Etude de la survie et identification des fonctions ...

HAL Id: tel-01875799https://tel.archives-ouvertes.fr/tel-01875799

Submitted on 17 Sep 2018

HAL is a multi-disciplinary open accessarchive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come fromteaching and research institutions in France orabroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, estdestinée au dépôt et à la diffusion de documentsscientifiques de niveau recherche, publiés ou non,émanant des établissements d’enseignement et derecherche français ou étrangers, des laboratoirespublics ou privés.

Etude de la survie et identification des fonctionsexprimées par la bactérie lactique Streptococcus

thermophilus dans le tractus digestifOphelie Uriot

To cite this version:Ophelie Uriot. Etude de la survie et identification des fonctions exprimées par la bactérie lactiqueStreptococcus thermophilus dans le tractus digestif. Médecine humaine et pathologie. Universitéd’Auvergne - Clermont-Ferrand I, 2016. Français. �NNT : 2016CLF1PP06�. �tel-01875799�

https://tel.archives-ouvertes.fr/tel-01875799

https://hal.archives-ouvertes.fr

UNIVERSITÉ BLAISE PASCAL UNIVERSITÉ D’AUVERGNE

Année 2016 N° d’ordre 06-DOC-PH

ECOLE DOCTORALE

DES SCIENCES DE LA VIE ET DE LA SANTE N° d’ordre : 06-DOC-PH

Thèse

Présentée à l’Université d’Auvergne

pour l’obtention du grade de DOCTEUR

(Décret du 5 juillet 1984)

Spécialité : Science de la Vie et de la Santé

soutenue le 16 décembre 2016

URIOT Ophélie

Etude de la survie et identification des fonctions exprimées

par la bactérie lactique Streptococcus thermophilus

dans le tractus digestif

Rappor teurs : M. Jean-François CAVIN, Pr, Université de Bourgogne-Franche Comté

Mme Françoise RUL, CR, HDR, INRA, Jouy-en-Josas

Examinateur s: M. Grégory JUBELIN, CR, INRA Clermont-Ferrand Theix

M. Christophe CHASSARD, DR, INRA Aurillac

Mme Stéphanie BLANQUET-DIOT, Dr, HDR, Université d'Auvergne (Directrice de Thèse)

Mme Annie DARY-MOUROT, Pr, URAFPA, Université de Lorraine (Co-directrice de Thèse)

Conception Ingénierie et Développement de l’Aliment et du Médicament,

EA-CIDAM 4678, Université d’Auvergne

28 place Henri Dunant – 63001 Clermont-Ferrand Cedex

Protéolyse et Biofonctionalités des Protéines et des Peptides,

PB2P, UR AFPA, Université de Lorraine

Boulevard des Aiguillettes B.P. 70239, 54506 Vandoeuvre-lès-Nancy Cedex

Résumé - Abstract

Résumé:

Streptococcus thermophilus est la bactérie lactique la plus utilisée après Lactococcus lactis dans l’industrie laitière pour la

fabrication de yaourts et de fromages. Il s’agit du seul streptocoque à avoir le statut de bactérie GRAS (Generally

Recognized As Safe). Malgré de récentes études montrant sa capacité à survivre dans le tractus digestif humain et des effets

santé intéressants, le statut probiotique de S. thermophilus reste l’objet d’interrogations. Ainsi, les objectifs de cette thèse

ont été (i) d’approfondir les connaissances sur la capacité de survie de S. thermophilus en conditions digestives humaines

simulées, grâce, en particulier, au système dynamique multi-compartimenté TIM (TNO gastro-intestinal model) et (ii)

d’identifier des gènes de S. thermophilus spécifiquement activés dans des conditions complexes comme l’environnement

digestif, à l’aide de la technologie R-IVET (Recombinase-based In Vivo Expression Technology) basée sur l’excision d’un

gène rapporteur. Le système R-IVET est composé d’un vecteur plasmidique portant la recombinase cre démunie de son

promoteur et d’une cassette chromosomique composée d’un gène marqueur entouré de sites loxP reconnus par Cre. Ainsi,

dans un premier temps, nous avons implanté la technologie R-IVET chez S. thermophilus LMD-9. Sa fonctionnalité a été

testée et validée in vitro et dans le tractus digestif de la souris. Puis, l’étude de la survie de quatre souches de

S. thermophilus dans le système TIM a montré que trois d’entre elles étaient plus résistantes que la quatrième, très sensible

aux stress gastro-intestinaux. Ces résultats confirment donc que la survie de S. thermophilus dans l’environnement digestif

est souche-dépendante. Ils montrent également que la survie de S. thermophilus est influencée par la matrice alimentaire,

celle-ci étant plus importante en lait fermenté qu’en lait liquide. Enfin, dans un troisième temps, nous avons construit une

première banque génomique R-IVET, en clonant en amont de cre des fragments d’ADN génomiques provenant de LMD-9.

Cette banque a été testée uniquement en conditions gastriques simulées dans le TIM. Puis, après avoir optimisé notre outil

chez S. thermophilus en améliorant la méthode d’identification des gènes activés, une seconde banque R-IVET a été testée

dans l’ensemble du tractus gastro-intestinal (TIM) et en système batch en présence du microbiote intestinal. Ces

expériences nous ont permis de mettre en évidence, pour la première fois, des gènes de S. thermophilus spécifiquement

activés dans les différents compartiments digestifs de l’homme. Ce travail de thèse contribue ainsi à approfondir les

connaissances sur le comportement de cette bactérie dans le tractus gastro-intestinal humain. A moyen terme, ces travaux

devraient permettre d’identifier des marqueurs de survie de S. thermophilus et de mieux comprendre son activité

métabolique dans l’environnement digestif, facilitant la sélection de souches dans la perspective de développement

d’aliments fonctionnels.

Mots clés: Streptococcus thermophilus, probiotique, Recombinase-based In Vivo Expression Technology, survie,

metabolisme, tractus digestif humain, modèle gastrointestinal TIM

Abstract:

Streptococcus thermophilus is the lactic acid bacterium most commonly used after Lactococcus lactis in the dairy industry

for the production of yogurt and cheese. It is the only streptococcus strain to have the GRAS status (Generally Recognized

As Safe). Despite recent studies showing its ability to survive through the human digestive tract and valuable health effects,

the probiotic status of S. thermophilus remains questioned. Thus, the objectives of this pHD work were (i) to increase

knowledge on the survival of S. thermophilus in human digestive environment, by using the dynamic multi-compartmental

TIM system (TNO gastro-intestinal model) and (ii) to identify the genes from S. thermophilus that are specifically activated

in complex digestive environment using the R-IVET technology (Recombinase-based In Vivo Expression Technology). R-

IVET is based on the excision of a reporter gene and consists of a plasmid vector carrying the promoterless recombinase

cre and a chromosomal cassette composed of a marker gene flanked by loxP recognized by Cre. First, we introduced the R-

IVET technology in S. thermophilus LMD-9. Its functionality was tested and validated in vitro and in the mice digestive

tract. Then, the survival of four S. thermophilus strains was investigated in the TIM system and we showed that 3 of these

strains were more resistant than the other one, very sensitive to gastrointestinal stresses. These results strengthen the idea

that the survival of S. thermophilus is strain-dependent. We also highlighted that the survival of S. thermophilus was

influenced by the food matrix, being higher in fermented compared to liquid milk. Lastly, we constructed a first genomic

R-IVET library, by cloning upstream of cre genomic DNA fragments from LMD-9. This librarywas tested only in gastric

condition (TIM). After optimization of our tool in S. thermophilus (improvement of the method allowing identification of

the activated genes), a second R-IVET library was tested throughout the gastrointestinal system (TIM) and in batch system

including intestinal microbiota. By identifying bacterial genes specifically activated in human digestive conditions, this

work contributes to extend our knowledge on the behavior of S. thermophilus in the human gastrointestinal tract. This

could open up opportunities in determining survival markers for S. thermophilus and better describing its metabolic activity

in the human gut, then facilitating the selection of strains that can be included in functional foods.

Keywords: Streptococcus thermophilus, probiotic, Recombinase-based In Vivo Expression Technology, survival,

metabolic activity, human digestive tract, gastrointestinal TIM model

Remerciements

Je tiens tout d’abord à remercier Mme Françoise Rul et M. Jean-François Cavin d’avoir

accepté d’être rapporteurs de ce travail, pour le temps passé à la lecture du manuscrit et à la

critique de ce travail. Je remercie également M. Christophe Chassard et M. Grégory Jubelin pour

avoir accepté d’évaluer ce travail.

Je tiens à remercier Mme Annie Dary-Mourot, responsable de l’équipe PB2P, et Mme

Monique Alric, responsable de l’équipe EA-CIDAM, pour m’avoir accueillie au sein de leur

équipe.

Je remercie Mme Stéphanie Blanquet-Diot et Mme Annie Dary-Mourot, mes directrices

de thèse, pour la confiance que m’avez accordée en me permettant d’effectuer ce travail, pour

votre soutien tout au long de la thèse et pour votre encadrement. J’ai beaucoup appris à vos côtés

et je vous en remercie.

Je remercie Sylvain Denis pour avoir été présent lors de cette thèse, pour votre aide, pour

vos conseils, m’avoir appris à me servir du TIM et pour tout le reste. Merci également à Sandrine

Chalancon pour avoir été présente et m’avoir fournit une aide indispensable lorsque j’étais à

Clermont-Ferrand et pour la gentillesse que tu as eu à mon égard. Sans vous deux, les manips

TIM ne se seraient pas passées aussi bien.

Je remercie également Emilie Lorson qui a été d’une aide précieuse notamment lors de

cette merveilleuse expérience qu’est le repiquage de milliers de colonies et pour la patience dont

tu as fait preuve lors des centaines de PCR que tu as réalisées. Un grand merci aussi pour ton

amitié et pour ton soutien.

Je remercie également Fleur Awussi avec qui j’ai partagé un bureau, pour avoir partagé

avec moi toutes les émotions liées à nos thèses (joie, rire, colère, déprime,…). Tu as été une

véritable amie et les petits échanges que nous avons eus lors de cette thèse vont me manquer.

Je remercie également Yvonne Roussel pour votre présence au début de ma thèse et pour

vos conseils.

Je remercie également les membres des deux équipes pour leur acceuil et leur soutien (une

petite pensée pour les doctorants qui vont soutenir prochainement).

Enfin, je remercie ma famille. Mes deux frères que j’ai dû rendre sourd avec mes états

d’âme. Et à ma mère qui m’a soutenue dès le début quand j’ai eu l’idée saugrenue de faire une

thèse. J’espère te rendre fière.

i

Table des matières

Liste des figures et tableaux .................................................................................... iv

Abréviations ....................................................................................................................... vi

Avant-propos ....................................................................................................................... 1

Première partie ‒ synthèse bibliographique ‒.................................................. 5

CHAPITRE 1: LA DIGESTION HUMAINE ET SA MODELISATION IN VITRO ................... 7

1. Le tractus gastro-intestinal humain ................................................................................ 9

1.1. Histologie du tube digestif..................................................................................................... 9

1.2. Digestion bucco-œsophagienne ........................................................................................... 11

1.3. Digestion gastrique .............................................................................................................. 12

1.3.1. Anatomie et péristaltisme de l’estomac ..................................................................... 12

1.3.2. Sécrétions gastriques ................................................................................................... 13

1.4. Digestion intestinale ............................................................................................................ 15

1.4.1. Anatomie et péristaltisme de l’intestin grêle ............................................................. 15

1.4.2. Cellules et sécrétions de la muqueuse intestinale ...................................................... 16

1.4.2.1. Entérocytes et absorption des nutriments ......................................................... 17

1.4.2.2. Cellules caliciformes et production de mucus ................................................... 18

1.4.2.3. Cellules de Paneth et sécrétions de peptides antimicrobiens ........................... 18

1.4.2.4. Cellules du système lymphoïde associé à l’intestin ........................................... 19

1.4.3. Sécrétions des glandes annexes et rôle dans la digestion ......................................... 19

1.4.3.1. Le foie, la vésicule biliaire et la sécrétion de bile .............................................. 20

1.4.3.2. Le pancréas et les sucs pancréatiques ................................................................ 20

1.5. Digestion colique .................................................................................................................. 22

1.6. Microbiote digestif ............................................................................................................... 23

2. La digestion artificielle: modèles in vitro de digestion humaine ................................. 26

2.1. Modèles gastriques .............................................................................................................. 26

2.1.1. Statiques ....................................................................................................................... 26

2.1.2. Dynamiques .................................................................................................................. 27

2.2. Modèles gastro-intestinaux ................................................................................................. 29

2.2.1. Mono-compartimentés statiques ................................................................................ 29

ii

2.2.2. Bi-compartimentés dynamiques ................................................................................. 30

2.2.3. Multi-compartimentés dynamiques ........................................................................... 33

2.2.3.1. Simulator of the Human Intestinal Microbial Ecosystem: SHIME ................ 33

2.2.3.2. TNO gastro-Intestinal Model: TIM ................................................................... 35

2.3. Avantages et limites des systèmes de digestion in vitro .................................................... 37

CHAPITRE 2: Streptococcus thermophilus, UN nouveau probiotique? .. 39

3. S. thermophilus, une bactérie lactique ........................................................................... 41

3.1. Généralités sur S. thermophilus .......................................................................................... 41

3.2. Taxonomie et adaptation au lait ......................................................................................... 42

3.3. Voies métaboliques de S. thermophilus .............................................................................. 43

3.3.1. Métabolisme carboné de S. thermophilus .................................................................. 44

3.3.1.1. Transport des sucres à travers la membrane plasmique ................................. 44

3.3.1.2. Métabolisme des sucres ....................................................................................... 45

