ID X03006; SV 1; linear; mRNA; STD; MAM; 620 BP.XXAC X03006;XXSV X03006.1XXDT 28-JAN-1986 (Rel. 08, Created)DT 12-SEP-1993 (Rel. 36, Last updated, Version 2)XXDE Bovine mRNA for lens beta-s-crystallinXXKW beta-crystallin; beta-gamma-crystallin; crystallin.XXOS Bos taurus (cow)OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;OC Eutheria; Laurasiatheria; Cetartiodactyla; Ruminantia; Pecora; Bovidae;OC Bovinae; Bos.XXRN [1]RP 1-620RX PUBMED; 4054100.RA Quax-Jeuken Y.E.F.M., Driessen H., Leunissen J., Quax W.J., de Jong W.,RA Bloemendal H.;RT "Beta-s-crystallin: structure and evolution of a distinct member of theRT beta-gamma-superfamily";RL EMBO J. 4(10):2597-2602(1985).XXCC Data kindly reviewed (06-MAR-1986) by Y. Quax-JeukenXX...

EM

BL

Index

parserindex

flatfile

Retrieve

index parser displayentries

SRS

Sequence Retrieval Systeman indexing and retrieval system for

flat file databases

http://srs.bioinformatics.nl

http://srs.ebi.ac.uk

Q: Which sequences in EMBL [do not] encode for a protein for which the 3D structure is known?

Q: Which sequences in EMBL [do not] encode for a protein for which the 3D structure is known?

Command line SRS

Using getz

Retrieve the UniProt entry for the protein with accession number P19558:

getz "[uniprot-acc:P19558]" -e

Count the human proteins in the UniProt database:getz "[uniprot-org:human]" –c

Print sequence of the rice proteins in the UniProt database that have a length between 10 and 50 aa:getz "[uniprot-org:rice]&[uniprot-sl#10:50]" -f sl

Give the id and description for all A.thal proteins that have at least 8 transmembrane domains:

getz '[swissprot-org:arabidopsis thaliana]< ([swissprot-CountedItem:transmem]&[swissprot-CountedN#8:]))' -f "id des"

Count the human protein sequences in the NCBI RefSeq database:getz "[refseqp-org:human]" –c

Count the human mRNA sequences in the NCBI RefSeq database:getz "[refseq-org:human]&[refseq-mol:mrna]" –c

Retrieve the mRNA sequences for all human proteins in the NCBI RefSeq database in fasta format :getz "[refseqp-org:human]>[refseq-mol:mrna]" –d –sf fasta

MRS: A fast and compact retrieval system for biological data. Hekkelman M.L., Vriend G.

http://mrs.cmbi.ru.nl/

European Molecular BiologyOpen Software Suite

EMBOSS

"European Molecular Biology Open Software Suite"

http://emboss.sourceforge.net/

Toolbox with bioinformatics applications

http://emboss.bioinformatics.nl/

http://main.g2.bx.psu.edu/

command line / shell

Useful EMBOSS commandscommand descriptionshowdb Displays information on the currently available

databaseswossname Finds programs by keywords in their one-line

documentationtfm Reads the manual entries for each program in EMBOSSseealso Finds the relevant programs of certain programseqret Reads and writes (returns) sequencesentret Reads and writes (returns) flatfile entries

extractfeat Extract features from a sequence

extractseq Extract regions from a sequencetranseq Translate nucleic acid sequences

Get help from EMBOSS itself

# showdbShows the currently available databases# tfm wossnameHow to use a EMBOSS command? Just (r)tfm it# wossname alignmentWhich commands can handle alignments?# seealso seqretAre there any other commands able to do the similar thing?

Command line options

• All EMBOSS programs react to a number of command line options. The most important ones are–help Get help–help –verbose Get elaborate help–auto “no questions asked” –stdout Write to standard output–filter Read stdin, write stdout

SEQRET parameterszonnebloem> seqret -help Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqoutall [<sequence>.<format>] Sequence set(s) filename and optional format (output USA)

Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -feature boolean Use feature information -firstonly boolean Read one sequence and stop

General qualifiers: -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose

SEQRET parameterszonnebloem> seqret -help -verbose Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and

optional format, or reference (input USA) [-outseq] seqoutall [<sequence>.<format>] Sequence set(s) filename and optional format (output USA)

Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -feature boolean Use feature information -firstonly boolean Read one sequence and stop

Associated qualifiers:

"-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used ///

SEQRET parameters /// "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name ///

