnosis/Therapy Must Be Integrated

50% reduced risk of recurrenceafter one year

Some women with metastatic breast cancer have

tumors that overexpress the HER2 gene and

have a poorer response to chemotherapy

Identifying HER2+ patients with genetic

(FISH) or immunological (IHC) tests and

targeting with Herceptin improves treatment.

Herceptin +

Target treatment…

HercepTest®

Pathway®

PathVysion®

HER2 pharmDx™

IHC

FISH

The Foundations of Systems Biology and

Systems Medicine–Four Pillars

1. View medicine as an informational science

2. Systems approaches allow one to understand wellness and disease—holist rather than atomistic

3. Emerging technologies will allow us to explore new dimensions of patient data space

4. Transforming analytic tools will allow us to decipher the billions of data points for the individual--sculpting in exquisite detail wellness and disease

Big Science/Small Science

• Two types of big science– Discovery (human genome project)– Integrative, cross-disciplinary, hypothesis driven, focused

on concrete objective

• Small science—individual investigator initiated

Big and small science are synergist—and should be integrated

Currently an enormous conflict at the NIH funding levels for big science. Should have a balanced portfolio of big and small science.

Four ISB Technology-Driven New

Big Projects

• Complete genome sequencing of families—sequences and new stratifications to identify disease genes—1000s individuals

• The Human Proteome Project—SRM mass spectrometry assays for all human proteins

• Clinical assays for patients that allow new dimensions of data space to be explored

• The 2nd Human Genome Project—mining all complete human genomes and their phenotypic/clinical data

Whole Genome Sequencing of

Families: A New Genomic Strategy

• Sequencing by Complete Genomics, Inc.

• D. Galas, J. Roach, G. Glusman and A. Smit at ISB

• Collaboration with human geneticists at the UW and Utah

Whole Genome Sequencing of Family of Four

Unaffected parents

Children each with 2 diseases--craniofacialmalformation (Miller Syndrome) and lung disease (ciliarydyskinesia)

Identify 70% of sequence errors using principles of Mendelian genetics—less than 1/100,000 error rate—now 1/ 1,000,000Discovery of about 230,000 rare variants in family—confirmed by identificationin two or more family members

Reduce the genome haplotype search space for disease genes—Mendelianhaplotype blocks reduce space to ¼ haplotypes for each individual

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X

centromere

error region

heterochromatin

haploidentical maternal

identical

haploidentical paternal

nonidentical

CNV

candidate gene

maternal recombination

paternal recombination

DH

OD

HK

IAA

05

56DN

AH

5

ZNF7

21

Miller’s gene

Ciliarydyskenesis gene

Genomes of kids

Sibling genomes are identical across ~25% of their length

(23.2% here)

Family Genome Sequencing May

Facilitate Finding

• Mendeliandisease genes

• Modifiers of disease genes--sequencing genomes of about 80 Huntington’s patients from families—mostly finished

• Genes encoding complex genetic diseases after proper patient stratification—Alzheimer’s/Parkinson’s diseases

Game Changer—

declining cost of sequencing genomes will make them a part of your

medical record in 10 years or less

The Human Proteome Project

• Strategic partners: ISB (R. Moritz)/ETH (R. Aebersold)/Agilent/AB-Sciex/Origene

* Commercial software not part of TPP

1. Trans Proteomic Pipeline (TPP) components

2. TPP: Foundation for PeptideAtlas

Advanced, uniform processing of all data

Drives tool development and optimization

38

3. Targeted Proteomics: Human SRMAtlas

4. SRM assays for most of the known 20,333

human proteins

Analyze 100-200 proteins quantitatively in 1 hour

Making Blood a Window into Health and Disease for 100s millions of patients:

50 organ-specific blood proteins from each of 50 organs

Integrated nanotech/microfluidics platform

Jim Heath, et al

cells out

300 nanoliters of plasma

Assay region

5 minute measurement1. Uses fraction of droplet of blood2. Assay takes 5 minutes3. Dynamic range 106

4. Potential for thousands of protein assays on one chip

Technologies for

Exploring New

Dimensions of Patient

Data Space

Individual Patient Information-Based Assays of

the Present/ Future (I)• Genomics

– Complete individual genome sequences—predictive health history—will be done sequencing families

– Complete individual cell genome sequences—cancer.– Complete MHC chromosomal sequence in families—autoimmune disease and

allergies– 200 Actionable SNPs—pharmacogenetics-related and disease-related genes– Sequence 1000 transcriptomes—tissues and single cells—stratification disease– Analyze aging transcriptome profiles—tissues and single cells—wellness– Analyze miRNA profiles—tissues, single cells and blood—disease diagnosis

• Proteomics– Organ-specific blood MRM protein assays—110 brain, 80 liver and 20 lung

– 2500 blood organ-specific blood proteins from 300 nanoliters of blood in 5 minutes—twice per year (50 proteins from 50 organs)—wellness assessment.