3.3.1.3. Métabolisme du pyruvate ................................................................................... 47

3.3.1.4. Régulation du métabolisme carboné .................................................................. 47

3.3.1.4.1. Organisation et régulation par GalR du cluster galKTEMlacSZ ................. 47

3.3.1.4.2. Régulation par les protéines CcpA et HPr ..................................................... 48

3.3.2. Métabolisme azoté de S. thermophilus ....................................................................... 50

3.3.2.1. Besoins en acides aminés ..................................................................................... 50

3.3.2.2. Système protéolytique ......................................................................................... 51

3.3.3. Métabolisme de l’oxygène de S. thermophilus ........................................................... 53

3.4. Utilisation de S. thermophilus en industrie laitière ........................................................... 54

3.4.1. Production de yaourt ................................................................................................... 54

3.4.2. Production de fromage ................................................................................................ 55

4. S. thermophilus, vers un nouveau probiotique? ........................................................... 57

Revue: Streptococcus thermophilus: from yogurt starter to a new promising probiotic

candidate? ................................................................................................................................. 59

CHAPITRE 3: MéTHodEs d’éTudE du TRAnsCRIPToME bACTéRIEn dAns un

environnement complexe ............................................................................................ 97

5. Méthodes basées sur l’hybridation ................................................................................ 99

5.1. Technologie des puces à ADN ........................................................................................... 100

5.2. Technique SCOTS ............................................................................................................. 101

6. Méthodes basées sur les constructions génétiques ..................................................... 103

iii

6.1. Méthode STM .................................................................................................................... 103

6.2. Méthode IVET, R-IVET et DFI ....................................................................................... 105

6.2.1. Technologie IVET ...................................................................................................... 105

6.2.2. Méthode DFI .............................................................................................................. 106

6.2.3. Technologie R-IVET ................................................................................................. 107

Seconde partie ‒ travaux expérimentaux ‒ ...................................................... 109

Chapitre1: développement de la recombinase-based in vivo expression

technology (r-ivet) chez Streptococcus thermophilus ........................... 111

Publication 1: Development of the recombinase-based in vivo expression technology in

Streptococcus thermophilus and validation using the lactose operon promoter .................... 113

Commentaire de la publication 1 ........................................................................... 127

CHAPITRE 2: éTudE dE lA suRvIE ET dE l’ACTIvITé MéTAbolIquE dE

Streptococcus thermophilus en conditions gastriques simulées ...... 131

Publication 2: Use of the dynamic gastro-intestinal model TIM to explore the survival of the

yogurt bacterium Streptococcus thermophilus and the metabolic activities induced in the

simulated human gut .............................................................................................................. 133


CHAPITRE 3: oPTIMIsATIon dE l’ouTIl R-IVET et validation en condtions

digestive simulées ........................................................................................................ 153

Publication 3: Use of the Technology R-IVET to identify in Streptococcus thermophilus

genes specifically expressed under simulated human digestion conditions and in presence of

intestinal microbiota ............................................................................................................... 155


Troisième partie ‒Conclusions et perspectives‒ .......................................... 193

Références bibliographiques ................................................................................ 205

iv

Liste des figures et tableaux

Liste des figures:

Figure 1: Organisation générale du système digestif humain et des glandes annexes .......................... 10

Figure 2: Structure fondamentale du tube digestif ................................................................................ 11

Figure 3: Anatomie de l’estomac .......................................................................................................... 13

Figure 4: Structure de la muqueuse de l’estomac .................................................................................. 14

Figure 5: Représentation de la structure de l’épithélium intestinal ....................................................... 16

Figure 6: Représentation schématique de la structure de l’épithélium de l’intestin grêle ..................... 17

Figure 7: Organes annexes du système digestif .................................................................................... 19

Figure 8: Anatomie du gros intestin ...................................................................................................... 22

Figure 9: Espèces microbiennes dominantes dans les différentes régions du système digestif humain 24

Figure 10: Représentation schématique de la cellule digestive de l’Université de Leeds ..................... 27

Figure 11: Le DGM (Dynamic Gastric Model) ..................................................................................... 28

Figure 12: HGS (Human Gastric Simulator) ......................................................................................... 28

Figure 13: TIM-agc (TNO gastro-Intestinal Model advanced gastric compartment) ........................... 29

Figure 14: Modèle bi-compartimenté dynamique de Mainville ............................................................ 30

Figure 15: Système bi-compartimenté dynamique de Levi et Lesmes .................................................. 31

Figure 16: Système DIDGI, système dynamique de digestion gastro-intestinale ................................. 32

Figure 17: TinyTIM (TNO gastro-intestinal model) ............................................................................. 32

Figure 18: Représentation du schématique SHIME .............................................................................. 33

Figure 19: Représentation schématique du M-SHIME ......................................................................... 34

Figure 20: Représentation schématique du TIM-1 ................................................................................ 35

Figure 21: Photographie de Streptococcus thermophilus ...................................................................... 41

Figure 22: Transport et métabolisme carboné chez S. thermophilus ..................................................... 46

Figure 23: Organisation du cluster gal-lac chez S. thermophilus .......................................................... 48

Figure 24: Régulation du transport du lactose chez S. thermophilus .................................................... 49

Figure 25: Système protéolytique de S. thermophilus ........................................................................... 52

Figure 26: Représentation du principe de la puce à ADN ................................................................... 100

Figure 27: Représentation de la technique SCOTS (Selective capture of transcribed sequence) ....... 102

Figure 28: Représentation de la technique STM (Signature tagged mutagenesis) .............................. 104

Figure 29: Représentation du principe de la technique IVET ............................................................. 106

Figure 30: Principe de la technique R-IVET à sélection négative....................................................... 128

Figure-1: Construction of the S. thermophilus mutant STUL5003. .................................................... 165

Figure 31: Principe de fonctionnement de l’outil R-IVET à sélection positive .................................. 186

v

Liste des Tableaux:

Table 1: Evolutionary stages of probiotic definitions (adapted from Vasiljevic and Shah, 2008) ........ 64

Table 2: Main bacterial and yeast probiotics and their health effects, as observed in animal models or

during human trials ................................................................................................................................ 66

Table 3: Overview of S. thermophilus survival studies in the digestive environment: human trials, in

vivo assays in animal models and in vitro experiments ......................................................................... 70

Table 4: Characterization of some bacteriocins produced by S. thermophilus ...................................... 80

Table-1: Bacterial strains and plasmid used in the present study ........................................................ 161

Table-2: Oligonucleotides used in the present study with their relevant characteristics ..................... 162

Table-3: Parameters of the TIM model when simulating the digestion of milk by a healthy adult. ... 166

Table-4: Survival rates and number of R-IVET clones analyzed in each compartment of the TIM

system and in the batch cultures .......................................................................................................... 172

Table-5: S. thermophilus LMD-9 loci identified using R-IVET technology during the passage through

the TIM model ..................................................................................................................................... 176

Table-6: S. thermophilus LMD-9 loci identified using R-IVET batch cultures with human intestinal

microbiota ............................................................................................................................................ 177

vi

Abréviations

AAD Antibiotic-associated diarrhea

ABC ATP-binding cassette transporters

AckA Acétate kinase

AcoABCL Complexe acétoïne déshydrogénase

Ac-P Acétyl-phosphate

ADN Acide désoxyribonucléique

ADNc Acide désoxyribonucléique complémentaire

ADP Adénosine diphosphate

AldB α-acétolactate déshydrogénase

Als α-acétolactate synthase

ARCOL Artificial colon

ARN pol Acide ribonucléique polymerase

ARN Acide ribonucléique

ATP Adénosine triphosphate

Asp Acid-shock protein

B. Bifidobacterium

C. Clostridium

CcpA Catabolite control protein A

Cellules M Microfold cells

CFU Colony forming unit

CoA Coenzyme A

DFI Differential fluorescence induction

DGM Dynamic gastric model

DiDGI Système dynamique de digestion gastro-intestinale

DVC-FISH Direct viable count - fluorescent in situ hybridization

E. Enterococus

EA CIDAM Equipe d’accueil « Conception, Ingénierie et Développement de

l’Aliment et du Médicament »

EFSA European food safety authority

EHEC Escherichia coli entérohémorragiques

EI Enzyme I

EIEC Enteroinvasive Escherichia coli

EPS Exopolysaccharide

EQPS European presumption of safety list of food bacteria

erc élément de répression catabolique

ETEC Escherichia coli entérotoxinogènes

FACS Fluorescence activated cell sorting

FAO Food and agriculture organization

FBP Fructose-1,6-biphosphate

vii

FDA Food and drug administration

Fru-6P Fructose-6-phosphate

FruB Fructo-1-phosphate kinase

GalE UDP glucose 4-epimerase

GalK Galactokinase

GalM Galactose maturotase

GalT Galactose 1-phosphate uridylyltranferase

GF Germ-free

GFP Green fluorescent protein

GIT Gastrointestinal tract

GlcK Glucose kinase

Glu-6P Glucose-6-phosphate

Gpi Phosphoglucose isomérase

GRAS Generally recognized as safe

HCl Acide chlorhydrique

HGS Human gastric simulator

His Histidine

HMA Human-associated microbiota

HPr Histidine phophocarrier protein

Hsp Heat-shock protein

IL Interleukin

IVET In vivo expression technology

J.G. Jus gastrique

J.P. Jus pancréatique

L. Lactococcus

LAB Lactic acid bacteria

LacS Transporteur du lactose

LacZ β-galactosidase

Lb. Lactobacillus

Ldh L-lactate déshydrogénase

MLST Multilocus sequence typing

M-SHIME Mucosal-simulator of the human intestinal microbial ecosystem

NAD+ Nicotinamide adénine dinucléotide sous forme oxydée

NADH Nicotinamide adénine dinucléotide sous forme réduite

NaHCO3 Bicarbonate de sodium

P Phosphate

PB2P Protéolyse et biofonctionnalités des protéines et des peptides

PEP Phospho-énolpyruvate

Pfk Phosphofructokinase

Pfl Pyruvate formate lyase

PflA Pyruvate formate lyase activation enzyme

PgmA Phosphoglucomutase

Pta Phosphotransacétylase

PTS Sugar phosphotransferase systems

viii

R-IVET Recombinase-based in vivo expression technology

ROS Reactive oxygen species

S. Streptococcus

SCOTS Selective capture of transcribed sequences

ScrB Saccharose-6-phosphate hydrolase

ScrK Fructokinase

Ser Sérine

SHIME Simulator of the human intestinal microbial ecosystem

SOD Superoxyde dismutase

SpecRKan

S Phénotype spectinomycine résistant et kanamycine sensible

SpecSKan

R Phénotype spectinomycine sensible et kanamycine résistant

STM Signature-tagged mutagenesis

TGI Tractus gastro-intestinal

THG Transfert horizontal de gènes

TIM-1 (TIM) TNO gastro-intestinal model

TIM-agc TNO gastrointestinal model advanced gastric compartment

UDP Uridine diphosphate

UDP-Gal UDP-galactose

UDP-Glu UDP glucose

UFC Unité formant colonie

URAFPA Unité de Recherche Animal et Fonctionnalité des Produits Animaux

V. Vibrio

WHO World health organization

1

Avant-propos

Au début du 20ème

siècle, Elie Metchnikoff a proposé l’existence d’un le lien entre la

santé de l’homme et la consommation de «microbes utiles» (Metchnikoff, 1907). Depuis, le

concept de probiotique, défini comme « des micro-organismes vivants qui, lorsqu’ils sont

administrés en quantité adéquate produisent un effet bénéfique pour la santé de l’hôte »

(FAO/WHO, 2002), a été établi.

De plus en plus d’études sont réalisées sur les probiotiques et leurs effets bénéfiques

sur la santé de l’homme. Le commerce de ces bactéries s’est fortement accru depuis plus de

10 ans et de nombreuses recherches sur les effets probiotiques de bactéries utilisées en

alimentaire se sont développées. C’est ainsi que la recherche alimentaire s’oriente vers le

concept de nutrition « positive » et le développement d’aliments fonctionnels qui

permettraient le traitement préventif ou curatif de certaines maladies telles que le syndrome

du colon irritable, les diarrhées aigües ou encore, agiraient comme immunostimulants.

Cependant, depuis l’adoption de la réglementation européenne sur les allégations

nutritionnelles et santé (n°1924/2006, 1er

juillet 2007), les industriels doivent apporter des

preuves scientifiques étayées pour avoir l’autorisation d’apposer une allégation santé sur le

packaging d’un nouveau produit.

Les bactéries probiotiques sont souvent administrées sous la forme de gélules

(compléments alimentaires) mais comme évoqué précédemment, leur administration via leur

inclusion dans un aliment est de plus en plus explorée. Il s’agit souvent de matrices laitières

telles que les laits fermentés ou les yaourts. Ainsi, le yaourt, résultat de la fermentation du lait

par Streptococcus (S.) thermophilus et Lactobacillus (Lb.) delbrueckii subsp. bulgaricus, a été

accrédité par l’EFSA (European Food Safety Authority) en 2010 d’une allégation santé

portant sur l’amélioration de la digestibilité du lactose pour les personnes intolérantes.

