Identification and characterization of Casein Kinase 2 as ...€¦ · Identification and...

Identification and characterization of

Casein Kinase 2 as MuSK binding partner

Den Naturwissenschaftlichen Fakultäten

der Friedrich-Alexander-Universität Erlangen-Nürnberg

zur

Erlangung des Doktorgrades

vorgelegt von

Tatiana Cheusova

aus Nowosibirsk, Russland

2006

Als Dissertation genehmigt von den Naturwissen-

schaftlichen Fakultäten der Universität Erlangen-Nürnberg

Tag der mündlichen Prüfung: 7. Juni 2006

Vorsitzender der Promotionskommission: Prof. Dr. D.-P. Häder

Erstberichterstatter: PD Dr. F. Titgemeyer

Zweitberichterstatter: Prof. Dr. M. Wegner

To my mother

Table of contents ___________________________________________________________________________

Table of contents Zusammenfassung.................................................................................................................... 1

Summary................................................................................................................................... 2

1. Introduction .......................................................................................................................... 3

1.1. Structure and function of the NMJ................................................................................... 3

1.1.1. The presynaptic part is formed by motoneuron......................................................... 4

1.1.2. The postsynaptic part is generated by myotubes ....................................................... 4

1.1.3. The role of Schwann cells at the NMJ....................................................................... 5

1.1.4. The basal lamina at the NMJ ..................................................................................... 6

1.1.5. Physiology of the NMJ .............................................................................................. 6

1.2. Development of the NMJ................................................................................................. 7

1.2.1. Origin of cells ............................................................................................................ 7

1.2.2. Establishment of nerve-muscle contact ..................................................................... 8

1.2.3. Postsynaptic differentiation ....................................................................................... 9

1.3. Molecules and signaling cascades involved in the postsynaptic differentiation............ 10

1.3.1. Agrin-MuSK-rapsyn signaling cascade................................................................... 10

1.3.2. Synapse specific transcription ................................................................................. 17

1.3.3. MuSK binding partners ........................................................................................... 19

2. Aim of the study.................................................................................................................. 23

3. Material and methods ........................................................................................................ 25

3.1. Materials ........................................................................................................................ 25

3.1.1. Reagents................................................................................................................... 25

3.1.2. Devices .................................................................................................................... 26

3.1.3. Oligonucleotides...................................................................................................... 27

3.1.3. siRNAs..................................................................................................................... 31

3.1.4. Enzymes................................................................................................................... 34

3.1.5. Kits and Columns .................................................................................................... 34

3.1.6. Antibodies................................................................................................................ 35

3.1.7. Frequently used solutions ........................................................................................ 36

3.1.8. Cell culture .............................................................................................................. 37

3.1.9. Animals.................................................................................................................... 37

3.2. Methods.......................................................................................................................... 38

3.2.1. Molecular Biology Methods.................................................................................... 38

I


3.2.1.1. Isolation of plasmid DNA ................................................................................. 38

3.2.1.2. Determination of DNA/RNA concentration ..................................................... 38

3.2.1.3. Electrophoretic separation of DNA fragments in agarose gel........................... 39

3.2.1.4. PCR amplification of DNA............................................................................... 39

3.2.1.5. Cloning techniques............................................................................................ 39

3.2.1.6. Plasmid constructs............................................................................................. 40

3.2.1.7. Transformation of E. coli competent cells. ....................................................... 42

3.2.1.8. Site directed mutagenesis. ................................................................................. 43

3.2.1.9. Lightcycler PCR................................................................................................ 44

3.2.1.10. Total RNA isolation ........................................................................................ 45

3.2.1.11. Complementary DNA-synthesis (Reverse Transcription) .............................. 45

3.2.1.12. Yeast two hybrid (Y2H) techniques................................................................ 46

3.2.2. Protein Biochemistry Methods ................................................................................ 49

3.2.2.1. Preparation of protein extract from cells and tissues. ....................................... 49

3.2.2.2. Immunoprecipitation ......................................................................................... 49

3.2.2.3. Protein expression and extraction from bacteria ............................................... 50

3.2.2.4. GST-pulldown................................................................................................... 51

3.2.2.5. Determination of protein concentration ............................................................ 51

3.2.2.6. Electrophoresis of proteins................................................................................ 51

3.2.2.7. Staining of protein gels ..................................................................................... 52

3.2.2.8. Western blot ...................................................................................................... 53

3.2.2.9. In vitro kinase assay .......................................................................................... 53

3.2.3. Cell culture methods................................................................................................ 54

3.2.3.1. Cultivation of HEK293, Cos7, C2C12, MuSK-deficient myoblasts................. 54

3.2.3.2. Transient transfection of cells ........................................................................... 55

3.2.3.3. Luciferase reporter test...................................................................................... 56

3.2.3.4. Agrin treatment ................................................................................................. 57

3.2.3.5. Application of CK2 inhibitors........................................................................... 57

3.2.3.6. Immunocytochemistry....................................................................................... 57

3.2.3.7. AChR cluster stability assay ............................................................................. 58

3.2.3.8. Quantification analysis of AChR clusters .................................................... 58

3.2.4.Animal care and immunohistochemistry methods ................................................... 58

3.2.4.1. Generation of muscle specific CK2β knockout animals ................................... 58

3.2.4.2. Genotyping ........................................................................................................ 59

II


3.2.4.3. Surgical Procedures........................................................................................... 60

3.2.4.4. Immunohistochemistry...................................................................................... 60

3.2.4.5. Mycroscopy, imaging and quantification of endplates. .................................... 61

4. Results ................................................................................................................................. 62

4.1. Searching for MuSK binding proteins ........................................................................... 62

4.1.1. Generation and characterization of MuSK baits for yeast two hybrid screens ....... 62

4.1.2. Outcome of the yeast two hybrid screens with MuSK baits.................................... 63

4.2. Detailed investigation of MuSK – CK2 interaction....................................................... 65

4.2.1. Quantitative determination of CK2 transcript level in different tissues .................. 65

4.2.2. Biochemical verification of the interaction of CK2 subunits with MuSK .............. 67

4.2.3. Mapping of interacting domains between MuSK and CK2β .................................. 69

4.2.4. Localization of CK2 at the NMJ.............................................................................. 72

4.2.5. Biological role of CK2 at the NMJ.......................................................................... 76

4.2.5.1. Inhibition of CK2 activity ................................................................................. 76

4.2.5.2. Knockdown of CK2 subunits by using siRNA ................................................. 78

4.2.5.3. Phosphorylation of MuSK by CK2 ................................................................... 80

4.2.5.4. Role of CK2 dependent serine phosphorylation of MuSK for AChR clustering

........................................................................................................................................ 82

4.2.5.5. Role of kinase insert domain of MuSK in AChR clustering............................. 84

4.2.5.6. Mechanism of CK2 action................................................................................. 87

4.2.5.7. Generation and characterization of muscle-specific CK2β knockout mice ...... 88

5. Discussion............................................................................................................................ 94

5.1. Potential MuSK binding partners................................................................................... 94

5.2. CK2 – newly characterized MuSK binding partner....................................................... 96

5.3. Phosphorylation of MuSK by CK2 is required for appropriate AChR clustering......... 97

5.4. KI domain of MuSK is involved in modulation of postsynaptic specialization ............ 99

5.5. Role of CK2 in development of postsynaptic apparatus in vivo. ................................. 100

6. Abbreviations.................................................................................................................... 103

7. References ......................................................................................................................... 105

Curriculum vitae .................................................................................................................. 114

Publications........................................................................................................................... 115

Acknowledgments................................................................................................................. 116

III

Zusammenfassung ___________________________________________________________________________

Zusammenfassung Die Synaptogenese an der neuromuskulären Verbindung erfordert u.a. die Bildung eines

postsynaptischen Apparats, welcher duch die Sezernierung von Agrin an Nervenendigungen

eingeleitet wird. Agrin stimuliert die muskel-spezifische Rezeptortyrosinkinase MuSK, dass

seinerseits die Aggregation nikotinischer Acetylcholin-Rezeptoren herbeiführt. Signalwege,

welche von MuSK aktiviert werden sind bisher nur unzureichend verstanden.

Das Ziel der vorliegenden Arbeit war die Identifikation von Bindepartnern des MuSK. Dazu

wurde das Verfahren des Hefe-2-Hybrid angewandt. Einer der Proteine, welcher mit der

intrazellulären Region des MuSK interagiert, war die regulatorische β Untereinheit der Casein

Kinase 2 (CK2β). Es konnte gezeigt werden, dass sowohl die katalytische α-, als auch die

regulatorische β Untereinheit des CK2 in vivo mit MuSK interagieren. Zudem sind die

Transkripte der CK2 Untereinheiten in der postsynaptischen Region der Myotuben adulter

Mäuse angereichert. Inhibitor-, oder siRNA-vermittelte Reduktion der CK2 Aktivität

beeinrächtigte die Aggregation nikotinischer Acetylcholin-Rezeptoren in Zellkulturmodell. Es

konnte gezeigt werden, dass in vitro CK2 bestimmte Serine im ‚kinase insert’, einem bisher

funktionell nicht charakterisiertem Epitop von MuSK phosphorylieren kann. Der Ausfall

dieser Phosphorylierung geht mit einer fehlerhaften Aggregation der nikotinischen

Acetylcholin-Rezeptoren einher. Weitere Experimente zeigten, dass diese Beeinträchtigung

der Aggregation der Acetylcholin-Rezeptoren auch zu beobachten ist, wenn das ‚kinase

insert’ von MuSK mit dem ‚kinase insert’ anderer Rezeptortyrosinkinasen ausgetauscht wird,

welche keine CK2-phosphorylierbaren Aminosäuren enthalten. Die Behandlung von

Myotuben-Kulturen mit einem CK2-Inhibitor zeigte, dass nicht die Kinase-Aktivität von

MuSK abhängig von der Phosphorylierung genannter Serine ist, sondern die Stabilität der

Acetylcholin-Rezeptoren. Schliesslich wurde die Bedeutung dieser Interaktion zwischen

MuSK und CK2β in vivo untermauert. Die Deletion des CK2β in Myotuben von Mäusen

führte zu einem myasthenischen Phänotyp.

In dieser Studie wurde erstmals sowohl eine funktionelle Bedeutung für das ‚kinase insert’

Epitop von MuSK nachgewiesen, als auch die Abhängigkeit der Synaptogenese des

postsynaptischen Apparates von Phosphorylierungen von Serinresten demonstriert.

1

Summary ___________________________________________________________________________

Summary

The formation of the postsynaptic apparatus at the neuromuscular junction is initiated by the

release of agrin from the nerve terminal and subsequent activation of the muscle-specific

receptor tyrosine kinase MuSK which leads to the aggregation of nicotinic acetylcholine

receptors. Signaling pathways downstream of MuSK are poorly understood.

The goal of this study was to investigate MuSK downstream pathways by identification of

MuSK interactors using a yeast two hybrid system. One of the identified proteins interacting

with the intracellular domain of MuSK was the regulatory β subunit of the Casein Kinase 2

(CK2β). Our study has shown that both the catalytic α and the regulatory β subunits of CK2

interact with MuSK in vivo and that their mRNAs as well as proteins are concentrated at

postsynaptic specializations of adult mice. Inhibition of CK2 activity either by chemical

compounds or by siRNA in muscle cell culture resulted in impairment of AChR cluster

morphology. Further investigations have revealed that CK2-mediated phosphorylation of

MuSK occurs at serines 680 and 697 which belong to a domain of unknown function

separating the kinase domain in two part and called ‘kinase insert’. The phosphorylation of

these serine residues is required for appropriate AChR clustering. Consistently, the

replacement of the MuSK kinase insert domain by kinase insert domains of other receptor

tyrosine kinases containing potential CK2-phosphorylatable serines correlated with their

ability to mediate proper AChR clustering. MuSK kinase activity was not changed, but AChR

cluster stability dramatically decreased upon blockage of CK2. Muscle-specific ablation of

CK2β in mice resulted in the change of CK2 activity and fragmentation of muscle endplates

accompanied by a myasthenic phenotype.

This study demonstrates that CK2-mediated phosphorylation of serine residues inside of the

MuSK kinase insert domain plays an important role for the development of postsynaptic

specializations at the neuromuscular junctions.

2

Introduction ___________________________________________________________________________

1. Introduction

According to the definition of Sherrington, synapses are points of contact between two

neurons (Pearce 2004). Nowadays, this term describes a sophisticated machinery which is

required to ensure proper transmission of information between neurons (at the central nervous

system; CNS) or neurons and muscle cells (at the peripheral nervous system; PNS). More

precisely, synapses are composed of a presynaptic and a postsynaptic part. Neurotransmitter

molecules are released from the presynaptic nerve terminal and interact with neurotransmitter

receptors thereby activating them in the membrane of postsynaptic cell. To ensure a rapid and

reliable transmission, first, the presynaptic terminal has to be organized in a way to maximize

the efficacy of neurotransmitter secretion and, second, receptors at the postsynaptic membrane

must be present in high density (a hallmark of postsynaptic specialization) directly opposite of

the sites of neurotransmitter release.

Despite good knowledge of synapse architecture, little is known about the processes, which

lead to the presynaptic and postsynaptic differentiation. Much of current data originates from

studies on the vertebrate neuromuscular junction (NMJ), a peripheral cholinergic synapse

between motoneuron and skeletal muscle. This prototypical synapse offers a number of

advantages, like large size, simplicity, accessibility, and availability of tools for its analysis

(Sanes and Lichtman 2001).

1.1. Structure and function of the NMJ

The NMJ comprises portions of three cells – motoneuron, muscle fiber and Schwann cell.

Basal lamina surrounds all three cells passing through the synaptic cleft and extending into

the junctional folds formed by muscle fiber (Fig. 1).

3

Introduction ___________________________________________________________________________

Fig. 1: Structure of the NMJ. The motor nerve terminal occupies a shallow gutter in the muscle fiber. The terminal Schwann cell caps the entire synaptic structure. Basal lamina passes through the synaptic cleft and extends into the junctional folds (from (Liyanage et al. 2002)).

1.1.1. The presynaptic part is formed by motoneuron

The motoneuron terminal is specialized for neurotransmitter release. It has a large number of

synaptic vesicles containing the neurotransmitter acetylcholine (ACh), as well as numerous

mitochondria, which provide the energy for its synthesis and release. Most of the vesicles

cluster in the half-terminal that is opposed to the muscle fiber, whereas most of the

mitochondria in the half-terminal beneath the Schwann cell (Fig. 1). Many of the vesicles are

further focused at dense patches on the presynaptic membrane, called active zones, where

they fuse with the presynaptic membrane thereby releasing their content into the synaptic cleft

(Fig. 1) (Yee 1988).

The best-studied molecules of the nerve terminal are proteins of the synaptic vesicles. Mostly

these are the neurotransmitter ACh, the enzyme responsible for its synthesis choline

acetyltransferase, and ACh transporter, which carries out vesicular storage of ACh by

exchanging intravesicular protons for cytoplasmic ACh (Bravo and Parsons 2002; Calakos

and Scheller 1996). Other components of synaptic vesicles are SNARE proteins, such as

synaptobrevin and synaptotagmin that act as mediators of the vesicle fusion (Atwood and

Karunanithi 2002).

1.1.2. The postsynaptic part is generated by myotube

The postsynaptic muscle membrane is specialized to respond effectively to released

neurotransmitter. In the region which faces the motor nerve terminal it has a very high

concentration of nicotinic acetylcholine receptors (AChRs) (>10000/µm2) (Salpeter and

Loring 1985). Several actin binding proteins associate with the cytoplasmic portion of the

4

Introduction ___________________________________________________________________________

AChRs thereby linking them to the muscle cytoskeleton, which is important for generation

and maintenance of the high synaptic density of the receptors (Grady et al. 2000). The

postsynaptic membrane of the muscle fibers is depressed into shallow gutters beneath the

nerve terminals, and then further invaginated to form so-called junctional folds, which are

about 0.1 µm wide, 1µm deep and spaced at 1-3µm intervals (Fig. 1). The throats of the folds

open directly opposite of the active zones. AChRs are located at the crests and pathway down

the sides of the folds, whereas voltage gated Na+-channels and the neural cell adhesion

molecule (N-CAM) are found preferentially at the troughs of folds (Covault and Sanes 1986;

Flucher and Daniels 1989). Such arrangements serve, first, to increase the contact area

between nerve and muscle (the gutters), second, to have high AChRs density at ACh release

sites (folds) and, at last, to facilitate the depolarization of the membrane leading to the

generation of action potential and contraction of the muscle (distribution of AChRs and Na+-

channels). Altogether, this organization enhances the efficacy of the synaptic transmission

from nerve to muscle (Sanes and Lichtman 1999; Wood and Slater 1997). The cytoskeletal-

binding protein composition of the folds is also heterogeneous: utrophin and α-dystrobrevin-1

are located together with rapsyn and AChRs at the tops of folds, while ankyrin, α-

dystrobrevin-2 and dystrophin are concentrated at their bottoms (Flucher and Daniels 1989;

Peters et al. 1998; Wood and Slater 1997). Cytoskeletal elements are most likely involved not

only in generating the folds but also in maintaining the different domains with different

proteins from which they are composed.

1.1.3. The role of Schwann cells at the NMJ

At the NMJ the entire synaptic structure is covered with specialized glial cells (Fig. 1). These

cells are termed perisynaptic or terminal Schwann cells. In contrast to Schwann cells, which

contact preterminal portions of the axon forming myelin sheaths, terminal Schwann cells are

nonmyelinating. These two types of Schwann cells, though derived from the same

progenitors, later, according to their functional specialization, differ structurally and express

different genes. For example, myelin-forming Schwann cells highly express myelin basic

protein, myelin-associated glycoprotein, and P0, whereas terminal Schwann cells are able to

synthesize high levels of N-CAM and S-100 (Mirsky et al. 1996). Among functions of

terminal Schwann cells are insulation of the nerve terminal from the environment and its

supply with trophic sustenance. Terminal Schwann cells also play a role in recovery of

synaptic integrity following injury (Son et al. 1996) as well as in modulation of synaptic

5

Introduction ___________________________________________________________________________

activity through short-term plasticity, which can contribute to the reliability of synaptic

transmission (Colomar and Robitaille 2004).

1.1.4. The basal lamina at the NMJ

The structured form of extracellular matrix also known as basal lamina ensheaths the whole

muscle fiber and passes at the site of nerve contact through the synaptic cleft, extending into

the junctional folds (Fig. 1). The basal lamina of the NMJ contains members of large protein

families like collagen IV, laminin, entactin, fibronectin, and heparan sulfate proteoglycans.

Subsequently, synaptic and extrasynaptic portions of the basal lamina contain different

isoforms of these proteins. The best known example is laminin, the β1 chain containing

isoform of which is part of the extrasynaptic basal lamina, while β2 chain laminins are found

exclusively in synaptic portion and originally were named s-laminins (Hunter et al. 1989).

Other components strongly enriched in mature basal lamina include the collagen-tailed form

of acetylcholinesterase (AChE), a set of glycoconjugates, and two signaling molecules, agrin

and neuregulin (NRG) (Goodearl et al. 1995; Krejci et al. 1997; McMahan 1990; Scott et al.

1988). Synapse-specific components of basal lamina can be considered as candidate cues for

regulation of synapse formation and function.

1.1.5. Physiology of the NMJ

Muscle contraction in response to a nerve impulse requires the sequential activation of at least

five different sets of ion channels. First, the arrival of an action potential at the nerve terminal

induces the opening of Ca2+ channels, which are located at active zones. As the [Ca2+] outside

of cells is >1000 fold higher then inside, the Ca2+ ions flow into the nerve terminal. The

increased [Ca2+] in the nerve terminal induces the fusion of synaptic vesicles at active zones

and subsequent release of the neurotransmitter ACh into the synaptic cleft. In turn, ACh binds

to postsynaptic muscular AChRs. The opening of AChRs leads to Na+ influx and local

membrane depolarization, which induces opening of closely located voltage-gated Na+-

channels. This results in further influx of Na+ and a self-propagating depolarization (action

potential) that spreads through the entire muscle membrane. The generalized depolarization of

the muscle cell membrane activates voltage-gated Ca2+-channels in specialized intracellular

regions of muscle fiber, called transverse T-tubules. This induces the opening of Ca2+-release

channels in the adjacent region of the sarcoplasmic reticulum and an efflux of Ca2+ ions in the

cytoplasm from this intracellular reservoir. Sudden increase of the cytosolic Ca2+

6

Introduction ___________________________________________________________________________

concentration activates the muscle contraction (Alberts Fourth Edition; Sanes and Lichtman

1999).

Unlike most synapses of the CNS the motor nerve of the NMJ releases more quanta of ACh

than is required to induce an action potential and the following contraction of the muscle

fiber. This excess of released ACh quanta establishes the safety factor of the NMJ, making the

system extremely reliable (Slater 2003).

1.2. Development of the NMJ

1.2.1. Origin of cells

All three cell types composing the NMJ migrate a long distances to meet and establish a

synapse (Fig. 2).

The muscle fibers originate from mesodermal cells that acquire their myogenic identity in the

dermatomyotomal portion of the somites. The myogenic cells migrate to sites of muscle

formation, where they divide and differentiate into myoblasts. Beginning at embryonic day 11

(E11) in mouse, the myoblasts fuse in order to form multinucleated myotubes. At this time,

genes that encode contractile and synaptic proteins are activated. Per definition, a myotube

becomes a myofiber when the myonuclei move from the core of the tube to its periphery.

Motoneurons arise in the ventral portion of the neural tube from multipotential progenitors.

Motor axons exit the central nervous system through ventral roots or cranial nerves. They run

long distances through peripheral nerves to the developing muscles. At E12-E13 the motor

axons approach the muscle fibers and synapse formation starts.

7

Introduction ___________________________________________________________________________

Fig. 2: Early steps of the NMJ formation. (a) Origin of cells comprising the NMJ. Myoblasts arise from somites, motor axons from somata in the neural tube, and Schwann cells from the neural crest. (b) Myotubes formed by fusion of myoblasts are approached by motor axons, closely followed by Schwann cells. (c) Initial contacts between growth cones of motor axons and myofibers are not specialized. (d) As development proceeds, presynaptic and postsynaptic specialization occurs, resulting at birth in (e) fully functional and multiply innervated NMJs (from (Sanes and Lichtman 1999)).

Schwann cells, the glial cells of the peripheral nervous system, derive from the neural crest,

the dorsal part of the neural tube. Schwann cells and motor axons traverse the rostral halves of

the somites, from which they acquire their segmental arrangement. Schwann cells become

associated with motor axons somewhere within or near the somites and then follow them

through the periphery into muscles. The motor axons supply Schwann cells with mitogenic

stimuli and migratory guidance (Sanes and Lichtman 1999).

It is assumed that prior to their contact the three cells types of the synapse already acquire

their identity and express most of the proteins, which are subsequently concentrated at the

NMJ. Even more interesting is that muscle cells are capable of formation of postsynaptic

specialization (AChR clustering) already on early stages of embryogenesis and do not require

nerve contact for this (Lin et al. 2001).

1.2.2. Establishment of nerve-muscle contact

During development, initial contact between motor nerve terminal and muscle fiber is

established directly after the formation of the muscle fiber (Fig. 2) (Burden 2002). At this

time the motor neuron is not specialized yet, but already capable of neurotransmission.

Because initially both nerve terminal and muscle fiber lack their specialization, the efficacy of

8

Introduction ___________________________________________________________________________

the transmission is low. At E14 first signs of postsynaptic specialization indicated by the

aggregation of AChR clusters appear on the surface of muscle fibers. These first clusters are

aneural because they do not correspond to the geometry of the intercellular contacts.

Innervation causes redistribution of these clusters and by E16-E18 all AChR clusters are

matching to the nerve terminals. At birth, both nerve terminal and muscle fiber are greatly

transformed and have accomplished their pre- and postsynaptic specialization. At this stage

the NMJ is functional, but still immature (Luo et al. 2003b). In the first two or three postnatal

weeks the NMJ undergoes a number of morphological changes which result in formation of

pretzel-like shaped endplate innervated by a single-motor neuron.

In mammals the main intramuscular nerve extends through the central region of the muscle,

perpendicular to the long axis of the myotube. Individual motor axons branch and terminate

forming synapses at the central end-plate band, which give the impression that the midpoints

of muscle fibers are especially susceptible to innervation. An earlier hypothesis was that

axons form synapses just at the sites of their entry into the muscle (Sanes and Lichtman

1999). Some observations of aneural AChR aggregates at the end-plate zone, which were

supported further by genetic perturbation of motor neurons in animals throw into doubt this

idea. In mice, lacking motoneurons AChR clusters (the sign of postsynaptic specialization)

appeared in the muscle central end-plate zone, which has never seen a nerve. On the other

hand, direct observation of synapse formation in nerve-muscle co-cultures has shown that

neurites do not seek spontaneously formed high-density clusters of AChRs in uninnervated

myotubes, but rather organize new clusters at initially unspecialized sites (Anderson and

Cohen 1977; Frank and Fischbach 1979). One possible explanation is that a motor neuron

randomly contacts aneurally formed AChR clusters, stabilizing them in case of matching and

dispersing them in the case of mismatch. In this case, aneural clusters can serve as a back up

system to ensure that every myotube will finally receive its synapse (Sanes and Lichtman

2001).

1.2.3. Postsynaptic differentiation

As soon as myoblasts fuse to form myotubes, they start to express AChR subunits and to

assemble them into functional pentamers (α2βγδ), which will then be inserted in the plasma

membrane. Originally, the distribution of the receptors is uniform with the density of

~1000/µm2. In the mature muscle the density runs up to >10000/µm2 at synaptic sites and

9

Introduction ___________________________________________________________________________

falls down to ~10/µm2 within a few micrometers from the synapse (Salpeter and Loring 1985;

Salpeter et al. 1988).

At least four distinct processes regulate this transition:

1. Redistribution of AChRs from the extrasynaptic to synaptic sites (Dai et al. 2000).

2. Increased stability of membranous AChRs from ~1 day (at embryonic stages) to 14 days (in

adult) (Fambrough 1979).

3. Enhanced transcription of AChR subunit genes by synaptic nuclei (Schaeffer et al. 2001).

4. Repression of the AChR subunit gene expression in the extrasynaptic nuclei by electrical

activity (Goldman et al. 1988).

1.3. Molecules and signaling cascades involved in the postsynaptic

differentiation

1.3.1. Agrin-MuSK-rapsyn signaling cascade

During development of the NMJ postsynaptic specializations are induced by agrin, a heparan

sulphate proteoglycan which is released by motoneurons.

Originally agrin was isolated by McMahan and colleagues as factor of the basal lamina,

which was sufficient to instruct the synapse to reform after denervation (Sanes et al. 1978).

Expression studies in vivo and experiments on AChR aggregation in vitro allowed McMahan

to postulate the “agrin hypothesis”, which reads that agrin is a critical nerve derived organizer

of postsynaptic differentiation (McMahan 1990). Later this hypothesis has been confirmed.

Synaptic differentiation was severely impaired in agrin knockout mice and led to premature

death due to breathing failure (Gautam et al. 1996). Conversely, ectopic injection of

expression plasmids expressing agrin into extrasynaptic region of innervated rodent muscle

caused the formation of a fully functional postsynaptic apparatus in vivo (Jones et al. 1997).

Agrin consists of more then 2000 amino acids and has a predicted molecular weight of 225

kDa. The actual mass of agrin is ~600 kDa due to the extensive N- and O- glycosylation of

the protein N-terminus. The N-terminal region contains nine cysteine rich follistatin-like

domains and laminin EGF-like region (Fig. 3). There are two serine/threonine-rich regions in

the central part. The C-terminal region is characterized by four EGF-like repeats and three

laminin G-like domains (Burden 2002).

10

Introduction ___________________________________________________________________________

There are several agrin isoforms known, which are generated by alternative RNA splicing and

have different tissue distribution and biological functions. Alternative splicing at the N-

terminus causes the generation of two agrin isoforms. The first encodes a cleavable signaling

sequence (SS) followed by the N-terminal agrin (NtA) domain responsible for laminin

binding. The second isoform contains a non-cleavable signal-anchor, which converts agrin to

a type II transmembrane protein.

Fig. 3: Schematic representation of the structure of agrin. GAG - glycosaminoglycan (from (Willmann

and Fuhrer 2002)).

Agrin RNA can be spliced in at least two other positions which are known as A/y and B/z

sites (A and B – for chicken and y and z – for mammals) and are present in the C-terminal

laminin G-like domains. Splicing at these sites gives rise to proteins that can contain 0 or 4

amino acids at the A/y site and 0, 8, 11 or, 19 (8+11) amino acids at the B/z site. The amino

acid insertion at the B/z site is crucial for the AChR clustering ability of agrin. Although agrin

is expressed not only by motoneurons, but also by the muscle and Schwann cell, its “active”

B/z+ isoform is synthesized only by neurons (Bezakova and Ruegg 2003).

After agrin is released by motoneuron it activates at the muscle cell membrane the receptor

tyrosine kinase MuSK. MuSK, which was discovered because of its abundance in the

synapse-rich Torpedo electric organ is specifically expressed by skeletal muscle (Jennings et

al. 1993) and is now considered as the most critical component of the agrin receptor complex.

The extracellular part of MuSK has four immunoglobulin (Ig)-like domains and a cystein rich

domain (named also C6-box) (Fig. 4). The first Ig-like domain is required for the activation of

11

Introduction ___________________________________________________________________________

MuSK by agrin. The fourth Ig-like domain and C6-box are important for the co-clustering

with rapsyn (Zhou et al. 1999). In avians, fish and amphibians, the extracellular region of

MuSK also contains a kringle domain of unknown function (Fu et al. 1999; Ip et al. 2000;

Jennings et al. 1993). The intracellular region of MuSK contains a ~50 amino acid

juxtamembrane domain, a kinase domain, and a short 8- aa C-terminal domain. The kinase

domain is responsible for the kinase activity of MuSK, which is “a must” for agrin-induced

AChR clustering. The kinase domain is divided into two subdomains by a region of

disordered and exposed conformation, named kinase insert (KI). Nothing is known about the

function of MuSK KI up to now except that this region contains a serine residue, which is

probably phosphorylated by some serine/threonine kinase (Till et al. 2002). The C-terminal

domain of MuSK has a sequence corresponding to the consensus PDZ domain-binding motif,

but the significance of this domain for AChR clustering has not been discovered yet (Zhou et

al. 1999).

Fig. 4: Schematic structure of MuSK. In the MuSK cytoplasmic domain, the amino acids critical for agrin-induced AChR clustering are highlighted by gray circles (from (Willmann and Fuhrer 2002)).