– New protein capture agents.– Array of 13,000 human proteins—against autoimmune or allergic sera--stratify.– Single molecule protein analyses—blood organ-specific proteins and single cell

analyses

Individual Patient Information-Based Assays of

the Present/ Future (II)

• Single cells• Analyze10,000 B cells and 10,000 T cells for the functional

regions of their immune receptors—past and present immune responsiveness—follow vaccinations—identify autoimmune antibodies.

• Analyze individual blood macrophages—inflammation, etc.• Use pore technology to separate epithelial cells from blood

cells—cancer

• iPS (stem) cells– Analyze individual stem (iPS) cells from each individual

differentiated to relevant tissues to get important phenotypic information—molecular, imaging and higher level phenotypic measurements.

Applications of Induced

Pluripotential Stem (iPS) Cells

Induced Pluripotent Stem Cells

Blood draw or skin biopsy

Induced pluripotent stem (iPS) Cells

Introduce four reprogramming factors

Induced Pluripotential Stem Cells (iPS cells)

Induced Pluripotent Stem CellsTwo Critical Characteristics

Replicate Indefinitely Make all

100s or more cell types in human body

Induced Pluripotent Stem (iPS) Cells

What’s so special about iPS cells?

The Foundation of Systems Biology and Systems

Medicine–Four Pillars

1. View medicine as an informational science

2. Systems approaches allow one to understand wellness and disease—holist rather than atomistic

3. Emerging technologies will allow us to explore new dimensions of patient data space

4. Transforming analytic tools will allow us to decipher the billions of data points for the individual--sculpting in exquisite detail wellness and disease

In 10 years a Virtual Cloud of Billions of Data Points Will

Surround Each Individual

Transactional

110101000101010101101010101001000101101010001

Phenome

Na143 K 3.7 BP 110/70

HCT32 BUN 12.9 Pulse

110 PLT150 WBC 92

GCGTAGATGCGTAGGCATGCATGCCATTATAGCTTCCA

Genome

Proteome

arg-his-pro-gly-leu-ser-thr-ala-trp-tyr-val-met-phe-asp-cys

Transcriptome

UUAGUGAUGCGUCUAGGCAUGC

AUGCC

Epigenome

110101000101010101101010101001000101101010001

Single Cell

110101000101010101101010101001000101101010001

iPS Cells

110101000101010101101010101001000101101010001

Social Media

110101000101010101101010101001000101101010001

TeleHealth

110101000101010101101010101001000101101010001

Healthcare

Predictive, Personalized, Preventive and Participatory (P4) Medicine

• Driven by systems approaches to disease, new measurement (nanotechnology) and visualization technologies and powerful new computational tools, P4 medicine will emerge over the next 10-20 years

49

Strategic Partnerships

ISB Strategic Partnerships:

Objectives

• Critical to fulfill ISB’s mission of attacking big scientific problems

• Complementary scientific/medical expertise

• New funding resources

• Assess to new patient materials and records

• Access to novel technologies and analytic tools

• Gather the best scientists in the world to do big science—integrative, cross-disciplinary, hypothesis-driven science.

ISB’s Strategic Partners for P4

Medicine

• Develop the P4 tools and strategies for patient assays—State of Luxembourg--$100 million over 5 years

• Bring P4 medicine to patients with the creation of the non-profit P4 Medical Institute (P4MI) in partnership with Ohio State Medical School—two pilot projects—wellness and heart failure

ISB/Luxembourg

Strategic Partnership

• Helping to creating a Center for Systembiomedicine similar to ISB—Rudi Balling Director—recruit and training of personnel

• Helping establish biotech industry in Luxembourg—start ups and established companies--integrated personalized medicine company—Integrated Diagnostics

• Two collaborative research projects--$100 million to ISB over 5 years

The P4 Medicine Institute (http://www.P4MI.org)

• Non-profit 501c3--ISB and Ohio State founding members• Vision--identify, recruit and integrate strategic partners

with ISB to bring P4 medicine to patients—create a small network of large and small medical centers

• Convince a skeptical medical community through demonstration with two Ohio pilot projects (and others)—wellness and heart failure—exhibit success and power of P4 medicine

• Seek academic and industrial partners who share the P4 vision and have complementary skills/resources

• Bringing on consultants to analyze the societal challenges of P4 medicine—ethics, security, confidentiality, policy, regulation, economics, etc.