S. thermophilus est l’une des bactéries les plus utilisées en industrie laitière, après

Lactococcus (L.) lactis. C’est une bactérie lactique qui bénéficie d’une image très positive. En

effet, il est reconnu comme GRAS (Generally Recognized As Safe) par la FDA (Food and

Drug Administration) et qui appartient à la liste EQPS (European Presumption of Safety list

of food bacteria). Pourtant, malgré son utilisation massive, sa consommation importante par

Avant-Propos

2

l’homme et son image positive, les propriétés probiotiques de S. thermophilus ont été à ce jour

relativement peu explorées, certainement en raison de travaux soutenant son incapacité à

survivre lors du transit digestif (Ballesta et al., 2008; del Campo et al., 2005; Pedrosa et al.,

1995). Dans le cadre du développement de produits nutraceutiques ou d’aliments fonctionnels

à partir de S. thermophilus, il est important de caractériser les effets probiotiques potentiels de

S. thermophilus, et par conséquent il est nécessaire de mieux connaître l’état physiologique de

cette bactérie dans le tractus digestif humain.

Les travaux de recherche présentés dans ce manuscrit ont été effectués au sein de

l’Equipe d’Accueil « Conception, Ingénierie et Développement de l’Aliment et du

Médicament » (EA-CIDAM 4678), de l’Université d’Auvergne, dirigée par le Professeur

Monique Alric et l’équipe PB2P (Protéolyse et Biofonctionnalités des Protéines et des

Peptides) du laboratoire URAFPA, de l’Université de Lorraine, dirigée par le Professeur

Annie Dary-Mourot. Ces travaux ont été réalisés sous la direction du Docteur Stéphanie

Blanquet-Diot (EA-CIDAM) et du Professeur Annie Dary-Mourot (PB2P, URAFPA).

Le laboratoire EA-CIDAM possède une expertise reconnue dans le domaine de la

digestion artificielle. Cette équipe a mis en place une plate-forme technologique associant des

modèles in vitro de mastication, digestion, fermentation et absorption à des technologies de

formulation et des outils moléculaires de génomique et post-génomique. L’objectif de cette

équipe est de développer des produits ou des concepts innovants dans le domaine de la

Nutrition et Santé Humaine ou Animale. Actuellement, leur recherche s’oriente autour des

conditions physiopathologiques dans l’environnement digestif humain associées (i) au

vieillissement, (ii) à la présence de polluants d’origine alimentaire et (iii) à la présence de

bactéries pathogènes comme les Escherichia coli entérohémorragiques (EHEC) ou encore

enterotoxinogènes (ETEC). Pour chacune de ces conditions, l’équipe évalue l’intérêt de

stratégies basées sur l’utilisation de souches probiotiques.

L’équipe PB2B de l’URAFPA s’intéresse aux produits laitiers en tant que vecteurs

d’ingrédients qui pourraient en modulant certaines fonctions physiologiques du

consommateur maintenir ou renforcer sa santé, et ainsi prévenir certaines pathologies.

L’équipe a développé une expertise sur le lait et la production de peptide bioactifs à partir des

protéines du lait. Elle s’intéresse également à S. thermophilus et cherche (i) à caractériser son

système protéolytique afin de produire des peptides bioactifs à partir des protéines du lait, (ii)

Avant-Propos

3

à évaluer son potentiel probiotique et (iii) à étudier son comportement dans l’environnement

digestif humain.

Ainsi, les objectifs de cette thèse ont été, dans un premier temps, d’évaluer la capacité

de survie de plusieurs souches de S. thermophilus en conditions digestives humaines simulées

dans le modèle gastro-intestinal TIM (TNO gastro-intestinal model) de l’EA-CIDAM et

l’influence du mode d’administration des souches. Dans un second temps, un outil basé sur la

technologie R-IVET (Recombinase-based In Vivo Expression Technology) a été développé

chez S. thermophilus afin d’identifier les gènes qui sont exprimés dans un environnement

complexe comme le tractus digestif humain. Puis, nous avons cherché à optimiser l’outil R-

IVET par construction d’un système de sélection positif. Enfin, nous avons étudié le

comportement de S. thermophilus dans l’environnement digestif en recherchant des gènes

activés en conditions digestives humaines simulées en combinant l’outil R-IVET au modèle

gastro-intestinal TIM et à des systèmes batch simples reproduisant l’environnement colique

humain.

La première partie de ce manuscrit présente le contexte scientifique général. Cette

synthèse bibliographique s’articule autour de trois chapitres. Un premier chapitre introductif

décrit la physiologie générale du tractus digestif humain, les conditions rencontrées dans la

lumière gastro-intestinale chez l’homme ainsi que les principaux modèles in vitro permettant

de modéliser l’environnement digestif humain. Un second chapitre est consacré à

S. thermophilus et récapitule les données disponibles sur sa survie dans l’environnement

digestif ainsi que ses propriétés probiotiques. Ce chapitre est rédigé sous la forme d’une revue

scientifique que nous souhaiterions soumettre à Journal of Functional Foods. Enfin, un dernier

chapitre décrit les technologies génétiques utilisées pour identifier/étudier l'expression de

gènes qui sont importants pour la survie et la physiologie des bactéries dans des

environnements complexes tels que le tractus digestif humain. Les résultats expérimentaux

sont exposés sous la forme de trois publications (deux parues et une en préparation) puis

commentés dans la seconde partie de ce manuscrit. Enfin, dans la partie discussion générale et

conclusion, l’ensemble des résultats de cette thèse sera discuté et des perspectives concernant

l’ensemble de ce travail proposées.

5

Première partie ‒ synthèse bibliographique ‒

Première PARTIE

— Synthèse bibliographique —

7

CHAPITRE 1: LA DIGESTION HUMAINE ET SA MODELISATION IN VITRO

Chapitre 1

La digestion humaine et sa modélisation

in vitro

SOMMAIRE

1. Le tractus gastro-intestinal humain ................................................................................ 9

1.1. Histologie du tube digestif....................................................................................................... 9

1.2. Digestion bucco-œsophagienne ............................................................................................. 11

1.3. Digestion gastrique ................................................................................................................ 12

1.4. Digestion intestinale .............................................................................................................. 15

1.5. Digestion colique ................................................................................................................... 22

1.6. Microbiote digestif ................................................................................................................ 23

2. La digestion artificielle: modèles in vitro de digestion humaine ................................. 26

2.1. Modèles gastriques ................................................................................................................ 26

2.2. Modèles gastro-intestinaux .................................................................................................... 29

2.3. Avantages et limites des systèmes de digestion in vitro ........................................................ 37

Chapitre 1: La digestion humaine et sa modélisation in vitro

9

CHAPITRE 1: LA DIGESTION HUMAINE ET SA MODELISATION

IN VITRO

La digestion humaine est définie par un ensemble d’actions mécaniques, chimiques et

fermentaires liés au fonctionnement de l’appareil digestif. Cette succession d’étapes, où

chaque partie du tractus digestif à un rôle spécifique, permet la transformation des aliments en

nutriments. L’appareil digestif assure le transfert des nutriments, de l’eau et des électrolytes

apportés par l’alimentation vers l’organisme. Ce chapitre présente les paramètres essentiels de

la digestion ainsi que les différents modèles in vitro développés pour reproduire la digestion

gastro-intestinale humaine.

1. Le tractus gastro-intestinal humain

L’appareil digestif est constitué de la bouche, du pharynx, de l’œsophage, de

l’estomac, de l’intestin grêle (duodénum, jéjunum et l’iléum), du gros intestin (caecum,

appendice, côlon ascendant, côlon transverse, côlon descendant, côlon sigmoïde et rectum) et

de l’anus. Associés au tube digestif, les organes digestifs sont les glandes salivaires, le foie, la

vésicule biliaire et le pancréas (Figure 1) (Sherwood, 2015).

1.1. Histologie du tube digestif

De l’œsophage à l’anus, la paroi du système digestif est constituée de quatre couches

principales, les tuniques: la séreuse, la musculeuse, la sous-muqueuse et la muqueuse de la

couche la plus externe à la plus interne. Selon le segment du tractus digestif considéré, les

tuniques sont constituées d’un tissu prépondérant avec des épaisseurs différentes (Figure 2).

Formant le péritoine viscéral, la séreuse est la tunique la plus externe du tube digestif

et a un rôle essentiellement protecteur. Elle est composée de tissu conjonctif lâche aréolaire

recouvert d’une couche de cellules épithéliales squameuses, le mésothélium. Néanmoins

l’œsophage qui est situé dans la cavité thoracique, ne possède pas de séreuse, cette tunique est

remplacée par une enveloppe fibreuse ordinaire appelée adventice.


10

Figure 1: Organisation générale du système digestif humain et des glandes annexes Le système digestif humain est composé de la cavité buccale, du pharynx, de l’œsophage, de l’estomac

(proximal [1] et distal [2]), de l’intestin grêle (duodénum [3], jéjunum [5] et iléum [6]), du gros

intestin (côlon ascendant [7], côlon transverse [8], côlon descendant [9], côlon sigmoïde [10]), du

rectum et de l’anus. Des organes et glandes annexes sont également associés à ce système: les trois

principales glandes salivaires (parotides, sublinguales et submandibulaires), le pancréas, le foie, la

vésicule biliaire et l’appendice. [4] Valvule iléocæcale. (Modifié d’après Sherwood, 2015).

La musculeuse est composée de deux couches de cellules musculaires lisses: une

couche circulaire interne et une couche longitudinale externe. Elles sont contrôlées par un

système nerveux autonome grâce à des neurones entériques présent entre les deux couches de

fibres musculaires. Le péristaltisme et le brassage du bol alimentaire (ou chyme) résultent de

l’activité conjointe des deux couches musculaires. Au niveau des sphincters, la musculeuse

est plus épaisse et contrôle le passage du chyme d’un organe à un autre.

La sous-muqueuse est constituée d’un tissu conjonctif alvéolaire épais responsanble

de l’elasticité du tube digestif. Ce sont les fibres élastiques abondantes de cette tunique qui

permettent à l’estomac de revenir à sa forme initiale après un repas copieux. Cette tunique

présente des neurofibres et est riche en vaisseaux sanguins et lymphatiques qui desservent les

tissus environnants.

Œsophage


11

La muqueuse est la tunique la plus interne du tractus. L’épithélium qui la constitue est

directement en contact avec la lumière du tube digestif. Cette couche remplit différentes

fonctions: (i) la sécrétion d’enzymes digestives et d’hormones, (ii) l’absorption des produits

de digestion et leur transfert dans le sang et (iii) elle forme une barrière protectrice. La

muqueuse est une barrière (i) physique: cohésion des cellules épithéliales, (ii) chimique:

production de mucus et de sécrétions défensives et protectrices et (iii) immunitaire:

interaction entre les cellules épithéliales et le système lymphoïde associé au tube digestif

(Marieb et Hoehn, 2015).

Figure 2: Structure fondamentale du tube digestif La paroi du tube digestif est composée de quatre couches principales: la muqueuse, la sous-muqueuse,

la musculeuse et la séreuse (de la couche la plus interne à la plus externe) (Marieb et Hoehn, 2015).

1.2. Digestion bucco-œsophagienne

Dans la cavité orale débute les premières étapes de la digestion: la mastication et la

sécrétion de salive. Par l’action des dents, des joues et de la langue, la mastication prépare les

aliments en réduisant la taille des particules et forme le bol alimentaire favorisant l’action des

enzymes digestives intestinales. La salive, sécrétée par les trois paires de glandes salivaires:

parotides, submandibulaires et sublinguales, est constituée essentiellement d’eau (95 % à

99,5 %), d’électrolytes, de protéines tel que des enzymes ou des immunoglobulines, de l’urée


12

et de l’ammoniaque (de Almeida et al., 2008). La salive a pour rôle de favoriser la formation

du bol alimentaire lors de la mastication et la déglutition ainsi que d’hydrolyser des

polysaccharides en dextrines grâce à l’activité de l’amylase salivaire qui se poursuit dans

l’estomac jusqu’à son inhibition par l’acidité gastrique (Dawes et al., 2015). Lors de la

déglutition, un acte reflexe, le bol alimentaire est poussé à l’arrière de la cavité buccale par

l’action de la langue, dans le pharynx, puis il est entrainé jusqu’à l’estomac par des

contractions péristaltiques de l’œsophage qui sécrète du mucus afin de faciliter cette

progression (Sherwood, 2015).

1.3. Digestion gastrique

1.3.1. Anatomie et péristaltisme de l’estomac

L’estomac est une poche de 15 à 25 cm de long en forme de « J » (Figure 1). A jeun,

le pH gastrique à une valeur médiane de 1,55. Lors d’un repas, le pH gastrique augmente suite

à la présence des aliments pour atteindre une valeur comprise entre 5 et 6 lors des premières

minutes post-ingestion, puis dans les deux heures post-ingestion, le pH gastrique diminue

pour atteindre des valeurs inférieures à 2 (Malagelada et al., 1979; Van Wey et al., 2014). A

jeun, son volume est d’environ 50 mL et peut augmenter jusqu’à 1,5 à 2 L (même jusqu’à 4

L) en phase postprandiale.

L’estomac a un rôle de stockage et de brassage des aliments. Le bol alimentaire arrive

dans l’estomac en passant par le cardia (Figure 3) qui reste fermé après le passage des

aliments pour réduire le risque de reflux œsophagien. La partie proximale de l’estomac,

constituée du fundus et du corps (Figure 3), joue un rôle de réservoir des aliments déglutis.

L’essentiel des sécrétions digestives est sécrété dans cette région. La partie suivante

correspond à l’estomac distal ou antre (Figure 3) qui assure la fragmentation des solides et

leur homogénéisation avec les sécrétions gastriques et régule la vidange du produit de la

digestion dans le duodénum. A l’extrémité de l’estomac se trouve le pylore qui ferme

l’estomac.