Several facts argue in favor of MuSK being a component of the agrin receptor complex. First,

MuSK knockout mice show at birth a similar phenotype to that of agrin null mice. Both

mutants are immobile, cannot breath and die at birth. Muscle derived proteins, including

AChRs, AChE and ErbB receptors, which are normally concentrated at the postsynapse, are

uniformly distributed in myofibers of MuSK knockouts (DeChiara et al. 1996). Second,

myotube culture derived from MuSK deficient mice fails to form AChR clusters in response

to agrin. This defect can be rescued by reintroduction of MuSK. Third, the application of

agrin to muscle cells induces a dimerization and a rapid phosphorylation of MuSK

intracellular domain (Watty et al. 2000). Forth, the expression of a dominant negative MuSK

12

Introduction ___________________________________________________________________________

mutant in C2 cells prevents the AChR clustering in response to agrin. And finally, MuSK and

agrin can be found crosslinked after the application of chemical cross-linkers to muscle cells

(Glass et al. 1996; Hopf and Hoch 1998). Though it was not possible to demonstrate direct

binding of purified agrin to MuSK, the abundance of evidence strengthen MuSK in its status

of the major component of agrin receptor complex.

Interestingly, earlier in development, the phenotype of MuSK knockout mice is different from

that of agrin deficient mice. In agrin knockout mice at E14 AChR clusters are present and

concentrated in the central region of the muscle. In contrast, the AChR clusters are absent

from MuSK ablated mice at all stages of development (Lin et al. 2001). These data indicate

that MuSK plays a central role during the first steps of postsynaptic differentiation, whereas

agrin is required during later stages for the synaptic growth and maintenance.

The next important player in the process of the AChR clustering, which acts in agrin signaling

downstream of MuSK is rapsyn (receptor-associated protein at the synapse). Rapsyn is a

peripheral membrane protein that is present at the postsynaptic membrane of the NMJ and

associates with AChRs in a 1:1 stoichiometry (LaRochelle and Froehner 1986, 1987). In

transfected non-muscle cells rapsyn is able to cluster itself and, upon co-transfection, AChRs

and some other postsynaptic components (Huh and Fuhrer 2002).

Rapsyn has an unique protein structure in which the N-terminal myristoylation sequence,

which mediates the targeting of rapsyn to the plasma membrane is followed by eight

tetratricopeptide repeats that are necessary for rapsyn self association (Fig. 5). The eighth

TPR overlaps with a coiled-coil motif that is required for the binding of rapsyn to AChRs and

their clustering. The ring zinc finger motif and a serine phosphorylation site at the C-terminus

were suggested to be necessary for linking rapsyn with postsynaptic cytoskeleton proteins and

implicated in AChR stability (Banks et al. 2003; Huh and Fuhrer 2002).

Rapsyn null mice lack aggregates of AChRs and some other postsynaptic proteins such as

dystroglycan, utrophin, syntrophin and ErbB receptors (Gautam et al. 1995). Interestingly,

MuSK is still localized at the NMJ of rapsyn knockout mice and responds to agrin by tyrosine

phosphorylation in rapsyn -/- myotubes (Apel et al. 1997). This shows that MuSK is a critical

component of the primary synaptic scaffold, whereas rapsyn clearly acts downstream of

MuSK.

13

Introduction ___________________________________________________________________________

Fig. 5: Schematic structure of rapsyn (from (Willmann and Fuhrer 2002)).

Whereas the main players of synaptic differentiation, agrin, MuSK and rapsyn are already

known, the complete picture of the signaling processes that lead to AChR clustering has still

to be puzzled out.

1. What is the ligand of MuSK?

Although agrin can activate MuSK in myotubes, it is not able to activate MuSK, which is

over-expressed in fibroblasts and even myoblasts (Glass et al. 1996). These data strongly

suggest that MuSK is complexed with another molecule that is selectively expressed in

skeletal muscle and required for agrin binding. This hypothetical muscle accessory

component (MASC) can be a second agrin-binding subunit of the heteromeric MuSK-receptor

complex (Fig. 6). Particular carbohydrates, which are present on the myotube surface, the

MuSK molecule or the amino-terminal part of agrin might also play the role of MASC

(Parkhomovskiy et al. 2000). In this case, the first Ig-like domain of the MuSK extracellular

part, which is necessary for agrin responsiveness, should serve as a binding site for MASC or

as a place for carbohydrate modification (Zhou et al. 1999).

2. How is MuSK activated?

It has been shown that in response to agrin MuSK undergoes dimerization and tyrosine

phosphorylation that occurs within minutes. Six of the nineteen intracellular MuSK tyrosine

residues become phosphorylated upon activation (Watty et al. 2000). Besides tyrosines within

the activation loop of the kinase domain, which are necessary for MuSK kinase activity, the

juxtamembrane domain tyrosine Y553 (Fig. 4) appears to be required for agrin-induced

AChR clustering (Herbst et al. 2002). Furthermore, the specificity of MuSK signaling is

determined in particular by the juxtamembrane domain, since this region of MuSK even in the

context of a different kinase (TrkA) domain sufficient to activate the signaling cascade

leading to postsynaptic differentiation in vivo (Herbst et al. 2002). The amino acid sequence

14

Introduction ___________________________________________________________________________

surrounding Y553 represents the typical NPXY motif, which can interact with a PTB domain-

containing protein, which in turn can recruit other components of downstream signaling.

3. How aggregation and stabilization of AChRs occurs?

In myotube culture agrin induces the tyrosine phosphorylation of AChR β- and δ- subunits

(Ferns et al. 1996). It is believed that tyrosine phosphorylation facilitates the interaction of

AChRs with the cytoskeleton and contributes mainly to the stability of AChR clusters, but not

to initial steps of their formation (Huh and Fuhrer 2002). The kinase, which phosphorylates

AChRs appears to be different from MuSK and is a member of the Src kinase family (Src,

Fyn, Yes). These kinases have been found in association with AChRs in myotubes and agrin

was able to cause their rapid activation and tyrosine phosphorylation, which was dependent

on rapsyn. Additionally, Src kinases have been shown to form complexes with and

phosphorylate MuSK in myotube culture (Fuhrer and Yang 1996; Mittaud et al. 2001;

Mohamed et al. 2001). Interestingly, Src kinases interact with both MuSK and AChRs to

some extent even before the addition of agrin, thus implying the existence of some

preassembled protein complexes. The available evidence suggests that a MuSK-Src kinase

complex acts as the primary synaptic scaffold and clustered at first by agrin (Fig. 6). The

AChR-Src kinase complex is recruited later due to a link between MuSK and rapsyn. The

fourth Ig-like domain together with the C6-box within the extracellular portion of MuSK is

required for the formation of the link with rapsyn, suggesting that this domain can be involved

in interaction with rapsyn through hypothetical protein RATL (rapsyn-associated

transmembrane linking molecule) (Fig. 6), which is still not found (Zhou et al. 1999).

Dystrophin/utrophin glycoprotein complex (D/UGC) is involved in the stabilization of muscle

sarcolemma by linking the cytoskeleton of the muscle fiber to the extracellular matrix. Present

at both synaptic and extrasynaptic sites, D/UGC differs in its protein composition (Huh and

Fuhrer 2002). Interactions with components of D/UGC have been shown for several proteins

of postsynaptic specialization. α-dystroglycan binds to agrin (Fig. 6) and was originally

proposed as a candidate for MASC. However, subsequent studies have shown that an agrin

fragment incapable of dystroglycan binding still activates MuSK and induces AChR

clustering (Hopf and Hoch 1996; Jacobson et al. 1998). Rapsyn interacts with utrophin

mediating link between AChRs and cytoskeleton components (Fig. 6) (Huh and Fuhrer 2002).

Studies on knockouts of components of the D/UGC have shown that this complex is largely

dispensable for the initial formation of AChR clusters, but, instead, is mainly required for

their postnatal maturation and stabilization (Deconinck et al. 1997; Grady et al. 2000).

15

Introduction ___________________________________________________________________________

4. What else regulates postsynaptic aggregations?

Agrin induced postsynaptic specializations are likely to be regulated by additional signaling

intermediates. It has been shown that calcium influxes are required for the AChR clustering

(Megeath and Fallon 1998). Moreover, activities of several intracellular enzymes in muscle,

such as Rho-family GTPases and nitric oxide synthetases (NOS), are increased in response to

agrin (Jones and Werle 2000). Rac and Cdc42 small GTPases are known to control the actin

polymerization, for example by inducing focal reorganization of actin cytoskeleton in

response to extracellular cues. In turn, it has been shown that AChR clusters are tightly

associated with several cytoskeletal proteins, including actin and agrin increases this

association. Using dominant negative forms of Rac and Cdc42 it has been proven that the

activity of the small GTPases is necessary for agrin-induced AChR clustering. P21-activated

kinase (PAK), a well-known cytoplasmic kinase involved in cytoskeleton regulation, can act

downstream of small GTPases. PAK is activated by agrin in muscle cells in a Rac and Cdc42

dependent manner and its inhibition leads to attenuation of AChR cluster formation. These

data suggest the existence of a signaling pathway involving small GTPases and PAK that

regulates the stabilization of AChR clustering by promoting their linkage with the

cytoskeleton (Luo et al. 2002; Weston et al. 2000).

16

Introduction ___________________________________________________________________________

Fig. 6: Agrin induced signaling cascades leading to assembly of the postsynaptic membrane at the NMJ. In the absence of nerve-derived agrin, at least two pre-assembled signaling complexes (AChR complex and a MuSK complex) exist in the muscle membrane. Agrin causes rapid activation of MuSK, which triggers downstream signaling cascades with the involvement of calcium, Rac, Cdc42, NO, and actin. Upon agrin stimulation Src/Fyn kinases phosphorylate MuSK and AChRs. Preassembled AChR complexes bind to the MuSK complex through rapsyn. Dystrophin/utrophin glycoprotein complex (D/UGC) is additionally recruited, stabilizing the entire postsynaptic apparatus. α -DG, α -dystroglycan; p, tyrosine phosphorylation (Modified from (Huh and Fuhrer 2002)).

1.3.2. Synapse specific transcription

The postsynaptic specialization is not only the result of clustering of synaptic proteins, but

also of selective transcription of their genes. This process is carried out by myofiber nuclei

near the synaptic site. Synapse specific transcription ensures that AChRs and other

postsynaptic components are available in the required density in the postsynaptic membrane.

Defects in synapse targeted gene expression of the AChR ε subunit gene have been shown to

be the cause of congenital myasthenia (Nichols et al. 1999). In search for nerve-derived

inducers of the synapse-specific transcription ARIA (AChR-inducing activity), an isoform of

the secreted growth factor neuregulin (NRG)-1 has been isolated (Falls et al. 1993). NRG,

like agrin, is synthesized by motoneurons and secreted into the synaptic cleft. NRG receptors

are transmembrane tyrosine kinases ErbB, which are concentrated at the postsynaptic site of

the NMJ (Rimer et al. 1998). It has been shown that in vitro NRG stimulation of ErbBs leads

17

Introduction ___________________________________________________________________________

to the activation of MAP/ERK and the Phosphatidyl-Inositol 3 (PI3)-kinase pathways (Tansey

et al. 1996). ERK in turn activates the Ets family transcription factor GABP, which binds to

regulatory element in the AChR ε and δ promoters, termed N-box, and stimulates the

transcription of respective genes (Koike et al. 1995; Schaeffer et al. 1998). For a long time it

was believed that NRG and agrin work in parallel: agrin promoting AChR clustering and

NRG – activating local transcription. Later a pile of evidence changed this belief, awarding to

agrin the main role in both processes. It has been shown that even in the absence of neuronal

NRG synapse specific transcription of AChR occurs in a normal way (Yang et al. 2001). It

raised the possibility that agrin or MuSK can cluster muscle-derived NRG and ErbBs, thus

stimulating the transcription of AChR genes in an autocrine way (Meier et al. 1998). The

group of H.R. Brenner demonstrated that agrin can induce MuSK transcription and, possibly,

the transcription of other synaptic genes not only by the autocrine NRG/ErbB pathway, but

also by a novel “shunt” pathway in which agrin-MuSK signaling stimulates the activation of

Rac and JNK independent of NRG/ErbB (Fig. 7) (Lacazette et al. 2003).

Fig. 7: Model of synaptic gene expression. Nerve-derived agrin activates preexisting MuSK to induce the expression of MuSK gene by (1) organizing an NRG/ErbB pathway, involving MuSK-induced recruitment of ErbB receptors and of muscle-derived NRG, and by (2) MuSK induced activation of JNK via Rac/Cdc42. With MuSK expression stabilized, the same pathways are used for AChR and ErbB genes expression. Expression can be strengthened by NRG-1 secreted from nerve terminal. P, tyrosine phosphorylation (from (Lacazette et al. 2003).

Recent data from the same group about conditional inactivation of ErbB2 and ErbB4

receptors in muscle demonstrated that development and maintenance of NMJ are only

marginally affected in the absence of all NRG signaling (Escher et al. 2005). These data

18

Introduction ___________________________________________________________________________

argues in favor of a new scenario, where agrin, in vivo, regulates, may be together with NRG,

synapse specific transcription and NRG signaling is redundant with that of agrin.

1.3.3. MuSK binding partners

In an attempt to find a link from agrin-activated MuSK to rapsyn that clusters AChRs, several

groups started to identify proteins that interact with different domains of MuSK.

By a proteomic approach Strochlic et al. have identified MAGI-1c as a MuSK binding

partner. MAGI-1c belongs to the MAGUK family, which includes scaffolding proteins

possessing multiple protein-protein interaction domains and is involved in cell polarity and

the organization of signal transduction within cellular junctions. Among other domains

MAGI-1c contains six PDZ domains, the fourth and fifth were shown to interact with the

consensus C-terminal PDZ binding site of MuSK (Strochlic et al. 2001; Strochlic et al.

2005a). MAGI-1c was colocalized with adult rat NMJs, but was not concentrated at agrin-

induces AChR clusters in C2 myotubes, suggesting that the protein is not involved in the

clustering mechanism (Strochlic et al. 2001). These data correlate with the fact that the PDZ

binding site of MuSK is dispensable for its clustering activity in the muscle cell culture (Zhou

et al. 1999). As the other scaffolding proteins important for the organization of central

excitatory synapses, e.g. PSD-95/SAP90, MAGI-1c might be involved in the formation of

specialized signaling proteins complexes at the NMJ (Strochlic et al. 2001).

Consistent with a number of data about the participation of actin in the process of AChR

aggregation, several MuSK binding partners involved in actin cytoskeleton reorganization

have been identified. Searching by yeast two hybrid (Y2H) technique for MuSK interacting

proteins the group of L. Mei has revealed Dishevelled (Dvl) (Luo et al. 2002). Dvl was

originally discovered in Drosophila, where it is implicated in the development of coherent

arrays of polarized cells via the Wnt signaling pathway. The authors demonstrated the co-

localization of Dvl with AChR clusters at the NMJ. The interaction of Dvl with MuSK was

mapped to both the juxtamembrane and the kinase domains of MuSK, however this

association was not facilitated by MuSK phosphorylation. The disruption of the interaction

between MuSK and Dvl or inhibition of Dvl function attenuated agrin-induced AChR

clustering in C2 cells and formation of neuromuscular synapses in culture. It has been shown

that Dvl interacts with PAK1, an effector of Rac and Cdc42 in actin reorganization. PAK1 is

activated in muscle cells upon agrin stimulation and this activation is required for AChR

clustering. Consistently, induced PAK1 activation and subsequent AChR clustering was

19

Introduction ___________________________________________________________________________

attenuated in cells expressing Dvl mutants, suggesting the importance of Dvl for this event.

Thus, the possible function of Dvl could be the recruitment of PAK to the MuSK signaling

complex for AChR clustering (Luo et al. 2002).

Another MuSK binding partner, potentially important in downstream signaling with

involvement of actin reorganizers – geranylgeranyltransferase I (GGT I) has been identified

by the same group in the Y2H screen with MuSK intracellular domain. It has been

demonstrated that the α subunit of GGT I interacts with the kinase domain of MuSK. Agrin

caused a rapid increase of GGT activity. The blockage of GGT I activity resulted in the

abolishment of Rac1, Cdc42 and PAK1 activation in response to agrin and attenuated AChR

cluster formation in muscle cells. Moreover, transgenic mice, expressing an inactive mutant

of GGT I reveal defects in NMJ formation (Luo et al. 2003a). These data strongly indicate

that the prenylation of agrin-induced signaling components and their following membrane

targeting is important for AChR clustering. However, the role of MuSK-GGT I interaction in

this model is still unclear.

The tumor suppressor and actin binding protein Adenomatous Poliposis Coli (APC) has been

shown to interact with the AChR β subunit (Wang et al. 2003). APC might help in localizing

AChR to actin in the cytoskeleton, though its importance for AChR clustering in vivo has not

been explored yet.

Abelson tyrosine kinases Abl1 and Abl2 comprise a family of nonreceptor tyrosine kinases

that regulate actin structure and presynaptic axon guidance. A.M. Pendergast and

collaborators have hypothesized and successfully proven the role of Abl kinases in

postsynaptic assembly. In the muscle Abl was localized to the postsynaptic site of the NMJ.

In C2 culture Abl activity was required for the enhancement of agrin-induced MuSK tyrosine

phosphorylation and AChR clustering. Moreover, Abl and MuSK interacted physically and

effected reciprocal tyrosine phosphorylation. These findings suggest that Abl kinases might

act by amplification of initial agrin-induced signaling through the tyrosine phosphorylation

and also participate in cluster assembly by cytoskeleton remodelling (Finn et al. 2003).

20

Introduction ___________________________________________________________________________

Fig. 8: MuSK binding partners and downstream signaling pathways. Cytoplasmic effectors of MuSK – Abl, GGT, Dvl – activate Rac/Cdc42-PAK1 leading to actin cytoskeleton reorganization and AChR aggregation, likely through APC. The scaffolding protein MAGI-1c, binding to the C-terminal consensus PDZ binding site of MuSK, potentially recruits multiple, not identified, signaling molecules. Adaptor protein 14-3-3-γ represses synaptic gene expression via inhibition MAPK-PI3K signaling pathways. MuSK - Syne-1 interaction mediates clustering of synaptic nuclei at the synaptic sites (modified from (Strochlic et al. 2005a)).

Another protein, which has been shown to interact with MuSK is Synaptic nuclear envelope-1

(Syne-1). This protein is enriched at the envelope of the synaptic nuclei (Apel et al. 2000).

Syne-1 has two calponin-homology (CH) domains in the N-terminal region that binds to actin

(Korenbaum and Rivero 2002). It is believed that Syne-1 can cluster synaptic nuclei by

tethering their envelope to the actin cytoskeleton. MuSK in this case would operate through

Syne-1 clustering myonuclei to the NMJ.

By mass spectrometry analysis of MuSK crosslinked products from the postsynaptic

membrane of Torpedo electrocytes. A.Cartaud and collaborators identified the adaptor protein

14-3-3-γ. The 14-3-3-γ was co-localized with AChRs at the NMJ and co-immunoprecipitated

with MuSK. The over-expression of 14-3-3-γ in C2 myotubes specifically repressed

transcription of several synaptic genes, pointing out the role of the protein in gene regulation.

Consistently, MuSK expression potentiated 14-3-3-γ repression of transcription (Strochlic et

al. 2004). It is suggested, that the repressive function of 14-3-3-γ targets the downstream

effectors of the NRG/ErbB pathway, namely Raf-1 (Strochlic et al. 2005b). MuSK-14-3-3-γ

21

Introduction ___________________________________________________________________________

interaction then would be important for localization of 14-3-3-γ at the synaptic site, where it

could modulate NRG/ErbB pathway. These data provide another piece of evidence, which

proves the involvement of MuSK in the regulation of synaptic gene expression at the NMJ.

22

Aim of the study ___________________________________________________________________________

2. Aim of the study

In the light of available data, MuSK plays a pleiotropic role during NMJ development. In the

last few years, a number of MuSK binding partners have been reported, shedding some light

onto the mechanism of its action. Despite of many efforts, the steps in agrin-MuSK signaling

between MuSK activation and AChR cytoskeleton anchoring and clustering via rapsyn still

are poorly characterized.

Among objectives of this study were: (1) identification of linker protein between MuSK and

rapsyn and (2) elucidation of MuSK downstream signaling events by identification of proteins

associated with MuSK intracellular domain.

The search for MuSK effectors was performed using a Y2H system that allows an in vivo

detection of protein-protein interactions. In this system cDNA encoding a protein of interest is

cloned into a bait vector, creating a fusion of a GAL4 DNA binding domain (DNA-BD) and a

protein of interest. A second cDNA encoding an interacting protein (or a library of cDNAs

encoding an entire collection of different potential interactors) is cloned into a prey vector,

creating a fusion of an activation domain (AD) of GAL4 and the interacting protein. When

bait interact with library fusion protein the DNA-BD and AD of GAL4 are brought into

proximity, reconstitute transcription factor and mediate transcription of reporter genes in yeast

cell, which results in their ability to grow on selective growth conditions.

Since extracellular Ig-like IV domain together with C6-box of MuSK have been suggested to

be involved in co-clustering of MuSK with rapsyn trough the hypothetical protein RATL

(Zhou et al. 1999), we have chosen these domains for generation of the bait vectors used in

Y2H for identification of RATL-like interactors. The bait bearing only the Ig-like IV domain

should have helped to evaluate the impact of C6-box.

For the identification of proteins involved in MuSK-downstream signaling cascade, the baits

were constructed on the basis of MuSK intracellular domains. The juxtamembrane (JM)

domain of MuSK contains a tyrosine embedded into a NPXY motif, phosphorylation of which

is believed to generate a potential docking site for downstream signaling proteins (Herbst et

al. 2002). In order to identify such proteins, a bait containing JM domain of MuSK was

generated.

In order to facilitate identification of MuSK downstream signaling components we have used

bait mimicking the dimerized and phosphorylated form of MuSK intracellular domain, which

23

Aim of the study ___________________________________________________________________________

it acquires upon agrin stimulation (named MuSK2xwt). Another kinase-defective variant of

the same bait was used to address the question about tyrosine-phosphorylation dependent

binding of interactors.

Identified by the Y2H MuSK binding partners were further characterized and their biological

role for NMJ development was assessed.

24

Material and methods ___________________________________________________________________________

3. Material and methods

3.1. Materials

3.1.1. Reagents

Basic solutions and reagents used have been purchased from Roche Molecular Biochemicals (Mannheim), Carl Roth (Karlsruhe), Promega (Mannheim) or Sigma (Deisenhofen). Specific reagents used were: Yeast Two-Hybrid: 5-bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside (X-Gal)

Sigma

β-Mercaptoethanol Sigma

3-amino-1,2,4-triazole (3-AT) Sigma DMSO Roth Minimal SD Base media Clontech Amino acids for drop out (DO) supplement Sigma Yeast cells AH109, HF7c Clontech Carrier DNA Clontech YPD Medium Clontech Agar Bacto E. coli: BL21(Rosetta) Competent cells Novagen Escherichia coli XL1-Blue Competent cells Novagen Isopropyl-beta-D-thiogalactoside (IPTG) Sigma LB Broth Sigma Molecular Biology and Biochemistry Standard Techniques:

Agarose electrophoresis grade Gibco/BRL

Ethidiumbromid Gibco/BRL

DEPC-treated water Roth Oligo-dT Invitrogen 10x M MulV Reverse Transcriptase Buffer New England Biolabs dNTPs Fermentas DNA polymerase 10xBuffer, Mg free Fermentas MgCl2 Fermentas Ampicillin Sigma Luciferin Promega TRIzol Invitrogen Rotiphorese gel 40 (40% w/v acrylamide solution with Roth

25


0.8% bisacrylamide in ratio 29:1) TEMED Roth Dithiothreitol (DTT) Roth Protease inhibitor cocktail tablets-Complete and EDTA free

Applichem

Phenylenmethylsulfonylfluorid (PMSF) Roche Lysozym Roth Coomassie Brilliant Blau Roche Protein A Sepharose CL4-B Amersham Ni-NTA agarose Qiagen Glutathione SepharoseTM 48 Amersham Ammonium Persulphate (APS) Roth Nitrocellulose membrane PROTRAN BA85 Schleicher & Schuell

Bioscience P81 phosphocellulose paper Whatman Immunocytochemistry: Sodium azide Sigma Bovine Serum Albumin (BSA) Sigma Fetal Calf Serum (FCS) Serva Mowiol Invitrogen Proteinase K Roth Radiochemicals γ-32P ATP Amersham Table 3.1. Specific reagents

3.1.2. Devices

Horizontal gel electrophoresis apparatus (33 cm x 42 cm)

Gibco/BRL

Horizontal gel electrophoresis apparatus OWI Electrophoresis Power Supply PS 304 Life Technologies Vertical mini-gel system Sigma Videodocumentation system for DNA-Gels

Biometra

Gel-Blotting apparatus Multiphor II Pharmacia Film developer X-Omat 1000 Prozessor Kodak Gel dryer SE1160 Hoefer Scientific Instruments Phosphoimager Molecular Dynamics Water Bath GFL Centrifuge 5415D Eppendorf Centrifuge 5417R Eppendorf Centrifuge 5810R Eppendorf Centrifuge RC 5B Plus Sorvall SpectroPhotometer Ultrospec 3000 Pharmacia Vortexer REAX2000 Heidolph Thermomixer compact Eppendorf Luminescence reader Lumat LB9501 Berthold

26


PCR-Thermocycler PTC-2000 Peletier Thermal Cycler

MJ Research

Lightcycler Roche Glass Teflon homogenizer Wheaton Homogenizer Kinematica AG (Dispersing and Mixing

Technology) Ultrasonic Disintegrator Sonifier Branson Confocal laser-scanning microscope (LSM 5 Pascal)

Leica

Microscope MZ75 Leica Microscope DMIL Leica Inverted microscope (DMIRB) equipped with a cooled MicroMax CCD camera

Leica/ Princeton Instruments

Cryotome CM3050S Leica Microsystems, Nussloch Liquid-Scintillation machine Wallac 1410

Pharmacia

Table 3.2. Devices

3.1.3. Oligonucleotides

Oligonucleotides were synthesized by MWG-Biotech AG or Invitrogen. Their positions on

the relative transcripts are indicated and correspond to the beginning of the coding sequence

for forward (bp-) and the end of complementary sequence for reverse (-bp) primer. In primers

used for subcloning restriction sites sequences are included.

Name of the primer

Sequence (5’-3’) Restriction digestion site

Acc.No. Position (bp)

MuSK-17 CCGGAATTCATAGCTACCAATAAGCAC

EcoRI NM_010944 847-

MuSK-18 CCGGAATTCTGCCTGGCGGTAAAGGAG

EcoRI NM_010944 1201-

MuSK-21 ACGCGTCGACTTAGGAGTACGCAGGCGAGAC

SalI NM_010944 -1624

MuSK-22 CCGGAATTCGAGTCGACCGCGGTGACC

EcoRI NM_010944 1594-

MuSK-23 CGCGGATCCTTACAGGCTGAGCAACTTAGG

BamHI NM_010944 -1711

MuSK-38 GGAATTCTATTGCTGCCGAAGGAGGAAA

EcoRI NM_010944 1552-

MuSK-61 ACGCGTCGACTTACTTGGGATTCAGAAGGA

SalI RNU34985 -1809

MuSK-62 ACGCGTCGACTTAGCGCTGCAGGATCCGGT

SalI RNU34985 -2164

MuSK-63 ACGCGTCGACTTACAGGTCACTGTGGCTGA

SalI RNU34985 -2688

MuSK-64 ACGCGTCGACTTAGACGCCTACCGTTCCCA

SalI RNU34985 -2724

Table 3.3. Oligonucleotides, which were used for the generation of MuSK bait plasmids for a yeast two hybrid (Y2H) screening and mapping experiments. Sequences of restriction digestion sites are underlined.

27


Name of the primer



CK2β-24 GGGGATCCGTATGAGCAGCTCAGAGGAG

BamHI NM_001320 147-

CK2β-25 GAAGATCTTTATCGGTAGTGAGGGACCT

BglII NM_001320 -481

CK2β-26 GAAGATCTTTAGTCCAAGATCATGTCTAG

BglII NM_001320 -505

CK2β-27 GAAGATCTTTAGTCTTCCAGTTCTTCATC

BglII NM_001320 -532

CK2β-28 GAAGATCTTTAGCACTTGGGGCAGTAGAG

BglII NM_001320 -760

Table 3.4. Oligonucleotides used for subcloning of CK2β epitopes into the Y2H prey vector. Sequences of restriction digestion sites are underlined. Name of the primer



CK2β-3 ATCAAGCTTCATGAGCAGCTCAGAGGAG

HindIII NM_001320 341-

CK2β-4 ATACTCGAGTCAGCGAATCGTCTTGAC

XhoI NM_001320 -988

CK2β-7 ATAGGTACCATGAGCAGCTCAGAGGAG

KpnI NM_001320 341-

CK2β-12 ATAAAGCTTTCAGCGAATCGTCTTGACTGG

HindIII NM_001320 -988

CK2β-29 CCGCTCGAGGATGAGTAGCTCTGAGGAG

XhoI BC003775 147-

CK2β-23 GGGGTACCTCAGCGAATAGTCTTGAC

KpnI BC003775 -794

CK2α-3 CCGCTCGAGGATGTCGGGACCCGTGCCA

XhoI BC060742 217-

CK2α-4 GGGGTACCTTACTGCTGAGCGCCAGC

KpnI BC060742 -1392

CK2α’-5 CCCAAGCTTGATGCCCGGCCCGGCCGCG

HindIII BC057862 34-

CK2α’-4 GGGGTACCTCATCGTGCTGCGGTGAGAC

KpnI BC057862 -1086

Table 3.5. Oligonucleotides used for subcloning of CMV-driven plasmids expressing full length CK2β, CK2α or CK2α’. Sequences of restriction digestion sites are underlined. Name of the primer



MuSK-39 GGAATTCGTATTGCTGCCGAAGGAGGAAA

EcoRI NM_010944 1552-

MuSK-40 CCGCTCGAGTTACTTAGGATTCAGAAGGAG

XhoI NM_010944 -1698

MuSK-41 CCGCTCGAGTTAGCGCTGCAGGATCCTGTG

XhoI NM_010944 -2580

MuSK-42 CCGCTCGAGTTACAGGTCACTGTGGCTGAG

XhoI NM_010944 -2055

MuSK-44 CCGCTCGAGTTAGACACCCACCGTTCCCTC

XhoI MMU37709 -2755

Table 3.6. Oligonucleotides used for the PCR amplification of different MuSK intracellular domains for the generation of CMV – expression plasmids.