SEQRET parameters /// "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory ///

SEQRET parameters /// General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages

Universal Sequence AddressType Example Description

filename xxx.seq A sequence file "xxx.seq" in any format

format::filename fasta::xxx.seq A sequence file "xxx.seq" in fasta format

db:IDname embl:paamir EMBL entry PAAMIR, using whatever access method is defined locally for the EMBL database

db:AccessionNumber embl:X13776EMBL entry X13776, using whatever access method is defined locally for the EMBL database and searching by accession number and entry name (X13776 is the accession number in this case)

db-acc:AccessionNumber embl-acc:X13776 EMBL entry X13776, using whatever access method is defined locally for the EMBL database and searching by accession number only

db-id:IDname embl-id:paamir EMBL entry PAAMIR, using whatever access method is defined locally for the EMBL database, and searching by ID only

db-searchfield:word embl-des:lectin EMBL entries containing the word 'lectin' in the Description line

db-searchfield:wildcard-word embl-org:*human* EMBL entries containing the wildcarded word 'human' in the

Organism fields

db:wildcard-ID embl:paami*EMBL entries PAAMIB, PAAMIE and so on, usually in alphabetical order, using whatever access method is defined locally for the EMBL database

Universal Sequence AddressType Example Description

db or db:* embl or EMBL:* All sequences in the EMBL database

@listfile @mylist Reads file mylist and uses each line as a separate USA. List files can contain references to other lists files or any other standard USA.

list:listfile list:mylist Same as "@mylist" above

'program parameters |' 'getz -e [embl-id:paamir] |'The pipe character "|" causes EMBOSS to fire up getz (the SRS sequence retrieval program) to extract entry PAAMIR from EMBL in EMBL format. Any application or script which writes one or more sequences to stdout can be used in this way.

asis::sequence asis::atacgcagttatctgaccatSo far the shortest USA we could invent. In 'asis' format the name is the sequence so no file needs to be opened. This is a special case. It was intended as a joke, but could be quite useful for generating command lines.

Each of the above can have '[start : end]' or '[start : end : r]' appended to them. The 'file' and 'dbname' forms of USA can have 'format::' in front of them (although a database knows which format it is and so this is redundant and error-prone)

Walk through exercise

For a protein with UniProt Accession number:

Q5ZKN6

find the nucleotide sequence that encodes this (repeated) amino acid fragment:

VAEEVAEE

Getting the sequence

seqret -auto uniprot:Q5ZKN6 -stdout

>Q5ZKN6_CHICK Q5ZKN6 SubName: Full=Putative uncharacterized protein;MADNLPSEFDVVVIGTGLPESIIAAACARSGQRVLHVDSRNYYGGNWASFSFSGLLSWIKENQQNTDIKDECEDWRKLILENEEVISLNKKDKTIQHVEAFCFDDQDAAEDVEEAGALARLPAYGASVAEEVAEEPEKECSPLESAVPGAENLESEKATSVDPASAAEGNVTEINAESESSHDSASGESTLESGKTEAALSEISAQEPKKITYSQIVREGRRFNIDLVSKLLYSRGLLIELLIKSNVSRYAEFKNATRILAFREGKVEQVPCSRADVFNSRQLAMVEKRMLMKFLTFCLEYEQHPDEYQDYKNSTFAQFLKTRKLTPSLQHFILHSIAMVSEKDCNTLEGLQATRKFLQCLGRYGNTPFLFPLYGQGEIPQCFCRMCAVFGGIYCLRHSVQCLVVDKESGRCKAVVDHFGQRISANYFIVEDSYLSESVCENVCYRQLSRAVLITDQSVLKTDSEQQVSILMVPPVDLGQPAVCVIELCSSTMTCMKDTYLVHLTCPSTKTAREDLEPVVQKLFSLNAETEKETEDEVLEKPRVLWALYFNMRDSSGIDRNSYSGLPSNVYVCSGPDSALGNDCAVKQAETIFQEMFPTEEFCPAPPNPEDIIYDEDEIASEETGFNNSPETKPESSLQESSSRGSSTAVKEHIEE