En présence d’aliments, les fibres musculaires circulaires internes de la paroi gastrique

se contractent pour former un anneau qui se propage du cardia au pylore à la fréquence de

trois contractions par minute. Ces ondes péristaltiques sont responsables du mélange des

aliments avec les sécrétions digestives pour obtenir le chyme. Chaque contraction pousse le

chyme vers le pylore qui joue un rôle de filtre et laisse passer une petite quantité de chyme (5

à 30 mL), composé de liquide et de particules de taille inférieure à 1 ou 2 mm, vers le


13

duodénum. Le reste du chyme reflue vers le centre de l’estomac afin d’être d’avantage

dégradé. Lorsqu’une onde péristaltique atteint le pylore, celui-ci se referme (Khan et al.,

2009; Marieb et Hoehn, 2015; Sherwood, 2015). Le temps de transit gastrique médian chez

l’Homme, pour un repas standard (1500 kJ) a été estimé à environ 56 min (Worsöe et al.,

2011).

Figure 3: Anatomie de l’estomac L’estomac débute au niveau du cardia et se termine au pylore. Il est constitué de trois parties: le fundus

et le corps formant la partie proximale et ayant un rôle de réservoir alimentaire et de sécrétion des sucs

digestifs et l’antre ou estomac distal ayant un rôle de fragmentation du bol alimentaire (Marieb et

Hoehn, 2015).

De nombreux facteurs peuvent influencer la vitesse d’évacuation du chyme, les

principaux étant le volume et la fluidité du contenu gastrique. La composition d’un repas est

aussi un autre facteur qui régule directement la vidange gastrique. Par exemple, un bol

alimentaire riche en lipides inhibe fortement la vidange gastrique. Enfin, des facteurs extra-

digestifs peuvent également influencer la vidange gastrique tels que les émotions (tristesse,

colère, peur) ou encore la douleur. Ces effets dépendent essentiellement des individus et sont

donc imprévisibles (stimulation ou inhibition de la vidange gastrique) (Sherwood, 2015).

1.3.2. Sécrétions gastriques

La paroi gastrique est constituée d’invaginations, les cryptes de l’estomac, qui sont

constituées des cellules glandulaires sécrétrices responsables de la production des sucs

gastriques: les cellules à mucus, les cellules pariétales, les cellules principales et les cellules


14

endo/paracrines (Figure 4). La sécrétion gastrique est stimulée par le système

parasympathique, à la vue, l’odeur et le goût des aliments.

Les cellules à mucus du collet sécrètent du mucus alcalin et du bicarbonate de sodium

(NaHCO3) afin de protéger la muqueuse gastrique contre les agressions mécaniques, l’auto-

digestion et l’acidité gastrique. Les cellules pariétales, ou bordantes, sécrètent de l’acide

chlorhydrique (HCl), contribuant à l’acidification du pH gastrique et de la dénaturation des

protéines (ruptures des ponts disulfures et des liaisons hydrogènes), et le facteur intrinsèque,

une glycoprotéine nécessaire à l’absorption de la vitamine B12 au niveau intestinal. Les

cellules principales, ou peptiques, sécrètent le pepsinogène qui est le précurseur d’une

endopeptidase, la pepsine, activée par hydrolyse acide et la lipase gastrique impliquée dans la

digestion des lipides. Enfin, les cellules endo/paracrines (des cellules enterochromaffine-like

(ECL), G et D) sécrètent des hormones telles que la gastrine et l’histamine stimulant la

production d’HCl par les cellules pariétales, la sérotonine provoquant la contraction des

couches musculaires lisses entourant l’estomac, la somatostatine régulant la sécrétion des

hormones et la ghréline stimulant l’appétit (Marieb et Hoehn, 2015; Sherwood, 2015).

Figure 4: Structure de la muqueuse de l’estomac (a) Coupe longitudinale de la paroi de l’estomac qui est constituée de la séreuse (enveloppe externe de

l’estomac), de la musculeuse (trois couches de fibres musculaires), de la sous-muqueuse (tissu

conjonctif) et la muqueuse (paroi interne de l’estomac contenant les cryptes et les glandes gastriques).

(b) Schéma des cryptes et des glandes gastriques. (c) Emplacement des cellules composant une glande

gastrique. Quatre types de cellules composent les cryptes de l’estomac: les cellules à mucus

(production de mucus), les cellules pariétales (production de acide chlorhydrique et du facteur

intrinsèque), les cellules endo/paracrines (production de la gastrine, l’histamine, la somatostatine et la

ghréline), et les cellules principales (production de pepsinogène et de lipase) (Marieb et Hoehn, 2015).


15

1.4. Digestion intestinale

La quasi-totalité de la digestion du chyme et de l’absorption a lieu dans l’intestin

grêle. L’essentiel du processus de digestion s’effectue par les sécrétions de la muqueuse

intestinale et par les sécrétions des glandes annexes: le pancréas, le foie et la vésicule biliaire

qui lui sont associés (Figure 1).

1.4.1. Anatomie et péristaltisme de l’intestin grêle

L’intestin grêle est la partie la plus longue du système digestif, il mesure 6 à 7 m

(maintenue à 2 à 4 m avec le tonus musculaire). Il s’étend du pylore à la valvule iléocæcale et

est divisé en trois partis: le duodénum (20 cm), le jéjunum (2,5 m) et l’iléum (3,5) (Figure 1).

Chez l’Homme, après une période de jeune, les pH médians de ces trois sections sont

respectivement 6,4; 7,1 et 7,4 (Fallingborg et al., 1998). A jeun, son volume est de 100 mL et

peut atteindre un volume de 500 mL en phase postprandiale. Le temps de transit médian dans

l’intestin grêle de 4 h environ (Worsöe et al., 2011).

Le duodénum est incurvé autour de la tête du pancréas et reçoit les sécrétions

digestives des glandes annexes au système digestif (foie, vésicule biliaire et pancréas). Le

conduit cholédoque et le conduit pancréatique, apportant respectivement la bile produit par le

foie et le suc pancréatique, se rejoignent au niveau de l’ampoule hépato-pancréatique,

également nommée ampoule de Vater. Cette ampoule déverse son contenu dans le duodénum

par la papille duodénale majeure. Les apports en bile et suc pancréatique dans le duodénum

sont régulés par le muscle sphincter de l’ampoule hépato-pancréatique. En ce qui concerne le

jéjunum et l’iléon ne se distinguent que par leur couleur, rose pâle et rouge, respectivement.

La grande capacité d’absorption de l’intestin grêle est liée à une adaptation structurelle

de la muqueuse et de la sous-muqueuse, qui augmente considérablement la surface totale

d’échange, jusqu’à atteindre 200 m2. La muqueuse et la sous-muqueuse forment des plis

circulaires (Figure 5a) atteignant des hauteurs de 1 cm et donnant un mouvement

tourbillonnant au chyme favorisant son mélange avec les sécrétions intestinales. Ce

phénomène permet d’augmenter l’absorption des nutriments en ralentissant la progression du

chyme. La surface d’absorption est augmentée par la présence d’invaginations et de replis sur

les plis circulaires, ce sont les villosités (Figure 5b). Ces villosités, d’une hauteur de 1 mm,

sont plus nombreuses et plus larges au niveau du duodénum, elles deviennent plus étroites et

plus courtes au fur et à mesure de la progression vers l’extrémité iléale. L’épithélium

intestinal est constitué d’entérocytes dont la face apicale du côté de la lumière intestinale


16

présente de très nombreuses évaginations, les microvillosités, qui forment une bordure en

brosse (Marieb et Hoehn, 2015; Sherwood, 2015).

Figure 5: Représentation de la structure de l’épithélium intestinal (a) Structure de la muqueuse de l’intestin grêle formant des plis circulaires. (b) Structure d’une

villosité avec l’agrandissement d’un entérocyte constituant l’épithélium intestinal (Sherwood, 2015).

Lors de la digestion du chyme, le péristaltisme qui parcourt l’intestin grêle est

différent de celui de l’estomac. Les cellules musculaires circulaires, constituant la paroi

intestinale, se contractent en ondes de segmentation (succession de contractions et de

relaxations stationnaires) qui induisent la fragmentation du contenu intestinal. Ces ondes

mélangent le chyme aux sécrétions intestinales et induisent une progression du chyme

suffisamment lente pour être optimale (Khan et al., 2009; Sherwood, 2015).

1.4.2. Cellules et sécrétions de la muqueuse intestinale

La muqueuse est la couche la plus complexe de la paroi intestinale. Elle est composée

d’un épithélium complexe qui repose sur la sous-muqueuse intestinale, riche en vaisseaux

sanguins et lymphatiques. La muqueuse et sous-muqueuse intestinales ont une structure riche

en replis, les villosités, et en invagination, les cryptes de Lieberkühn (Figure 6). Les cryptes

de Lieberkühn ont un rôle dans l’homéostasie cellulaire et dans le renouvellement des cellules

de l’épithélium de l’intestin grêle (présence de cellules souches au fond des cryptes).


17

Figure 6: Représentation schématique de la structure de l’épithélium de l’intestin grêle

Quatre type de cellules composent l’épithélium, issus de la différentiation des cellules souches situées

au fond des cryptes intestinales: (i) les entérocytes (absorption de nutriments), (ii) les cellules de

Paneth (sécrétion de peptides antimicrobien), (iii) les cellules entéroendocrines (sécrétion d’hormones)

et (iv) les cellules caliciformes (sécrétion de mucus). L’épithélium de l’intestin grêle possède des

régions spécialisées, les follicules composés des cellules M (initiation de la réponse immunitaire) à la

surface des plaques de Peyer (Modifié d’après Peterson et Artis, 2014).

L’épithélium intestinal, monostratifié, se compose principalement de quatre

populations cellulaires dérivant de cellules souches pluripotentes et dont les proportions

diffèrent selon les segments concernés: (i) les entérocytes (absorption de nutriments), (ii) les

cellules caliciformes (sécrétion de mucus), (iii) les cellules de Paneth (sécrétion de peptides

antimicrobiens) et (iv) les cellules entéroendocrines (sécrétion d’hormones). Les cellules sont

liées entre elles par des jonctions serrées et des desmosomes formant ainsi une barrière

physique étanche. Des cellules immunitaires, les cellules M (microfold cells), sont retrouvées

aux niveaux de l’iléon (Du et al., 2015; Peterson et Artis, 2014; Roth et al., 2012).

1.4.2.1. Entérocytes et absorption des nutriments

Dans la lumière de l’intestin, la digestion des lipides est complète alors que celle des

glucides et des protéines est incomplète. La digestion de ces derniers est achevée au niveau de

la bordure des cellules épithéliales intestinales. Les entérocytes (Figure 6) qui constituent

environ 80 % des cellules de l’épithélium intestinal, ont avant tout un rôle d’absorption mais

aussi un rôle digestif. Des enzymes hydrolytiques, synthétisées directement par la cellule ou

absorbées à partir du chyme et des sucs pancréatiques, sont ancrées à la membrane cellulaire


18

des entérocytes (au niveau du pôle apical). Ces enzymes hydrolytiques sont: les

entéropeptidases qui activent le trypsinogène, une pro-enzyme pancréatique sécrétée dans le

duodénum, en trypsine, les disaccharidases qui hydrolysent les disaccharides en sucres

simples, et les aminopeptidases qui hydrolysent les extrémités aminées des polypeptides. Les

protides et des glucides alimentaires seront alors absorbés par les entérocytes et apportés

jusqu’aux capillaires sanguins présent sous l’épithélium intestinal.

Les produits de digestion peuvent être absorbés par trois mécanismes distincts: (i) la

diffusion passive: passage des nutriments selon un gradient de concentration à travers la

membrane des entérocytes, (ii) la diffusion facilitée: passage des nutriments assuré par des

transporteurs membranaires selon un gradient de concentration et (iii) le transport actif:

passage des nutriments contre le gradient de concentration qui utilise des transporteurs

membranaires et de l’énergie ou encore un co-transport avec d’autres molécules.

1.4.2.2. Cellules caliciformes et production de mucus

Les cellules caliciformes sont présentes entre les entérocytes au niveau des villosités et

des cryptes. Ces cellules produisent en continu du mucus, une sécrétion acqueuse de 2 % de

mucine (Figure 6). Une couche de mucus recouvre l’intestin grêle et concentre les peptides

antimicrobiens produits par les cellules de Paneth et les Immunoglobulines A. Cette couche

de mucus constitue une barrière physique étanche aux microorganismes et aux toxines qu’ils

produisent et permet leur maintien à distance de l’épithélium (Peterson et Artis, 2014).

1.4.2.3. Cellules de Paneth et sécrétions de peptides antimicrobiens

Les cellules de Paneth sont présentes uniquement au fond des cryptes intestinales

(Figure 6). Elles jouent un rôle important dans la sécrétion de peptides antimicrobiens, bien

que tous les types cellulaires de l’épithélium intestinal participent à ce processus. Ces

molécules antimicrobiennes sont sécrétées dans le mucus et participent à la protection contre

les bactéries du microbiote et les agents pathogènes en formant une barrière protectrice

bactéricide (action lytique par destruction partielle de la paroi bactérienne). Ces molécules

sont les défensines, la phospholipase A2 (sPLA2), RegIIIγ, l’angiogénine, les cathélicidines et

les lectines de type C (Antoni et al., 2014; Bulet et al., 2004). Les lectines de type C jouent un

rôle important dans la réponse immunitaire, elles activent les fonctions immunitaires telles

que la phagocytose en se liant aux microorganismes. Les défensines-α sont sécrétées en

réponse immédiate à la présence de bactéries (Nakamura et al., 2016; Selsted et Ouellette,

2005).