28


Name of the primer



CK2β-8 ATAAAGCTTTTATCGGTAGTGAGGGACCGT


CK2β-9 ATAAAGCTTTTAGTCCAAGATCATGTCTAG


CK2β-10 ATAAAGCTTTTAGTCTTCCAGTTCTTCATC


CK2β-11 ATAAAGCTTTTAGCACTTGGGGCAGTAGAG


CK2β-12 ATAAAGCTTTCAGCGAATCGTCTTGACTGG


CK2β-16 CCGCTCGAGATGAGCAGCTCAGAGGAG

XhoI NM_001320 341-

CK2α-5 CCGCTCGAGATGTCAGGACCTGTGCCAAG

XhoI BC072167 172-

CK2α-6 CCCAAGCTTCTACTGAGTGGCTCCAGCTG

HindIII BC072167 -1377

MuSK-47 CCCAAGCTTACCATGTATTGCTGCCGAAGGAGGAGAGAG

HindIII RNU 34985 1443-

MuSK-48 GGCCTCGAGTTGCTCTAGCTCAAGAAATTCC

XhoI RNU 34985 -2727

Table 3.7. Oligonucleotides used for the generation of pGEXKG constructs, expressing the GST-fusions of MuSK intracellular epitope, CK2β, CK2α or CK2β epitopes. Sequences of restriction digestion sites are underlined. Name of the primer

Sequence (5’-3’) Acc.No. Position (bp)

MuSK-67 CCTGGTCCTCCACCACTGGCCTGTGCAGAACAGCTCTGCATTGCC

NM_010944 2077-

MuSK-68 GGACCAGGAGGTGGTGACCGGACACGTCTTGCTGAGACGTAACGG

NM_010944 -2112

MuSK-71 CGCACACTGTTTGCAGCCTCAGCCACGCTGACCTGTCCACGAGGGCTCGGGTG

NM_010944 2021-

MuSK-72 CACCCGAGCCCTCGTGGACAGGTCAGCGTGGCTGAGGCTGCAAACAGTGTGCG

NM_010944 -2074

MuSK-73 CGCACACTGTTTGCAGCCTCAGCCACGATGACCTGTCCACGAGGGCTCGGGTG

NM_010944 2021-

MuSK-74 CACCCGAGCCCTCGTGGACAGGTCATCGTGGCTGAGGCTGCAAACAGTGTGCG

NM_010944 -2074

MuSK-75 CGCACACTGTTTGCAGCCTCAGCCACGAGGACCTGTCCACGAGGGCTCGGGTG

NM_010944 2021-

MuSK-76 CACCCGAGCCCTCGTGGACAGGTCCTCGTGGCTGAGGCTGCAAACAGTGTGCG

NM_010944 -2074

MuSK-77 GTCTAGCCCTGGTCCTCCACCACTGGACTGTGCAGAACAGCTCTGCATTGCC

NM_010944 2077-

MuSK-78 GGCAATGCAGAGCTGTTCTGCACAGTCCAGTGGTGGAGGACCAGGGCTAGAC

NM_010944 -2129

MuSK-79 GCCCTGGTCCTCCACCACTGGAGTGTGCAGAACAGCTCTGCATTGCC

NM_010944 2077-

MuSK-80 GGCAATGCAGAGCTGTTCTGCACACTCCAGTGGTGGAGGACCAGGGC

NM_010944 -2122

Table 3.8. Oligonucleotides used for the generation of MuSK point mutants. Sites of mutation are underlined.

29


Name of the primer



Musk.KIdel3 CGAATTCATGAGAGAGCTTGTCAACATTC

EcoRI MMU37709 149-

Musk.KIdel4 CCCTAGGAACTCATTGAGGTCACCATAG

AvrII MMU37709 2142-

Musk.KIdel5 GCCTAGGGTGTGCAGAACAGCTCTGC

AvrII MMU37709 2140-

Musk.KIdel6 CTCTAGATTAGTATTGGTGAGGCCA

XbaI MMU37709 -2646

IGF1R3 CTAGCGTCTCTGAGGCCAGAAGTGGAGCAGAATAATCTAGTCCTCATTCCTCCGAGCTTC

Compatible with AvrII

NM_010513 3279-

IGF1R4 CTAGGAAGCTCGGAGGAATGAGGACTAGATTATTCTGCTCCACTTCTGGCCTCAGAGACG


NM_010513 -3336

IR3 CTAGCGTCTCTGAGGCCAGATGCTGAGAATAACCCAGGCCGCCCTCCCCCTACCTTGCAA


NM_010568 3367-

IR4 CTAGTTGCAAGGTAGGGGGAGGGCGGCCTGGGTTATTCTCAGCATCTGGCCTCAGAGACG


NM_010568 -3420

PDGFbR3 AGCTAGCGCGACACTCCAACAAGCATTG

NheI NM_008809 2240-

PDGFbR4 GGCTAGCACTGGTGAGTCGTTGATTAAG

NheI NM_008809 -2528

TrkC14.1 CTAGCGCTCTTTAATCCATCTGGAAATGAT TTTTGTATATGGTGTGAG

Fit to AvrII S62933 2250-

TrkC14.2 CTAGCTCACACCATATACAAAAATCATTTCCAGATGGATT AAA GAG CG

Fit to AvrII S62933 -2133

Table 3.9. Oligonucleotides used for subcloning of MuSK kinase insert (KI) mutant constructs. Sequences of restriction digestion sites are underlined. Name of the primer

Sequence (5’-3’) Acc.No. Position (bp)

Product size (bp)

AChRα-1 ACGCTGAGCATCTCTGTCTT NM_007389 810- AChRα-2 TTGGACTCCTGGTCTGACTT NM_007389 -1258

448

MuSK-24 GCCTTGGTTGAAGAAGTAGC NM_010944 115- MuSK-25 CTTGATCCAGGACACAGATG NM_010944 -488

353

CK2β-1 AATGAGCAGGTGCCTCACTA BC003775 291- CK2β-2 ACTCTGGATGCACCATGAAG BC003775 -667

376

CK2β-31 TCTGTGAGGTGGATGAAGAC BC003775 211- CK2β-32 TGTGGATGCACCATGAAGAG BC003775 -664

453

CK2α-1 TGAGGATAGCCAAGGTTCTG BCO60742 944- CK2α-2 TGCCATGCTAGTGGAACTCA BCO60742 -1256

293

CK2α’-2 CTGGCAGAGTTCTATCATCC BC057862 568- CK2α’-2 CACGGTGTTCTCAGCACAAG BC057862 -1056

489

mbact111 TGGAATCCTGTGGCATCCATGAAA

NM_007393 885-

mbact112 TAAAACGCAGCTCAGTAACAGTCCG

NM_007393 -1235

350

Table 3.10. Oligonucleotides pairs used for quantitative PCR reactions. Size of resulting PCR product is given in bp.

30


Name of the primer Sequence (5’-3’) CK2β-17 GAGGGCATAGTAGATATGAATCTG CK2β-18 ATTTCTGAGATCGAGGCCAGTCTG CK2β-19 ATGAGTAGCTCTGAGGAGGTG CK2β-20 GGATAGCAAACTCTCTGAG HSA-CreF GACATGTTCAGGGATCGCCAGGCG HSA-CreR GACGGAAATCCATCGCTCGACCAG Table 3.11. Oligonucleotides used for genotyping PCR

3.1.3. siRNAs

For silencing of CK2 subunits two types of siRNA were used: pSUPERneoEGFP

(Oligoengine) based and stealth siRNA. Targeting sequences were designed by Sfold program

(Ding et al. 2004). Targeting oligonucleotides and stealth siRNAs were synthesized by

Invitrogen.

Name Target Efficiency

of inhibition

Primers used for subcloning

Sequence of primers or stealth siRNA

Acc.No. Position

CK2ß-siRNA-5

GATCCCCGCTCTGGACATGATCTTAGTTCAAGAGACTAAGATCATGTCCAGAGCTTTTTGGAAA

pSuperNeo EGFP (E979)-CKIIβ-siRNA-203

CK2ß No inhibition

CK2ß-siRNA-6

AGCTTTTCCAAAAAGCTCTGGACATGATCTTAGTCTCTTGAACTAAGATCATGTCCAGAGCGGG

BC003775 203-

CK2ß-siRNA-3

GATCCCCGCTCTGGACATGATCTTAGTTCAAGAGACTAAGATCATGTCCAGAGCTTTTTGGAAA


CK2ß No inhibition

CK2ß-siRNA-4

AGCTTTTCCAAAAAGCTCTGGACATGATCTTAGTCTCTTGAA CTAAGATCATGTCCAGAGCGGG

BC003775 154-


CK2ß 51% CK2ß-siRNA-7

GATCCCCTCTTACTGGACTCAATGAGTTCAAGAGACTCATTGAGTCCAGTAAGATTTTTGG

NM_009975

437-

31


CK2ß-siRNA-8

AGCTTTTCCAAAAATCTTACTGGACTCAATGAGTCTCTTGAACTCATTGAGTCCAGTAAGAGGG

CK2ß-siRNA-9

GATCCCCTGAGCAGGTGCCTCACTATTTCAAGAGAATAGTGAGGCACCTGCTCATTTTTGGAAA


CK2ß 88%

CK2ß-siRNA-10

AGCTTTTCCAAAAA TGAGCAGGTGCCTCACTATTCTCTTGAATAGTGAGGCACCTGCTCA GGG

NM_009975

453-

CK2ß-siRNA-11

GATCCCCCCTGATGAAGAGCTGGAAGTTCAAGAGACTTCCAGCTCTTCATCAGG TTTTTGGAAA


CK2ß 51%

CK2ß-siRNA-12

AGCTTTTCCAAAAA CCTGATGAAGAGCTGGAAGTCTCTTGAACTTCCAGCTCTTCATCAGG GGG

NM_009975

505

CKIIβ siRNA -189 (stealth)

CK2ß 85% AGAAGAAUUCAUUACCACGGAGCCC

BC00375 189

CK2α-siRNA-1

GATCCCCGATGACTATCAGCTTGTTCTTCAAGAGAGAACAAGCTGATAGTCATCTTTTTGGAAA

pSuperNeo EGFP (E979)-CKIIα-siRNA-325

CK2α 63%

CK2α-siRNA-2

AGCTTTTCCAAAAAGATGACTATCAGCTTGTTCTCTCTTGAAGAACAAGCTGATAGTCATCGGG

BC060742 325

CK2α-siRNA-3

GATCCCCGTGTTTGAAGCCATCAACATTCAAGAGATGTTGATGGCTTCAAACACTTTTTGGAAA

pSuperNeo EGFP (E979)-CKIIα-siRNA-373

CK2α 88%

CK2α-siRNA-4

AGCTTTTCCAAAAAGTGTTTGAAGCCATCAACATCTCTTGAATGTTGATGGCTTCAAACACGGG

BC060742 373

CKIIα siRNA - (stealth)

CK2α No inhibition

ACAAAGUCUUACCAACGUCUGCUUU

BC060742 129

32


CK2α’-siRNA-1

ATCCCCCAATGAGAGGGTGGTTGTATTCAAGAGATACAACCACCCTCTCATTGTTTTTGGAAA

pSuperNeo EGFP (E979)-CKIIα’-siRNA-220

CK2α’ No inhibition

CK2α’-siRNA-2

AGCTTTTCCAAAAACAATGAGAGGGTGGTTGTATCTCTTGAATACAACCACCCTCTCATTG GGG

BC057862 220

CK2α’-siRNA-3

GATCCCCGATTCTGGAGAACCTTCGTTTCAAGAGAACGAAGGTTCTCCAGAATCTTTTTGGAAA



CK2α’-siRNA-4

AGCTTTTCCAAAAAGATTCTGGAGAACCTTCGTTCTCTTGAAACGAAGGTTCTCCAGAATCGGG

BC057862 286

CK2α’-siRNA-5

GATCCCCCCTTCGTGGTGGAACAAATTTCAAGAGAATTTGTTCCACCACGAAGGTTTTTGGAAA



CK2α’-siRNA-6

AGCTTTTCCAAAAACCTTCGTGGTGGAACAAATTCTCTTGAAATTTGTTCCACCACGAAGGGGG

BC057862 298

CK2α’-siRNA-7

GATCCCCCTTGGTCGGGGCAAGTATATTCAAGAGATATACTTGCCCCGACCAAGTTTTTGGAAA



CK2α’-siRNA-8

AGCTTTTCCAAAAACTTGGTCGGGGCAAGTATATCTCTTGAATATACTTGCCCCGACCAAG GGG

BC057862 173

CK2α’-siRNA-9

GATCCCCAGGACCCTGTGTCAAAGACTTCAAGAGAGTCTTTGACACAGGGTCCTTTTTTGGAAA



CK2α’-siRNA-10

AGCTTTTCCAAAAAAGGACCCTGTGTCAAAGACTCTTGAAGTCTTTGACACAGGGTCCTGGG

BC057862 342

33


CK2α’-siRNA-11

GATCCCCAGAGGTTAAGATTCTGGTTCAAGAGACCAGAATCTTAACCTCTCGTTTTTGGAAA



CK2α’-siRNA-12

AGCTTTTCCAAAAACGAGAGGTTAAGATTCTGGTCTCTTGAACCAGAATCTTAACCTCTCG GGG

BC057862 275

CKIIα’ siRNA -690 (stealth)

CK2α’ 72% (inhibits CK2α by 65%)

UAUCAUGCUCGCUAACAUGCAGCCC

BC057862 690



UGAGCAGGAUGAUAGAACUCUGCCA

BC057862 569


CK2α’ 44% UCCUGCUCAGGAGUACAAUGUUCGA

BC057862 585


CK2α’ 73% (inhibits CK2α by 27%)

AUUCGAACAAGCUGGUCAUAGUUGU

BC057862 746

Table 3.12. siRNAs.

3.1.4. Enzymes

Restriction enzymes New England BioLabs, Gibco/BRL,

Roche, Fermentas RNase A Roth M MulV Reverse Transcriptase New England Biolabs APex TM Heat-Labile alkaline phosphatase

Epicenter

Taq DNA polymerase Fermentas T4 DNA ligase Roche Table 3.13. Enzymes used

3.1.5. Kits and Columns

Plasmid DNA Purification Kit (Nucleobond AX)

Macherey-Nagel

DNA Purification Kit (Nucleospin Extract)

Macherey-Nagel

High Pure Plasmid Isolation Kit Roche Quikchange XL Site-directed Mutagenesis Kit

Stratagene

Lightcycler–FastStart DNA Master Roche

34


SYBR Green Kit Centricon Plus-20 Centrifugal Filter Device

Amicon bioseparations

Table 3.14. Kits and Columns used

3.1.6. Antibodies

A. Primary antibodies

Antigen (species) Use and Dilution Company/Suppliers

T7 (mouse monoclonal)

WB 1:10000 IP 1:1000

Novagen

myc (mouse monoclonal)

WB 1:10000 IP 1:1000

Cell Signaling

α−ΗΑ (mouse monoclonal)

WB 1:10000 IP 1:1000

Cell Signaling

α-CK2β S.269 (rabbit polyclonal)

IHC 1:500 Dr. Mathias Montenarh

α-CK2β (rabbit polyclonal)

IHC 1:200 Dr. Claude Cochet

α-CK2β 123-GLSDI-127 (mouse monoclonal)

WB 1:250 Drs. Olaf-Georg Issinger and Brigitte Boldyreff

α-CK2β (mouse monoclonal)

WB 1:250 BD (Transduction Laboratories)

α-CK2β (mouse monoclonal)

WB 1: 10000 Calbiochem

α-CK2α (rabbit polyclonal)

WB 1:1000 IHC 1:100

Upstate

α-MuSK Rb194T (rabbit polyclonal)

WB 1:1000 IHC 1:1000 IP 1:10

Dr. Markus Ruegg

α-MuSK PA1-1740 (rabbit polyclonal)

WB 1:100 IHC 1:30

ABR

α-MuSK ab5618 (rabbit polyclonal)

WB 1:100 IHC 1:30

Abcam

α-MuSK 20kD (rabbit polyclonal)

WB 1:3000 Amir Khan

α−Synaptophysin (rabbit polyclonal)

IHC 1:200 DAKO

α−NF 200 (rabbit polyclonal)

IHC 1:5000 Chemicon

α−NF 165 (mouse monoclonal)

IHC 1:1000 Developmental Studies Hybridoma Bank, Iowa

Table 3.15. Primary antibodies used in WB, IHC and IP

B. Secondary antibodies

Antigen (species) Use and Dilution Company/ Suppliers

Goat anti-mouse IgG HRP- WB 1:3000 Amersham Pharmacia Biotech

35


conjugated Protein A HRP-conjugated WB 1:3000 Amersham Pharmacia Biotech Cy2-cojugated goat anti-mouse IgG

IHC 1:100 Dianova

Cy2-cojugated goat anti-rabbit IgG

IHC 1:100 Dianova

Cy3-cojugated goat anti-mouse IgG

IHC 1:200 Dianova

Cy2-cojugated goat anti-mouse IgG

IHC 1:200 Dianova

Alexa 488 (green fluorescence) conjugated goat anti-rabbit IgG

IHC 1:500 Molecular Probes

Table 3.16. Secondary antibodies used in WB, IHC and IP

3.1.7. Frequently used solutions

Solution name Composition 10xDNA loading buffer 50% Glycerin, 0.1% Xylene cyanol FF,

0.1% Bromophenol blue 1xTBE buffer 88 mM Tris, 88 mM Boracid, 2 mM

EDTA pH 8.3 3x Lammli buffer 187 mM Tris, 6% SDS, 30% Glycerin,

0.02% Bromophenol blue, 15% β-Mercaptoethanol

1xPBS 140 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4 x 2 H2O, 1.5 mM KH2PO4

PBST PBS, 0.1% Tween-20 Mowiol 6 ml water was added to 6.0 g Glycerol

and 2.4 g Mowiol and left for 2 h at RT. Afterwards, 12 ml 0.2 M Tris pH 8.5 was added and the solution was rotated for 24 h at 53˚C, followed by centrifugation at 3220 rcf and aliquoting. Mowiol solution was stored at -20˚C for up to 12 months.

4% PFA 20 g Paraformaldehyde (PFA) was dissolved in 300 ml water (65ºC). After pH was adjusted to 7.4 water was added up to 500 ml, and the solution was sterile filtered, aliquoted and stored at -20ºC.

Tail lysis buffer 50 mM Tris-HCl pH 8.0, 100 mM EDTA, 0.1 M NaCl, 1% SDS

Table 3.17. Frequently used solutions

36


3.1.8. Cell culture

Human embryonic kidney 293 cells (HEK293)

American Type Culture Collection

Cos7 American Type Culture Collection C2C12 Gift from Prof. Hans-Rudolf Brenner MuSK-deficient myoblasts (MuSK-/-) C3.16

Gift from Drs. Ruth Herbst and Steven Burden

HEK293 cells expressing continuously secretable active (4.8.) or inactive (0.0) agrin

Gift from Dr. Stefan Kröger

Dulbecco’s MEM (DMEM) with GlutamaxTM-1 with Sodium Pyruvate and 4500 mg/L Glucose

Gibco/BRL

Fetal Calf Serum (FCS) Invitrogen Heat-inactivated Horse Serum (HS) Invitrogen Chick Embryo Extract (CEE) SLI Mouse recombinant interferon-γ Sigma Matrigel Becton Dickinson Apigenin Sigma, HCLP grade 2-Dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole (DMAT)

Gift from Drs. Flavio Meggio and Lorenzo A. Pinna

Rhodamine-α-bungarotoxin (Rh-α-BTX) or Alexa-α-bungarotoxin (Alexa-α-BTX)

Molecular Probes, Eugene

SuperFect Qiagen LipofectamineTM 2000 Invitrogen DEAE-Dextran Pharmacia, Sigma Chloroquin Sigma Table 3.18. Cell culture materials.

3.1.9. Animals.

Wild type C57/BL6 mice were purchased from Charles River Laboratories. CK2βloxP/loxP

conditional knockout mice were generated by Thierry Buchou, University of Southern

Denmark (Buchou et al. 2003). HSA-Cre transgenic mice were a kind gift from Prof. Hans-

Rudolf Brenner.

37


3.2. Methods

Standard methods were performed according to the following book:

Sambrook, J., Russell D.W.

Molecular Cloning: A Laboratory Manual, 3rd edition (Volume 1-2-3)

Cold Spring Harbor Laboratory Press, 2001

3.2.1. Molecular Biology Methods

3.2.1.1. Isolation of plasmid DNA

Up to 10 µg of plasmid were isolated using the following protocol. Bacterial cells were

pelleted by centrifugation. Cell pellet was resuspended in 100 µl of buffer S1. Then 200 µl of

S2 buffer was added and mixed gently by inverting to avoid shearing of the genomic DNA.

After 5 min of incubation 150 µl of S3 buffer was added and mixed gently. The mixture was

centrifuged at 4°C (20000 rcf for 10min). To precipitate the plasmid DNA 1 ml of absolute

Ethanol was added to the supernatant, mixed and centrifuged at 4°C (20000 rcf for 10 min).

The pellet was centrifuged once more with 300µl of 70% Ethanol at 4ºC (14000 rpm for 5

min), air dried, and resuspended in 50 µl water.

S1 Buffer 50 mM Tris, 10 mM EDTA, 100 µg/ml RNase A pH 8.0

S2 Buffer 200 mM NaOH, 1% SDS

S3 Buffer 2.8 M KAc pH 5.1 Table 3.19. Solutions for isolation of plasmid DNA Larger amounts of plasmid (20-2500 µg) were prepared with the use of Macherey-Nagel

Plasmid DNA Purification Kit (Nucleobond AX) according the manufactures protocol, which

is based on a modified alkaline lysis procedure followed by binding of plasmid DNA to an

anion-exchange resin under appropriate low-salt and pH conditions. RNA, proteins and low-

molecular-weight impurities are removed by a medium-salt wash; DNA is eluted in a high-

salt buffer and then concentrated and desalted by isopropanol precipitation.

3.2.1.2. Determination of DNA/RNA concentration

38


The concentration of DNA/RNA in solution was determined in a spectrophotometer,

measuring the absorption of the solution at 260 nm and using the following formulas:

1A260 =50 µg double stranded DNA

1A260 =33 µg single stranded DNA

1A260 =40 µg RNA

3.2.1.3. Electrophoretic separation of DNA fragments in agarose gel

DNA was loaded on 0.7-2 % agarose gels prepared in 1xTBE buffer with 0.5 µg/ml ethidium

bromide. The electrophoresis was performed for ~1 h at 120 V (Horizontal gel electrophoresis

apparatus – Gibco/BRL). The DNA fragments were visualized under UV light.

3.2.1.4. PCR amplification of DNA

The Polymerase-Chain-Reaction (PCR) was performed according to the method of Saiki

(Saiki et al., 1986). A standard PCR reaction to amplify DNA from plasmid template

contained about 50 ng plasmid DNA, forward and reverse primers (10 pmol each), 200 µM

dNTPs, 1xTaq-polymerase buffer + (NH4)2SO4, 2 mM MgCl2 and 1U Taq DNA polymerase

(Fermentas), in a total volume of 50 µl.

The amplification was carried out in a PCR-Thermocycler PTC-2000 Peletier Thermal Cycler

(MJ Research). The amplification conditions were as follows:

(1) Initial denaturation for 2 min at 94°C;

(2) 25-30 cycles of 10-30 sec at 94°C, 10-30 sec at the annealing temperature of the primer

pair and extension of 1 min/kbp at 72°C;

(3) Incubation for 10 min at the extension temperature to allow for the complete amplification

of all products.

The annealing temperature, the time of denaturation, annealing and the extension were

optimized for each experiment. The PCR products were then analyzed in an agarose gel by

separation according to their size (see 3.2.1.3.).

3.2.1.5. Cloning techniques

The DNA fragment to be subcloned was amplified by PCR (see 3.2.1.4.) using specific

primers containing unique restriction sites, analyzed on an agarose gel (see 3.2.1.3.) and

purified either by using DNA Purification Kit - Nucleospin Extract (Macherey Machinery) or

by the Tombstone procedure. For that the gel area directly above (towards the cathode) and

under (towards to anode) the band of the PCR product was cut and pieces of DE81 cellulose

39


paper were inserted into the nicks. During further migration of the DNA the desired PCR

product was transferred and bound to the lower DE81 paper, while the upper DE81 paper

prevented contamination of the PCR product with other DNA fragments. The DE81 paper

with the PCR product was removed from the gel and placed into a 0.5 ml PCR tube with a

hole in the bottom and inserted into the 1.5 ml Eppendorf tube. Residual TBE buffer was

removed from the DE81 paper by centrifugation (16000 rcf for 30 sec.). DNA of the PCR

fragment was eluted three times from the DE81 paper with high salt Tombstone buffer (1 M

LiCl, 20% Ethanol, 10 mM Tris pH 7.5, 1 mM EDTA) and precipitated with three volumes of

absolute Ethanol, washed with 80% Ethanol, air dried and dissolved in 20 µl of water.

The purified PCR product and the subcloning vector were digested in a total volume of 20 µl

comprising of about 1 U of restriction enzyme per 1 µg of DNA, 2 µl of 10x corresponding

restriction buffer and sterile water. When the vector ends were blunt or compatible with each

other, the vector was dephosphorylated prior to ligation to prevent self-ligation. To remove 5’

phosphates from the vector, 1 U of APex TM Heat-Labile alkaline phosphatase (Epicenter) was

added directly to the digestion reaction. The reaction was incubated for 20 min at 37°C.

Phosphatase was heat inactivated at 70°C for 5 min. After enzymatic digestion or

dephosphorylation the vector or PCR product were purified by agarose gel electrophoresis.

Before ligation the concentrations of PCR-fragment and vector were roughly estimated on an

agarose gel. A typical ligation reaction contained vector and insert at a molar ratio of about

1:2 (600 ng total DNA), 1x ligase buffer (New England BioLabs), and 1 U of T4 DNA Ligase

(New England BioLabs) in a volume of 10 µl. The incubation was carried out at RT for 5 h or

at 16°C for 12-16 h. After that, 1 µl of the ligation reaction was transformed in Escherichia

coli competent cells.

3.2.1.6. Plasmid constructs

Plasmid constructs generated according to the basic cloning techniques (see 3.2.1.5.) are listed

in the Table 3.12. For primers sequences and Acc.No. position see 3.1.3.

Plasmid name Primers used for

subcloning Restriction digestion sites used for subcloning

Template used for PCR

pCMX.PL1-T7-CK2β CK2β-3+CK2β-4 HindIII/XhoI

pCMV5-myc-CK2β CK2β-7+CK2β-12 KpnI/HindIII

pGADGH-CK2β-full length (fished by Y2H)

pCMX.PL1-T7-CK2β−m CK2β-29+CK2β-23 XhoI/KpnI

pCMX.PL1-T7-CK2α−m

CK2α−3+CK2α-4 XhoI/KpnI

1st cDNA of C2C12

40


pCMX.PL1-T7-CK2α’−m

CK2α’−5+CK2α’-4 HindIII/KpnI

pGEXKG-CK2β-47 CK2β-16+CK2β-8 XhoI/HindIII




pGEXKG-CK2β-full length

CK2β-16+CK2β-12 XhoI/HindIII

pGADGH-CK2β-full length (fished by Y2H)

pGEXKG-CK2α-full length

CK2α−5+CK2α-6 XhoI/HindIII pTX-HX-CK2α

pCMX.PL1-T7-MuSK-563

MuSK-39+MuSK-40 EcoRI/XhoI







pMT-MuSK-full-length

pET28b-MuSK-868 MuSK-47+MuSK-48 HindIII/XhoI pCDNA3-MuSK2xwt

pET28b-MuSK-868-A-683/699

MuSK-47+MuSK-44 HindIII/XhoI pMT-MuSK-A-683/699

Table 3.20. Plasmid constructs.

pcDNA-MuSK2xwt-myc and pcDNA-MuSK2xkd-myc constructs have been generated and

kindly provided by the group of Prof. Hans-Rudolf Brenner. For their generation two

intracellular domains of MuSK or its kinase defective mutant (aa 467-868; Acc.No. U34985)

were linked together by five E/G (E-Glutamic Acid, G-Glycin) modules. The first

intracellular MuSK domain was subcloned into HindIII/NheI of myc-tagged pcDNA3

(Invitrogen). The second intracellular MuSK domain was joint by ligation into the NheI and

EcoRI sites of the plasmid.

For the generation of pSUPERneoGFP based siRNAs (see 3.1.3.) used for silencing of mouse

CK2β/CK2α/CK2α’ a pair of oligonucleotides according to the following design was

synthesized:

compatible with BglII

5’ – GATCCCCC ( sense ) TTCAAGAGA (anti sense) TTTTTGGAAA – 3’ 3’ – GGG (anti sense) AAGTTCTCT ( sense ) AAAAACCTTTTCGA – 5’ hairpin loop compatible with HindIII

Sense and anti sense specific sequences targeting the mRNA of corresponding genes were

designed with the software Sfold (Ding et al. 2004). The oligos were hybridized and

subcloned into restriction digestion sites HindIII/BglII of pSUPERneoEGFP(E979)

(Oligoengine) destroying at the same time the BglII site.

41


CMV expression plasmids pCMX.PL1, carrying the luciferase gene and CK2β/CK2α/ CK2α’

cDNA as bicistronic message were constructed as follows. Luciferase gene was amplified by

PCR from the plasmid pGL2-basic (using primers Luc-1: 5’-

CGGGATCCATGGAAGACGCCAAAAAC-3’ and Luc-2: 5'-

CGGGATCCTTACAATTTGGACTTTCC-3' and subcloned into BamHI site of pCMX.PL1

(then named pCMX.PL1-Luc). cDNAs of CK2β/CK2α/CK2α’ were cut out from

pCMX.PL1-T7-CK2β−m/CK2α−m/CK2α’-m respectively and ligated into the XhoI/KpnI

(for CK2β and CK2α) or HindIII/KpnI (CK2α’) of pCMX.PL1-Luc.

For generation of pcDNA3-MuSK∆KI, lacking kinase insert (KI) domain (aa 667-697), the 3’

portion of mouse MuSK cDNA downstream of the KI was amplified by PCR using primers

Musk.KIdel5 (containing AvrII site) and Musk.KIdel6 (containing XbaI site) and subcloned

into pCR2.1 vector (Invitrogen). The 5’ portion of MuSK upstream of the KI was amplified

using primers Musk.KIdel3 (containing EcoRI) and Musk.KIdel4 (containing AvrII) and

ligated into pCR2.1-MuSK-3’, opened by EcoRI/AvrII digestion. MuSK chimeras,

containing KIs of other receptor tyrosine kinases were generated on the basis of pCR2.1-

MuSK∆KI construct. KIs of Insulin-Like Growth Factor Receptor 1 (ILGFR-1), Insulin

Receptor (IR) and TrkC were generated by hybridization of the following primers, containing

overhangs compatible with AvrII site: IGF1R3 with IGF1R4, IR3 with IR4 and TrkC14.1

with TrkC14.2 respectively. Platelet-Derived Growth Factor-β Receptor (PDGFβR) ΚΙ was

amplified by PCR from mouse muscle 1st strand cDNA, using primers PDGFbR3 and

PDGFbR4, containing NheI site compatible with AvrII. All kinase inserts were ligated into

pCR2.1-MuSK∆KI vector, opened with AvrII digestion. The MuSK KI chimera cassettes

were excised from pCR2.1 by EcoRI/XbaI digestion and transferred into pcDNA3. For the

construction of pcDNA3-MuSK-full-length vector full length cDNA of mouse MuSK

(Acc.No. MMU37709) was cut out from pMT-MuSK-full-length (gift from Dr. Christian

Fuhrer) and ligated into EcoRI/XbaI sites of pcDNA3.