Getting the sequence

seqret -auto uniprot:Q5ZKN6 -stdout

>Q5ZKN6_CHICK Q5ZKN6 SubName: Full=Putative uncharacterized protein;MADNLPSEFDVVVIGTGLPESIIAAACARSGQRVLHVDSRNYYGGNWASFSFSGLLSWIKENQQNTDIKDECEDWRKLILENEEVISLNKKDKTIQHVEAFCFDDQDAAEDVEEAGALARLPAYGASVAEEVAEEPEKECSPLESAVPGAENLESEKATSVDPASAAEGNVTEINAESESSHDSASGESTLESGKTEAALSEISAQEPKKITYSQIVREGRRFNIDLVSKLLYSRGLLIELLIKSNVSRYAEFKNATRILAFREGKVEQVPCSRADVFNSRQLAMVEKRMLMKFLTFCLEYEQHPDEYQDYKNSTFAQFLKTRKLTPSLQHFILHSIAMVSEKDCNTLEGLQATRKFLQCLGRYGNTPFLFPLYGQGEIPQCFCRMCAVFGGIYCLRHSVQCLVVDKESGRCKAVVDHFGQRISANYFIVEDSYLSESVCENVCYRQLSRAVLITDQSVLKTDSEQQVSILMVPPVDLGQPAVCVIELCSSTMTCMKDTYLVHLTCPSTKTAREDLEPVVQKLFSLNAETEKETEDEVLEKPRVLWALYFNMRDSSGIDRNSYSGLPSNVYVCSGPDSALGNDCAVKQAETIFQEMFPTEEFCPAPPNPEDIIYDEDEIASEETGFNNSPETKPESSLQESSSRGSSTAVKEHIEE

Run a program within Perl: 3 ways

$seq = `seqret -auto uniprot:Q5ZKN6 stdout`;

system("seqret -auto uniprot:Q5ZKN6 stdout");

open SEQRET,"seqret -auto uniprot:Q5ZKN6 stdout|";while(my $line = <SEQRET>) {if($line !~ /^>/) {

chomp($line);$seq .= $line;

}}close SEQRET;

my $lsOutput = `ls -l`;

put shell commands or programs in backticks to run from Perl. The

output can be stored in a variable.

open LS,"ls -l|";

The open function can run a program and read its output. The pipe symbol "|" links the output to a filehandle.

Find the fragment’s position

my $seq = "";open SEQRET,"seqret -auto uniprot:Q5ZKN6 stdout|";

while(my $line = <SEQRET>) {if($line !~ /^>/) {

chomp($line);$seq .= $line;

}}close SEQRET;# look for location of the repeatmy $position = index($seq, "VAEEVAEE") + 1;# print the offsetprint "Position = ", $position, "\n";

!~

opposite of "=~ "gives true if the search found no hits.

Get a cross-reference to EMBL

entret uniprot:Q5ZKN6 -auto stdout |grep "DR "

Get the feature table of this protein entry

Understand the cross-reference

DR EMBL; AJ720048; CAG31707.1; -; mRNA.

Read the detailed documentation of UniProt cross referencehttp://www.expasy.org/sprot/userman.html#DR_line

Database cross reference

EMBL accession numberProtein ID Molecule Type

Link to EMBL Status identifier

The correspondingcross reference in EMBL

Get a cross-reference to EMBL

entret uniprot:Q5ZKN6 -auto stdout | grep "DR " |grep "EMBL;"

In Perl, use a regular expression to locate the EMBL reference line, and extract the EMBL accession number and the protein-ID

Link protein to coding DNA

extractfeat embl:AJ720048 -value CAG31707.1 stdout

Returns the DNA coding for protein CAG31707.1 (=Q5ZKN6)

Figure out the offset in DNA

Offset in amino acid sequence: 128Offset in corresponding nucleotide sequence: ((128-1) x 3) + 1

OR (128 x 3)-2 = 382Position is from 382 to (382 + 8x3)=406

Figure out the position of its corresponding coding DNA sequence (is there anything wrong here?)

Extract the DNA sequenceextractfeat embl:AJ720048 -value CAG31707.1 stdout | extractseq –filter -reg "382-406"

Now we got the corresponding DNA sequence for the protein fragment

It should be: “gttgctgaggaggttgctgaagaac”

But is that correct? Let's translate it for verification…

Verify the result

extractfeat embl:AJ720048 -value CAG31707.1 stdout | extractseq –filter -reg "382-406"| transeq -filter

Result is “VAEEVAEEX” but not “VAEEVAEE”

What’s wrong here?

Always try to verify your results: computers make very few errors, but that is not true for people...

Exercise

Build a pipeline in Perl to perform the previous steps of the walkthrough (from slide 34)

Test it with the UniProt protein A0L7N9

Find the fragment at offset 305 that is 8 aa long

Find out the coding DNA of this amino acid fragment and verify it