19

1.4.2.4. Cellules du système lymphoïde associé à l’intestin

Au niveau de la paroi de l’intestin, la lamina propria située sous l’épithélium présente

des follicules lymphoïdes épars ou agrégés qui font partie du MALT (Mucosa-Associated

Lymphatic Tissue). Ces plaques, plaques de Pleyer, contribuent à la défense contre les agents

pathogènes qui ont pu pénétrer le système digestif. Leur nombre augmente vers l’extrémité

distale de l’intestin grêle. Elles sont constituées d’un domaine sous-épithélial qui sépare la

plaque de Peyer de l’épithélium intestinal contenant des lymphocytes B et d’un centre

germinatif contenant des lymphocytes B (produisant des IgA), des lymphocytes T et des

macrophages (Figure 6).

Les plaques de Peyer sont encadrées par un épithélium associé au follicule (FAE)

principalement composé de cellules M intercalées entre les entérocytes et de cellules

dendritiques (Figure 6). Les cellules M, très actives dans la phagocytose et la transcytose, sont

impliquées dans l’échantillonnage d’antigènes et de microorganismes présents dans la lumière

intestinale pour la présentation au système immunitaire sous-jacent, notamment aux cellules

dendritiques, et initier une réponse immunitaire de la muqueuse (Ohno, 2016; Peterson et

Artis, 2014).

1.4.3. Sécrétions des glandes annexes et rôle dans la digestion

Dans l’intestin grêle, la digestion chimique dépend des sécrétions biliaires et

pancréatiques sécrétées par les organes digestifs annexes: le foie, la vésicule biliaire et le

pancréas (Figure 7).

Figure 7: Organes annexes du système digestif La synthèse des différentes sécrétions digestives est assurée par le pancréas, le foie et la vésicule

biliaire: le suc pancréatique se déverse par le canal de Wirsung dans le duodénum; la bile est sécrétée

par le foie directement ou stockée dans la vésicule biliaire avant d’être déversée dans le duodénum par

le canal cholédoque.


20

1.4.3.1. Le foie, la vésicule biliaire et la sécrétion de bile

De nombreuses fonctions régulatrices et métaboliques sont assurées par le foie, mais

son unique rôle direct dans la digestion est la synthèse de bile avec une production moyenne

de 0,8 à 1 L par jour. La vésicule biliaire est une petite poche musculeuse capable de stocker

la bile produite par le foie. Elle peut contenir un volume de 10 à 50 mL de bile concentrée

suite à l’absorption d’eau et d’ions. La bile ainsi contenue dans la vésicule est 4 à 6 fois plus

concentrée que la bile hépatique. Avant sa libération, la concentration de la bile peut même

atteindre un facteur 10 à 20 fois supérieures, et dans certains cas dépasser les limites de

solubilité des acides biliaires, engendrant des calculs.

La bile est déversée dans le duodénum via le canal cholédoque à une hauteur de 500

mL par jour. Elle est composée d’eau, de sels biliaires (molécules amphiphiles dérivées du

cholestérol), de sels minéraux, de cholestérol, de lécithine, de pigments biliaires (bilirubine et

biliverdine). Chez l’Homme, les principaux sels biliaires primaires sont l’acide cholique et

l’acide chénodéoxycholique. Lors de la digestion, les sels biliaires permettent la digestion des

lipides en les émulsifiant (formation de micelles lipidiques), ce qui favorise l’activité de la

lipase pancréatique. Au niveau de l’iléum, la majorité des sels biliaires (95 %) est réabsorbée

vers le sang, grâce à un système de transport actif, et retourne au foie par l’intermédiaire de la

veine porte hépatique. Dans le foie, ils seront reconjugués et pourront à nouveau être sécrétés

dans la bile. Ce phénomène de recyclage des sels biliaires correspond au cycle entéro-

hépatique et celui-ci se repète deux à trois au cours d’un repas (Marieb et Hoehn, 2015;

Sherwood, 2015). Dans le duodénum, les concentrations initiales en sels biliaires sont de 10 à

15 mmol/L et diminuent progressivement dans les deux heures après le repas pour atteindre

une valeur de 5 mmol/L. Après un repas, les concentrations sont respectivement 10 mmol/L et

2 à 4 mmol/L dans le jéjunum et l’iléum (Northfield et McColl, 1973).

1.4.3.2. Le pancréas et les sucs pancréatiques

Le pancréas est une glande mixte ou amphicrine qui sécrète un ensemble d’enzymes,

le suc pancréatique, permettant la dégradation des macromolécules du chyme. Le suc

pancréatique est déversé dans le duodénum par le conduit pancréatique, aussi nommé le canal

de Wirsung, qui fusionne avec le canal cholédoque juste avant le duodénum (au niveau de

l’ampoule hépato-pancréatique). Le pancréas produit un volume d’enzymes quotidien, sécrété

dans le duodénum, d’environ 1500 mL (Sherwood, 2015).


21

Le tissu endocrine est composé des Îlots de Langerhans (1 % des cellules

pancréatiques) qui sécrètent dans le sang des substances endocrines: insuline (hormone

hypoglycémiante), glucagon (hormone hyperglycémiante), somatostatine (hormone

régulatrice des sécrétions endocrines) et polypeptide pancréatique (inhibiteur de la sécrétion

pancréatique exocrine). Le tissu exocrine est plus abondant et se compose de cellules

acineuses sécrétant des quantités importantes de bicarbonate (neutralisation de l’acidité du

chyme gastrique) et des proenzymes inactives. Le suc pancréatique est composé d’enzymes

protéolytiques (trypsine, chymotrypsine, carboxypeptidase), de ribonucléases (RNase) et de

désoxyribonucléases (DNase) utilisées pour la dégradation des résidus nucléotidiques, ainsi

que des lipases et des amylases pancréatiques.

L’activation des enzymes a lieu dans la lumière duodénale afin de protéger le pancréas

contre l’autodigestion. Elle débute par la conversion du trypsinogène en trypsine active par

l’intermédiaire d’une protéase présente sur la bordure en brosse des entérocytes de la

muqueuse duodénale: l’entéropeptidase ou entérokinase. La trypsine active alors plus de

trypsinogène en trypsine ainsi que le chymotrypsinogène et le procarboxypeptidase en

chymotrypsine et carboxypeptidase actives. Chacune de ces enzymes pancréatiques hydrolyse

différentes liaisons peptidiques: la trypsine et la chymotrypsine sont des endopeptidases

(coupent à l’intérieur de la chaine peptidique) et les carboxypeptidases sont des exopeptidases

(libèrent acide-aminé en C-terminal ou N-terminal) (Khan et al., 2009; Marieb et Hoehn,

2015).

Seule la lipase pancréatique est capable de digérer les lipides. Secrétée sous forme

active, elle hydrolyse les triglycérides des aliments en monoglycérides et acides gras libres, la

forme absorbable des lipides. L’amylase pancréatique est sécrétée sous forme active et

poursuit l’activité de l’amylase salivaire. Grâce à une activité plus forte que l’amylase

salivaire, elle transforme l’amidon en dextrines puis en maltose.


22

1.5. Digestion colique

Le gros intestin est la partie terminale du tractus digestif et s’étend de la jonction iléo-

caecale à l’anus sur environ 1 m à 1,5 m et est constitué de plusieurs parties: le cæcum

prolongé par l’appendice, le côlon ascendant, le côlon transverse, le côlon descendant, le

côlon sigmoïde, le rectum et l’anus (Figure 8).

Figure 8: Anatomie du gros intestin

Le côlon humain est composé du côlon ascendant, du côlon transverse et du côlon descendant, suivis

du côlon sigmoïde et du rectum (Marieb et Hoehn, 2015).

Le côlon a pour fonctions physiologiques la réabsorption hydro-électrolytique, la

dégradation des composés non-digestibles et le stockage des selles avant défécation. Le côlon

a un rôle essentiel dans le contrôle du volume et de la composition ionique des selles, en

sécrètant les ions potassium et bicarbonate et en absorbant les ions sodium et chlorure (Khan

et al., 2009). Le côlon abrite une population microbienne dense qui participe à la fermentation

et/ou putréfaction de substrats exogènes (glucides non digérés ou non absorbés par l’intestin

grêle) et endogènes (protéines issues de la desquamation cellulaire, enzymes digestives,

mucus), ce qui conduit à la production de nombreux métabolites, tels que les vitamines B et K

et les acide gras à chaines courtes. Les métabolites produits sont principalement absorbés et

utilisés par l’hôte.


23

L’épithélium colique est essentiellement composé de cellules caliciformes et

d’entérocytes (les colonocytes). Cet épithélium se différencie de l’épithélium de l’intestin

grêle par l’absence de plis et de villosités, les nutriments étant essentiellement absorbés dans

l’intestin grêle. Les colonocytes sont responsables de l’absorption de l’eau et des électrolytes.

De très nombreuses cellules caliciformes sécrétant un gel muqueux favorisent le glissement

des particules alimentaires non digérées et des fèces. La production du mucus est la seule

sécrétion produite dans le côlon. Le mucus produit est alcalin et à un rôle de protection des

muqueuses contre les agressions chimiques et mécaniques. Le NaHCO3 neutralise les produits

acides résultant des fermentations bactériennes hébergées dans le côlon. Le mucus colique est

constitué de deux couches: une couche interne fermement ancrée à la surface de l’épithélium

et qui sert de barrière en empêchant le passage des bactéries et une couche externe formée à

partir de la couche interne, non-ancrée à l’épithélium et plus lâche que la couche interne, ce

qui permet le passage et la colonisation des bactéries (Johansson et al., 2013).

La progression des résidus le long du gros intestin est assurée par des contractions de

segmentation lente et durant entre 12 et 24 h lors d’un transit normal. On considère que ce

temps de transit est de 3 à 5 h dans le côlon ascendant, de 0,2 à 4 h dans le côlon transverse et

de 5 à 72 h dans le côlon descendant et sigmoïde (Wilson, 2010).

1.6. Microbiote digestif

Le système digestif héberge une communauté d’environ 1014

microorganismes en

symbiose avec l’hôte. Ce microbiote est majoritairement composé de bactéries mais la

présence d’eucaryotes (appartenant principalement au règne des fungi comme les levures), de

virus et d’archées est observée (Eckburg et al., 2005; Hugon et al., 2016; Walker et al., 2014).

Le microbiote est composé de plus de 1000 espèces différentes, essentiellement anaérobie

strictes, appartenant à différent phyla bactériens (Firmicutes, Bacteroidetes, Actinobacteria,

Proteobacteria et Fusobacteria, Verrucomicrobia, Cyanobacteria et Spirochaetes) ainsi qu’à

des Archae appartenant au phyllum des Euryarchaeota (Hugon et al., 2016).

Avant la naissance, le tube digestif est stérile. Le microbiote intestinal se met en place

pendant les deux premières années de la vie. La colonisation des différentes espèces est

influencée par les conditions variables d’environnement et d’hygiène, ce qui explique qu’à

l’âge adulte, chaque individu héberge un microbiote qui lui est propre et relativement stable

dans le temps (Qin et al., 2010; Rambaud et al., 2004).


24

Figure 9: Espèces microbiennes dominantes dans les différentes régions du système

digestif humain Les trois phyla majoritaires sont les Firmicutes, les Bacteroidetes et les Actinobacteria. Les

Proteobacteria et les Fusobacteria sont présents principalement au niveau buccal (Rambaud et al.,

2004).

La population bactérienne n’est pas homogène sur l’ensemble du système digestif

(Figure 9), en raison des différentes conditions rencontrées dans les différentes régions du

tractus digestif (pH, niveau d’anaérobie, sels biliaires et composition de mucus) (Simrén et

al., 2013).

La cavité buccale présente une biomasse bactérienne d’environ 108 à 10

9 UFC/g,

majoritairement représentée par les Firmicutes, Bactéroidetes, Actinobacteria, Proteobacteria

et les Fusobacteria. Ces phyla sont également retrouvés dans l’œsophage (Ahn et al., 2011;

Rambaud et al., 2004).

Les conditions rencontrées dans l’estomac, où le pH est fortement acide, ont

longtemps laissé penser que l’implantation de microbiote était impossible. La biomasse dans

l’estomac est faible, allant de 101 à 10

3 UFC/g. La majorité des séquences des bactéries


25

présentes dans l’estomac appartiennent aux phyla Firmicutes, Bacteroidetes, Actinobacteria,

Proteobacteria et Fusobacteria (Nardone et Compare, 2015).

Le passage rapide des matières digestives dans l’intestin grêle ne permet pas une

croissance bactérienne importante. Le nombre de microorganismes augmente le long de

l’intestin grêle: 103-4

dans le duodénum à 108 UFC/mL dans l’iléum (en corrélation avec la

diminution de la concentration en sels biliaires et en oxygène). L’intestin grêle héberge des

bactéries aérobies-anaérobies facultatives telles que les Streptococcus, les Lactobacillus et les

Enterobacteriaceae auxquelles s’ajoutent des espèces anaérobies strictes du genre

Bacteroides au niveau iléal (Rambaud et al., 2004).

Dans le côlon, le développement de communautés bactériennes complexes,

généralement anaérobies strictes, est facilité par la faible vitesse de déplacement du contenu

digestif, la neutralité du pH et la faible concentration en sels biliaires. Ces facteurs engendrent

un microbiote colique particulièrement abondant avec une diversité et une densité maximales:

1011

UFC/mL représentés par plus de 1000 espèces bactériennes différentes (Qin et al., 2010).

Deux flores peuvent être distinguées: une flore résidente composée d’espèces présentes en

permanence et une flore de transit qui provient de l’alimentation et n’est présente que dans un

laps de temps court. Deux phyla sont majoritairement présents dans les populations du côlon:

les Firmicutes et les Bacteroidetes. On retrouve aussi des bactéries des phyla suivant:

Actinobacteria, Proteobacteria, Fusobacteria et Verrucomibrobia (Cho et Blaser, 2012; Hugon

et al., 2016; Qin et al., 2010).