The generation of pCEFL-HA-CK2α is described elsewhere (Korn et al. 2001).

3.2.1.7. Transformation of E. coli competent cells.

While XL1-blue cells were used for subcloning of plasmid vectors, BL21 cells were used for

protein expression.

1-10 ng of plasmid DNA or an aliquot from a ligation reaction (1 µl) were added to 50 µl of

E. coli XL1-Blue or BL21 (Rosetta) electrocompetent cells (Novagen). The cell-DNA

42


mixture was transferred into a prechilled electroporation cuvette (EquiBio). DNA was

transformed into the bacteria cells by means of an electric impulse (1800 V, 7.5 ms). After

electroporation the bacteria were shaken for 30 min at 37°C in 200 µl of LB medium, then

plated on LB plates containing antibiotic (100 µg/ml ampicillin or kanamicin) and incubated

at 37°C for about 16 h, until colonies appeared.

3.2.1.8. Site directed mutagenesis.

Substitutions of S (Serine) residues within the KI of MuSK by A (Alanine), E (Aspartic Acid)

or D (Glutamic Acid) were introduced into the plasmid pMT-MuSK-full-length, using the

Quikchange XL Site-directed Mutagenesis Kit (Stratagene). Primers for the site directed

mutagenesis should fulfill the following criteria: have a length 25-50 b, Tm>78°C and carry a

mutation of nucleotide(s), which would lead to the exchange of the desired amino acid

without a shift in the open reading frame of the targeted gene. A plasmid carrying the target

gene serves as a template for the mutagenesis PCR. Usage of PfuTurbo DNA-Polymerase

ensures high fidelity of the PCR reaction. Following DpnI digestion results in the elimination

of the methylated form of the template plasmid. Remaining unmethylated plasmid produced

by PCR and carrying the mutated gene is subsequently transformed into E. coli competent

cells.

A 20 µl PCR reaction contains: 2 µl of 10x reaction buffer, 1.2 µl Quick solution, 0.4 µl

dNTP Mix, 125 ng of two primers and 10 ng of template plasmid. Combinations of the

primers and templates used al well as the resulting mutations are indicated in the Table 3.21.

Primer combination Template Mutation Resulted plasmid MuSK-71+MuSK-72 pMT-MuSK- full-length S-683 -> A pMT-MuSK-A-683

MuSK-67+MuSK-68 pMT-MuSK- full-length S-699 -> A pMT-MuSK-A-699 MuSK-67+MuSK-68 pMT-MuSK-A-699 S-683 -> A pMT-MuSK-A-683/699 MuSK-73+MuSK-74 pMT-MuSK- full-length S-683 -> D pMT-MuSK-D-683 MuSK-77+MuSK-78 pMT-MuSK- full-length S-699 -> D pMT-MuSK-D-699 MuSK-73+MuSK-74 pMT-MuSK-D-699 S-683 -> D pMT-MuSK-D-683/699 MuSK-75+MuSK-76 pMT-MuSK-D-683 D-683->E pMT-MuSK-E-683 MuSK-79+MuSK-80 pMT-MuSK-D-699 D-699->E pMT-MuSK-E-699 MuSK-79+MuSK-80 pMT-MuSK-D-683 D-699->E pMT-MuSK-E-683/699 Table 3.21. Combination of primers (see Table 3.8.) and templates used for site directed mutagenesis of MuSK.

Mutagenesis PCR was carried out according to the program indicated in the Table 3.22.

43


Step Number of cycles Temperature Time

Denaturation 1 95°C 1 min

95°C 50 sec

60°C 50 sec

Amplification

18

68°C 7 min

Elongation 1 68°C 7 min

Table 3.22. The program of the site directed mutagenesis PCR.

The PCR product was digested with DpnI at 37°C for 1 h. XL1-Blue electrocompetent

bacteria were transformed with 1 µl of digested PCR product. Plasmid DNA was isolated

from bacteria clones and verified by sequencing.

3.2.1.9. Lightcycler PCR

Lightcycler PCR allows to quantitatively estimate the amounts of gene transcripts and to

compare them for different tissues, cells or developmental stages. The Lightcycler–FastStart

DNA Master SYBR Green Kit allows to quantify the amount of PCR products by means of

incorporated SYBR Green fluorescence, which is proportional to the amount of double

stranded DNA.

Total RNA was extracted from cells (C2C12 myoblasts, C2C12 myotubes treated with the

inactive 0.0. or active 4.8. isoform of agrin) or tissues (muscle, brain, synaptic and

extrasynaptic regions of diaphragm) and then transcribed into complementary DNA (cDNA).

cDNA was used as a template for Lightcycler PCR reaction. A 10 µl reaction contained 1 µl

of cDNA (in dilution 1:10), 1.2 µl MgCl2 (25 mM), 1 µl of two primers (10 pmol each) and 1

µl MasterSG mix (Taq DNA–Polymerase, SYBR Green, dNTPs and 10 mM MgCl2).

Lightcycler PCR was performed, using the Lightcycler Thermal Cycle System (Roche). The

PCR program is given in the Table 3.23.

44


Table 3.23. The program of the Lightcycler PCR.

Step Number of cycles Temperature Time

Denaturation 1 95°C 8 min

95°C 0 sec

62°C 7 sec

Amplification

35

72°C 1 min

1 95°C 30 sec

1 67°C 30 sec Elongation

1 95°C 0 sec

The amount of gene transcripts was defined for MuSK, AChR α subunit, CK2β, CK2α and

CK2α’ and normalized to the amount of transcripts of a housekeeping gene (β-actin).

Respective primers used for PCR reactions and sizes of resulting PCR products are listed in

the Table 3.10. (see 3.1.3.).

3.2.1.10. Total RNA isolation

Total RNA was extracted from mouse brain, leg muscle, extrasynaptic and synaptic regions of

diaphragm, C2C12 myoblasts, C2C12 myotubes treated with inactive 0.0. or active 4.8.

isoforms of agrin using the TRIzol Reagent (Invitrogen). 1 ml of TRIzol reagent was used per

50-100 mg of tissue or per 10 cm cell plate area. Tissues were homogenized using an

automatic homogenizer (Kinematica), insoluble material was removed by centrifugation

(12000 g for 10 min at 2-8°C). After 5 min at RT 0.2 ml chloroform was added per 1 ml

TRIzol Reagent, vortexed for 15 sec, incubated additional 3 min at RT and centrifuged

(12000 g for 15 min at 2-8°C). The aqueous phase was transferred to a fresh tube and RNA

was precipitated with 0.5 ml isopropanol per 1 ml TRIzol Reagent for 10 min at RT. After

centrifugation (12000 g for 15 min at 2-8°C) the RNA pellet was washed with 75% Ethanol,

briefly dried and dissolved in RNAse free water. RNA was aliquoted and stored at -80°C.

3.2.1.11. Complementary DNA-synthesis (Reverse Transcription)

The reverse transcription (RT) allows the transcription of RNA in complementary DNA

(cDNA) that can be subsequently used as template for PCR. For cDNA-synthesis, 2 µg of

total RNA were incubated in a total volume of 15.5 µl, including 1 µl of oligo-dT (0.5 µg/µl)

(Invitrogen) and DEPC water at 70°C for 10 min and then quickly chilled on ice to open

secondary structures. The following mix was then added to each tube: 2.5 µl of 10x First-

45


Strand Buffer (New England BioLabs), 4 µl dNTP mix (10 mM) and 2 µl of DEPC water and

incubated 1 min at 37°C. After that 200 U of M MulV Reverse Transcriptase (New England

BioLabs) were added and the reaction was incubated for 50 min at 37°C. Finally the enzyme

was inactivated at 70°C for 15 min and the cDNA was aliquoted and stored at –80°C.

3.2.1.12. Yeast two hybrid (Y2H) techniques

The MATCHMAKER Two-Hybrid System 3 (Clontech), was used to identify protein-protein

interactions in yeast cells. It comprises a bait sequence expressed as a fusion to the GAL4

DNA-binding domain (DNA-BD) from the pGBKT7 plasmid (Table 3.24.), while prey

sequences are expressed as a fusion to the GAL4-activation domain (AD) from pGADT7 or

from pGAD424 (Table 3.24.). When bait and prey fusion proteins interact, the DNA-BD and

AD of GAL4 are brought into proximity, thus activating transcription of reporter genes. Yeast

strains HF7c and AH109 have been used for the Y2H screens. The elimination of false

positives have been performed by using the reporter genes - HIS3, lacZ (for HF7c) and

ADE2, HIS3, lacZ (for AH109), which are under the control of distinct GAL4 upstream

activating sequences (UASs) and TATA boxes.

For generation of bait constructs for the Y2H screens, different domains of muscle receptor

tyrosine kinase (MuSK) were amplified by PCR using pMT-MuSK-full-length as a template

and subcloned in frame into the EcoRI/SalI restriction sites of pGBKT7 (Table 3.25.).

MuSK2xwt and MuSK2xkd baits were generated and kindly provided by the group of Prof.

Hans-Rudolf Brenner. In brief, two intracellular domains of rat MuSK or its kinase defective

mutant (Acc.No. U34985) were linked together by five E/G modules. As restriction sites for

the first intracellular MuSK domain NcoI and EcoRI and for the second intracellular MuSK

domain EcoRI and SalI of pGBKT7 were used.

Cloning vectors Epitope Yeast selection Bacterial selection

pGBKT7 (bait) myc TRP1 kanamicin

pGADT7 (prey) LEU2 ampicillin

pGAD424 (prey) LEU2 ampicillin

Control vectors Epitope Yeast selection Bacterial selection

pGADT7-T HA LEU ampicillin

pGBKT7-53 myc TRP1 kanamicin

Table 3.24. Yeast vectors used.

46


Bait MuSK domains Aa

position

Primers used for subcloning (see Table

3.3.)

pGBKT7-K3 C6 box + Ig-like IV 232-491 MuSK-17 + MuSK-21

pGBKT7-K4 Ig-like IV 350-491 MuSK-18 + MuSK-21

pGBKT7-JM Juxtamembrane (JM) 481-520 MuSK-22 + MuSK-23

pGBKT7-

MuSK2xwt

Two times whole

intracellular domain

2x (467-

868)

Gift from Prof. Hans-Rudolf Brenner

Table 3.25. Bait plasmids generated for Y2H screens.

Each cloned bait was first sequenced and then tested for transactivation of the yeast reporter

genes by transforming HF7c and AH109 yeast cells with the bait plasmid together with empty

prey plasmid pGADGH. The transformed cells were plated on yeast selection media with

different concentration of 3-amino-1,2,4-triazole (3-AT, Sigma; 0/5/10 mM), a competitive

inhibitor of the yeast HIS3 protein (His3p), used to suppress background growth of yeast

cells. To screen for MuSK interacting proteins, yeast HF7c and AH109 cells were

sequentially transformed with each bait vector and 1 µg of a human HeLa cDNA

MATCHMAKER library (Clontech), using the lithium acetate method (Schiestl and Gietz

1989) (see Table 3.26.).

1x Tris EDTA (TE) pH 7.5 From 10x TE: 100 mM Tris-Cl, 10 mM EDTA 1x TE/LiAc pH 7.5 From: 10x TE, 10x LiAc

PEG/LiAc/TE pH 7.5 40% PEG 3350 1x TE buffer 1x LiAc

DNA carrier Yeastmaker carrier DNA DMSO 10% final concentration Table 3.26. Solutions for yeast transformation.

The yeasts were plated on media selecting transformants (SD -Leu, -Trp) to estimate the

efficiency of transformation and on the media selective for the reporter gene activations (SD -

Leu, -Trp, -His or SD -Leu, -Trp, -His, -Ade) containing 5 or 10mM 3-AT. Yeast colonies

growth was evaluated after 5 days of incubation at 30°C. Selected positive clones were further

confirmed by colony-lift filter assays for β-galactosidase activity according to the Clontech

Manual. Transformation efficiency was calculated for every screen counting colonies (c.f.u. -

colony forming unit) growing on SD -Leu, -Trp dilution plates (1:10; 1:102; 1:10

3; 1:10

4)

according to the formula:

47


(counted c.f.u.) x total suspension volume (µl) = total c.f.u.

dilution factor

Prey plasmids were isolated from about 700 positive yeast colonies for all screens together,

according to the Clontech Manual protocol for preparation of plasmids from yeasts and then

shuttled into E. coli XL1-Blue electrocompetent cells. Prey plasmids were re-transformed

back into yeast cells together with respective baits or empty pGBKT7 vector to ensure that

positive clones do interact with the bait but not with the GAL4-DNA-BD. Library inserts of

positive, re-tested interactors were sequenced and analyzed with protein and nucleotide

databases of the National Center for Biotechnology Information (NCBI, Bethesda, MD) using

the Basic Local Alignment Search Tool (BLAST).

For binary epitope-mapping Y2H studies PCR-amplified intracellular epitopes of mouse

MuSK (Acc.No. MMU37709) were subcloned into pGBKT7 using restriction digestion sites

EcoRI and SalI (see Table 3.27.).

Bait MuSK epitope aa position Primers used for

subcloning (see Table 3.3.) pGBKT7-MuSK-563 JM 467-563 MuSK-38 + MuSK-61 pGBKT7-MuSK-682 JM + half of kinase domain 467-682 MuSK-38 + MuSK-62 pGBKT7-MuSK-857 JM + kinase domain 467-857 MuSK-38 + MuSK-63

pGBKT7-MuSK-868 Whole intracellular domain 467-868 MuSK-38 + MuSK-64

Table 3.27. MuSK bait constructs used in epitope-mapping experiments.

Different epitopes of human CK2β (Acc.No. NM_001320) were PCR amplified and

subcloned into the restriction sites BamHI and BglII of the prey vector pGAD424 as GAL4

AD fusions (see Table 3.28.).

Bait Aa position Primers used for subcloning (see Table 3.4.) pGAD424-CK2β-47 1-47 CK2β24 + CK2β-25 pGAD424-CK2β-55 1-55 CK2β24 + CK2β-26 pGAD424-CK2β-64 1-64 CK2β24 + CK2β-27

pGAD424-CK2β-140 1-140 CK2β24 + CK2β-28

Table 3.28. CK2β prey constructs used in epitope-mapping experiments

For binary Y2H interaction assays transactivation of reporter genes was analyzed in the HF7c

yeast strain on selective plates SD –Leu, -Trp, -His + 10 mM 3-AT. Functionality of Y2H

assays was always tested using the positive control plasmids pGBKT7-53 or pGADT7-T of

48


the MATCHMAKER GAL4 Two-Hybrid System 3 (Clontech), encoding for the murine

tumor suppressor protein p53 and the SV40 large T-antigen, respectively (Table 3.24.).

3.2.2. Protein Biochemistry Methods

3.2.2.1. Preparation of protein extract from cells and tissues.

For preparation of protein extract HEK293 cells were transfected with SuperFect (Qiagen) in

10 cm plates, Cos7 cells were transfected in 10 cm plates using DEAE-dextran technique

followed by chloroquin treatment (see 3.2.3.2.). Whole cell protein extracts were prepared

from transfected HEK293 or Cos7 cells or nontransfected C2C12 cells. For that, cells were

lysed in the presence of 2 µg/µl leupeptin and aprotinin in ice-cold buffer containing 10 mM

Hepes pH 7.9, 0.2 mM EDTA, 2 mM DTT, and 1% Nonidet P-40. Immediately after the lysis,

NaCl was added to a final concentration of 400 mM. After incubation for 15 min (for

HEK293 cells) or 30 min (for C2C12 cells) under constant rotation, cell debris was removed

from the extract by centrifugation.

For preparation of muscle tissue extract, mouse hind limb muscles were frozen in liquid

nitrogen, mashed and further homogenized in ice cold lysis buffer, containing 10 mM Hepes

pH 7.9, 0.2 mM EDTA, 2 mM DTT, and 1% Nonidet P-40, 2 µg/µl leupeptin and aprotinin

for 10 min. Cell debris was removed from the extract by centrifugation (14000 rpm for 10

min).

3.2.2.2. Immunoprecipitation

For immunoprecipitation experiments HEK293 or Cos7 cells were transiently transfected with

one of the following CMV-expression plasmids encoding for: T7- or myc-tagged MuSK2xwt

and MuSK2xkd constructs; HA-tagged full length CK2α; T7- or myc-tagged full length

CK2β; T7-tagged MuSK C-terminal truncations (see 3.2.1.6.). Protein extract was prepared as

described above (see 3.2.2.1.). For each extract the protein concentration was determined (see

3.2.2.5.) or expression level of proteins was analyzed by Western blot (see 3.2.2.8.) and

adjusted. Lysates containing expressed proteins were mixed and the final volume set to 500 µl

with the buffer containing 10 mM Hepes pH 7.9, 0.2 mM EDTA, 10 mM PMSF, 1 mM

leupeptin and aprotinin. 1 µl of a monoclonal antibody against the T7- (Novagen), myc- or

HA- (Cell Signaling) was added and the reaction was incubated under constant rotation at 4°C

49


for 30 min. Next, 20 µl of in PBS equilibrated Protein A Sepharose CL-4B beads (Amersham)

were added and incubation continued overnight. After washing the beads three times with

buffer containing 50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.1%

Triton X-100, 10 mM PMSF, 1 mM leupeptin and aprotinin the precipitated proteins were

analyzed by SDS-PAGE and Western blot. For immunoprecipitation of endogenous CK2β

and MuSK proteins from C2C12 cells or muscle tissue, a polyclonal rabbit serum against

MuSK (Abcam) was pre-conjugated with Protein A Sepharose. 20 µl of antibody was

incubated with 40 µl of Protein A Sepharose in 1 ml of PBS overnight at 4°C under constant

rotation. Then Sepharose beads containing MuSK antibody on their surface were washed two

times with 500 µl of PBS and equilibrated with PBS in a 1:1 ratio. A 10 µl aliquot of MuSK-

antibody-Sepharose conjugate was added to the extracts. Samples were incubated under the

constant rotation overnight. After washing three times with a buffer containing 50 mM Hepes

pH 7.5, 50 mM NaCl, 1 mM EDTA, 10% glycerol, 10 mM PMSF, 1 mM leupeptin and

aprotinin proteins bound to the Sepharose beads were resolved by SDS gel and analyzed by

Western blot.

3.2.2.3. Protein expression and extraction from bacteria

Full length or 3’-terminal truncations of CK2β cDNA were ligated in-frame to the coding

sequence of glutathione-S-transferase (GST) in pGEXKG (see 3.2.1.6.). cDNA encoding for

the intracellular domain of rat MuSK or its alanine mutant (S683/699A) were fused in frame

to the His-tag of pET28b (see 3.2.1.6.). Plasmids were transformed in E. coli BL21 (Rosetta).

Bacteria expressing GST-fusions of CK2β were grown in 50 ml cultures until OD600 0.4 and

protein expression was induced by 1 mM isopropyl-beta-D-thiogalactoside (IPTG; Sigma) for

4 h. Afterwards bacteria were collected by centrifugation, incubated in sonification buffer (50

mM NaH2PO4, 300 mM NaCl, 25 U/ml Benzonase, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 1

µl/ml Triton X-100, 10 µg/ml DNAseI, 15 U/µl Lysozym) at 4°C for 30 min, lysed by

sonification and centrifuged (14000 rpm for 10 min). The supernatants containing the GST-

fusion proteins were collected and used freshly for the further GST-pulldown experiments

(see 3.2.2.4.).

Bacteria expressing His-tag fusions of MuSK intracellular domain or its mutant were grown

in 4 l culture until OD600 1.0 and protein expression was induced by 1 mM IPTG for 4 h.

Bacteria were pelleted by centrifugation. The pellet was dissolved in 270 ml buffer A, pH 8.0

(6 M guanidine hydrochloride, 0.1 M NaH2PO4, 0.01 M Tris pH 8.5) and shook overnight at

250 rpm. The lysate was centrifuged to remove cell debris, the supernatant was collected and

50


incubated with 6 ml Ni-NTA agarose (Qiagen) under constant rotation during 3 h at RT. Ni-

NTA beads were washed five times in buffer B pH 8.0 (8 M Urea, 0.1 M NaH2PO4, 0.01 M

Tris), three times with buffer B pH 6.6 and the protein was eluted by washing the beads five

times with 7.5 ml buffer B pH 4.5. The eluted protein was concentrated to a volume of 2.5 ml

using Centricon Plus-20 column (Amicon Bioseparations). The protein was additionally

purified by SDS gel electrophoresis. The band of the expected size was identified by

Coomassie staining (see 3.2.2.7.) and isolated. The gel piece was placed into a dialysis tube

and the protein was eluted from the gel and purified from SDS by horizontal electrophoresis

(50 mA for 5 h in SDS-running buffer (see 3.2.2.6.) and then 50 mA for 2 h in running buffer

without SDS). Resulting protein was concentrated by Centricon Plus-20 column to a final

concentration of 200-500 ng/µl.

3.2.2.4. GST-pulldown

The supernatants containing the GST-fusion proteins were supplemented by 30 µl

equilibrated Glutathione-Sepharose beads and incubated under constant rotation at 4°C for 2

h. After washing three times with washing buffer containing 4.3 mM Na2HPO4, 1.47 mM

KH2PO4, 1.37 mM NaCl, 2.7 mM KCl an aliquot of the beads was loaded on a SDS gel for

estimation of the concentration by a Coomassie Brilliant Blue (Roche) staining. Then the

beads carrying the GST-fusion protein were incubated together with 25 µl of extract from

Cos7 cells expressing the desired protein after transient transfection. After washing three

times with the washing buffer, proteins bound to the beads were analyzed by SDS-PAGE and

Western blot.

3.2.2.5. Determination of protein concentration

Protein concentration was estimated according to the slightly modified method of Bradford

(Bradford 1976). A calibration curve from the concentration measurement of BSA samples (1

mg/ml; A280 = 0.66) in different dilutions was used as a standard for the protein sample

measurements. 0.5, 1, 5 and 10 µl of protein extract dissolved in 800 µl of PBS were mixed

with 200 µl of Bradford reagent (BIO-RAD). The absorbance of the samples at 595 nm was

then measured. All samples were prepared and analyzed in duplicate. Protein concentration

was calculated per 1 µl of protein extract.

3.2.2.6. Electrophoresis of proteins

51


Proteins were resolved on denaturing SDS polyacrylamide gels, using the Vertical Mini-gel

system (Sigma). The separating gel contained 8, 10 or 12.5% polyacrylamide depending on

the molecular weight of the protein and the stacking gel was 5% (see Table 3.29, 3.30.). The

proteins were mixed with sample loading Lammli buffer, denatured at 100°C for 5 min and

loaded on the gel. Electrophoresis was started at 100 V until the probes entered the separating

gel and was then carried out constantly at 120 V for 1-2 h in SDS gel running buffer

depending on the protein dimensions.

Separating gel buffer 1.5 M Tris-Base pH 8.8, 0.4% (w/v) SDS

Stacking gel buffer 500 mM Tris-HCl pH 6.8, 0.4% (w/v) SDS

10 x Running buffer 250 mM Tris-Base pH 8.3, 1.92 M Glycin 1% (w/v) SDS

Table 3.29.: Solutions for SDS-PAGE.

Separating gel 8% 10% 12.5% Stacking gel 5%

H2O 2.9 ml 2.5 ml 2 ml H2O 1.5 ml Separating gel buffer 1.5 ml 1.5 ml 1.5 ml Stacking gel buffer 625 µl

Acrylamide/Bisacrylamide (30%) 1.625 ml 2 ml 2.5 ml Acrylamide/Bisacryl

amide (30%) 425 µl

APS (20% w/v) 22.5 µl 22.5 µl 22.5 µl APS (20% w/v) 5 µl

TEMED 5 µl 5 µl 5 µl TEMED 2 µl Table 3.30. Separating gels and stacking gel for SDS-PAGE (calculated for one gel of 11 cm x 8 cm x 0.7 mm size).

3.2.2.7. Staining of protein gels

Coomassie staining was used to detect proteins in SDS polyacrylamide gels. After

electrophoresis, the gel was placed in the staining solution (30% Methanol, 10% acetic acid,

0.05% Coomassie Brilliant Blue) for 15 min at RT and then destained overnight in a solution

containing 25% Methanol and 15% acetic acid. The gel was dried on Whatman paper covered

with a cellophane sheet on a Gel dryer SE1160 (Hoefer Scientific Instruments).

52


3.2.2.8. Western blot

Proteins resolved on SDS polyacrylamide gels were transferred to nitrocellulose membrane in

blotting buffer (see Table 3.29.) for ~1.5 h at 150 mA. The membrane was then blocked in

blocking buffer (see Table 3.31.) for 1 h at RT and further incubated for a minimum of 1 h up

to overnight with the first antibody diluted in washing buffer (see Table 3.31.). A monoclonal

antibody directed against the T7-tag (Novagen), myc-tag, HA-tag (Cell Signaling) and against

CK2β (gift from Drs. Olaf-Georg Issinger and Brigitte Boldyreff) or polyclonal sera against

either CK2α (Upstate) or MuSK (ABR, Abcam, 194T or 20kD) served as primary antibodies.

1:10000 dilution was used for anti-T7- and anti-myc-tag antibodies; 1:250 dilution - for

monoclonal anti-CK2β antibody and 1:100 for all polyclonal antibodies (except 1:3000 for α-

MuSK 20kD). The membrane was washed three times for 5 min with the washing buffer,

incubated for 1 h with secondary antibody (Horseradish-peroxidase-coupled-Protein A or

anti-mouse-Ig-coupled-horseradish-peroxidase in 1:3000 dilution), and subsequently washed

three times for 5 min with the washing buffer. The bound antibodies were detected by the

ECL system (Amersham) according to the manufacturer’s protocol, and the membrane was

exposed to X-ray film super RX (FUJI Medical) that was developed in a film developer X-

Omat 1000 Prozessor (Kodak).

Blotting buffer 480 mM Tris, 380 mM Glycin, 0.1% SDS, 20% Methanol

Blocking buffer PBS, 0.1% Tween-20, 5% dry milk powder

Washing buffer PBS, 0.1% Tween-20

Table 3.31. Western blot buffers

3.2.2.9. In vitro kinase assay

Kinase activity of protein kinases (MuSK and CK2) was determined as amount of radioactive

phosphate incorporation into their substrates.

A known substrate of MuSK is enolase (Feder and Bishop 1990; Mohamed et al. 2001).

MuSK protein was isolated by immunoprecipitation from protein extracts of C2C12

myotubes, which were treated for 16 h with agrin 0.0. or agrin 4.8. and in the presence or

absence of 40 µM 2-Dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole (DMAT; gift from

Drs Flavio Meggio and Lorenzo A. Pinna). 1/3 of the extract from one 10 cm plate (200 µl)

was incubated overnight with 15 µl of MuSK-antibody-protein A Sepharose conjugate (see

53


3.2.2.2.) in a total volume of 1 ml adjusted by PBS. Immunoprecipitates were washed three

times in buffer containing 50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol,

0.1% Triton X-100, 10 mM PMSF, 1 mM leupeptin and aprotinin and then two times in

kinase buffer (10 mM MnCl2, 50 mM Tris, pH 7.4). Beads with precipitated MuSK were

resuspended in 40 µl of the kinase buffer and 1µg of acid denatured enolase was added. The

reaction was started by the addition of 0.8 µl γ-32P ATP (specific activity 60000 cpm/pmol) at

RT and stopped by addition of 20 µl 3x Lammli after 10 min. After boiling for 5 min, the

samples were resolved by 10% SDS-gel for radiography. For acid denaturation of enolase 1

vol of enolase (1.5 mg/ml, Sigma) was mixed with 1 vol of 50 mM acetic acid and incubated

for 5 min at 30°C. Denaturation was stopped by the addition of 1 vol of 1 M Hepes pH 7.4.

Recombinant intracellular domain of MuSK from rat or its alanine mutant were expressed and

purified from bacteria (see 3.2.2.3.). 2.5 µg of the recombinant proteins were phosphorylated

in vitro by 150 ng of CK2α (Biaffin) alone or together with 20 pmol CK2β (gift from Dr.

Olaf-Georg Issinger) in a 20 µl volume containing 50 mM Tris-HCl, pH 8.0, 10 mM MgCl2, 1

mM DTT and 100 µM γ-32P ATP with specific activity 3.0 Ci/mmol. After 30 min of

incubation at 30°C the reaction was stopped by the addition of 10 µl of 3xLammli and the

samples were resolved by 10% SDS-gel for radiography.

CK2 activity was measured in 10µg mouse muscle lysates as described above using 10 µM of

800 µM synthetic peptide substrate RRRDDDSDDD.

3.2.3. Cell culture methods

3.2.3.1. Cultivation of HEK293, Cos7, C2C12, MuSK-deficient myoblasts.

HEK293 or Cos7 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM;

Gibco/BRL) containing 10% (v/v) fetal calf serum (FCS; Invitrogen) at 37°C and 5% CO2.

C2C12 cells were maintained for proliferation in DMEM containing 20% (v/v) FCS, for

differentiation the medium was replaced by DMEM with 5% (v/v) heat-inactivated horse

serum (HS, Invitrogen) at the same growth conditions. Myotubes were formed after 4-6 days.

MuSK-deficient myoblasts (gift from Drs. Ruth Herbst and Steve Burden) were proliferated

in DMEM containing 10% (v/v) FCS, 10% (v/v) HS, 0.5% chick embryo extract (CEE; SLI),

mouse recombinant interferon-γ (Sigma) at 330C, 10% CO2. For differentiation, MuSK-

deficient myoblasts were transferred to the proliferation medium lacking CEE and interferon-

54


γ at 39°C, 10% CO2. For MuSK-deficient cells dishes were coated with Matrigel (Becton

Dickinson). Myotubes were usually observed after 2-3 days.

3.2.3.2. Transient transfection of cells

24 h before transfection exponentially growing cells were replated in growth medium and

transfected at 50-60% (HEK293, Cos7) or 80-90% (C2C12, MuSK-deficient myoblasts)

confluence.