The Flattening of Many Worlds: Strategic Partnerships and the

Globalization of ScienceThe worlds of science, technology, health are flattening.

Tremendous opportunities for national and international strategic partnerships in science, technology and education.

• Network of interacting complementary, institutions

– Training in systems biology and recruiting the best world talent

• Transferring and collaborating on new technologies and computational tools

• Strategic partnerships on systems approaches to biology and P4 medicine

• New patient populations

• New fundraising and commercialization opportunities

Commercialization

13 Companies Founded Or Cofounded

By Hood Lab: Transferring Knowledge to

Society

• Applied Biosystems--molecular instrumentation--technology• Amgen--molecular biology--biology• Systemix--stem cell biology--biology• T Cell Sciences--T cell therapies--biology• Darwin--genomics--technology• Prolinx--protein chemistry--technology*• Rosetta--global array analyses—technology• Geospezia—informatics• Cytopeia—high speed, multiparameter cell sorting• Macrogenics--antibodies and innate immunity—biology• Nanostring--digital counting of RNA molecules--technology• Accelerator--commercialize early start-ups--business• Integrated Diagnostics--blood diagnostics--medicine

ISB’s Accelerator Corporation

Accelerator Corporation1616 Eastlake Avenue East

Carl Weissman CEOSeattle

For Profit Company:•Commercializing cutting edge ideas in Systems Biology and related fields--6 new companies founded--more than 350

business plans reviewed

•ISB to get founders equity--long term endowment--facultyconsulting and facilities access

Established: May, 2003

Partners:ISB + 6 Life Science Leaders

CEO: Carl Weissman

Location: Seattle – 10 minute drive from ISB

•Arch Ventures ($1 B+)•MPM Capital ($2.1 B)•Versant ($650 M+)•OVP ($500)•Amgen ($100)•Alexandria Real Estate Investment Corp

Essential Components for Starting

Companies• A good scientific idea that creates a marketable product• Clear business plan that is milestone driven• Good management—the CEO is critical• Capital—with staying power if the company is successful—in biotech

company development is expensive and takes time• Those who can critically evaluate startups—and can select the 1/100

successful companies—this is critical• Skilled workforce—good young scientists• A clearly formulated one or more provisional exit strategies• Entrepreneurial scientists—with an inclination to think about how their

science can be transferred to society—how do we train?• Fostering serial entrepreneurs• A source of good science for company ideas—usually outstanding

academic centers• Intellectual property is key• National and international opportunities for funding

Two Final Points

Conceptual Themes of P4 Medicine

Disease DemystifiedWellness Quantified

P4 MedicinePredictive

Preventive

Personalized

Participatory

Will impact the health care system significantly:

• Pharmaceuticals

• Biotechnology

• Diagnostics

• IT for healthcare

• Healthcare industry

• Health insurance

• Medicine--diagnostics, therapy, prevention, wellness

• Nutrition

• Assessments of environmental toxicities

• Academia and medical schools

P4 Medicine Will Transform the Health Care Industry

Healthcare System

Fundamentally new ideas need New organizational structures

Digitalization of Biology and Medicine Will Transform Medicine

• Analysis of single molecules, single cells, single organs and single individuals

• I Phone-like device with digitalize personal records—monitoring and access

• A revolution that will transform medicine even more than digitalization transformed information technologies and communications

• Digitization of medicine will lead to dramatically lower healthcare costs

Single individual Single cell Single molecule

ISB Is Inventing the Future

20th Century Biomedicine 21st Century BiomedicineISB•Analyzing one gene and one

small problem at a time• Systems analysis of biology and

medicine--e.g., ability to attack big problems such as P4 medicine

• Technology development

• Pioneer computational tools

• Transferring knowledge to society-creating companies--changing K-education

• Strategic partnerships—for bigscientific problems—e.g. P4

medicine--industrial, academic, government, international

Biomedical Challenges at Skolkovo

• What type of science will be done? What is leading-edge?• Systems medicine offers unique potential—for understanding

disease mechanisms, the need for intimate integration of diagnosis and therapy as well as new strategies for drug target discovery.

• Include non-profit (academic) as well as for profit? How can you enable company creation? How can you attract existing companies? What are appropriate non-profit models?

• Will you try and recruit back Russian scientists from abroad—or will you do it will resident Russian scientists?

• Will the Skolkovo money compete with that for other Russia sciences (or the National Academy)? If so, expect resistance.

• Will you employ strategic partnerships to jump start the creation of Skolkovo? If so, resources will have to go to strategic partners.

• Will you reform your current academic science in keeping with the bold Skolkovo initiative? Two keys: give young scientists an opportunity and resources to direct their own science at an early age and realize the essential nature of good peer review in the allocation of science resources.