Le microbiote intestinal exerce des fonctions fondamentales comme le maintien de la

santé de l’hôte au niveau intestinal mais influence aussi la physiologie générale de l’hôte. Le

microbiote intestinal intervient au niveau de nombreux processus physiologiques tels que le

métabolisme des glucides et des protéines, la synthèse de vitamines B et K. Il est également

impliqué de la déconjugaison des acides biliaires, stimule la motilité colique, contribue à

l’entretien de la muqueuse colique et est également impliqué dans la maturation du système

immunitaire et dans la protection contre les pathogènes (Montalto et al., 2009; Wlodarska et

al., 2015).


26

2. La digestion artificielle: modèles in vitro de digestion humaine

Pour des raisons techniques, scientifiques, règlementaires, budgétaires, de délai et

d'éthique, les méthodes de digestion in vitro s'avèrent être des alternatives de plus en plus

utiles à l'expérimentation animale et humaine, à condition que la pertinence de ces méthodes

soit du niveau de celle des essais in vivo. Des modèles de digestion artificielle ont été

développés par différentes équipes scientifiques. Ces systèmes modélisent les conditions

physicochimiques et/ou microbiologiques rencontrées dans l’environnement digestif. Ces

systèmes peuvent être mono- ou multi-compartimentés, statiques ou dynamiques. Ils peuvent

d’être utiliser dans le cadre d’études nutritionnelles, microbiologiques, toxicologiques ou

pharmaceutiques.

Cette partie présentera les principaux modèles de digestion in vitro reproduisant les

conditions digestives gastriques et intestinales chez l’homme. Des modèles simulant la

mastication ont également été développé tels que le masticateur Bite Master II (Meullenet et

Gandhapuneni, 2006), la Bouche Artificielle (Salles et al., 2007), le masticateur de

l’université du Minnesota (Krause et al., 2011) et le modèle AM2 (Artificial Masticatory

Advanced Machine; Woda et al., 2010). De même, il existe aussi des modèles simulant la

digestion colique, allant des modèles statiques simples dit « batch » aux modèles plus

complexes fonctionnant en mode continu (Artificial Colon (ARCOL), EnteroMix, modèle

développé par l’équipe de Lacroix, TIM-2) (Blanquet-Diot et al., 2012; Cinquin et al., 2004;

Mäkivuokko et al., 2005; Minekus et al., 1999; Venema et van den Abbeele, 2013). Ces

modèles ne seront pas présentés ici, notre travail de thèse n’ayant pas porté spécifiquement

sur la mastication ou la digestion colique.

2.1. Modèles gastriques

2.1.1. Statiques

Les modèles gastriques les plus simples consistent en une hydrolyse peptidique

d’aliments homogénéisés (37°C, pH 1,5, 1 à 3 h).

D’autres modèles statiques intègrent des paramètres supplémentaires. Par exemple, le

modèle développé à l’Université de Leeds (Chen et al., 2011) reproduit le mélange des

aliments avec le suc gastrique grâce à une sonde sphérique en rotation sur un axe vertical. Ces

mouvements engendrent également les forces de compressions auxquelles le bol alimentaire

est soumis in vivo (Figure 10). Le réservoir est maintenu à 37°C par la circulation d’eau

autour du réservoir.


27

Cependant, ces modèles simples ne simulent pas l’acidification progressive du contenu

stomacal ou la vidange gastrique.

Figure 10: Représentation schématique de la cellule digestive de l’Université de Leeds

Une sonde sphérique reproduit des forces similaires à celles subies par les aliments dans l’estomac et

permet leur brassage. J.G.: Jus Gastrique (Chen et al., 2011).

2.1.2. Dynamiques

Des modèles gastriques dynamiques ont été développés qui intègrent l’acidification

progressive et la vidange gastrique. Un des modèles les plus simples est le modèle développé

par Hoebler et al. (2002). Ce modèle permet le contrôle de la température et du pH, il

reproduit l’ajout de pepsine et la vidange gastrique.

Un modèle plus complexe, le DGM (Dynamic Gastric Model) reproduit la spécificité

régionale de l’estomac (Figure 11). Deux compartiments successifs le composent: le

compartiment supérieur qui modélise le corps de l’estomac où les aliments sont mélangés aux

sécrétions et le compartiment inférieur qui représente l’antre et reproduit des forces de

cisaillement, de broyage et des contractions similaires à celles observées dans l’estomac

(Mercuri et al., 2011).

Le Human Gastric Simulator (HGS) est le modèle qui reproduit le plus fidèlement les

mouvements péristaltiques de l’estomac (Kong et Singh, 2010). L’HGS est composé d’une

chambre en latex entourée de quatre systèmes d’entrainement mécaniques (Figure 12). La

force de compression descendante appliquée par ces mécanismes sur la membrane en latex

permet de reproduire une contraction péristaltique, semblable à celle de l’estomac, à une

fréquence physiologique de trois contractions par minute. L’HGS reproduit avec efficacité

l’amplitude, l’intensité et la fréquence des contractions péristaltiques. De plus, la présence

d’une valve et d’un filet de porosité définie (1,5 mm) permet une vidange graduelle du

contenu de l’estomac en fonction de la taille des particules du bol alimentaire.


28

Figure 11: Le DGM (Dynamic Gastric Model) Composé de deux compartiments simulant le corps et l’antre de l’estomac, ce modèle est équipé d’une

valve permettant une vidange sélective des particules selon leur taille et la rétropulsion des plus

grosses particules vers le corps de l’estomac. J.G.: Jus Gastrique (Mercuri et al., 2011).

Figure 12: HGS (Human Gastric Simulator)

Ce système est conçu afin de reproduire au mieux les mouvements péristaltiques observés in vivo, au

moyen de système de roues montées sur poulies, comprimant les parois souples de la chambre en

latex. J.G.: Jus Gastrique (Kong and Singh, 2010).

Récemment, un nouveau modèle de simulation gastrique a été développé, le TIM-agc

(TNO gastro-Intestinal Model advanced gastric compartment). Ce système simule les profils

de pression observés in vivo au cours du transit gastrique. Le TIM-agc est composé de trois

parties pouvant être contractées de façon indépendante (Figure 13). La première partie simule

le corps de l’estomac. Elle possède une membrane interne souple qui peut être contractée

progressivement afin de simuler la réduction du volume lors de la vidange gastrique. Les deux

parties suivantes modélisent l’antre proximal et l’antre distal. Les contractions synchronisées

de ces deux parties permettent de simuler les vagues antrales. Une valve synchronisée avec


29

une onde antrale permet de simuler l’ouverture du sphincter pylorique autorisant la vidange

gastrique (Minekus, 2015).

Figure 13: TIM-agc (TNO gastro-Intestinal Model advanced gastric compartment) Ces schémas représentent le système TIM-agc lorsque les compartiments sont pleins (gauche) ou vide

(droite). Ce système est composé de trois compartiments: le corps (A), l’antre proximal (B) et l’antre

distal (C). Une valve synchronisée (D) simule le sphincter pylorique (Minekus, 2015).

Ces systèmes, pertinents pour étudier la digestion gastrique, ne fournissent néanmoins

qu’un aperçu de l’ensemble des phénomènes ayant lieu dans le tractus digestif supérieur. Des

systèmes gastro-intestinaux ont été développés afin de mieux simuler le transit gastro-

intestinal.

2.2. Modèles gastro-intestinaux

2.2.1. Mono-compartimentés statiques

De nombreux modèles de digestion gastro-intestinale ont été développés. Les plus

simples reproduisent, dans un unique compartiment, une phase gastrique (pepsine, pH 1-2),

pouvant être éventuellement précédée d’une phase de digestion buccale (salive, pH 6,5) et

suivie d’une phase pancréatique (enzymes pancréatiques, présence ou non de bile, pH 6-7).

Les systèmes gastro-intestinaux statiques les plus connus sont ceux d'Englyst et al.

(1996), de Garrett et al. (1999) et celui d’Oomen et al. (2003). Ces systèmes sont intéressants

pour des études préliminaires de pré-screening.

L’utilisation de ces systèmes engendre une grande variabilité en raison des différences

dans les paramètres de digestion utilisés (pH, origine et quantité d’enzymes digestives, ou

encore temps d’incubation). Avec l’objectif d’harmoniser les futures études avec un protocole

de digestion simple utilisable par l’ensemble de la communauté scientifique, un consensus a

été proposé par le réseau de chercheurs européens COST « Infogest » (Minekus et al., 2014).


30

Néanmoins, les conditions reproduites par les modèles mono-compartimentés statiques

restent très éloignées de la complexité des processus de digestion in vivo. En effet, ces

modèles ne simulent pas la succession des compartiments digestifs observée chez l’Homme,

les temps de transit associés et les fonctions propres à chacun de ces compartiments (brassage,

dégradation des macromolécules et absorption des nutriments) et les produits de digestion ne

sont pas éliminés du milieu digestif. Pour pallier ces limites, des systèmes bi- et multi-

compartimentés dynamiques ont été développés.

2.2.2. Bi-compartimentés dynamiques

Des modèles in vitro bi-compartimentés et dynamiques ont été développés pour

simuler, en fonctions de données in vivo, la digestion dans l’estomac et l’intestin grêle. Ces

modèles sont composés de deux compartiments connectés, l’un simulant la digestion

gastrique et l’autre simulant soit la digestion dans le duodénum soit dans l’intestin grêle dans

son intégralité.

Le système de Mainville a été développé pour simuler l’estomac et le duodénum. Le

pH, la température, le temps de transit, la concentration en bile sont contrôlés par ordinateur

et paramétrés à partir de données in vivo (Figure 14) (Mainville et al., 2005).

Figure 14: Modèle bi-compartimenté dynamique de Mainville Ce modèle simule l’estomac et le duodénum et est paramétré en fonctions de données in vivo

(Mainville et al., 2005).


31

Le modèle IViDiS a été adapté à partir de celui de Mainville. Il est composé de deux

compartiments à double enveloppe simulant l’estomac et le duodénum proximal, et d’un tube

immergé dans un bain-marie représentant le duodénum distal. Les paramètres comme le pH,

le temps de transit, l’ajout de sécrétions digestives ou l’état d’anaérobie sont contrôlés par

ordinateur (Tompkins et al., 2011).

Le modèle élaboré par Levi et Lesmes (2014) est constitué de deux bioréacteurs

connectés en série recréant les conditions dynamiques rencontrées dans l’estomac et le

duodénum de l’adulte ou de personnes âgées (Figure 15).

Figure 15: Système bi-compartimenté dynamique de Levi et Lesmes Système composé de deux bioréacteurs connectés en série simulant l’estomac et le duodénum (Levi et

Lesmes, 2014).

Le système dynamique de digestion gastro-intestinale (DIDGI) a été utilisé pour

simuler la digestion du lait chez le nouveau-né et plus particulièrement la déstructuration et

les cinétiques d’hydrolyse d’aliment (Ménard et al., 2014). Le DIDGI est constitué de deux

compartiments simulant l’estomac et l’intestin grêle. Le logiciel STORM permet de contrôler

la chute de pH gastrique linéaire, le maintien du pH de l’intestin grêle, les temps de transit

observés in vivo et l’ajout de sécrétions digestives (Figure 16).


32

Figure 16: Système DIDGI, système dynamique de digestion gastro-intestinale Ce modèle est constitué de deux compartiments qui simulent la digestion de l’estomac et de l’intestin

grêle. Les paramètres de digestion simulés dans ce système sont contrôlés par le logiciel STORM

(Ménard et al., 2014).

Figure 17: TinyTIM (TNO gastro-intestinal model) Ce système simule la digestion de l’estomac et de l’intestin grêle. A: compartiment de l’estomac, B:

sphincter pylorique, C: compartiment intestinal, D: sécrétions gastrique, E: sécrétions intestinales, F:

pré-filtre, G: électrodes de pH, H: membrane de dialyse, I: système de dialyse, J: capteur de pression et

K: capteur de niveau (Havenaar et al., 2013).

Le tinyTIM (TNO gastro-intestinal Model) est une version simplifié du TIM-1 (voir

paragraphe 2.2.3.2.) (Figure 17). Ce modèle simule l’estomac dans un compartiment et

l’intestin grêle en un autre au lieu des trois du système TIM-1. Ce système a été développé

pour les études qui ne nécessitent pas l’utilisation des trois compartiments distincts de

l’intestin grêle (duodénum, jéjunum et iléum) du système TIM-1, tel que les études de

digestion protéique et de carbohydrate ou pour l’étude pédiatrique chez les nouveau-nés et les

nourrissons. Le tinyTIM reproduit la température, les cinétiques de pH gastrique et intestinal,

le brassage du chyme, les temps de transit, les sécrétions digestives (α-amylase, lipase,


33

pepsine, HCl, bile, pancréatine et NaHCO3). De plus, ce système peut simuler l’absorption

passive d’eau et des petites molécules via un système de dialyse (Havenaar et al., 2013).

2.2.3. Multi-compartimentés dynamiques

Les systèmes multi-compartimentés et dynamiques sont rares. A ce jour, seuls deux

systèmes répondent à ces deux critères et ont été validés par des corrélations in vitro/in vivo.

2.2.3.1. Simulator of the Human Intestinal Microbial Ecosystem: SHIME

Le SHIME (Simulator of the Human Intestinal Microbial Ecosystem) a été développé

par l’Université de Gand en Belgique (Molly et al., 1993) et est jusqu’ici le seul modèle qui

intègre en un seul système l’ensemble des compartiments de l’estomac au côlon. Composé de

cinq réacteurs en série: l’estomac, l’intestin grêle, et les trois parties du côlon: caecum-côlon

ascendant, côlon transverse, et côlon descendant (Figure 18). Chaque bioréacteur se

caractérise par leur pH, leur volume réactionnel et leur temps de résidence qui leur est propre.