A. SuperFect transfection

For preparation of protein extracts HEK293 cells were transiently transfected with CMV

expression plasmids (see 3.2.2.2.) in 10 cm dishes with in total 10 µg of expression vectors

using SuperFect (Qiagen). In order to test the efficiency of siRNAs against different CK2

subunits HEK293 cells were transfected in 6 cm plates with 1 µg of CMV-expression vectors

encoding for full length CK2 subunits together with 3 µg of the respective

pSUPERneoEGFP(E797)-siRNA constructs or with 100 pmol of stealth siRNAs. For 10 cm

plate transfection DNA was dissolved in 300 µl of DMEM medium lacking FCS. Then 30 µl

of SuperFect reagent was added to the DNA solution and mixed by vortexing for 10 sec. The

samples were incubated for 5-10 min at RT to allow transfection complex formation. In the

meantime the growth medium was aspirated from the dishes and the cells were washed once

with 4 ml of PBS. Then 3 ml of cell growth medium (containing FCS) were added to the

reaction tube containing the transfection complex, mixed by pipetting and immediately

transferred to the cells. Cells were incubated with the transfection complexes for 3-12 h under

their normal growth conditions. After that the medium containing the remaining complexes

was removed from the cells, cells were washed once with 4 ml of PBS and fresh growth

medium was added. Transfection efficiency was controlled by transfection of one cell plate

with the plasmid expressing Green Fluorescence Protein (GFP) with nuclear localization

signal – pnlsGFP (Hashemolhosseini et al. 2000). At 48 h post-transfection, cells were

harvested for extract preparation as described (see 3.2.2.1.).

B. DEAE-Dextran transfection

In some cases Cos7 cells were transfected using the DEAE-Dextran technique. The

transfection reaction for 10 cm dish was made as follows: 10 µg of expression plasmid DNA

were mixed with 187.5 µl of PBS and 375 µl of DEAE-Dextran. The mix was added to the

growth medium of the cells. After incubation for 30 min under standard growth conditions,

55


the medium was replaced by 8 ml of fresh medium and 80 µl of Chloroquin was added. Cells

were incubated for 3 h, then the growth medium was changed once again. At 48 h post-

transfection, cells were harvested for extract preparation as described (see 3.2.2.1.).

C. LipofectamineTM 2000 transfection

For immunocytochemistry C2C12 and MuSK-deficient cells were transiently transfected in

3.5 cm plates with 1 µg of plasmid expressing nuclear localized GFP – pnlsGFP together with

either 3 µg pSUPERneoEGFP(E797)-siRNA constructs or 3 µg expression plasmid

containing one of the MuSK serine or KI mutants. 24 h before transfection cells were replated

in growth medium without antibiotic. 4 µg of DNA were dissolved in 250 µl of DMEM

medium lacking FCS. 10 µl of Lipofectamine were diluted separately in 250 µl DMEM

medium lacking FCS. After incubation for 5 min at RT the mixtures were combined and

incubated for 20 min at RT. Then 500 µl of DNA-Lipofectamine complex was added to each

plate. The medium was replaced by differentiation medium after one day. In order to check

silencing of CK2α, CK2α’ and CK2β by luciferase activity tests HEK293 cells were

transfected in 24 well dishes with 0.125 µg of luciferase- CK2α/CK2α’/CK2β cDNA fusion

constructs (see 3.2.1.6.) and 0.375 µg of pSUPERneoGFP(E797)-siRNA constructs or 20

pmol of stealth siRNA. In this case 1µl of Lipofectamine was used.

3.2.3.3. Luciferase reporter test.

The ATP dependent oxidation of luciferin by luciferase is accompanied by the light emission,

which can be measured. The luciferase activity test was performed to check the ability of

different siRNAs to knockdown the mRNAs of CK2 subunits (α, α’, β). The cDNAs of the

respective genes were subcloned together with the luciferase gene to be transcribed as a

bicistronic message (see 3.3.1.6.). An effective siRNA would target the chimeric luciferase-

CK2subunit mRNA which would result in its degradation and lead to a decrease of luciferase

activity. HEK293 cells transfected with the constructs described above were lysed 48 h

posttransfection. The lysis of the cells was performed in 300 µl per well of Luciferase

Harvest/Assay Buffer, which contained 88 mM Tris/MES pH 7.8, 12.5 mM MgAc, 2.5 mM

ATP, 1 mM DTT and 0.1% Triton X-100. Measuring of the chemiluminescence reaction was

performed for 200 µl of the cell lysate in a luminometer (Berthold–Lumat LB9501), after

injection of 100 µl of 0.5 mM luciferin dissolved in 5 mM KHPO4. The luciferase activity

was calculated in Relative Light Units (RLU).

56


3.2.3.4. Agrin treatment

The production of agrin-conditioned media was performed as described before (Kröger 1997).

In brief, stably transfected HEK293 cells (gift from Dr. Stephan Kröger) expressing

continuously secreted active agrin 4.8. or inactive agrin 0.0. were grown in DMEM

containing 10% FCS until 80-90% confluence. The terms inactive and active reflect agrin

originating either from isoform agrinA0B0 or agrinA4B8 respectively (Gesemann et al. 1995).

After another 4 days of proliferation in serum-free DMEM, agrin-conditioned medium was

collected, aliquoted and frozen. Agrin-conditioned medium was added at 1:8 dilution (125 µl

per 3.5 cm dish) to C2C12 myotubes. AChR aggregates were detected or quantified 16 h later

as described below (see 3.2.3.8.).

3.2.3.5. Application of CK2 inhibitors

Inhibition of endogenous CK2 activity was performed using either apigenin (Sigma, HCLP

grade) or 2-Dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole (DMAT; gift from Drs

Flavio Meggio and Lorenzo A. Pinna) (Pagano et al. 2004). Stock solutions for both inhibitors

were generated by dissolving them in DMSO at 100 mM or 10 mM, respectively. 4 h before

adding agrin-conditioned media to C2C12 or MuSK-deficient cells apigenin was added to the

cell cultivation medium at different concentrations: 0/10/20/40/60/80µM. 12 h later another

25% of apigenin was added to compensate for the degradational loss of inhibitor activity.

DMAT was added to the cell cultivation medium at the same time as agrin-conditioned

medium at indicated concentrations: 0/10/20/40/60/80µM. In both cases cells were incubated

in total 16 h with agrin-conditioned medium. The same amounts of DMSO added to C2C12 or

MuSK-deficient cells served as controls.

3.2.3.6. Immunocytochemistry

AChR clusters on the surface of C2C12 or MuSK-deficient cells were visualized by α-

Bungarotoxin staining. Cultivation medium was aspirated from the dishes and cells were

washed three times with PBS. Then cells were fixed with 2% PFA solution in PBS for 20 min

at RT. After washing three times with PBS cells were stained for 1 h with Rhodamine-

conjugated-α-Bungarotoxin (Rh-α-BTX), which was applied in 1:2500 dilution in PBS. After

washing three times with PBS the bottoms of the dishes with cells on their surface were cut

out and mounted on cover slides with Mowiol. Slides were analyzed and documented using

57


the Cy3 filter of a Leica inverted microscope (DMIRB) equipped with a cooled MicroMax

CCD camera (Princeton Instruments, Stanford, CA).

3.2.3.7. AChR cluster stability assay

For assessing AChR cluster stability C2C12 cells were treated for 16 h with agrin 4.8. alone

or together with 60 µM apigenin, washed and then maintained in fresh cultivation medium

with or without apigenin at the same concentration. Cells were fixed with 2% PFA at 0/4/ 8h

and stained with Rh-α-BTX (see 3.2.3.6.).

3.2.3.8.Quantification analysis of AChR clusters

The numbers of AChR aggregates were quantified as follows: using the Cy3 filter pictures

were taken from 8 areas exhibiting similar myotube density by phase contrast microscopy at

100x magnification. AChR clusters were counted for each area, normalized to mock treatment

set to 100%, and the standard deviation was calculated for the 8 areas. Quantification analysis

of AChR clusters was performed for three independent experiments.

Quantification of the AChR cluster density and length was done using Scion Image program

as describe before (Jacobson et al. 2001). In brief, pictures of MuSK-deficient myotubes or

C2C12 cells expressing clusters on their surface were taken by fluorescence microscopy at

400x and 200x magnification respectively. Images were imported into the Scion Image

program in grey scale mode. Size scale calibration was set to 0.58 pixel/µm or to 1.16

pixel/µm respectively. The total cluster area was determined by circumscribing clusters using

free hand tool and then Measure command. The clusters were highlighted then using Density

slice tool and the area occupied by clusters was measured using Analyze particle command.

The resulting values were summed to give the particle area. The AChR density, given as a

percentage, was calculated as particle area divided by total area of the cluster. The length of

AChR clusters was arbitrary assigned as number of pixels. Statistical analysis was performed

using unpaired two-tailed t-test.

3.2.4.Animal care and immunohistochemistry methods

3.2.4.1. Generation of muscle specific CK2β knockout animals

For the generation of muscle specific CK2β knockout, mice of the CK2βloxP/loxP genotype

were crossed with HSA-Cre transgenic mice to get CK2βloxP/+, HSA-Cre offspring. Then

58


CK2βloxP/+, HSA-Cre mice were crossed with CK2βloxP/loxP mice to get animals with

CK2βloxP/loxP, HSA-Cre genotype.

3.2.4.2. Genotyping

DNA for genotyping was obtained from tail tips. The samples were lysed in 185 µl of Tail

lysis buffer with 15 µl proteinase K (20 µg/µl; Roth) for 1-2 h at 55˚C. The DNA was

precipitated with 150 µl of isopropanol. After centrifugation for 20 min at 16000 rcf the DNA

was washed with 1 ml of 70% ethanol, dried and dissolved in 500 µl of water. Genotyping

PCRs for identification of homozygous CK2βloxP/loxP and HSA-CRE animals were performed

according to the schemes given in the Table 3.32 and 3.33 respectively.

Table 3.32. Scheme for CK2βloxP/loxP genotyping. For the sequences of the primers see 3.1.3.

PCR mix Step

Number of

cycles Temperature Time

H20 6.1 µl Denaturation 1 94°C 4 min

10xTaq-polymerase

buffer+(NH4)2SO4

1.2 µl 94°C 30 sec

MgCl2 (25 mM) 1 µl 55°C 30 sec

dNTP (10 mM) 1.2 µl

Amplification

35

72°C 30 sec

CK2β-17/19 0.125 µl Elongation 1 72°C 8 min

CK2β-18/20 0.125 µl

Taq DNA polymerase 0.25 µl

Genomic DNA 2 µl

1 10°C 10 min

PCR mix Step

Number of

cycles Temperature Time

H20 11.2 µl Denaturation 1 94°C 3 min

10xTaq-polymerase

buffer+(NH4)2SO4

2 µl 94°C 30 sec

MgCl2 (25 mM) 2.4 µl 60°C 30 sec

dNTP (10 mM) 2 µl

Amplification

35

72°C 1 min

HSA-Cre-F 0.125 µl Elongation 1 72°C 2 min

HSA-Cre-R 0.5 µl

Taq DNA polymerase 0.5 µl

Genomic DNA 1 µl

1 10°C 10 min

59


Table 3.34. Scheme for HSA-Cre genotyping. For the sequences of the primers see 3.1.3.

3.2.4.3. Surgical Procedures

Adult C57/BL6 wild type mice were anesthetized by intraperitoneal administration of a

Ketamine–Rompune mixture (100 mg/per kg body weight Ketanest (Pfizer); 5 mg/per kg

body weight Xylacin (Bayer)) for surgery using standard aseptic technique. A skin incision

was made on the lateral thigh to expose the left biceps femoris muscle, and a longitudinal

incision was made to expose and transect the sciatic nerve at the level of its trifurcation. After

sciatic nerve transaction the mice were stitched. 5 days postoperatively mice were sacrificed

and soleus and gastrocnemius muscles were dissected.

Frozen sections of rat soleus muscle, which was ectopically injected with plasmid encoding

for agrin 4.8. (Hashemolhosseini et al. 2000) were kindly provided by Prof. Hans-Rudolf

Brenner.

3.2.4.4. Immunohistochemistry

For the preparation of frozen sections for immunohistochemical analysis, all muscles were

quick-frozen in prechilled isopentane and embedded in Tissue-Tec (Leica Instruments). 12

µm slices were prepared using a cryotome (Leica Microsystems, Nussloch) and placed on

glass slides (HistoBond, Adhesion Micro Slides, Jung HistoService). The sections were air-

dried for 1 h at RT and stored at -80˚C or directly subjected to the immunohistochemical

stainings.

Unfixed sections were rinsed with PBS and permeabilized for 5-10 min in PBS supplemented

with 0.1% Triton-X100. Further, sections were blocked in blocking solution (10% FCS and

1% BSA) for 1-2 h and stained for AChR with Rh-α-BTX (1:2500 dilution) or incubated with

rabbit anti-CK2β (at 1:500 or 1:200 dilution; gift from Drs. Mathias Montenarh or Claude

Cochet respectively) or anti-CK2α antibody (at 1:1000 dilution; Upstate Biotechnology)

dissolved in the blocking solution at 4˚C in a humid environment overnight. After washing

the sections six times for 5 min in PBS, secondary antibodies conjugated to Cy2, Cy3 or

Alexa 488 immunofluorescent dyes (Dianova, Molecular probes) were applied in 1:100,

1:200 or 1:500 dilutions respectively for 1 h at RT. Subsequently, sections were washed six

times for 5 min in PBS and covered with Mowiol.

For whole mount preparations the hind limb muscles were isolated from the adult

CK2βloxP/loxP, HSA-Cre mice and their wild type littermates. The hind limb muscles (soleus,

60


gastrocnemius and extensor digitorum longus (EDL)) were quickly fixed in 4% PFA for 10

min and then teased in thin bundles of 5-10 myotubes. The tissue was blocked in 100 mM

glycin in PBS for 15 min, permeabilized in 0.5% Triton X-100, 5% BSA, 1%FCS for 1 h and

incubated with rabbit anti-Neurofilament antibody (at 1:5000 dilution; Chemicon) overnight.

Then the tissues were washed six times for 10 min in PBS and incubated for 1-2 h with

secondary antibodies conjugated to Alexa 488 (at 1:500 dilution; Molecular Probes)

together with Rh-α-BTX. After washing six times for 10 min in PBS the tissues were covered

with Mowiol.

3.2.4.5. Microscopy, imaging and quantification of endplates.

Sections were analyzed and documented using a Leica inverted microscope (DMIRB)

equipped with a cooled MicroMax CCD camera (Princeton Instruments, Stanford, CA) or a

Leica confocal microscope TCS SL equipped with Leica confocal software TCS SL version

2.5.1347a. The confocal stacks were shown as average projections comprising several stacks

taken with an interval of about 0.5 µm. For quantification of AChR cluster disassembly,

endplates were divided according to their morphology in four categories: A-intact; B-slightly

impaired (with several brakes); C-fragmented; D-disassembled in micro aggregates of

AChRs. Statistics were performed by averaging three sets of independent quantifications of

minimum 50 endplates for each muscle.

61

Results ___________________________________________________________________________

4. Results

4.1. Searching for MuSK binding proteins

4.1.1. Generation and characterization of MuSK baits for yeast two hybrid

screens

cDNA representing extracellular (Ig-like IV and C6-box: aa 232-491; or IgIV-like alone: aa

350-491) or intracellular (JM: aa 481-520) domains of MuSK have been subcloned in frame

with GAL4-DNA-BD in pGBKT7 and named K3, K4 and JM bait respectively (Fig. 9).

Fig. 9: Different MuSK domains were used as baits for yeast two hybrid (Y2H) screens. K3 bait composed of Ig-like IV and C6-box and K4 bait comprising Ig-like IV domain only were used in order to identify RATL. Intracellular baits: JM representing juxtamembrane domain and MuSK2xwt mimicking active MuSK intracellular domain conformation were used for identification of MuSK downstream effectors. Candidates from Y2H screen with MuSK2xwt were checked for interaction with kinase defective MuSK2xkd bait.

All expression cassettes were verified by sequencing. The expression of the K3, K4 and JM

baits was verified using Western blot of protein extracts prepared from transformed yeast

cells (Fig. 10).

62

Results ___________________________________________________________________________

Fig. 10: Expression of the Y2H baits K3, K4 and JM in yeast. Expression of myc-tagged K3, K4 (A) and JM (B) Y2H baits was verified in two different yeast strains HF7c and AH109 by Western blot with α-myc antibody. JM bait expression was under detection limit in HF7c strain. Position of SeeBlue protein ladder (Invitrogen) is indicated on the left side of each blot. A bait comprising two complete intracellular domains of MuSK fused by a flexible G/E linker

(named MuSK2xwt) and its kinase defective mutant bearing substitution of lysine in the ATP-

binding site (Zhou et al. 1999) of the kinase domain (named MuSK2xkd) (Fig. 9) have been

generated and tested regarding expression and auto-tyrosine phosphorylation in the group of

Prof. Hans-Rudolf Brenner (Biocenter, Basel, Switzerland). Autophosphorylation has been

observed in yeast and mammalian cells for MuSK2xwt protein but not for MuSK2xkd mutant.

4.1.2. Outcome of the yeast two hybrid screens with MuSK baits

Bait constructs were tested for autonomous trans-activation of yeast reporter genes. With

some of the baits 3-AT was used to avoid trans-activation. For the screen, a commercial HeLa

cDNA library (Clontech) was used. In all screens, the number of examined colonies was

higher than the number of independent clones of the library to ensure that statistically every

clone of the library was tested at least one time (1x106; Table 4.1.). The isolated yeast clones

after screening by selective growth conditions on auxotrophic markers were further analyzed

for β-galactosidase gene activation. Afterwards, prey plasmids were isolated from yeast

clones and transformed into E. coli. To avoid further work with identical clones, prey

plasmids were compared by their restriction patterns after EcoRI/XhoI or ApaI digestion.

Prey plasmids were then re-transformed into yeast cells together with the specific bait to

confirm specificity of protein-protein interaction or with an empty bait plasmid pGBKT7 to

check whether the candidate interacts with GAL4 DNA-BD alone. All candidates identified

by screening with the JM bait interacted with the GAL4 DNA-BD and could not be further

considered as specific. The inserts of isolated and evaluated prey plasmid were analyzed by

63

Results ___________________________________________________________________________

sequencing. Coding sequences of proteins (or part of the proteins) corresponding to the yeast

candidates were identified by the BLAST program (Basic Local Alignment Search Tool at the

National Center for Biotechnology Information) using sequences of prey plasmids. Only

candidates, whose coding sequences were in frame with the GAL4 AD have been selected for

further investigation.

Only clones representing proteins, which spatially and subcellularly co-localize with the

respective MuSK domains used as baits for their identification, were considered as potential

MuSK binding partners (Table 4.1.).

Bait Conditions N° of

independent clones screened

Candidates Confirmed Potential MuSK binding partners

N° of identification (aa)

Nedd9

2 (aa 500-762)

Casein kinase2β (CK2β)

167 (aa 1-215)

Hypothetical protein DKFZp434A1319

1 (aa 110-376)

MuSK2xwt (HF7c) -T-L-H+ 10mM3AT

4x106 493 44

LIM domain only 7

2 (aa 945-1350)

K3 (AH109) -T-L-H-A

2.4x106 66 21 EFEMP-1/ S1-5 4 (aa 87-494)/ (aa 4-388)

(AH109) -T-L-H-A

0.6x106

3

1 -

WISP2

5 (aa 1-251)

K4

(AH109) -T-L-H +5mM3AT

1.9x106

89 22

Laminin receptor 1

1 (aa 127-898)

(AH109) -T-L-H-A

3x106

30 - JM

(HF7c) -T-L-H + 10mM3AT

3.6x106 14 -

Table 4.1. Results of the Y2H screens with the MuSK domains. Only relevant candidates, e.g. with the corresponding tissue expression and sub-cellular localization to that of MuSK, are shown in the column “potential MuSK binding partners”. The number of independent sequences and amino acid region of candidate obtained from the Y2H screen are indicated in the last column.

One of the candidates, which have been identified many times in the Y2H screen with the

MuSK intracellular domain is regulatory β subunit of Casein Kinase 2 (CK2β). CK2 is highly

conserved and ubiquitously expressed serine/threonine kinase, which is involved in many

64

Results ___________________________________________________________________________

biological processes such as gene expression, protein synthesis and signal transduction

(Meggio and Pinna 2003; Olsten and Litchfield 2004). Interaction of this protein with MuSK

has been further studied in details.

4.2. Detailed investigation of MuSK – CK2 interaction

To evaluate the significance of the interaction between MuSK and CK2 following

experiments have been performed:

- Investigation of the temporal and spatial expression profile of CK2 at the NMJ

- Biochemical verification of the interaction between MuSK and CK2

- Mapping of the binding epitopes for both proteins

- Co-localization of MuSK and CK2 proteins at the NMJ

- Investigation of the biological significance of the interaction between MuSK and CK2

4.2.1. Quantitative determination of CK2 transcript level in different tissues

After identification of CK2β interacting with MuSK in yeast, we wanted to know if CK2 is

expressed in the same tissues and cells as MuSK. Moreover, considering the fact that

transcripts of MuSK as well as other proteins of postsynaptic specialization, for example

AChR subunits, are upregulated at the synapse (Moore et al. 2001; Witzemann et al. 1991),

we intended to investigate whether the same is true for CK2. Taking into account that the

CK2 holoenzyme is a tetramer, consisting of two catalytic α or α’ subunits and two

regulatory β subunits we decided to investigate the expression profile of all subunits. It

seemed to be even more interesting to investigate the distribution of all CK2 subunits,

because CK2 can act in some processes without regulatory subunit and there is a functional

specialization between α and α’ subunits in different tissues (Boldyreff and Issinger 1997;

Chen et al. 1997; Escalier et al. 2003; Xu et al. 1999). The quantity of transcripts was

estimated by quantitative real time PCR for all CK2 subunits as well as for some proteins

concentrated at the NMJ, e.g. MuSK and AChR α subunit. For 1st strand cDNA synthesis

RNA was prepared from synaptic and extrasynaptic regions of mouse diaphragm, C2C12

myoblasts, and C2C12 myotubes treated with conditioned media containing either nerve-

derived agrin 4.8., which is able to induce clustering of AChRs or an inactive muscle-derived

isoform agrin 0.0. As a negative control for MuSK and AChRα expression 1st strand cDNA

from brain has been used.

65

Results ___________________________________________________________________________

As expected, MuSK and AChRα transcripts accumulate in the synaptic part of the diaphragm

(Fig. 11 A, B). Their quantity is higher in myotubes than in myoblasts and subsequent

treatment of myotubes with agrin 4.8. induces further increase of the transcripts level.

Fig. 11: Distribution of MuSK and AChRα transcripts. The level of MuSK (A) and AChRα (B) mRNA was defined by real time PCR in brain, synaptic and extrasynaptic regions of diaphragm, C2C12 myoblasts and myotubes treated with muscle-derived agrin 0.0. or nerve-derived agrin 4.8. Quantification data were normalized to β-actin for each sample. Gene expression level in C2C12 myotubes was always set to 1.

Next, we investigated the expression profile of the CK2 subunits. As CK2 is an ubiquitous

protein, the expression of all CK2 subunits is detected in both brain and muscle tissues,

whereas muscle contains a higher amount of CK2 transcripts (Fig. 12). CK2β and CK2α’

transcripts are enriched in the synaptic region of the diaphragm (Fig 12 B, C). Although

expression level of all CK2 subunits is higher in C2C12 myotubes than in myoblasts, only

CK2 α’ subunit transcription is slightly elevated in myotubes in response to agrin 4.8.

treatment (Fig. 12 B).

66

Results ___________________________________________________________________________

Fig. 12: Distribution of CK2 subunits transcripts. Relative amounts of CK2 α (Α), α’ (B) and β (C) subunits transcripts were measured for brain, extrasynaptic and synaptic areas of diaphragm, C2C12 myoblasts and myotubes treated with either agrin 0.0. or agrin 4.8. by quantitative real time PCR. All quantification data were normalized to β-actin and calibrated for each CK2 subunit to the level of their transcripts in C2C12 myoblasts, which was set to 1.

4.2.2. Biochemical verification of the interaction of CK2 subunits with

MuSK

In order to confirm the interaction between CK2β and the intracellular domain of MuSK by

co-immunoprecipitation experiments both proteins were over-expressed in mammalian cells.

For that, full length human CK2β identified by Y2H screen was subcloned into a CMV-

expression vector in frame with the T7-tag and transiently transfected together with an

expression plasmid encoding a myc-tagged MuSK2xwt (pcDNA3-MuSK2xwt-myc) into

HEK293 cells. The cells were harvested after 48 h, protein extracts were prepared and used

for co-immunoprecipitation. As a negative control protein extract containing only

MuSK2xwt-myc was used. Immunoprecipitation of CK2 β subunit with anti-T7-tag

antibodies resulted in co-immunoprecipitation of MuSK2xwt, which was detected by Western

blot with anti-myc antibodies (Fig. 13). The CK2β preferentially interacted with the tyrosine-

phosphorylated form of MuSK intracellular domain, which corresponds to the upper band

detected for MuSK2xwt (Fig. 13, Fig. 14 A). Since CK2 in most cases acts as a tetramer

67

Results ___________________________________________________________________________

composed of β and α subunits, interaction between HA-tagged catalytic α subunit and

MuSK2xwt has also been studied. α subunit of CK2 was also able to bind to the intracellular

domain of MuSK, but the observed interaction was very weak (Fig. 13).

Fig. 13: Co-immunoprecipitation of MuSK2xwt by CK2α and CK2β. Protein extracts of HEK293 cells containing over-expressed either HA-tagged CK2α or T7-tagged CK2β together with MuSK2xwt-myc were used for immunoprecipitation with anti-HA-tag or anti-T7-tag antibodies respectively. Western blot with α-myc antibodies has shown that MuSK2xwt is co-precipitated by CK2α and CK2β. Phosphorylated form of MuSK2xwt interacts strongly with CK2β. Position of SeeBlue protein ladder is indicated on the left (the figure is kindly provided by Amir Khan).

To reveal if the α and β subunits of CK2 bind to the same epitope of MuSK, the interaction

between MuSK2xwt and CK2β has been studied under the excessive amounts of CK2α and

vice versa. It has to be noted, that due to the ubiquitous expression of CK2 protein, α and β

subunits are always present at least in minor amounts in every cell system. Precipitation of

T7-tagged CK2β in the presence of high amounts of over-expressed CK2α resulted in the

same efficient co-precipitation of MuSK2xwt (Fig. 14 A). The interaction was also observed

between MuSK2xwt and CK2α when CK2β subunit was over-expressed (Fig. 14 B). At last,

a strong binding between CK2α and CK2β was not affected by the presence of high amounts

of MuSK2xwt, which most likely reflects existence of additional CK2β – CK2α complexes

independent of MuSK (Fig. 14 C).

68

Results ___________________________________________________________________________

Fig. 14: Co-immunoprecipitation of CK2β, CK2α and MuSK2xwt. Co-immunoprecipitation experiments were performed with protein extracts of HEK293 cells transiently transfected with T7-tagged CK2β, HA-tagged CK2α and myc-tagged MuSK2xwt. (A) Interaction between MuSK2xwt and CK2β was not affected by over-expression of CK2α. (B) Immunoprecipitation of MuSK2xwt in the presence of over-expressed CK2β resulted in co-precipitation of CK2α. (C) Strong binding between CK2β and CK2α was not disturbed by over-expression of MuSK2xwt. Position of protein ladder is indicated on the left of each blot.

As a next step, the interaction between MuSK and CK2β was analyzed in vivo. Precipitation

of endogenous MuSK protein from C2C12 myotubes or mouse hind limb muscle tissue

lysates resulted in co-immunoprecipitation of endogenous CK2β (Fig. 15 A, B).

Fig. 15: Co-immunoprecipitation of endogenous MuSK and CK2β. Interaction between endogenous MuSK and CK2β has been shown by co-immunoprecipitation experiments using (A) protein extract of C2C12 myotubes and (B) of mouse hind limb muscle. MuSK protein was precipitated by a mixture of three α-MuSK antibodies (ABR, Abcam and 194T) conjugated to protein A Sepharose beads, CK2β was detected by Western blot with α-CK2β specific antibodies (123-GLSDI-127). Position of protein marker is indicated on the left of each Western blot.

4.2.3. Mapping of interacting domains between MuSK and CK2β

To identify the epitopes of MuSK interacting with CK2β a series of C-terminal deletions of

MuSK intracellular domain were generated (Fig. 16). First, deletion mutants were subcloned

69

Results ___________________________________________________________________________

as a fusion to GAL4 DNA-BD in the Y2H bait vector and used in binary Y2H interaction

assays with the full length CK2β identified by the screen.

Fig. 16: MuSK deletion constructs. C-terminal deletions of MuSK intracellular domain are shown. The numbers in the name of the constructs correspond to the C-terminal aa positions of truncation. All truncations were subcloned into the Y2H bait vector pGBKT7 and into CMV-expression vector.

CK2β interacted with MuSK2xwt, MuSK2xkd and with whole MuSK intracellular domain

(MuSK-868) (Fig. 17 A).

Fig. 17: Mapping the epitope of MuSK interacting with CK2β. Epitope of MuSK interacting with CK2β was mapped by binary Y2H assay (A) and by co-immunoprecipitation (B) to the kinase domain. (A) C-terminal truncations of MuSK were expressed as GAL4 DNA-BD fusions, whereas full length CK2β was fused to GAL4 AD. Interaction between MuSK constructs and CK2β is indicated by the yeast growth. Positive control implies interaction between murine tumor suppressor protein p53 and the SV40 large T-antigen encoded by pGBKT7-53 and pGADT7-T (Clontech) respectively. (B) Co-immunoprecipitation of myc-tagged CK2β by different T7-tagged truncations of the MuSK intracellular domain over-expressed in HEK293 cells.

70

Results ___________________________________________________________________________

While deletion of MuSK C-terminal domain (MuSK-857) enclosing PDZ-binding motif did

not affect interaction with CK2β, the truncation of kinase domain to the half (MuSK-682)

completely abolished the binding (Fig. 17 A).

To confirm the results of Y2H experiments the same MuSK intracellular domain C-terminal

truncations were expressed as T7-tagged proteins and used in immunoprecipitation

experiments together with myc-tagged full length CK2β. From MuSK deletion mutants only

MuSK-868 and MuSK-857 were able to interact with CK2β that corresponded to the Y2H

data (Fig. 17 B).

To identify the epitope of CK2β which interacts with MuSK we followed the same strategy

generating a series of deletion constructs (Fig. 18). For CK2β the following epitopes are

known: (1) a ‘destruction box’ which is responsible for CK2β turnover; (2) an ‘acidic loop’

which interacts with basic residues present on CK2α and mediates the association of the

holoenzyme with the plasma membrane; (3) a ‘zinc finger domain’ which is responsible for

the dimerization of CK2 β subunits; (4) a ‘positive regulatory domain’ at the C-terminus

which appears to play a role in the oligomerization of the kinase. Starting from the C-

terminus, we subsequently chopped of CK2β domains, subcloned the remaining parts as

GAL4 AD- or as GST-fusions and used them with MuSK2xwt in Y2H assays and GST-

pulldown experiments, respectively.

Fig. 18: CK2β constructs used for epitope mapping. Domain structure of CK2β protein is shown. C-terminal truncations enclosing different domains were generated and subcloned either into the Y2H prey vector or as GST-fusions. The numbers in the name of the constructs correspond to C-terminal aa position of truncation.

In contrast to the full length protein all deletion mutants of CK2β failed to interact with

MuSK2xwt in both assays (Fig. 19 A, B).

71

Results ___________________________________________________________________________

Fig. 19: Mapping of epitope of CK2β interacting with MuSK. Epitope of CK2β interacting with MuSK was identified in binary Y2H experiments (A) or by GST-pulldown (B) with MuSK2xwt. (A) CK2β truncations were expressed as preys and MuSK2xwt as a bait. Interaction was revealed by the yeast growth only for full length CK2β. (B) GST-fusions of CK2β epitopes were immobilized on Glutathione Sepharose beads and incubated with the extract of Cos7 cells transiently transfected with myc-tagged MuSK2xwt. Interaction was detected by Western blot with α-myc antibodies.

4.2.4. Localization of CK2 at the NMJ

MuSK is specifically expressed in muscle and concentrates at the postsynaptic sites.

Therefore, the next step was to study the distribution of CK2 subunits at the NMJ. Frozen

cross-sections of the soleus mouse muscles were stained with antibodies specifically

recognizing either the β or α subunits of CK2. The same sections were incubated with

Rhodamine-α-Bungarotoxin (Rh-α-BTX), which labels AChRs clustered at the postsynaptic

sites of the NMJ. While immunoreactivity of both CK2α and CK2β proteins was revealed in

the cytoplasm of muscle fibers (reflecting ubiquitous expression of CK2), the signal was

significantly concentrated at the NMJ and co-localized there with Rh-α-BTX-stained AChR

clusters (Fig. 20).

72

Results ___________________________________________________________________________

Fig. 20: Co-localization of CK2 subunits with the NMJ. Immunofluorescence micrographs of cross-sections of mouse soleus muscle stained with CK2α (upper panel) or CK2β (lower panel) antibodies shown in green together with Rh-α-BTX shown in red. Both subunits of CK2 are concentrated at the sites of AChR clustering. Scale bar 20 µm.

To rule out a presynaptic localization of CK2 subunits in motor nerve terminals or terminal

Schwann cells, we followed two different strategies. Firstly, transection of the sciatic nerve,

which leads to degeneration of nerve terminals which form synapses on the soleus muscle was

performed for one of the hind limbs of a mouse. The contra-lateral hind limb served as a

control. After 5 days post denervation immunohistochemistry of the muscle crossections

revealed that CK2β and CK2α proteins are still maintained co-localized with AChR clusters,

suggesting that CK2 subunits are at least in part located at the postsynapse (Fig. 21).

Fig. 21: Localization of CK2 subunits at the postsynaptic specializations. Immunohistochemical labeling of denervated mouse soleus muscle with antibodies specific for CK2α (upper panel) or CK2β (lower panel) shown in green together with Rh-α-BTX shown in red. CK2 subunits are co-localized with AChR clusters in the absence of the nerve terminal. Scale bar 20 µm.

73

Results ___________________________________________________________________________

Secondly, ectopic endplates were generated in vivo by injection plasmids expressing an active

isoform of agrin (agrin 4.8.) together with nlsGFP into anesthesized rats (Fig. 22 A). The

ectopic injections where performed by Prof. Hans-Rudolf Brenner (Biocenter, Basel,

Switzerland). Such ectopic endplates are known to be free of nerve terminals and Schwann

cells, but contain all proteins, which are normally concentrated at postsynaptic specializations

(Jones et al. 1997). We observed by immunostaining that CK2 β and α subunits are localized

at such ectopic endplates (Fig. 22 B).

Fig. 22: Co-localization of CK2 subunits at the ectopic endplates with AChR clusters. (A) Ectopic endplates, which are free of nerve terminal and Schwann cells were generated by injection of plasmids encoding active isoform of agrin pcAgrin 748 and nuclear localized GFP (pnlsGFP) into the NMJ free site of muscle (Hashemolhosseini et al. 2000). (B) Immunofluorescence confocal images of the region of rat soleus muscle expressing ectopic postsynaptic specialization stained with Rh-α-BTX (red) and antibodies against CK2α (upper panel) or CK2β (lower panel, green). Overlaid single Z-projections are shown. Scale bar 80 µm – upper image, 40 µm – lower image.

MuSK, as a key regulator of postsynaptic specialization, mainly plays its role during the late

phase of embryogenesis and early postnatal stage when the establishment of NMJs takes

place. At these stages, the MuSK protein is highly expressed, though later during

development it becomes downregulated (Valenzuela et al. 1995). To study whether the CK2

expression profile correlates with that of MuSK, mice hind limb muscles were examined at

different developmental stages (E18.5, P0 and P7) for the presence of CK2 subunits at the

NMJ. Staining with CK2β-specific antibodies has shown that accumulation of the protein at

postsynaptic sites detected by Rh-α-BTX staining of AChRs occurs starting from the first

postnatal week, while at the embryonic stage CK2β immunoreactivity is uniformly distributed

in the cytoplasm of muscle cells (Fig. 23).

74

Results ___________________________________________________________________________

Fig. 23: Accumulation of CK2β at the NMJ during development. Immunofluorescence micrographs of crossections of mouse hind limb muscles at different developmental stages (E18.5, P0 and P7) stained with α-CK2β antibody (shown in green) together with Rh-α-BTX (shown in red). Immunoreactivity for CK2β starts to be concentrated at the NMJ sites at P7 stage. Scale bar 10 µm.

Similarly, concentration of the signal for α subunit of CK2 became detectable at postsynaptic

membranes only at P7 and later (Fig. 24), suggesting that α and β subunits act together at the

late stages of the NMJ development.

75

Results ___________________________________________________________________________

Fig. 24: Accumulation of CK2α at the NMJ during development. Immunofluorescence micrographs of crossections of mouse hind limb muscles at different developmental stages (E18.5, P0 and P7) stained with α-CK2α antibody (shown in green) together with Rh-α-BTX (shown in red). Immunoreactivity for CK2α starts to become concentrated at the NMJ sites at P7 stage. Scale bar 5 µm.

4.2.5. Biological role of CK2 at the NMJ

Given that CK2 interacts with MuSK and that the subunits of CK2 are concentrated at the

NMJ on mRNA and protein level, we decided to examine the biological significance of CK2

for postsynaptic specializations.

4.2.5.1. Inhibition of CK2 activity

The physiological role of CK2 for postsynaptic assembly was studied using murine C2C12

myoblasts. C2C12 myoblasts were differentiated into myotubes under the low-serum

conditions. Upon treatment with agrin 4.8., the myotubes formed on their surface postsynaptic

specializations characterized by clustering of AChRs (Fig. 25 A). In order to investigate the

role of CK2 for AChR clustering, its activity was blocked by pharmacological inhibitors

either apigenin (Sigma, HCLP grade) or DMAT (2-Dimethylamino-4,5,6,7-tetrabromo-1H-

benzimidazole; gift from Drs Flavio Meggio and Lorenzo A. Pinna). DMAT was recently

published to be highly specific for CK2 (Critchfield et al. 1997; Pagano et al. 2004). To cover

the time of agrin-MuSK signaling, inhibitors were added to the myotubes before application

of agrin and treatment was continued for 16 h. The aggregation of AChRs was not abolished

76

Results ___________________________________________________________________________

in the presence of both inhibitors, but the number of clusters was significantly increased (Fig.

25 A).

Fig. 25: Inhibition of CK2 activity affects AChR clustering. (A) Immunofluorescence images of C2C12 cells treated with agrin 4.8. and either mock (DMSO) or CK2 inhibitors – 60 µM apigenin or 40 µM DMAT as indicated. Rh-α-BTX staining (depicted in red) shows that amount of AChR clusters is increased upon CK2 blockage. Scale bar 100 µm. (B) MuSK protein was immune-precipitated from either mock or 40 µM DMAT treated C2C12 cells after application of inactive agrin 0.0. or active agrin 4.8. Subsequently, the MuSK kinase activity was measured in in vitro by [32 P] γ –ATP incorporation assay against enolase (an in vitro MuSK substrate). As it is shown in autoradiography enolase phosphorylation reflecting MuSK kinase activity is induced by application of agrin 4.8., but not affected by DMAT.

The increase of the number of AChRs after treatment with inhibitors was dose-dependent,

with the number of clusters being 2.5-fold higher at the maximal inhibitor concentration used

(Fig. 26 A). The use of higher concentrations of CK2 inhibitors turned out to be toxic for the

cells. Interestingly, after detailed investigation it appeared that the high number of AChR

clusters after the inhibition of CK2 runs on account of very small cluster. At the same time

AChR aggregates of average and big size were still present as in the control situation (Fig. 26

B).

The change in AChR cluster formation upon application of the inhibitors was not induced by

a substantial change in MuSK kinase activity because the ability of MuSK to phosphorylate

its in vitro substrate enolase was not affected in the presence of DMAT (Fig. 25 B).

77

Results ___________________________________________________________________________

Fig. 26: Blockage of CK2 activity affects AChR clustering. (A) Pharmacological inhibitors of CK2 activity applied to C2C12 myotubes in increased concentrations (10 µM – 60 µM) together with agrin 4.8. induced a dose-dependent increase of number of AChR clusters. AChR clusters were counted in at least eight different fields expressing the same cell density at 100x magnification. The number of clusters for mock control was set to 100%. (B) Morphometrical analysis of AChR clusters formed after agrin 4.8. and either 60 µM apigenin or 40 µM DMAT treatment shows that inhibition of CK2 activity leads to appearance of big population of small clusters. The length of AChR clusters was measured by means of Scion Image program and presented in pixels.

4.2.5.2. Knockdown of CK2 subunits by using siRNA

In order to elucidate the requirement of different CK2 subunits for postsynaptic specialization

an additional approach of RNA interference has been used. Specific siRNAs knocking down

the genes encoding CK2 β, α and α’ subunits have been designed by Sfold software (Ding et

al. 2004) and either synthesized as stealth siRNA or expressed from plasmid pSUPERneoGFP

(Oligoengine). The knockdown efficiency was confirmed by luciferase reporter assay. For

that luciferase gene was subcloned as a bicistronic message together with CK2 subunits

cDNA in CMV expression vector. The vectors were co-transfected with siRNAs (or siRNA

producing vectors) targeting CK2 subunits into HEK293 cells. Targeting of the bicistronic

luciferase-CK2 subunit mRNA transcribed from the vector by specific siRNA led to its

degradation resulting in reduced luciferase activity. According to this assay, the siRNAs

CK2α-373 and CK2α’-746 specifically inhibited synthesis of the mRNA of the respective

CK2 subunits by about 80% (Fig. 27 A, E). siRNA CK2α’-690 effectively knocked down

mRNA of both CK2 α and α’ subunits (Fig. 27 A, E). Similarly, the efficiency of the CK2β-

specific siRNA (CK2β-189) was confirmed (Fig. 27 C). Next, the knockdowns of CK2α, α’

and β were confirmed on the protein level. For that plasmids expressing T7-tagged CK2

subunits were transfected together with respective siRNAs into HEK293 cells and the

expression of proteins was determined by Western blot using α-T7-tag antibodies (Fig. 27 B,

D, F).

78

Results ___________________________________________________________________________

Fig. 27: Knockdown of CK2 β, α or α’ subunit by different siRNAs. Efficiency of CK2 β, α or α’ knockdown by different siRNAs was assessed in luciferase-reporter assay (A, C, E) and on protein level by Western blot (B, D, F). (A, C, E) Luciferase activity was measured after co-transfection of HEK293 cells with plasmid encoding luciferase-CK2β/α/α’ bicistronic messages and defined siRNAs. Luciferase activity in control cells transfected with nonspecific siRNA was set to 100%. (B, D, F) Western blots of protein extracts of HEK293 cells transfected with vectors encoding T7-tagged CK2β/α/α’ subunits and indicated siRNAs. β-Tubulin amount in extracts was taken as a loading control. Note, that siRNAs CK2α-373 and CK2α’-746 specifically inhibit CK2α or CK2α’ subunit expression respectively. siRNA CK2α’-690 effectively inhibits both CK2 catalytic subunits. CK2β is knocked down by siRNA CK2β-189.

To investigate the biological consequences of knocking down the expression of CK2, we

transfected the effective siRNAs into MuSK-deficient myoblasts. Unlike C2C12 myotubes,

MuSK-deficient myotubes fail to cluster AChRs in response to agrin treatment, unless forced

to express MuSK by transfection of a respective expression plasmid. Like this, these cells

allow to avoid interference of endogenous MuSK and to study AChR clustering specifically

in MuSK-transfected cells. Specific siRNAs were transfected together with pMT-MuSK-full-

length plasmid into MuSK-deficient myoblasts, which were subsequently differentiated by

special medium and incubation conditions into myotubes. Transfected cells were detected by

fluorescence of co-transfected pnlsGFP. After application of agrin for the last 16 h, cells were

fixed and stained for AChR clusters with Rh-α-BTX. Transfection of siRNAs specific against

either CK2α or CK2α’ resulted as in the case of inhibitor application in appearance of high

amount of undersized AChR clusters (Fig. 28 A).

79

Results ___________________________________________________________________________

Fig. 28: Wile depletion of CK2 α or α’ subunits level results in formation of high amount of undersized AChR clusters, inhibition of either both catalytic subunits or regulatory subunit of CK2 leads to myoblasts death. (A) Images of MuSK-deficient cells transfected with full length MuSK and siRNAs (as indicated) are shown. AChR clusters are stained with Rh-α-BTX (red). Transfected cells detected by fluorescence of co-transfected nuclear localized GFP (green). Scale bar 50 µm. The amount of GFP-positive cells was quantified per 3.5 cm plate. Blockage of both CK2 α and α’ subunits by siRNA CK2α’-690 (B) or CK2 β subunit by siRNA CK2β-189 (C) disturbed cell survival.

While there was no apparent abnormality in differentiation and survival of MuSK-deficient

myoblasts transfected with siRNAs active against only one of catalytic α subunits, the

ablation of both α and α’ subunits by transfection of siRNA CK2α’-690 led to arrest of cell

differentiation and survival. The effect was quantified by calculation of the number of the

GFP-positive cells transfected with control or specific siRNA after 5 days of differentiation

(Fig. 28 B). The same effect was observed when CK2β subunit expression was suppressed by

siRNA CK2β-189 (Fig. 28 C).

4.2.5.3. Phosphorylation of MuSK by CK2

After we found out that MuSK interacts with CK2 it was obvious to speculate that CK2, as a

serine/threonine kinase might phosphorylate MuSK. Indeed, a phosphorylated serine residue

has been previously identified within the intracellular part of MuSK (Till et al. 2002). In silico

study showed that four serines (S-678, S-680, S-690 and S-697) which are located within the

kinase insert (KI) domain of MuSK might be phosphorylated by CK2. To identify which of

four serines are indeed phosphorylated, we started a collaboration with group of Prof. Jorge

Allende (Universidad de Chile, Santiago, Chile). They have checked a phosphorylation of

synthetic peptides (named MuSK667 and MuSK687) representing the parts of MuSK KI and

80

Results ___________________________________________________________________________

carrying serines potentially phosphorylated by CK2 or their corresponding mutants (named

MuSK667-S678A, MuSK667-S680A and MuSK687-S690A, MuSK687-S697A), carrying

substitutions of serines to alanines, which can not be phosphorylated (Fig. 29 A). Both wild

type peptides were highly phosphorylated by CK2 α subunit and addition of CK2 β subunit

(resulting in holoenzyme formation) led to further enhancement of the phosphorylation rate

(Fig. 29 B). While mutations of serine residues 678 and 690 did not have any prominent effect

on phosphorylation, substitutions of serines 680 and 697 to alanines significantly affected

phosphorylation of respective peptides either by CK2α or by holoenzyme, suggesting that

serines 680 and 697 can be phosphorylated by CK2.

Fig. 29: Identification of MuSK serine residues potentially phosphorylated by CK2. (A) Amino acid sequences of synthetic peptides representing MuSK KI. Serines - potential targets of CK2 phosphorylation or their alanine substitutions are shown in bold. First number in peptide name corresponds to its starting aa position in MuSK protein sequence. Three first R residues are required for binding of peptides to the phosphocellulose membrane. (B) In vitro kinase assay for peptides shown in (A) performed with CK2α (black bars) and holoenzyme (open bars). The amount of incorporated isotope is given in pmol and indicated above or within the respective bars. The figure is kindly provided by Prof. Jorge Allende (Universidad de Chile).

We verified the in vitro phosphorylation data obtained with small peptides using the whole

intracellular domain of MuSK or respective S680/S697A mutant. These MuSK proteins were

expressed in E.coli, purified and subsequently subjected to phosphorylation by CK2α or CK2

holoenzyme.

81

Results ___________________________________________________________________________

Fig. 30: In vitro phosphorylation of MuSK intracellular domain by CK2. Autoradiography after phosphorylation of MuSK intracellular domain or its alanine mutant S680/697A either by CK2α or holoenzyme.

Consistent with the phosphorylation of the peptides, the high degree of radioactive phosphate

incorporation was observed for the wild type MuSK intracellular domain, but not for its

alanine mutant S680/697A. However, in case of the MuSK intracellular domain the use of the

holoenzyme compared with the use CK2α alone resulted in a lower phosphorylation rate of

the protein (Fig. 30).

4.2.5.4. Role of CK2 dependent serine phosphorylation of MuSK for AChR clustering

To investigate if CK2-mediated phosphorylation is of any relevance in vivo, we mutated the

respective serine residues. Either we replaced them by alanines (S680/697A) to abolish

phosphorylation or by aspartic (S680/697D) or glutamic acid (S680/697E) which mimic

constitutive phosphorylation. Mutations were introduced into the plasmid pMT-MuSK-full-

length, encoding full-length mouse MuSK by use of a commercial Mutagenesis kit

(Stratagene). The expression of MuSK mutants was confirmed in HEK293 cells (Fig. 31 A).

82

Results ___________________________________________________________________________

Fig. 31: Ability of different MuSK mutants to restore AChR clustering in MuSK-deficient cells. (A) Expression of MuSK mutants, carrying substitutions of serines to alanines, aspartic or glutamic acids at positions 680 and 697 was confirmed in HEK293 cells by Western blot with α-MuSK antibodies (MuSK20kD). (B) Immunofluorescence images of MuSK-deficient myotubes transfected with wild type MuSK or its different mutants after agrin 4.8. application. AChR clusters stained with Rh-α-BTX are shown in red. Transfection of myotubes with MuSK plasmids is confirmed by co-transfected pnlsGFP (green). Treatment with CK2 inhibitor DMAT is indicated. DMAT treatment or mutation of serines 680/697 of MuSK to alanines (S680/697A) leads to formation of highly dispersed AChR clusters (arrowheads), whereas transfection of aspartic (S680/697D) or glutamic acid (S680/697E) MuSK mutants results in normal AChR clusters formation (arrows) even in the presence of DMAT. Scale bar 50 µm.

The ability of the MuSK mutants to restore the agrin-stimulated AChR clustering in MuSK-

deficient myotubes was studied. Plasmids, encoding MuSK mutants were transfected together

with the nlsGFP expression plasmid into MuSK-deficient myoblasts, which were

subsequently differentiated into myotubes. As a control, plasmid encoding wild type MuSK

was transfected. Upon agrin application the cells transfected with the wild type MuSK

exhibited on their surface regular dense patches of AChR clusters (Fig. 31 B). When the cells

83

Results ___________________________________________________________________________

expressing wild type MuSK were treated with inhibitor of CK2 activity DMAT appearance of

a bulk of very small AChR aggregates occupying large area of myotubes was detected (Fig.

31 B). Transfection of MuSK alanine mutant lacking potential CK2 phosphorylation sites

(S680/697A) resulted in the same phenotype of AChR clusters. Additional treatment of the

cells with DMAT did not further affect AChR clustering. Conversely, transfection of aspartic

(S680/697D) or glutamic acid (S680/697E) MuSK mutants mimicking constant

phosphorylation at aa positions 680 and 697 led to appearance of the regular size dense AChR

patches. The normal morphology of the AChR aggregates in the cells expressing S680/697D

or S680/697E mutants was preserved even in the presence of the DMAT, specifying the

importance of MuSK phosphorylation at aa positions 680/697 for the normal AChR

clustering. To confirm changes in visual appearance of the AChR clusters the morphometrical

analysis of the respective cluster areas was performed. Indeed, mutation of serines 680/697

and/or CK2 inhibition lead to statistically significant decrease in density of AChRs, while

mutations mimicking constitutive phosphorylation retain AChR at high density patches even

in the presence of CK2 inhibitor (Fig. 32).

Fig. 32: Quantification analysis of AChR clusters restoration by different MuSK serine mutants in MuSK-deficient cells. Density of AChR clusters was calculated in Scion Image program (as described in Material and Methods). AChR clusters formed in the cells transfected with wild type MuSK and subsequently treated with DMAT or in the cells transfected with S680/697A MuSK mutant have significantly lower density than AChR clusters in control. * P-values <0.0001.

4.2.5.5. Role of kinase insert domain of MuSK in AChR clustering

Considering that we identified CK2-phosphorylatable serine residues within the KI of MuSK,

we asked if their presence inside of KI might be required for modulation of AChR clustering.

We decided to delete the KI of MuSK or to replace it by the KI of other receptor tyrosine

84

Results ___________________________________________________________________________

kinases and to study if these MuSK mutants are able to induce AChR clustering upon agrin

4.8. application. For our replacement studies, we chose the KIs of different receptor tyrosine

kinases, such as Platelet-Derived Growth-Factor β Receptor (PDGFβR), Insulin-Like Growth

Factor Receptor 1 (ILGFR-1), Insulin Receptor (IR) and receptor tyrosine kinase TrkC with

KI of 14 aa (TrkC-14). Potential CK2-phosphorylatable serines are located within the KIs of

two receptor tyrosine kinases of our choice: PDGFβR and TrkC-14 (Fig. 33).

Fig. 33: In silico identification of potential CK2 phosphorylation sites in KIs of different receptor tyrosine kinases. All serine residues found in KIs (aa sequences are indicated) of the receptor tyrosine kinases shown in red. Serines potentially phosphorylatable by CK2 were found in KIs of PDGFβR and TrkC-14 (underlined).

The MuSK KI mutants have been transiently transfected into HEK293 cells and their

expression was verified by Western blot using α-MuSK antibody (MuSK 20kD) (Fig. 34 A).

The ability of MuSK KI mutants to restore AChR clustering was analyzed upon their

transfection into MuSK-deficient cells. MuSK-deficient myotubes expressing MuSK KI

deletion mutant or MuSK in which KI was replaced by that of TrkC-14 were not able to form

AChR clusters in response to agrin 4.8. application (Fig. 34 B). On the contrary, MuSK

mutant carrying the KI of PDGFβR was able to mediate normal AChR clustering (Fig. 34 B).

These data suggested that amino acid residues critical for AChR clustering are present in the

KIs of MuSK and PDGFβR but absent from the KI of TrkC-14.

85

Results ___________________________________________________________________________

Fig. 34: Restoration of AChR clustering by different MuSK KI mutants in MuSK-deficient cells. (A) Expression of MuSK mutants with deletion or substitution of KI domain by KIs of different receptor tyrosine kinases was confirmed in HEK293 cells by Western blot with α-MuSK antibody. (B) Images of MuSK-deficient cells transfected with different MuSK KI mutants. Transfected cells are identified by co-transfection of nlsGFP (green). AChR stained with Rh-α-BTX (red). Deletion of MuSK KI or its substitution with KI of TrkC-14 completely abolish AChR clustering. Substitution of MuSK KI by KI of PDGFβR doesn’t have any effect on AChR cluster morphology (arrows). Conversely, AChR clusters are affected in MuSK-deficient cells transfected with MuSK carrying KI of ILGFR-1 or IR (arrowheads). Scale bar 50 µm.

Interestingly, transfection of MuSK bearing ILGFR-1 or IR KIs resulted in the formation of

undersized AChR aggregates similar to that observed upon transfection of MuSK alanine

mutant S680/697A or CK2 inhibition, corroborating the importance of serine phosphorylation

within the KI domain for regular AChR clustering.

The observed changes in the AChR clusters morphology were quantified by morphometrical

analysis of respective cluster areas (Fig. 35).

86

Results ___________________________________________________________________________

Fig. 35: Quantification analysis of AChR clusters restoration by different MuSK KI mutants in MuSK-deficient cells. Density of AChR clusters was calculated in Scion Image program (as described in Material and Methods). AChR clusters formed in the cells transfected with MuSK bearing KI of ILGFR-1 or IR upon agrin stimulation have significantly lower density than regular AChR aggregates formed upon transfection with wild type MuSK or MuSK ∆KI (PDGFβR) mutant. * P-values <0.0001.

4.2.5.6. Mechanism of CK2 action

Up to now, our results demonstrated the requirement of CK2-dependent phosphorylation of

specific serine residues within the KI of MuSK for AChR clustering. Inhibition of CK2

activity or knockdown of CK2 protein or mutagenesis of respective serines resulted in

appearance of dispersed and undersized AChR clusters. We asked if the changed morphology

of AChR clusters is caused by a change in AChR cluster stability. To determine stability of

AChR clusters, C2C12 myotubes were treated with agrin 4.8. alone or together with CK2

inhibitor apigenin (60 µM), then agrin-containing medium was replaced by fresh medium and

the number of AChR clusters was assayed after 0, 4 and 8 h. The number of AChR clusters at

4 and 8 h was calculated as percentage of the value at time point 0 h, which was set to 100%.

As previously, the application of CK2 inhibitor led to the appearance of a high amount of

small AChR aggregates, but the rate of their dispersal after removal of agrin together with the

inhibitor was comparable with that for the mock control (Fig. 36, blue and red bars).

However, when the treatment with apigenin was continued after agrin withdrawal, AChR

clusters disappeared much faster than in the mock control. The significant difference between

apigenin and mock treated cells was observed already within 4 h. These data suggest that CK2

activity is required for stabilization of AChR clusters.

87

Results ___________________________________________________________________________

Fig. 36: AChR cluster stability. C2C12 myotubes were stimulated with agrin 4.8. in the presence of CK2 inhibitor apigenin (60 µM) or mock solution of DMSO (red and blue bars respectively). After agrin removal apigenin treatment was stopped (yellow bar) or continued (grey bar). Amount of AChR clusters left on myotube surface was quantified at 0, 4 and 8 h. AChR cluster stability was affected in the presence of CK2 inhibitor. * P-values <0.0003.

4.2.5.7. Generation and characterization of muscle-specific CK2β knockout mice

To explore the biological impact of CK2 for the postsynaptic specialization at the NMJ it is

necessary to examine mice after knocking out the genes of CK2 subunits specifically in

myonuclei. Considering interaction between CK2β and MuSK, we started by generating a

muscle-specific CK2β knockout. Fortunately, mice with manipulated genomes where the first

two exons of CK2β flanked by insertion of loxP sites (with the ATG located inside the second

exon) were already available (Buchou et al. 2003). In order to get muscle specific CK2β

knockout mice, first, we crossed CK2βloxP/loxP mice with transgenic mice expressing Cre

recombinase under the human skeletal actin (HSA) promoter (Schwander et al. 2003). The

resulting CK2βloxP/+,HSA-Cre mice were subsequently breaded with CK2βloxP/loxP mice to get

CK2βloxP/loxP,HSA-Cre offspring. Expression of the HSA-Cre recombinase in muscle

precursors from E9 stage (i.e. before NMJ formation at E13) should lead to deletion of first

two exons of CK2 gene resulting in its disruption selectively in muscle tissue.

CK2βloxP/loxP,HSA-Cre mice identified by genotyping PCR (see Methods) were found at all

developmental stages (E10.5, E15.5, E18.5 and adult; Fig. 37).

88

Results ___________________________________________________________________________

Fig. 37: Genotypes of mice obtained from CK2βloxP/+,HSA-Cre x CK2βloxP/loxP breadings. CK2βloxP/+,HSA-Cre mice were crossed with CK2βloxP/loxP mice to get animals with CK2βloxP/loxP,HSA-Cre genotype. At least 20 embryos were genotyped for each embryonic stage (E10.5, E 15.5 and E18.5) and 60 mice at the adult age (P30). CK2βloxP/loxP,HSA-Cre mice were found at all developmental stages in the ratio closed to Mendalian. In order to prove the disruption of the CK2β gene in the muscle of these mice, we performed

quantitative real-time PCR. One of the primers for this PCR was designed to anneal within the

first exon in order to be able to detect its deletion. Indeed, the quantity of CK2β transcripts

was significantly reduced in the muscles of mutant mice at both embryonic and adult stages

(Fig. 38). Residual detected levels of CK2β mRNA in the muscles of the mutants reflect the

presence of the large fraction of non-muscle cells (aprox. 60%) in adult muscle tissue (Escher

et al. 2005).

Fig. 38: Levels of CK2β transcripts in leg muscle of wildtype and CK2β mutant mice. CK2β transcript levels, measured by real-time RT-PCR, are reduced in muscles of mutant CK2βloxP/loxP, HSA-Cre mice compared to wildtype litters at both embryonic and postnatal stages. The residual transcripts in the muscles of mutant mice originate from non-muscle cells which make up approx. 60% of all nuclei in adult leg muscle.

Consistent with the muscle-specific deletion of the CK2β gene no immunoreactivity for

CK2β protein was detectable at the NMJs of the adult mutant mice (Fig. 39).

89

Results ___________________________________________________________________________

Fig. 39: Immunoreactivity for CK2β protein is absent from the muscle of CK2βloxP/loxP,HSA-Cre mouse. Immunofluorescence micrographs of cross-sections of wildtype and CK2βloxP/loxP,HSA-Cre mice (P210) gastrocnemius muscles stained with α-CK2β antibody (shown in green) together with Rh-α-BTX (shown in red). Immunoreactivity for CK2β is present in the muscle and concentrates at the NMJ of wildtype, but not CK2βloxP/loxP,HSA-Cre mice. Scale bar 10 µm.

Phenotypically, the mutant mice did not show any abnormalities during the first two months

of age. However, from P60 on the mutant mice started to display myasthenic characteristics.

Their grip strength, which was reflected by the time for which the mice were able to cling up

side down onto a wire grid began to decrease and at the age of six month went down to at

average 5-10 sec compared to 2 min for the wildtype litters (Fig. 39).

Fig. 39: Grid test. The time for which CK2β mutant mice of different age or their wildtype littermates can cling upside-down onto a horizontal wire mesh was measured. The test was discontinued after 120 sec. The mutant mice of more then 60 days age hold on the mesh significantly shorter time than their wildtype littermates. Means ± S.E. (N=6 for each age).

One reason for the observed myasthenia of these mice might be affected AChR aggregates at

the NMJ. Therefore whole mount preparations of different hind limb muscles (soleus,

90

Results ___________________________________________________________________________

gastrocnemius and extensor digitorum longus (EDL)) as well as diaphragmas from the mutant

mice and their wildtype litters of 210-240 days of age were stained with Rh-α-BTX.

Consistent with myasthenic appearance, the morphology of AChR aggregates was severely

affected in the CK2β mutants. The endplates were mostly fragmented and continued to

disintegrate further into small patches or spots of AChRs (Fig. 40, types C and D).