Figure 18: Représentation du schématique SHIME

Le SHIME est actuellement le seul système intégrant l’ensemble des phases digestives: estomac,

intestin grêle et les trois régions du côlon. J.P.: Jus Pancréatique (Molly et al., 1993).

Ce système permet de reproduire, en fonctions de données in vivo, la température, le

pH gastrique et intestinal, les sécrétions d’enzymes digestives (pancréatine, bile), le temps de

transit et les communautés microbiennes associés aux différentes régions du côlon humain.

Un filtre de dialyse est utilisable afin de simuler un phénomène d’absorption au niveau de

l’intestin grêle, cependant aucune absorption n’est simulé dans les compartiments coliques

(Vermeiren et al., 2011)

Le M-SHIME (Mucosal-SHIME, Figure 19), une amélioration du SHIME, présente un

compartiment supplémentaire doté de mucus intestinal (Van den Abbeele et al., 2012)

permettant l’adhésion d’une flore microbienne spécifique. Les flores microbiennes qui


34

adhèrent à la couche de mucus intestinal sont composées d’organismes jouant un rôle clé dans

la santé humaine et en étroite interactions avec l’hôte (Zoetendal et al., 2002), leurs présences

dans les systèmes in vitro permet une simulation de la digestion humaine plus proche de l’in

vivo. Le développement de ce système permet l’étude de ces microbiotes dans un contexte

sain ou de maladies telles que les maladies inflammatoires chroniques de l’intestin (MICI).

Figure 19: Représentation schématique du M-SHIME

Le M-SHIME est une adaptation du SHIME comportant un compartiment supplémentaire reproduisant

l’environnement muqueux. L-SHIME correspond à la phase colique d’origine (Van den Abbeele et al.,

2012)

Le système SHIME est particulièrement pertinent pour suivre sur plusieurs semaines

l’influence de composés alimentaires et de produits pharmaceutiques sur le microbiote

intestinal. Le SHIME a été récemment utilisé dans des études microbiologique (De Weirdt et

al., 2013; Geirnaert et al., 2015; Possemiers et al., 2010, 2013; Sivieri et al., 2013; Van den

Abbeele et al., 2012), pharmacologique (Almeida et al., 2011; Rodes et al., 2014),

toxicologique (Joly et al., 2013; Ouethrani et al., 2013; Yin et al., 2016) et nutrition/santé

(Barroso et al., 2014; Ichim et al., 2016; Marzorati et al., 2016; Truchado et al., 2015;

Vanhaecke et al., 2009; Vermeiren et al., 2012).


35

2.2.3.2. TNO gastro-Intestinal Model: TIM

Le système digestif artificiel TIM-1 (Minekus et al., 1995) sera plus décrit plus en

détail que les autres modèles étant le système utilisé lors de ce travail de thèse.

Le TIM-1 (ou TIM) (Figure 20) est un système multi-compartimenté, dynamique et

contrôlé par ordinateur. Il est composé de quatre compartiments représentant l’estomac et les

trois parties de l’intestin grêle: le duodénum, le jéjunum et l’iléum. Il reproduit le plus

physiologiquement possible les conditions physico-chimiques rencontrées dans la lumière

gastro-intestinale.

Figure 20: Représentation schématique du TIM-1

Le système TIM-1 (TNO gastro-Intestinal Model) est composé de quatre compartiments:

l’estomac, le duodénum, le jéjunum et l’iléum et reproduit les conditions physico-chimiques

rencontrées dans la lumière gastro-intestinale le plus fidèlement possible. EI: Electrolytes,

J.G.: Jus gastrique, J.P.: jus pancréatique (Minekus et al., 1995).


36

Les principaux paramètres de la digestion tels que l’évolution du pH gastrique et le

maintien du pH intestinal, la température corporelle, le brassage du chyme, le temps de

transit, les vidanges gastriques et iléales, les secrétions digestives (lipase, pepsine, HCl, bile,

pancréatine et NaHCO3), et l’absorption passive d’eau et des produits de digestion sont

reproduits à partir de données in vivo. Ces paramètres contrôlés par ordinateur peuvent ainsi

être modulés afin de simuler les différents stades de la vie (nourrisson, adulte, personne âgée),

les différent types de repas (solide, liquide) et les différentes conditions digestives d’un

individu sain ou malade (hyper- ou hypo-acidité gastrique, insuffisance pancréatique)

(Blanquet et al., 2004; Guerra et al., 2012; Minekus et al., 1995).

Chaque compartiment est composé d’unités en verre comprenant une paroi interne

flexible. De l’eau à 37°C circule entre la paroi en verre externe et la paroi flexible interne afin

de maintenir le système à température corporelle. Des variations de pression appliquées à

l’eau permettent de mimer le brassage du chyme en comprimant ou relâchant les parois

flexibles. Les différents compartiments sont reliés entre eux par des valves péristaltiques,

composés de trois tubes en « T » possédant une membrane flexible interne. L’ouverture et la

fermeture de ces valves, pilotées par ordinateur (envoi d'air comprimé ou vide), permettent le

passage d’une partie du chyme d’un compartiment à un autre, de façon à suivre une courbe de

transit prédéterminée. Afin de contrôler le transit, des capteurs de niveau mesurent le volume

dans chaque compartiment en permanence. Les vidanges gastriques et iléales sont

représentées par le modèle mathématique suivant (Elashoff et al., 1982):

ƒ représente la fraction de chyme délivrée, t le temps de vidange, t1/2 le temps de demi-vidange, β un

coefficient décrivant l’allure de la courbe

Ce modèle mathématique permet le contrôle par ordinateur du transit du chyme dans le

système digestif TIM-1.

Chaque compartiment est également équipé de sonde de pH afin de contrôler le pH en

continu, et d’ajuster, si nécessaire, avec une solution de HCl dans l’estomac et une solution de

NaHCO3 dans l’intestin grêle afin de se conformer aux valeurs de pH préalablement définies à

partir de données in vivo.


37

Les différentes sécrétions gastriques (lipase et pepsine), biliaires et pancréatiques sont

apportées en continu dans les compartiments correspondants par des pompes contrôlées par

ordinateur. Afin de reproduire l’état à jeun, des résidus gastrique, duodénal (contenant de la

trypsine), jéjunal et iléal sont introduits dans le TIM juste avant le début de la digestion.

Dans le compartiment jéjunal et iléal, l’absorption passive d’eau et de nutriments est

assurée par un système de fibre de dialyses dans lequel circule une solution d’électrolytes

(seuil de coupure: 10 000 Da).

Récemment, le système TIM-1 a été utilisé pour des études dans le domaine

nutritionnel (Denis et al., 2016; Larsson et al., 2016; Nalin et al., 2015; Nimalaratne et al.,

2015; Villemejane et al., 2016), pharmacologique (Barker et al., 2014; Hens et al., 2014;

Lyng et al., 2016; Ting et al., 2015; Verwei et al., 2016) et microbiologique (Arroyo-López

et al., 2014; Cordonnier et al., 2015; Miszczycha et al., 2014; Roussel et al., 2016; Uriot et

al., 2016).

2.3. Avantages et limites des systèmes de digestion in vitro

En raison de l’opinion publique sur l’expérimentation animale et les problèmes

d’éthique et de la nouvelle réglementation de l’Union Européenne (2010; code 2010/63/UE)

s’appuyant sur la règle des 3R (réduire, raffiner et remplacer), la communauté scientifique

s’oriente de plus en plus vers les modèles de digestion in vitro.

Ces modèles de digestion artificielle constituent de bonnes alternatives aux études in

vivo chez l’Homme ou chez l’animal. En effet, ces modèles in vitro permettent la réalisation

d’études (toxicologiques ou portant sur des microorganismes pathogènes) qui sont

techniquement ou éthiquement impossibles à réaliser chez l’Homme. De plus, ces systèmes

permettent de réaliser des études de pré-screening, ce qui, dans le cas où l’expérimentation

animale est nécessaire, permet de réduire le nombre d’animaux utilisés conformément à la

règle des 3R.

Les systèmes de digestion artificielle présentent ainsi un certain nombre d’avantages:

la rapidité d’exécution des expériences, la reproductibilité des expériences (sans variation

biologique inévitable in vivo), le coût relativement faible des expériences et le fait qu’ils ne

soient pas soumis aux contraintes éthiques.


38

Cependant, ne s’agissant que de modèle in vitro, les systèmes présentent évidemment

des limites. En effet, la digestion est un processus complexe dont les phénomènes tels que la

réponse immunitaire, les interactions avec les cellules de l’hôte, le contrôle nerveux et

hormonal de la digestion, ou encore l’absorption active des aliments sont difficiles voir dans

la plupart des cas impossible à reproduire in vitro. De plus, à l’exception du SHIME, les

modèles in vitro simulant l’estomac et l’intestin grêle n’intègrent pas de microbiote dans les

compartiments intestinaux comme c’est le cas chez l’Homme.

39

CHAPITRE 2: Streptococcus thermophilus, UN nouveau probiotique?

Chapitre 2

Streptococcus thermophilus,

UN nouveau probiotique?

Sommaire

3. S. thermophilus, une bactérie lactique ........................................................................... 41

3.1. Généralités sur S. thermophilus ............................................................................................. 41

3.2. Taxonomie et adaptation au lait ............................................................................................ 42

3.3. Voies métaboliques de S. thermophilus ................................................................................. 43

3.4. Utilisation de S. thermophilus en industrie laitière ................................................................ 54

4. S. thermophilus, vers un nouveau probiotique? ........................................................... 57

Revue de la littérature: Streptococcus thermophilus: from yogurt starter to a new promising

probiotic candidate? ................................................................................................................. 59

Chapitre 2: Streptococcus thermophilus, un nouveau probiotique?

41

CHAPITRE 2: Streptococcus thermophilus, UN

nouveau probiotique?

Ce chapitre est consacré à la bactérie lactique S. thermophilus. Dans une première

partie, des généralités sur S. thermophilus seront présentées ainsi que certaines de ses voies

métaboliques et son utilisation en industrie laitière. Dans une seconde partie, les capacités de

survie de S. thermophilus lors du transit dans le tractus gastro-intestinal (TGI) ainsi que ses

effets santé seront présentés sous la forme d’une revue de la littérature, qui sera

prochainement soumise à Journal of functional foods.

3. S. thermophilus, une bactérie lactique

3.1. Généralités sur S. thermophilus

Dans l’industrie agroalimentaire, S. thermophilus est la bactérie lactique la plus

utilisée après L. lactis. Il est traditionnellement employé en combinaison avec Lb. delbruceki

subsp. bulgaricus comme ferment pour la fabrication des yaourts (voir paragraphe 3.4.1.) ou

en combinaison avec Lb. helveticus pour la production de fromages à pâte pressée cuite

comme le gruyère ou l’emmental (voir paragraphe 3.4.2.). S. thermophilus est non pathogène,

il bénéficie du statut GRAS attribué par la FDA.

Figure 21: Photographie de Streptococcus thermophilus Photographie obtenue en microscopie électronique et montre la disposition en diplocoques et

chaînettes. Photo: Robert Hutkins, University of Nebraska (http://genome.jgi-

psf.org/strth/strth.home.html) (consulté le 10/10/2016)

S. thermophilus est une bactérie thermophile dont l’optimum de croissance se situe

autour de 43° - 45°C. D’un point de vue cellulaire, il s’agit d’une bactérie non mobile, de type

cocci formant des chainettes plus ou moins longues, de taille cellulaire comprise entre 0,9 et

http://genome.jgi-psf.org/strth/strth.home.html

http://genome.jgi-psf.org/strth/strth.home.html


42

1,7 µm (Figure 21), ne formant pas d’endospore, ne possédant ni catalase ni cytochrome

oxydase et de coloration Gram positive avec un faible pourcentage en GC (Farrow et Collins,

1984). Pour sa croissance, il requiert de nombreux substrats tels que des sources de carbone,

d’azote, des acides aminés, du phosphates et du soufre, mais également des facteurs de

croissance de type vitamines et oligoéléments. Cependant, il reste moins exigeant que d’autres

bactéries lactiques comme L. lactis par exemple (Letort et Juillard, 2001).

S. thermophilus est une bactérie homofermentaire qui est capable de produire de

l’acide lactique à partir de carbohydrates, et principalement de lactose (voir paragraphe

3.3.1.). Le catabolisme de carbohydrates par fermentation permet de générer de l’énergie sous

forme d’ATP et de convertir le pyruvate en acide lactique permettant de régénérer le NAD+

utilisé au cours de la glycolyse. En fin de fermentation, le produit principal est l’acide

lactique, obtenu à plus de 95 %. Des produits secondaires peuvent également être formés

comme le formate, l’acétoïne, le diacétyle, l’acétaldéhyde et l’acétate qui interviennent dans

les propriétés organoleptiques des produits fermentés.

C’est un organisme anaérobie aéro-tolérant qui peut croître en présence de faibles

concentrations d’oxygène et de ses dérivés toxiques grâce à une superoxyde dismutase (SOD)

et une glutathion réductase (voir paragraphe 3.3.3.).