Fig. 40: AChR clustering is affected in CK2β mutant mice. Confocal micrographs of wildtype and CK2βloxP/loxP,HSA-Cre mice (P210) gastrocnemius endplates stained with Rh-α-BTX (shown in red). AChR clusters in CK2β mutant muscles display different degree of fragmentation. AChR aggregates were grouped according to the following criteria. Type A: AChR cluster represent uninterrupted pretzel shaped structure; Type B: endplate is broken up into several longitudinal and circular structures (arrowheads); Type C: AChR aggregates are made up of only circular structure; Type D: endplate consist of circular structures and spots of AChR (arrows).

We further quantified the phenotype of the affected endplates in mutant mice. According to

their morphology, the AChR clusters were divided into four types: Type A. AChR cluster

represent a typical uninterrupted pretzel shaped structure; Type B. pretzel-shaped structure is

broken up into several longitudinal and circular structures; Type C. AChR aggregates are only

made up of circular structure; Type D. endplates consist of circular structures and small spots

of AChR aggregates. The quantification was performed for the soleus and gastrocnemius

muscles of wildtype and mutant mice and showed that endplates of wildtype mice mainly fall

into A and B categories (99%) with only 1% corresponding to the C type. The D type of

endplates was not found in the muscles of wildtype mice. Conversely, aprox. 90% of the

endplates of the mutant mice corresponded mainly to the Type C and D endplates (Fig. 41).

91

Results ___________________________________________________________________________

Fig. 41: Quantification analysis of AChR cluster affection in CK2β mutant mice. At least 100 images from 4 CK2βloxP/loxP, HSA-Cre and wildtype (P210-P240) soleus and gastrocnemius muscles were grouped independently by 3 individuals according to the criteria described in text. Percentages of each type averaged from the individual assessments (mean ± S.E.) are given in column graphs. Types C and D of endplates are more prominent in muscles of mutant mice, while types A and B in the muscles of wildtypes.

It might be that the motoneurons terminals are also affected in the muscles of the mutant

mice. To inspect carefully the NMJs of mutant mice for the morphology of the motoneuron

terminals, their hind limb muscle fibers were teased and stained with Rh-α-BTX together with

an antibody against neurofilament, detecting motoneurons. Interestingly, even in spite of

severe disruption of AChR clusters, the nerve terminal arborization was not looking affected

in the mutant mice. The nerve branches contacted in some cases, even very small spotty

patches of AChRs (Fig. 42). In some cases, we failed to see a dendrite co-localizing with

spots of AChR clusters. These data suggest that defects of the NMJ observed in CK2β

mutants are muscle specific.

Fig. 42: Nerve morphology at the NMJ of CK2βloxP/loxP, HSA-Cre mice. Confocal image of extensor digitorum longus (EDL) endplate stained with Rh-α-BTX (red) for AChR and with α-neurofilament antibody for the motor nerve terminal (green). Morphologically normal nerve terminal contact spotty subsynaptic AChR aggregates (arrow). Rarely AChR aggregates, which are not accompanied by the nerve terminal are detectable (arrowhead).

92

Results ___________________________________________________________________________

The deletion of the gene encoding CK2β in myotubes implies that the CK2 holoenzyme is

disrupted and this in turn leads to the change of CK2 activity. To investigate the CK2

enzymatic activity in the muscle after ablation of the CK2β gene, protein extracts were

prepared from a hind limb muscle of the mutant and wildtype mice and used in in vitro

phosphorylation assays with a CK2-phosphorylatable peptide as substrate (see Methods).

Surprisingly, the CK2 activity in the muscle of mutant mice was higher then in wildtypes.

Concomitantly, a decrease of CK2 activity was observed during aging for both mutant and

wildtype animals (Fig. 43). Note that because of the decline of CK2 activity, eight month old

animals display roughly the same amount of activity like one month old wildtypes (Fig. 43).

Fig. 43: CK2 activity in muscles of CK2β mutant and wildtype mice. CK2 activity was measured in muscle lysates of CK2β mutant and wildtype mice of different age. CK2 activity estimated as amount of isotope incorporated in synthetic CK2 substrate peptide was increased in CK2β mutant compare to wildtype mice, but decreased with age of animals of both genotypes.

93

Discussion ___________________________________________________________________________

5. Discussion

5.1. Potential MuSK binding partners

Identification of protein interactions is a prerequisite for revealing cascades of signaling

pathways. The state of knowledge at the NMJ regarding signal transduction is very limited.

The identification of interactions at the NMJ would allow better understanding of synapse

development and pathology. For example, recent data about interaction between MuSK and

the C-terminus of ColQ, a collagenic tail recruiting acetylcholinesterase (AChE) to the NMJ,

has approved that MuSK is responsible for synaptic localization of AChE and explained

certain forms of congenital myasthenic syndromes associated with mutations in the C-

terminal part of ColQ (Engel et al. 2003).

Using the Y2H technique, we looked for proteins, which interact with different domains of

MuSK. MuSK extracellular parts (C6-box and Ig-like IV domain) have been used as baits for

identification of the hypothetical protein RATL which is believed to link MuSK to rapsyn

(Zhou et al. 1999). The disadvantage of Y2H screening with extracellular parts of protein is

that they can not be appropriately post-translationally modified, for example glycosylated,

inside of the yeast cell that might result in a loss of desired interactions. Indeed, two

glycosylation sites have been found within the extracellular domain of MuSK which we used

in our screens (Watty and Burden 2002). Nevertheless, we have succeeded in screening with

these MuSK baits arguing that extracellular modifications might not be relevant for some

interactions. Among proteins obtained from these screens are an EGF-domain containing

protein of the extracellular matrix, EFEMP-1/S1-5; a member of connective tissue growth

factors family shown to be induced by Wnt signaling called WISP2 and Laminin Receptor-1

(LR-1).

EFEMP-1/S1-5 is a novel extracellular protein containing six EGF-like repeats. The EFEMP-

1 gene product have been found to be up regulated in Werner syndrome of premature aging

(Lecka-Czernik et al. 1995). Single-amino acid substitutions in the EFEMP-1 protein leads to

another disease - Malattia Leventinese - an inherited macular degenerative syndrome,

characterized by abnormal accumulation of EFEMP-1 protein inside of retinal pigment

epithelium cells (Marmorstein et al. 2002). The multidomain protein structure may indicate

94

Discussion ___________________________________________________________________________

that EFEMP-1 protein interacts with extracellular matrix components and serves to connect

and integrate the function of multiple partner molecules. Two more proteins found to interact

with the extracellular part of MuSK are WISP2 and LR1. WISP2 belongs to the subfamily of

connective tissue growth factors. WISP proteins are up-regulated downstream of the Wnt

pathway (Pennica et al. 1998). On the other hand, several members of Wnt signaling pathway

have been already shown to act at the NMJ (Luo et al. 2002; Luo et al. 2003a; Wang et al.

2003). Interestingly, out of all WISP proteins only WISP2 is expressed in skeletal muscle

(Pennica et al. 1998). LR1 is a 67kD non-integrin cell surface receptor expressed on different

cell types including muscle cells. It recognizes several non-identical hydrophobic domains on

elastin, laminin, and type IV collagen (Hinek 1996). These components of basement

membranes are also present in the basal lamina of the NMJ and some of them play an

important role during NMJ development (Patton et al. 1997).

Interactions between MuSK and EFEMP-1, WISP2 and LR-1 have to be confirmed and

require further investigation.

Among proteins found to bind to the active form of the intracellular MuSK domain in our

Y2H screens we have selected as the most interesting for our further studies neural precursor

cell expressed developmentally down-regulated 9 (Nedd9), Lim Domain Only 7 (LMO7) and

Casein Kinase 2 β (CK2β).

Nedd9 is a member of small Cas protein family (including Cas130, Nedd9 and Sin) which

acts as “docking” molecules in intracellular signaling cascades. Cas proteins contain N-

terminal SH3-domains, cluster of SH2 binding motives and a serine-rich region. These

proteins have been shown to participate as docking molecules in JNK, ERK and Rac signaling

pathways known to be activated by agrin at the NMJ (Jones and Werle 2000; Lacazette et al.

2003; Weston et al. 2003). Moreover, interactions with Nedd9 were demonstrated for other

signaling molecules which are involved in the NMJ development, such as Src and Abl kinases

(Finn et al. 2003; Mohamed et al. 2001). LMO7 is a novel protein, containing alternatively

spliced C-terminal LIM domain and found in nuclear and cytosolic cell fractions. LMO7

being widely expressed is present in skeletal muscle in high amounts (Putilina et al. 1998).

The deletion of the LMO7 gene in mice leads to their death between birth and weaning

accompanied by retinal and muscular degeneration and growth retardation (Semenova et al.

2003). CK2β is a regulatory subunit of CK2 – a ubiquitously expressed and constitutive

active serine/threonine kinase involved in many cell processes. Among CK2 substrates are

many proteins involved in different processes inside of cell including signal transduction.

95

Discussion ___________________________________________________________________________

5.2. CK2 – newly characterized MuSK binding partner

CK2β was identified numerous times in our Y2H-screen with the intracellular domain of

MuSK. Nevertheless, CK2β has not been found in the screens with the extracellular domains

of MuSK that suggests the specificity of the interaction. In all interaction assays CK2β bound

stronger to the phosphorylated form of MuSK, suggesting that the MuSK - CK2β interaction

is strengthened after the activation of MuSK followed by autophosphorylation of its

intracellular domain. Although CK2 regulatory β subunits normally associate with CK2

catalytic α subunits building the heterotetrameric holoenzyme, the α subunit is constitutively

active and can function independently (Heriche et al. 1997). Controversially, function of

CK2β independent of α subunit has also been reported (Bosc et al. 2000; Heriche et al. 1997).

Our interaction assays have shown a weak, most likely transient interaction between MuSK

and CK2α. This interaction was not influenced by an excess of CK2β, suggesting that α and

β subunits do not bind to the same MuSK epitope. Most likely, CK2β binds to MuSK at first

and operates further as a docking platform recruiting α subunit.

Epitope mapping studies have shown interaction between the positive regulatory domain at

the C-terminal of CK2β with the kinase domain of MuSK. It is also possible that CK2β binds

to the juxtamembrane region of MuSK and the kinase domain is involved in the proper

conformation or exposure of the juxtamembrane domain (Luo et al. 2002). Other proteins

involved in the development of the NMJ such as Dishevelled or Geranylgeranyltransferase I

also bind to the kinase domain of MuSK (Luo et al. 2002; Luo et al. 2003a). Since processes

of signal transduction are regulated by phosphorylation of serine, threonine or tyrosine

residues, it is not surprising that kinase domains of transmembrane receptors carrying most of

phosphorylation sites (Watty et al. 2000) become the target for upstream regulators or the

place of binding for downstream signaling effectors.

The C-terminal of CK2β comprising 155-196 aa has been shown to be responsible for

dimerization of β subunits, association with the α subunit, and up-regulation of CK2 activity

(Boldyreff et al. 1993; Krehan et al. 1996). In particular the area between 155-167 aa is

required for dimerization of β subunits, whereas the 172-196 aa motif appears to be crucial

for stabilizing the association of α and β subunits (Boldyreff et al. 1993; Boldyreff et al.

1996; Krehan et al. 1996; Marin et al. 1997). However, this facts do not exclude the

involvement of the C-terminus of CK2β in interaction with MuSK as other proteins such as c-

96

Discussion ___________________________________________________________________________

Mos and A-Raf have been shown to interact with the same region of CK2β (Boldyreff and

Issinger 1997; Chen et al. 1997).

5.3. Phosphorylation of MuSK by CK2 is required for appropriate

AChR clustering

Since CK2 subunits were found to bind to MuSK and concentrate at the postsynaptic site of

the NMJ in vivo we asked a biological role of CK2 during the postsynaptic development. Two

different approaches, fist, blockade of CK2 by chemical compounds and, second, knockdown

of CK2 subunits by specific siRNA have been used. If first approach allowed to estimate an

impact of CK2 activity on AChR clustering, the second could help to disclose a role of

different CK2 subunits in this process. In both cases ablation of catalytic activity of CK2 led

to appearance of high amount of undersized AChR clusters, suggesting that CK2 activity is

not required for initiation of AChR aggregation per se but rather important for the appropriate

condensation of micro-aggregates into the regular size endplates.

In spite of high similarity between CK2α and α’ subunits (aprox. 90% within their catalytic

domain) and considerable functional overlap, there is an evidence for their functional

specialization in some physiological processes (Litchfield 2003). While siRNA knockdown of

only one of CK2 subunits did not interfere with cell survival and differentiation into

myoblasts, it did influence the normal AChR aggregation, implying that one subunit can

compensate for the loss of the other during the cell proliferation, but presence of both subunits

is prerequisite for the normal postsynaptic development.

Previous studies hinted at serine phosphorylation inside the kinase insert (KI) domain of

MuSK (Till et al. 2002). We discovered that CK2 (catalytic subunit and holoenzyme) was

able to phosphorylate MuSK at serine residues 680 and 697 located in the KI region.

If the phosphorylation of these two serines is of fundamental importance for the MuSK

signaling, one would expect the residues to be conserved in different species. To see if serines

680 and 697 are conserved in KIs of MuSK from the other species we have performed an

alignment of mouse, rat, human, zebrafish, xenopus, chick and torpedo MuSK (Fig. 44).

Corroborating their functional importance serine residues 680 and 697 are indeed present in

the KIs of MuSK of most of the species. Moreover, serine 697 shows a higher degree of

conservation among species that correlates with our its higher phosphorylation rate (Fig. 29

B, Fig. 44).

97

Discussion ___________________________________________________________________________

Fig. 44: Conservation of MuSK serine residues 680 and 697 in different species. Alignment of KI areas of MuSK protein from different species. Sequences corresponding to KI is underlined. Serine residues 680 and 697 are boxed. Serine 697 is conserved in all indicated species.

The fact that mutation of serines 680 and 697 in the MuSK KI to the non-phosphorylatable

amino acids led to the similar phenotype of AChR cluster impairment as in experiments with

CK2 inhibition further supported a view that CK2-mediated phosphorylation of MuSK at

serines 680 and 697 is required for appropriate AChR clustering.

CK2 has been shown to participate in Wnt/β-catenin signaling pathway, phosphorylating and

by this way stabilizing cytosolic levels of Dishevelled and β-catenin proteins (Song et al.

2000; Song et al. 2003). On the other hand different members of this pathway, i.e. APC,

Dishevelled, β-catenin have been reported to bind to the main molecules of the NMJ (AChR β

subunit, MuSK, rapsyn, see introduction) and influence agrin induced AChR clustering. In

this regard, blockage of CK2 activity, leading to increased number of AChR clusters, can

exert also through the Wnt/β-catenin pathway by reducing the levels of cytosolic β-catenin.

Consistent with this hypothesis increased levels of β-catenin were found to inhibit AChR

clustering (Luo et al. 2003b; Sharma and Wallace 2003). Alternatively, CK2 can influence

AChR clustering through both MuSK- and Wnt/β-catenin signaling pathways. The fact that

substitution of CK2-phosphorylateble serines of MuSK by amino acids mimicking permanent

phosphorylation led upon their transfection in MuSK-deficient cells to formation of the

regular sized AChR clusters even in the presence of CK2 inhibitors corroborated the specific

involvement of CK2 in regulation of AChR clustering by modulation of agrin-MuSK, but not

the Wnt-signaling.

Regarding appearance of high amount of undersized AChR cluster aggregates upon blockage

of CK2-mediated serine phosphorylation of MuSK, different mechanisms of CK2 action can

be proposed. The involvement of Rac/Rho small GTP-ases is likely as they act at early stages

of AChR clustering, promoting initial aggregation of diffused AChRs into micro clusters

(Rac) and subsequent condensation of these micro clusters into full-size AChR aggregates

98

Discussion ___________________________________________________________________________

(Rho) (Weston et al. 2003). It is tempting to speculate that MuSK phosphorylation by CK2 in

this case is important for coordination of Rac/Rho activities and blockage of CK2 leads either

to upregulation of Rac or downregulation of Rho. Alternatively, AChR gene upregulation can

be involved. Recently, a new shunt pathway involving agrin-induced activation of Rac and

acting in synaptic gene regulation has been described by the group of H.-R. Brenner

(Lacazette et al. 2003). It can be proposed that CK2, phosphorylating MuSK acts as a

suppressor of Rac activity. As follows inhibition of CK2 results in upregulation of AChR

gene expression through the Rac-JNK pathway on the one hand and Rac-dependent micro

cluster generation on the other hand. Both hypotheses have to be further experimentally

proven.

Our data about the decreased stability of AChR clusters in the presence of CK2 inhibitors

suggests another mechanistical aspect of CK2 action, where CK2-mediated phosphorylation

of MuSK is required for AChR cluster stabilization. Further studies are required to understand

which MuSK-downstream signaling processes involved in AChR clusters stabilization are

regulated by its serine phosphorylation.

5.4. KI domain of MuSK is involved in modulation of postsynaptic

specialization

Many receptor tyrosine kinases such as PDGFβ-, ILGF-, Insulin-Receptors or c-kit contain in

their cytoplasmic portion a hydrophobic region of about 100 amino acids. These region

named kinase insert (KI) divides tyrosine kinase domains in two parts (Hubbard and Till

2000; Ullrich and Schlessinger 1990). The function of KI is poorly understood, but it is

speculated that along with juxtamembrane domain and C-terminus the KI domain contains

amino acid residues that are autophosphorylated upon binding of the ligand to the receptor

and serve as binding sites for the modular domains of other proteins (Hubbard and Till 2000).

For example, KI of PDGFβ-Receptor contains an autophosphorylated upon ligand binding

tyrosine, which recruits downstream effector - PI3-kinase (Kazlauskas and Cooper 1989).

Therefore, KIs of receptor tyrosine kinases can play an important role in the processes of

signal transduction. Our experiments with MuSK KI deletion mutant or MuSK KI chimeras

show that the KI of MuSK receptor tyrosine kinase has an important function in agrin-induced

AChR clustering. Thus, it can be hypothesized that serine phosphorylation within MuSK KI is

99

Discussion ___________________________________________________________________________

required for establishing of docking sites for certain intracellular proteins that participate in

agrin-mediated signaling required for the proper AChR clustering.

Recently, the adaptor protein 14-3-3 γ has been identified as a MuSK binding partner.

(Strochlic et al. 2004; Strochlic et al. 2005a). Since 14-3-3 proteins interact with their various

partners in a serine phosphorylation dependent manner a serine phosphorylation of MuSK KI

domain by CK2 might be of biological significance. The fact that 14-3-3 γ is involved in the

regulation of synaptic transcription can argue in favor of the hypothesis regarding

involvement of CK2 in AChR subunits gene regulation. Further investigation will enlighten

the potential implication of CK2 in regulation of MuSK-14-3-3 γ interaction.

Interestingly, the KIs of other receptor tyrosine kinases like Trk seem to have completely

different functional specialization rather disrupting then mediating biological signaling. Splice

variants of TrkC carrying 14- or 39- aa insert within their tyrosine kinase domain are not able

to mediate neurotrophin-3 induced signaling because of their inability to bind such

downstream effectors as Sch and phospholipase Cγ (Guiton et al. 1995). Consistent study has

shown that introduction of 14- aa KI of TrkC into TrkA receptor, which normally lacks the KI

domain leads to repression of TrkA downstream signaling (Meakin et al. 1997). Accordingly,

the introduction of 14- aa KI of TrkC into MuSK has also led to its inability to conduct agrin-

initiated signaling. These findings suggest the completely different mechanisms of regulation

of activity of Trk and PDGF-Receptors by KIs, assigning MuSK to be more similar to the

group of PDGF-Receptors.

5.5. Role of CK2 in development of postsynaptic apparatus in vivo.

Our in vitro and cell culture studies demonstrated the importance of CK2-dependent MuSK

phosphorylation for AChR clustering and their maintenance. Nonetheless, not all aspects of

synaptic differentiation can be studied using a tissue culture system since requirements for

synaptic proteins in tissue culture may differ from that in vivo. For example, rapsyn is

required to cluster MuSK in cultured cells but not during the synapse development in vivo

(Gillespie et al. 1996; Moscoso et al. 1995). Similarly, the extracellular domain of MuSK is

indispensable for AChR clustering in cell culture but not essential in vivo (Apel et al. 1997;

Sander et al. 2001). Thus, in vivo studies were required to prove the impact of CK2 during the

NMJ development.

100

Discussion ___________________________________________________________________________

Study of CK2α knockout in yeast has shown that this subunit can functionally replace CK2α’

and vise versa, but deletion of both subunits is lethal (Padmanabha et al. 1990). Conversely,

ablation of regulatory β subunit did not affect yeast cell survival (Bidwai et al. 1995). In mice

only CK2α’ subunit knockout has been studied so far, showing the inability of CK2α to

compensate for α’ only during spermatogenesis (Xu et al. 1999). In contradiction to the yeast

studies, the CK2β knockout mice died at embryonic stage shortly after implantation,

suggesting that in mammals CK2β protein is important at early stages of development for the

cell survival (Buchou et al. 2003). Consistently our cell culture data has shown that inhibition

of CK2β subunit by siRNA in myoblast cells leads to arrest of their proliferation and

differentiation. To reveal the biological importance of CK2β for NMJ development we have

used a conditional knockout approach selectively ablating CK2β in muscle tissue. Mice

carrying a deletion of CK2β in muscle displayed muscle weakness starting from the third

month of age. This phenotype correlated with the time of onset of their postsynaptic

membrane impairment. Phenotypically AChR clusters of CK2β muscle knockout mice are

similarly affected as observed for other myasthenic mice lacking components of

dystrophin/utrophin-glycoprotein complex (D/UGC). The endplates are fragmented and often

contain small patches or granules of AChRs (Grady et al. 2000). This phenotype is

reminiscent of AChR impairment in C2C12 cell culture after the blockade of CK2 or mutation

of potential CK2 phosphorylation sites on MuSK. Similarly, myotubes lacking α-dystrobrevin

or dystoglycan form in response to agrin plenty of small AChR aggregates (Grady et al.

2000). The late onset of phenotype in vivo shows that components of D/UGC are required not

for initial stages of postsynaptic specialization but rather for subsequent maturation and

stabilization of the muscle endplate. For CK2β the situation is similar. Firstly, blockage of

CK2 in C2C12 cell culture does not result in the loss of agrin-induced AChR clusters, but

rather affects their morphology. Secondly, stability of AChR aggregates is dramatically

reduced upon CK2 inhibition. And, finally, in vivo CK2 subunits concentrate at the

postsynaptic site of the NMJ only starting from the early postnatal age when AChR plaques

are already formed.

Recently Src and Abl class of kinases has been reported to act downstream of MuSK and

regulate the stability of AChR clusters controlling AChR-cytoskeleton linkage (Finn et al.

2003; Mittaud et al. 2004; Smith et al. 2001). The fact that CK2 participates in stabilization of

postsynaptic apparatus suggests the possible involvement these kinases in CK2-mediated

MuSK signaling. Alternatively, since ablation of CK2β in muscle leads to the NMJ phenotype

101

Discussion ___________________________________________________________________________

similar to that of D/UGC components knockout mice, CK2-mediated phosphorylation of

MuSK can be important for recruitment of these components to the AChR clusters during the

endplate maturation.

Interestingly that in cell culture in the presence of agrin and absence of CK2 activity we

immediately observe an impairment of AChR cluster morphology, in contrast, in vivo this

defect shows up only late postnatally. The existence of some other not yet identified factors,

promoting the proper aggregation of the AChR receptors at the late embryonic and early

postnatal stages might explain this contradiction. The other difference of our in vivo system

from the cell culture experiments is that in CK2β muscle knockout mice we still have both

CK2 catalytic subunits present. Moreover, surprisingly, our studies show that though CK2

activity decrease with the age, deletion of CK2 β in the muscle leads to upregulation of CK2

activity. Our in vitro data do not provide clear definition of how does CK2β regulates CK2α

activity on MuSK. Considering the fact that CK2 activity is downregulated during the aging it

can be proposed that decrease in the recruitment of CK2α to MuSK due to CK2β ablation can

be compensated in young, but not in old animals by the increased CK2α activity. The study of

mouse mutant having deletion of catalytic CK2 subunits or carrying substitution of MuSK

genomic locus by MuSK S680/697A mutant would provide the final explanation of how CK2

subunits counteract during MuSK phosphorylation.

Taken together, we our study has shown for the first time an interaction between CK2 and the

main organizer of the postsynaptic specialization – MuSK. These data provides the first

description of the role for the MuSK KI domain. CK2-mediated phosphorylation of serines

inside of this region of MuSK appears to be critical for the downstream signaling events

which lead to stabilization and maintenance of postsynaptic specialization at the NMJ. The

data presented here can be of general importance for the understanding of processes of

signaling transduction during synaptogenesis not only at the NMJ but also in the CNS, since

CK2 enzyme has already been shown to be involved in the several neural functions (Blanquet

2000).

102

Abbreviations ___________________________________________________________________________

6. Abbreviations

aa amino acid APS Ammonium Persulphate 3-AT 3-amino-1,2,4-triazole ATP adenosine triphosphate C6-box cysteine-rich domain (box) 1st cDNA first strand complementary deoxyribonucleic acid ColQ collagen Q Cy2, Cy3 carbocyanine 2 and 3 DMSO dimethylsulphoxide DNA deoxyribonucleic acid DNase deoxyribonuclease DO drop out DTT dithiothreitol dNTP deoxyribonucleotide triphosphate ECL enhanced chemiluminescence EDTA ethylenediamine tetra-acetic acid EFEMP-1 EGF-containing fibulin-like extracellular matrix protein

1 ERK extracellular-signal regulated kinase Ets domain E twenty-six domain EGF epidermal growth factor FGF fibroblast growth factor Fig. figure GABP GA-binding protein GST glutathione-S-transferase HB-GAB heparin-binding growth-associated molecule Ig immunoglobulin IP immunoprecipitation JNK c-Jun N-terminal kinase kd kinase defective ∆ΚΙ deletion of kinase insert lacZ β-galactosidase gene from E.coli MAPK mitogene activated protein kinase MAGUC membrane-associated guanylate kinase mRNA messenger RNA NP-40 Nonidet P-40 OD optical density P0 myelin protein zero PBS phosphate-buffered saline PCR polymerase chain reaction PDZ PSD-95/Discs-large/ZO-1 PEG polyethylenglicol PFA paraformaldehyde PMSF phenylenmethylsulfonylfluorid

103

Abbreviations ___________________________________________________________________________

PTB phospho-tyrosine binding motif RNA ribonucleic acid RNase ribonuclease RT reverse transcription RT-PCR reverse transcription followed by polymerase chain

reaction S100 calcium-binding protein SDS sodium dodecyl sulphate siRNA small interfering RNA SNAP-25 synaptosomal-associated protein of 25kDa SNARE soluble N-ethyl maleimide sensitive factor attachment

protein receptor TBE Tris/boric acid/EDTA TEMED N,N,N’,N’-Tetramethylethylenediamine TM transmembrane Tris Tris-(hydroxymethyl)-aminomethane Trk Tyrosine receptor kinase WB Western blot wt wildtype X-Gal 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside Units bp base pair ˚C degree Celsius cm centimeter cpm counts per minute h hour kD kilodalton M, mM, µM molar, milimolar, micromolar min minute ng, mg, µg nanogram, milligram, microgram ml, µl milliliter, microliter p pico pH -log H+ concentration rpm revolutions per minute rcf=g relative centrifugal field RLU Relative Light Units RT room temperature s second U Unit V Volt

104

References ___________________________________________________________________________

7. References

Alberts B., Johnson, A, Lewis, J, Raff, M, Roberts, K, Walter P. Molecular Biology of the Cell.(Fourth Edition) Garland Science Publishing. New York. Anderson M. J.,Cohen M. W. (1977) Nerve-induced and spontaneous redistribution of acetylcholine receptors on cultured muscle cells. J Physiol (268) 757-73 Apel E. D., Glass D. J., Moscoso L. M., Yancopoulos G. D.,Sanes J. R. (1997) Rapsyn is required for MuSK signaling and recruits synaptic components to a MuSK-containing scaffold. Neuron (18) 623-35 Apel E. D., Lewis R. M., Grady R. M.,Sanes J. R. (2000) Syne-1, a dystrophin- and Klarsicht-related protein associated with synaptic nuclei at the neuromuscular junction. J Biol Chem (275) 31986-95 Atwood H. L.,Karunanithi S. (2002) Diversification of synaptic strength: presynaptic elements. Nat Rev Neurosci (3) 497-516 Banks G. B., Fuhrer C., Adams M. E.,Froehner S. C. (2003) The postsynaptic submembrane machinery at the neuromuscular junction: requirement for rapsyn and the utrophin/dystrophin-associated complex. J Neurocytol (32) 709-26 Bezakova G.,Ruegg M. A. (2003) New insights into the roles of agrin. Nat Rev Mol Cell Biol (4) 295-308 Bidwai A. P., Reed J. C.,Glover C. V. (1995) Cloning and disruption of CKB1, the gene encoding the 38-kDa beta subunit of Saccharomyces cerevisiae casein kinase II (CKII). Deletion of CKII regulatory subunits elicits a salt-sensitive phenotype. J Biol Chem (270) 10395-404 Blanquet P. R. (2000) Casein kinase 2 as a potentially important enzyme in the nervous system. Prog Neurobiol (60) 211-46 Boldyreff B., Meggio F., Pinna L. A.,Issinger O. G. (1993) Reconstitution of normal and hyperactivated forms of casein kinase-2 by variably mutated beta-subunits. Biochemistry (32) 12672-7 Boldyreff B., Mietens U.,Issinger O. G. (1996) Structure of protein kinase CK2: dimerization of the human beta-subunit. FEBS Lett (379) 153-6 Boldyreff B.,Issinger O. G. (1997) A-Raf kinase is a new interacting partner of protein kinase CK2 beta subunit. FEBS Lett (403) 197-9 Bosc D. G., Graham K. C., Saulnier R. B., Zhang C., Prober D., Gietz R. D.,Litchfield D. W. (2000) Identification and characterization of CKIP-1, a novel pleckstrin homology domain-containing protein that interacts with protein kinase CK2. J Biol Chem (275) 14295-306 Bradford M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem (72) 248-54 Bravo D.,Parsons S. M. (2002) Microscopic kinetics and structure-function analysis in the vesicular acetylcholine transporter. Neurochem Int. (41) 285-289

105

References ___________________________________________________________________________

Buchou T., Vernet M., Blond O., Jensen H. H., Pointu H., Olsen B. B., Cochet C., Issinger O. G.,Boldyreff B. (2003) Disruption of the regulatory beta subunit of protein kinase CK2 in mice leads to a cell-autonomous defect and early embryonic lethality. Mol Cell Biol (23) 908-15 Burden S. J. (2002) Building the vertebrate neuromuscular synapse. J Neurobiol (53) 501-11 Calakos N.,Scheller R. H. (1996) Synaptic vesicle biogenesis, docking, and fusion: a molecular description. Physiol Rev (76) 1-29 Chen M., Li D., Krebs E. G.,Cooper J. A. (1997) The casein kinase II beta subunit binds to Mos and inhibits Mos activity. Mol Cell Biol (17) 1904-12 Colomar A.,Robitaille R. (2004) Glial modulation of synaptic transmission at the neuromuscular junction. Glia (47) 284-9 Covault J.,Sanes J. R. (1986) Distribution of N-CAM in synaptic and extrasynaptic portions of developing and adult skeletal muscle. J Cell Biol (102) 716-30 Critchfield J. W., Coligan J. E., Folks T. M.,Butera S. T. (1997) Casein kinase II is a selective target of HIV-1 transcriptional inhibitors. Proc Natl Acad Sci U S A (94) 6110-5 Dai Z., Luo X., Xie H.,Peng H. B. (2000) The actin-driven movement and formation of acetylcholine receptor clusters. J Cell Biol (150) 1321-34 DeChiara T. M., Bowen D. C., Valenzuela D. M., Simmons M. V., Poueymirou W. T., Thomas S., Kinetz E., Compton D. L., Rojas E., Park J. S., Smith C., DiStefano P. S., Glass D. J., Burden S. J.,Yancopoulos G. D. (1996) The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo. Cell (85) 501-12 Deconinck A. E., Rafael J. A., Skinner J. A., Brown S. C., Potter A. C., Metzinger L., Watt D. J., Dickson J. G., Tinsley J. M.,Davies K. E. (1997) Utrophin-dystrophin-deficient mice as a model for Duchenne muscular dystrophy. Cell (90) 717-27 Ding Y., Chan C. Y.,Lawrence C. E. (2004) Sfold web server for statistical folding and rational design of nucleic acids. Nucleic Acids Res (32) W135-41 Engel A. G., Ohno K.,Sine S. M. (2003) Congenital myasthenic syndromes: A diverse array of molecular targets. J Neurocytol (32) 1017-37 Escalier D., Silvius D.,Xu X. (2003) Spermatogenesis of mice lacking CK2alpha': failure of germ cell survival and characteristic modifications of the spermatid nucleus. Mol Reprod Dev (66) 190-201 Escher P., Lacazette E., Courtet M., Blindenbacher A., Landmann L., Bezakova G., Lloyd K. C., Mueller U.,Brenner H. R. (2005) Synapses form in skeletal muscles lacking neuregulin receptors. Science (308) 1920-3 Falls D. L., Rosen K. M., Corfas G., Lane W. S.,Fischbach G. D. (1993) ARIA, a protein that stimulates acetylcholine receptor synthesis, is a member of the neu ligand family. Cell (72) 801-15 Fambrough D. M. (1979) Control of acetylcholine receptors in skeletal muscle. Physiol Rev (59) 165-227 Feder D.,Bishop J. M. (1990) Purification and enzymatic characterization of pp60c-src from human platelets. J Biol Chem (265) 8205-11

106

References ___________________________________________________________________________

Ferns M., Deiner M.,Hall Z. (1996) Agrin-induced acetylcholine receptor clustering in mammalian muscle requires tyrosine phosphorylation. J Cell Biol (132) 937-44 Finn A. J., Feng G.,Pendergast A. M. (2003) Postsynaptic requirement for Abl kinases in assembly of the neuromuscular junction. Nat Neurosci (6) 717-23 Flucher B. E.,Daniels M. P. (1989) Distribution of Na+ channels and ankyrin in neuromuscular junctions is complementary to that of acetylcholine receptors and the 43 kd protein. Neuron (3) 163-75 Frank E.,Fischbach G. D. (1979) Early events in neuromuscular junction formation in vitro: induction of acetylcholine receptor clusters in the postsynaptic membrane and morphology of newly formed synapses. J Cell Biol (83) 143-58 Fu A. K., Smith F. D., Zhou H., Chu A. H., Tsim K. W., Peng B. H.,Ip N. Y. (1999) Xenopus muscle-specific kinase: molecular cloning and prominent expression in neural tissues during early embryonic development. Eur J Neurosci (11) 373-82 Fuhrer D. K.,Yang Y. C. (1996) Activation of Src-family protein tyrosine kinases and phosphatidylinositol 3-kinase in 3T3-L1 mouse preadipocytes by interleukin-11. Exp Hematol (24) 195-203 Gautam M., Noakes P. G., Mudd J., Nichol M., Chu G. C., Sanes J. R.,Merlie J. P. (1995) Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice. Nature (377) 232-6 Gautam M., Noakes P. G., Moscoso L., Rupp F., Scheller R. H., Merlie J. P.,Sanes J. R. (1996) Defective neuromuscular synaptogenesis in agrin-deficient mutant mice. Cell (85) 525-35 Gesemann M., Denzer A. J.,Ruegg M. A. (1995) Acetylcholine receptor-aggregating activity of agrin isoforms and mapping of the active site. J Cell Biol (128) 625-36 Gillespie S. K., Balasubramanian S., Fung E. T.,Huganir R. L. (1996) Rapsyn clusters and activates the synapse-specific receptor tyrosine kinase MuSK. Neuron (16) 953-62 Glass D. J., Bowen D. C., Stitt T. N., Radziejewski C., Bruno J., Ryan T. E., Gies D. R., Shah S., Mattsson K., Burden S. J., DiStefano P. S., Valenzuela D. M., DeChiara T. M.,Yancopoulos G. D. (1996) Agrin acts via a MuSK receptor complex. Cell (85) 513-23 Goldman D., Brenner H. R.,Heinemann S. (1988) Acetylcholine receptor alpha-, beta-, gamma-, and delta-subunit mRNA levels are regulated by muscle activity. Neuron (1) 329-33 Goodearl A. D., Yee A. G., Sandrock A. W., Jr., Corfas G.,Fischbach G. D. (1995) ARIA is concentrated in the synaptic basal lamina of the developing chick neuromuscular junction. J Cell Biol (130) 1423-34 Grady R. M., Zhou H., Cunningham J. M., Henry M. D., Campbell K. P.,Sanes J. R. (2000) Maturation and maintenance of the neuromuscular synapse: genetic evidence for roles of the dystrophin--glycoprotein complex. Neuron (25) 279-93 Guiton M., Gunn-Moore F. J., Glass D. J., Geis D. R., Yancopoulos G. D.,Tavare J. M. (1995) Naturally occurring tyrosine kinase inserts block high affinity binding of phospholipase C gamma and Shc to TrkC and neurotrophin-3 signaling. J Biol Chem (270) 20384-90

107

References ___________________________________________________________________________

Hashemolhosseini S., Moore C., Landmann L., Sander A., Schwarz H., Witzemann V., Sakmann B.,Brenner H. R. (2000) Electrical activity and postsynapse formation in adult muscle: gamma-AChRs are not required. Mol Cell Neurosci (16) 697-707 Herbst R., Avetisova E.,Burden S. J. (2002) Restoration of synapse formation in Musk mutant mice expressing a Musk/Trk chimeric receptor. Development (129) 5449-60 Heriche J. K., Lebrin F., Rabilloud T., Leroy D., Chambaz E. M.,Goldberg Y. (1997) Regulation of protein phosphatase 2A by direct interaction with casein kinase 2alpha. Science (276) 952-5 Hinek A. (1996) Biological roles of the non-integrin elastin/laminin receptor. Biol Chem (377) 471-80 Hopf C.,Hoch W. (1996) Agrin binding to alpha-dystroglycan. Domains of agrin necessary to induce acetylcholine receptor clustering are overlapping but not identical to the alpha-dystroglycan-binding region. J Biol Chem (271) 5231-6 Hopf C.,Hoch W. (1998) Tyrosine phosphorylation of the muscle-specific kinase is exclusively induced by acetylcholine receptor-aggregating agrin fragments. Eur J Biochem (253) 382-9 Hubbard S. R.,Till J. H. (2000) Protein tyrosine kinase structure and function. Annu Rev Biochem (69) 373-98 Huh K. H.,Fuhrer C. (2002) Clustering of nicotinic acetylcholine receptors: from the neuromuscular junction to interneuronal synapses. Mol Neurobiol (25) 79-112 Hunter D. D., Shah V., Merlie J. P.,Sanes J. R. (1989) A laminin-like adhesive protein concentrated in the synaptic cleft of the neuromuscular junction. Nature (338) 229-34 Ip F. C., Glass D. G., Gies D. R., Cheung J., Lai K. O., Fu A. K., Yancopoulos G. D.,Ip N. Y. (2000) Cloning and characterization of muscle-specific kinase in chicken. Mol Cell Neurosci (16) 661-73 Jacobson C., Montanaro F., Lindenbaum M., Carbonetto S.,Ferns M. (1998) alpha-Dystroglycan functions in acetylcholine receptor aggregation but is not a coreceptor for agrin-MuSK signaling. J Neurosci (18) 6340-8 Jacobson C., Cote P. D., Rossi S. G., Rotundo R. L.,Carbonetto S. (2001) The dystroglycan complex is necessary for stabilization of acetylcholine receptor clusters at neuromuscular junctions and formation of the synaptic basement membrane. J Cell Biol (152) 435-50 Jennings C. G., Dyer S. M.,Burden S. J. (1993) Muscle-specific trk-related receptor with a kringle domain defines a distinct class of receptor tyrosine kinases. Proc Natl Acad Sci U S A (90) 2895-9 Jones G., Meier T., Lichtsteiner M., Witzemann V., Sakmann B.,Brenner H. R. (1997) Induction by agrin of ectopic and functional postsynaptic-like membrane in innervated muscle. Proc Natl Acad Sci U S A (94) 2654-9 Jones M. A.,Werle M. J. (2000) Nitric oxide is a downstream mediator of agrin-induced acetylcholine receptor aggregation. Mol Cell Neurosci (16) 649-60 Kazlauskas A.,Cooper J. A. (1989) Autophosphorylation of the PDGF receptor in the kinase insert region regulates interactions with cell proteins. Cell (58) 1121-33

108

References ___________________________________________________________________________

Koike S., Schaeffer L.,Changeux J. P. (1995) Identification of a DNA element determining synaptic expression of the mouse acetylcholine receptor delta-subunit gene. Proc Natl Acad Sci U S A (92) 10624-8 Korenbaum E.,Rivero F. (2002) Calponin homology domains at a glance. J Cell Sci (115) 3543-5 Korn I., Jacob G., Allende C. C.,Allende J. E. (2001) The activity of CK2 in the extracts of COS-7 cells transfected with wild type and mutant subunits of protein kinase CK2. Mol Cell Biochem (227) 37-44 Krehan A., Lorenz P., Plana-Coll M.,Pyerin W. (1996) Interaction sites between catalytic and regulatory subunits in human protein kinase CK2 holoenzymes as indicated by chemical cross-linking and immunological investigations. Biochemistry (35) 4966-75 Krejci E., Thomine S., Boschetti N., Legay C., Sketelj J.,Massoulie J. (1997) The mammalian gene of acetylcholinesterase-associated collagen. J Biol Chem (272) 22840-7 Kröger S. (1997) Differential distribution of agrin isoforms in the developing and adult avian retina. Mol Cell Neurosci (10) 149-161 Lacazette E., Le Calvez S., Gajendran N.,Brenner H. R. (2003) A novel pathway for MuSK to induce key genes in neuromuscular synapse formation. J Cell Biol (161) 727-36 LaRochelle W. J.,Froehner S. C. (1986) Determination of the tissue distributions and relative concentrations of the postsynaptic 43-kDa protein and the acetylcholine receptor in Torpedo. J Biol Chem (261) 5270-4 LaRochelle W. J.,Froehner S. C. (1987) Comparison of the postsynaptic 43-kDa protein from muscle cells that differ in acetylcholine receptor clustering activity. J Biol Chem (262) 8190-5 Lecka-Czernik B., Lumpkin C. K., Jr.,Goldstein S. (1995) An overexpressed gene transcript in senescent and quiescent human fibroblasts encoding a novel protein in the epidermal growth factor-like repeat family stimulates DNA synthesis. Mol Cell Biol (15) 120-8 Lin W., Burgess R. W., Dominguez B., Pfaff S. L., Sanes J. R.,Lee K. F. (2001) Distinct roles of nerve and muscle in postsynaptic differentiation of the neuromuscular synapse. Nature (410) 1057-64 Litchfield D. W. (2003) Protein kinase CK2: structure, regulation and role in cellular decisions of life and death. Biochem J (369) 1-15 Liyanage Y., Hoch W., Beeson D.,Vincent A. (2002) The agrin/muscle-specific kinase pathway: new targets for autoimmune and genetic disorders at the neuromuscular junction. Muscle Nerve (25) 4-16 Luo Z., Wang Q., Dobbins G. C., Levy S., Xiong W. C.,Mei L. (2003) Signaling complexes for postsynaptic differentiation. J Neurocytol (32) 697-708 Luo Z. G., Wang Q., Zhou J. Z., Wang J., Luo Z., Liu M., He X., Wynshaw-Boris A., Xiong W. C., Lu B.,Mei L. (2002) Regulation of AChR clustering by Dishevelled interacting with MuSK and PAK1. Neuron (35) 489-505 Luo Z. G., Je H. S., Wang Q., Yang F., Dobbins G. C., Yang Z. H., Xiong W. C., Lu B.,Mei L. (2003) Implication of geranylgeranyltransferase I in synapse formation. Neuron (40) 703-17

109

References ___________________________________________________________________________

Marin O., Meggio F., Sarno S.,Pinna L. A. (1997) Physical dissection of the structural elements responsible for regulatory properties and intersubunit interactions of protein kinase CK2 beta-subunit. Biochemistry (36) 7192-8 Marmorstein L. Y., Munier F. L., Arsenijevic Y., Schorderet D. F., McLaughlin P. J., Chung D., Traboulsi E.,Marmorstein A. D. (2002) Aberrant accumulation of EFEMP1 underlies drusen formation in Malattia Leventinese and age-related macular degeneration. Proc Natl Acad Sci U S A (99) 13067-72 McMahan U. J. (1990) The agrin hypothesis. Cold Spring Harb Symp Quant Biol (55) 407-18 Meakin S. O., Gryz E. A.,MacDonald J. I. (1997) A kinase insert isoform of rat TrkA supports nerve growth factor-dependent cell survival but not neurite outgrowth. J Neurochem (69) 954-67 Megeath L. J.,Fallon J. R. (1998) Intracellular calcium regulates agrin-induced acetylcholine receptor clustering. J Neurosci (18) 672-8 Meggio F.,Pinna L. A. (2003) One-thousand-and-one substrates of protein kinase CK2? Faseb J (17) 349-68 Meier T., Masciulli F., Moore C., Schoumacher F., Eppenberger U., Denzer A. J., Jones G.,Brenner H. R. (1998) Agrin can mediate acetylcholine receptor gene expression in muscle by aggregation of muscle-derived neuregulins. J Cell Biol (141) 715-26 Mirsky R., Stewart H. J., Tabernero A., Bradke F., Brennan A., Dong Z.,Jessen K. R. (1996) Development and differentiation of Schwann cells. Rev Neurol (Paris) (152) 308-13 Mittaud P., Marangi P. A., Erb-Vogtli S.,Fuhrer C. (2001) Agrin-induced activation of acetylcholine receptor-bound Src family kinases requires Rapsyn and correlates with acetylcholine receptor clustering. J Biol Chem (276) 14505-13 Mittaud P., Camilleri A. A., Willmann R., Erb-Vogtli S., Burden S. J.,Fuhrer C. (2004) A single pulse of agrin triggers a pathway that acts to cluster acetylcholine receptors. Mol Cell Biol (24) 7841-54 Mohamed A. S., Rivas-Plata K. A., Kraas J. R., Saleh S. M.,Swope S. L. (2001) Src-class kinases act within the agrin/MuSK pathway to regulate acetylcholine receptor phosphorylation, cytoskeletal anchoring, and clustering. J Neurosci (21) 3806-18 Moore C., Leu M., Muller U.,Brenner H. R. (2001) Induction of multiple signaling loops by MuSK during neuromuscular synapse formation. Proc Natl Acad Sci U S A (98) 14655-60 Moscoso L. M., Merlie J. P.,Sanes J. R. (1995) N-CAM, 43K-rapsyn, and S-laminin mRNAs are concentrated at synaptic sites in muscle fibers. Mol Cell Neurosci (6) 80-9 Nichols P., Croxen R., Vincent A., Rutter R., Hutchinson M., Newsom-Davis J.,Beeson D. (1999) Mutation of the acetylcholine receptor epsilon-subunit promoter in congenital myasthenic syndrome. Ann Neurol (45) 439-43 Olsten M. E.,Litchfield D. W. (2004) Order or chaos? An evaluation of the regulation of protein kinase CK2. Biochem Cell Biol (82) 681-93 Padmanabha R., Chen-Wu J. L., Hanna D. E.,Glover C. V. (1990) Isolation, sequencing, and disruption of the yeast CKA2 gene: casein kinase II is essential for viability in Saccharomyces cerevisiae. Mol Cell Biol (10) 4089-99

110

References ___________________________________________________________________________

Pagano M. A., Meggio F., Ruzzene M., Andrzejewska M., Kazimierczuk Z.,Pinna L. A. (2004) 2-Dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole: a novel powerful and selective inhibitor of protein kinase CK2. Biochem Biophys Res Commun (321) 1040-4 Parkhomovskiy N., Kammesheidt A.,Martin P. T. (2000) N-acetyllactosamine and the CT carbohydrate antigen mediate agrin-dependent activation of MuSK and acetylcholine receptor clustering in skeletal muscle. Mol Cell Neurosci (15) 380-97 Patton B. L., Miner J. H., Chiu A. Y.,Sanes J. R. (1997) Distribution and function of laminins in the neuromuscular system of developing, adult, and mutant mice. J Cell Biol (139) 1507-21 Pearce J. M. (2004) Sir Charles Scott Sherrington (1857-1952) and the synapse. J Neurol Neurosurg Psychiatry (75) 544 Pennica D., Swanson T. A., Welsh J. W., Roy M. A., Lawrence D. A., Lee J., Brush J., Taneyhill L. A., Deuel B., Lew M., Watanabe C., Cohen R. L., Melhem M. F., Finley G. G., Quirke P., Goddard A. D., Hillan K. J., Gurney A. L., Botstein D.,Levine A. J. (1998) WISP genes are members of the connective tissue growth factor family that are up-regulated in wnt-1-transformed cells and aberrantly expressed in human colon tumors. Proc Natl Acad Sci U S A (95) 14717-22 Peters M. F., Sadoulet-Puccio H. M., Grady M. R., Kramarcy N. R., Kunkel L. M., Sanes J. R., Sealock R.,Froehner S. C. (1998) Differential membrane localization and intermolecular associations of alpha-dystrobrevin isoforms in skeletal muscle. J Cell Biol (142) 1269-78 Putilina T., Jaworski C., Gentleman S., McDonald B., Kadiri M.,Wong P. (1998) Analysis of a human cDNA containing a tissue-specific alternatively spliced LIM domain. Biochem Biophys Res Commun (252) 433-9 Rimer M., Cohen I., Lomo T., Burden S. J.,McMahan U. J. (1998) Neuregulins and erbB receptors at neuromuscular junctions and at agrin-induced postsynaptic-like apparatus in skeletal muscle. Mol Cell Neurosci (12) 1-15 Salpeter M. M.,Loring R. H. (1985) Nicotinic acetylcholine receptors in vertebrate muscle: properties, distribution and neural control. Prog Neurobiol (25) 297-325 Salpeter M. M., Marchaterre M.,Harris R. (1988) Distribution of extrajunctional acetylcholine receptors on a vertebrate muscle: evaluated by using a scanning electron microscope autoradiographic procedure. J Cell Biol (106) 2087-93 Sander A., Hesser B. A.,Witzemann V. (2001) MuSK induces in vivo acetylcholine receptor clusters in a ligand-independent manner. J Cell Biol (155) 1287-96 Sanes J. R., Marshall L. M.,McMahan U. J. (1978) Reinnervation of muscle fiber basal lamina after removal of myofibers. Differentiation of regenerating axons at original synaptic sites. J Cell Biol (78) 176-98 Sanes J. R.,Lichtman J. W. (1999) Development of the vertebrate neuromuscular junction. Annu Rev Neurosci (22) 389-442 Sanes J. R.,Lichtman J. W. (2001) Induction, assembly, maturation and maintenance of a postsynaptic apparatus. Nat Rev Neurosci (2) 791-805

111

References ___________________________________________________________________________

Schaeffer L., Duclert N., Huchet-Dymanus M.,Changeux J. P. (1998) Implication of a multisubunit Ets-related transcription factor in synaptic expression of the nicotinic acetylcholine receptor. Embo J (17) 3078-90 Schaeffer L., de Kerchove d'Exaerde A.,Changeux J. P. (2001) Targeting transcription to the neuromuscular synapse. Neuron (31) 15-22 Schiestl R. H.,Gietz R. D. (1989) High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr Genet (16) 339-46 Schwander M., Leu M., Stumm M., Dorchies O. M., Ruegg U. T., Schittny J.,Muller U. (2003) Beta1 integrins regulate myoblast fusion and sarcomere assembly. Dev Cell (4) 673-85 Scott L. J., Bacou F.,Sanes J. R. (1988) A synapse-specific carbohydrate at the neuromuscular junction: association with both acetylcholinesterase and a glycolipid. J Neurosci (8) 932-44 Semenova E., Wang X., Jablonski M. M., Levorse J.,Tilghman S. M. (2003) An engineered 800 kilobase deletion of Uchl3 and Lmo7 on mouse chromosome 14 causes defects in viability, postnatal growth and degeneration of muscle and retina. Hum Mol Genet (12) 1301-12 Sharma S. K.,Wallace B. G. (2003) Lithium inhibits a late step in agrin-induced AChR aggregation. J Neurobiol (54) 346-57 Slater C. R. (2003) Structural determinants of the reliability of synaptic transmission at the vertebrate neuromuscular junction. J Neurocytol (32) 505-22 Smith C. L., Mittaud P., Prescott E. D., Fuhrer C.,Burden S. J. (2001) Src, Fyn, and Yes are not required for neuromuscular synapse formation but are necessary for stabilization of agrin-induced clusters of acetylcholine receptors. J Neurosci (21) 3151-60 Son Y. J., Trachtenberg J. T.,Thompson W. J. (1996) Schwann cells induce and guide sprouting and reinnervation of neuromuscular junctions. Trends Neurosci (19) 280-5 Song D. H., Sussman D. J.,Seldin D. C. (2000) Endogenous protein kinase CK2 participates in Wnt signaling in mammary epithelial cells. J Biol Chem (275) 23790-7 Song D. H., Dominguez I., Mizuno J., Kaut M., Mohr S. C.,Seldin D. C. (2003) CK2 phosphorylation of the armadillo repeat region of beta-catenin potentiates Wnt signaling. J Biol Chem (278) 24018-25 Strochlic L., Cartaud A., Labas V., Hoch W., Rossier J.,Cartaud J. (2001) MAGI-1c: a synaptic MAGUK interacting with MuSK at the vertebrate neuromuscular junction. J Cell Biol (153) 1127-32 Strochlic L., Cartaud A., Mejat A., Grailhe R., Schaeffer L., Changeux J. P.,Cartaud J. (2004) 14-3-3 gamma associates with muscle specific kinase and regulates synaptic gene transcription at vertebrate neuromuscular synapse. Proc Natl Acad Sci U S A (101) 18189-94 Strochlic L., Cartaud A.,Cartaud J. (2005) The synaptic muscle-specific kinase (MuSK) complex: new partners, new functions. Bioessays (27) 1129-35 Strochlic L., Cartaud A.,Cartaud J. (2005) [14-3-3 gamma, a novel partner of MuSK downregulates synaptic gene transcription at the neuromuscular junction]. Med Sci (Paris) (21) 467-9

112

References ___________________________________________________________________________

Tansey M. G., Chu G. C.,Merlie J. P. (1996) ARIA/HRG regulates AChR epsilon subunit gene expression at the neuromuscular synapse via activation of phosphatidylinositol 3-kinase and Ras/MAPK pathway. J Cell Biol (134) 465-76 Till J. H., Becerra M., Watty A., Lu Y., Ma Y., Neubert T. A., Burden S. J.,Hubbard S. R. (2002) Crystal structure of the MuSK tyrosine kinase: insights into receptor autoregulation. Structure (10) 1187-96 Ullrich A.,Schlessinger J. (1990) Signal transduction by receptors with tyrosine kinase activity. Cell (61) 203-12 Valenzuela D. M., Stitt T. N., DiStefano P. S., Rojas E., Mattsson K., Compton D. L., Nunez L., Park J. S., Stark J. L., Gies D. R.,et al. (1995) Receptor tyrosine kinase specific for the skeletal muscle lineage: expression in embryonic muscle, at the neuromuscular junction, and after injury. Neuron (15) 573-84 Wang J., Jing Z., Zhang L., Zhou G., Braun J., Yao Y.,Wang Z. Z. (2003) Regulation of acetylcholine receptor clustering by the tumor suppressor APC. Nat Neurosci (6) 1017-8 Watty A., Neubauer G., Dreger M., Zimmer M., Wilm M.,Burden S. J. (2000) The in vitro and in vivo phosphotyrosine map of activated MuSK. Proc Natl Acad Sci U S A (97) 4585-90 Watty A.,Burden S. J. (2002) MuSK glycosylation restrains MuSK activation and acetylcholine receptor clustering. J Biol Chem (277) 50457-62 Weston C., Yee B., Hod E.,Prives J. (2000) Agrin-induced acetylcholine receptor clustering is mediated by the small guanosine triphosphatases Rac and Cdc42. J Cell Biol (150) 205-12 Weston C., Gordon C., Teressa G., Hod E., Ren X. D.,Prives J. (2003) Cooperative regulation by Rac and Rho of agrin-induced acetylcholine receptor clustering in muscle cells. J Biol Chem (278) 6450-5 Willmann R.,Fuhrer C. (2002) Neuromuscular synaptogenesis: clustering of acetylcholine receptors revisited. Cell Mol Life Sci (59) 1296-316 Witzemann V., Brenner H. R.,Sakmann B. (1991) Neural factors regulate AChR subunit mRNAs at rat neuromuscular synapses. J Cell Biol (114) 125-41 Wood S. J.,Slater C. R. (1997) The contribution of postsynaptic folds to the safety factor for neuromuscular transmission in rat fast- and slow-twitch muscles. J Physiol (500 ( Pt 1)) 165-76 Xu X., Toselli P. A., Russell L. D.,Seldin D. C. (1999) Globozoospermia in mice lacking the casein kinase II alpha' catalytic subunit. Nat Genet (23) 118-21 Yang X., Arber S., William C., Li L., Tanabe Y., Jessell T. M., Birchmeier C.,Burden S. J. (2001) Patterning of muscle acetylcholine receptor gene expression in the absence of motor innervation. Neuron (30) 399-410 Yee. (1988) Regional heterogeneity in the distal motor axon: three zones with distinctive intrinsic components. J. Neurocytol. (17) 649-656 Zhou H., Glass D. J., Yancopoulos G. D.,Sanes J. R. (1999) Distinct domains of MuSK mediate its abilities to induce and to associate with postsynaptic specializations. J Cell Biol (146) 1133-46

113

Curriculum vitae

Name: Tatiana Cheusova

Date of birth: 06.09.1978

Place of birth: Novosibirsk, Russia

Nationality: Russian

Marital status: Single

Education:

1985-1995 Secondary school, Novosibirsk, Russia

1995-2000 Novosibirsk State University, Russia

1998-2000 Master course at the State Research Center of

Virology and Biotechnology ”Vector” Title of

the thesis: “Ultrastructural Study

of Marburg virus replication cycle”.

Degree: M.Sc. in Biology

Specialization – cytology and genetics

(July 2000)

2000-2002 State Research Center of Virology and

Biotechnology ”Vector”, Senior scientific

employee

2002-2006 University of Erlangen-Nuremberg, Germany

PhD course at the Faculty of Medicine, Institute

of Biochemistry.

Title of the thesis: “Identification and

characterization of Casein Kinase 2 as MuSK

binding partner.”

114

Publications

Cheusova T., Khan M.A., Schubert S.W., Gavin A.-C., Buchou T., Jacob G., Sticht H., Allende J., Boldyreff B., Brenner H.-R., Hashemolhosseini S. (2006) Casein kinase 2 dependent serine phosphorylation of MuSK regulates acetylcholine receptor aggregation at the neuromuscular junction. Genes Dev; 20 (13) Schubert S.W., Kardash E., Khan M.A., Cheusova T., Kilian K., Wegner M., Hashemolhosseini S. (2004) Interaction, cooperative promoter modulation, and renal colocalization of GCMa and Pitx2. J Biol Chem 26;279(48) 50358-65

115

Acknowledgments

First, I would like to express my gratitude to my supervisor PD. Dr. Said Hashemolhosseini

for giving me the opportunity to do my doctoral thesis at the Institute of Biochemistry,

University of Erlangen-Nuremberg. I would like to thank him for his constant guidance,

understanding and patience during the PhD course, and for his critical reading of this thesis.

I am grateful to Prof. Dr. Has-Rudolf Brenner for the help in starting our scientific project. I

would also like to thank him for the guidance through the whole our study and great

assistance in the manuscript writing.

I am indebted to PD Dr. Fritz Titgemeyer for undertaking the revision of this thesis.

I would like to thank Prof. Dr. Michael Wegner for the help in difficult moments during my

PhD course and all his group members for the helpful advices and constant support in my

experimental work. I also thank Dr. Elisabeth Sock for correction of my thesis.

Very special thanks to my friend Amir Khan for his daily support; help with experiments for

the manuscript and for correction of my thesis. Many sincerer thanks to other lab members

and my dear friends Steffen Schubert and Nicolas Lamoureux for their help in experimental

and life difficulties and for creating friendly atmosphere in the lab.

I would like to acknowledge the group of Prof. Jorge Allende for performance of in vitro

phosphorylation experiments; Heinrich Sticht for in silico studies; Diana Hittmeyer for the

help in kinase assays. I thank Christian Fuhrer for MuSK constructs; Claude Cochet, Olaf-

Georg Issinger, Mathias Montenarh, and Markus Ruegg for providing us with antibodies;

Ruth Herbst and Steve Burden and Stefan Kröger for cells; Lorenzo Pinna and Flavio Meggio

for the CK2 inhibitor DMAT; Michael Sendtner for help in performing ischiadicus lesions.

Moreover, I wish to thank my family and all my friends from Russia and from the Institute for

their unfailing support and encouragement during my work in Germany. I am especially

grateful to Vitaly Vatsko for his respect of my wishes, constant love and great patience.

This work was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG) (HA

3309/1-1,2).

116

Identification and characterization of Casein Kinase 2 as ...€¦ · Identification and...

Documents

Transcript of Identification and characterization of Casein Kinase 2 as ...€¦ · Identification and...