3.2. Taxonomie et adaptation au lait

S. thermophilus appartient au phylum des Firmicutes, et au sous-groupe salivarius du

groupe viridans du genre Streptococcus. Ce sous-groupe inclut également S. salivarius et

S. vestibularis (Facklam, 2002; Gao et al., 2014; Kawamura et al., 1995). Pendant plusieurs

années, S. thermophilus a été classifié comme une sous-espèce de S. salivarius. Sa

reclassification en tant qu’espèce a été proposée en 1991 suite à une étude par hybridation

ADN-ADN (Schleifer et al., 1991). Plus récemment, la relation phylogénétique entre les trois

espèces qui composent le sous-groupe salivarius, S. thermophilus, S. salivarius et

S. vestibularis, a été étudiée par l’utilisation de la technique MLST (Multilocus Sequence

Typing). L’analyse de l’arbre phylogénétique, obtenu à partir de la variation entre les

séquences génomiques de huit gènes de ménage (ilvC, pepO, pyrE, glcK, ddlA, thrS, tkt,

dnaE), a montré que S. thermophilus était bien séparé des deux autres espèces montrant qu’il

s’agit d’une espèce à part entière (Delorme et al., 2010). La comparaison intra-espèce par

MLST a montré une très faible divergence entre les séquences des différents loci étudiés chez

les souches de S. thermophilus (Bolotin et al., 2004; Delorme et al., 2010; Junjua et al.,


43

2016). Cette faible divergence peut s’expliquer par le fait que S. thermophilus aurait des

origines récentes, il se serait différencié de S. salivarius il y a environ 7 000 ans. Il est

possible que S. thermophilus dérive de la domestication et de l’adaptation au lait d’une souche

bactérienne proche de S. salivarius (Delorme et al., 2010; Rasmussen et al., 2008).

En se différenciant de ses parents pathogènes, S. thermophilus a perdu la plupart des

gènes responsables de la virulence, et a acquis d’autres gènes lui permettant de s’adapter au

lait (Hols et al., 2005). En effet, la comparaison des séquences de différentes souches montre

que les gènes pathogènes sont soit absents soit inactifs (mutation non-sens, frameshift,

délétion) (Bolotin et al., 2004; Delorme et al., 2010; Goh et al., 2011). L’analyse des

séquences génomiques a également révélé que S. thermophilus aurait acquis, par transfert

horizontal de gènes (THG), des gènes lui permettant de s’adapter au lait. En effet, il a été

estimé que 10 % des gènes de S. thermophilus aurait été acquis par THG, ces gènes

proviendraient d’autres bactéries lactiques telles que Lb. helveticus, Lb. bulgaricus et L. lactis,

ou d’autres streptocoques tels que S. suis ou S. salivarius (Liu et al., 2009). Par exemple, la

région centrale du cluster eps, codant des exopolysaccharides (EPS) chez S. thermophilus

LMD-9 présente une très forte similitude avec celle de L. lactis; de plus, la présence de

transposases ainsi que son faible pourcentage en GC indiqueraient que cette région aurait été

acquise par THG (Goh et al., 2011). Un autre exemple est celui de la protéase pariétale PrtS.

Cette protéase est retrouvée chez certaines souches de S. thermophilus. Elle présente environ

96 % d’identité avec une protéase de paroi de S. suis. Cependant, son rôle chez les deux

bactéries est différent: chez S. suis, elle a un rôle dans la virulence alors que chez

S. thermophilus, elle a un rôle dans le clivage de la caséine en oligopeptides, ce qui montre

l’adaptation de S. thermophilus au lait (Bonifait et al., 2010; Goh et al., 2011). Par THG,

S. thermophilus aurait également acquis des gènes codant des protéines impliquées dans la

synthèse d’acides aminés et d’EPS, des transporteurs membranaires, des protéases cellulaires

ou encore des gènes impliqués dans la synthèse de bactériocines (Bolotin et al., 2004; Goh et

al., 2011; Liu et al., 2009; Rasmussen et al., 2008).

3.3. Voies métaboliques de S. thermophilus

Dans cette partie, les métabolismes carboné, azoté et de l’oxygène seront abordés. Ces

voies métaboliques présentent une utilité dans la production de produits fermentés, par la

production d’acide lactique, de composés organoleptiques ou encore en participant à la

croissance en lait.


44

3.3.1. Métabolisme carboné de S. thermophilus

La forte utilisation de S. thermophilus en industrie laitière est le résultat de sa capacité

à fermenter rapidement le lactose, le principal glucide du lait, en acide lactique. En outre, la

production de produits secondaires de fermentation, via le métabolisme du pyruvate, est

responsable des propriétés organoleptiques des yaourts.

3.3.1.1. Transport des sucres à travers la membrane plasmique

S. thermophilus est capable de fermenter cinq glucides: le lactose et le saccharose,

deux disaccharides, ainsi que le glucose, le galactose et le fructose, trois hexoses. Ces deux

derniers sucres ne peuvent être métabolisés que par un nombre restreint de souches de

S. thermophilus (van den Bogaard et al., 2004). Pour être utilisés comme source d’énergie par

la cellule, les sucres doivent franchir la barrière que constitue la membrane plasmique. Deux

systèmes de transport actif existent chez S. thermophilus: (1) le système PTS

(PhosphoTransferase System) qui couple le transfert et la phosphorylation du glucide et (2) le

système perméase énergie-dépendant qui fait pénétrer le glucide sous forme libre.

Les glucides transportés par le système PTS sont le saccharose et le fructose (Figure

22). Le système de transport PTS est composé de multiples enzymes qui aboutissent au

transport et à la phosphorylation du glucide par l’utilisation d’une molécule d’ATP (Kotrba et

al., 2001). Le transport de ces sucres est moins efficace que celui du lactose, illustrant

l’évolution de S. thermophilus vers une adaptation au lait par une utilisation préférentielle du

lactose (Hols et al., 2005; van den Bogaard et al., 2004).

Le glucose est un glucide non-PTS, qui est peu utilisé pour la croissance de la bactérie.

Il entre dans la cellule par un système de transport de type ABC (ATP Binding Cassette)

utilisant des protéines transmembranaires qui hydrolysent une molécule d’ATP pour le

transport d’une molécule de sucre (Figure 22) (Hols et al., 2005; Poolman, 1993).

Le lactose, disaccharide composé de galactose et de glucose, est uniquement transporté

par une perméase membranaire spécifique dépendante de la force promotrice, appelée LacS

(Foucaud and Poolman, 1992). Le transporteur LacS peut transporter le lactose de deux

façons différentes. Le premier type de transport est le transport symport lactose/H+, l’énergie

motrice étant fournie par le gradient de proton. Le second type de transport est le transport

antiport lactose/galactose, l’énergie motrice étant fournie par le gradient de concentration des

sucres de chaque côté de la membrane plasmique. A l’intérieur de la cellule, la β-


45

galactosidase (LacZ) hydrolyse le lactose en glucose et en galactose. Le galactose ainsi

obtenu est excrété hors de la cellule par le système LacS et permet par la suite l’entrée de

lactose (Figure 22). Le mode d’échange symport est plus lent que le système antiport, et serait

moins utilisé par S. thermophilus (Foucaud et Poolman, 1992; Gunnewijk et Poolman, 2000;

Poolman, 1993; Poolman et al., 1990; Veenhoff et al., 2001).

3.3.1.2. Métabolisme des sucres

Une fois entré dans la cellule, le lactose est hydrolysé en glucose et en galactose par la

β-galactosidase (LacZ). Le glucose est phosphorylé en glucose-6-phosphate (Glu-6P) par la

glucokinase (GlcK). Le Glu-6P est transformé en fructose-6-phosphate (Fru-6P) par la

phosphoglucose isomérase (Gpi), puis en fructose-1,6-biphosphate (FBP) par la 6-

phosphofructokinase (Pfk). Le FBP est alors pris en charge par les enzymes de la glycolyse

pour être transformé en pyruvate (Figure 22).

Lorsqu’ils sont transportés dans la cellule, le saccharose et le fructose sont

phosphorylés lors de leurs transports par le système PTS. Le saccharose-6-phosphate est

hydrolysé par la saccharose-6-phosphate hydrolase (ScrB) en Glu-6P et en fructose qui sera

phosphorylé par la fructokinase (ScrK) en Fru-6P. Le fructose-1-phosphate est phosphorylé

en FBP par la fructo-1-phosphate kinase (FruB). Le Glu-6P, le Fru-6P et le FBP ainsi obtenus

poursuivent la glycolyse par l’intervention des enzymes Gpi et Pfk (Figure 22) (Hols et al.,

2005; Poolman, 1993).

Le galactose, obtenu par l’hydrolyse du lactose, est soit rejeté à l’extérieur de la

cellule, soit catabolisé par la voie de Leloir par certaines souches de S. thermophilus. Quatre

enzymes constituant cette voie permettent la transformation du galactose en glucose-1-

phosphate: GalM (aldose 1-épimerase ), GalK (galactokinase), GalT (galactose-1-phosphate-

uridyl-transférase) et GalE (UDP-galactose-4-épimérase) (Figure 22). Les quatre gènes codant

ces quatre enzymes sont regroupés sous forme d’un opéron (galKTEM) (Figure 23), et sont

généralement présents chez S. thermophilus. L’incapacité de nombreuses souches à pouvoir

métaboliser le galactose serait due à la faible activité de GalK et GalM (Hols et al., 2005;

Vaillancourt et al., 2004, 2008).


46

Figure 22: Transport et métabolisme carboné chez S. thermophilus Encadré en rouge: produit principal de la fermentation du pyruvate. ABC: ATP-binding cassette

transporters; AckA: Acétate kinase; AcoABCL: Complexe acétoïne déshydrogénase; Ac-P: Acétyl-

phosphate; ADP: Adénosine Diphosphate; AldB: α-acétolactate déshydrogénase; Als: α-acétolactate

synthase; ATP: Adénosine Triphosphate; CoA: Coenzyme A; FBP: Fructose-1,6-biphosphate; Fru-

6P: Fructose-6-phosphate; FruB: Fructo-1-phosphate kinase; GalE: UDP glucose 4-epimerase; GalK:

Galactokinase; GalM: Galactose maturotase; GalT: Galactose 1-phosphate uridylyltranferase; GlcK:

Glucose kinase; Glu-6P: Glucose-6-phosphate; Gpi: Phosphoglucose isomérase; LacS: Transporteur

du lactose; LacZ: β-galactosidase; Ldh: L-lactate déshydrogénase; NAD+: Nicotinamide adénine

dinucléotide oxydée; NADH: Nicotinamide adénine dinucléotide réduit; P: Phosphate; Pfk:

Phosphofructokinase; Pfl: Pyruvate formate lyase; PflA: Pyruvate formate lyase activation enzyme;

PgmA: Phosphoglucomutase; Pta: Phosphotransacétylase; PTS: Sugar phosphotransferase systems;

ScrB: Saccharose-6-phosphate hydrolase; ScrK: Fructokinase; UDP: Uridine diphosphate; UDP-Gal:

UDP-Galactose; UDP-Glu: UDP Glucose (d’après (Hols et al., 2005; Poolman, 1993).

Glu-6P

Système de

transport de type

PTS

Saccharose-6-P

Fructose

Glycolyse

Pyruvate

Fru-6P

FBP

Fructose-1-P

Système de

transport

LacS

H+

LacZ

Glucose

Galactose

Galactose-1-P

GalK

GalM

Glucose-1-PGalT

UDP-GalUDP-Glu

GalE

Système de

transport de type

ABC

ATP ADP

Fructose

ATP ADP

Saccharose

ATP ADP

Glucose

Lactose

Lactose

H+

Galactose

Symport Antiport

GlcKGpi

Pfk

ScrB

ScrKFruB

Voie de

Leloir

PgmA

FormateL-LactateLdh

NAD+ NADH Acétyl-CoA

PflA

Pfl

Ac-P

Acétate

α-acétolactate

Als

DiacétyleAcétoïneAcétaldéhydeAcoABCL

AldB

Pta

AckA


47

3.3.1.3. Métabolisme du pyruvate

S. thermophilus est une bactérie homolactique obligatoire, il fermente le pyruvate en

L-lactate, produit majeur de la fermentation (> 95 %), et en autres produits secondaires

(Figure 22). Les produits formés par le métabolisme du pyruvate sont très utiles en industrie

laitière (Derzelle et al., 2005). Chez S. thermophilus, trois enzymes permettent la dégradation

du pyruvate: la L-lactate déshydrogénase (Ldh) principalement, la pyruvate-formate lyase (Pfl

et son enzyme d’activation PflA) et l’α-acétolactate synthase (Als), deux alternatives de

dégradation du pyruvate (Hols et al., 2005).

La Ldh permet la catalyse du pyruvate en lactate. En condition de métabolisme

homolactique, cette voie permet de ré-oxyder la majorité des NADH en NAD+

(Figure 22).

Chez S. thermophilus, il n’existe pas d’autre voie alternative pour la régénération du NAD+,

l’inactivation du gène ldh serait donc létale pour la bactérie (Hols et al., 2005).

La Pfl clive le pyruvate en formate et en acétyl-CoA (Figure 22) qui serait

phosphorylé par l’enzyme phosphotransacétylase (Pta) en acétyl-phosphate (Ac-P) et ce

dernier serait alors phosphorylé par l’acétate kinase (AckA) en acétate, composé intervenant

dans les propriétés organoleptiques des produits fermentés. Lors de la croissance de

S. thermophilus en lait, l’enzyme Pfl serait fortement induite (Derzelle et al., 2005),

cependant, son activité serait fortement inhibée par l’oxygène (Takahashi et al., 1987).

L’Als convertit le pyruvate en α-acétolactate (Figure 22). Ce dernier servirait à

produire de l’acétoïne et de l’acétaldéhyde par l’intervention respective des enzymes α-

acétolactate déshydrogénase (AldB) et d’un complexe acétoïne déshydrogénase (AcoABCL),

et serait impliquait dans la production du diacétyle. Ces composés sont également importants

pour les qualités aromatiques des yaourts (Hols et al., 2005).

3.3.1.4. Régulation du métabolisme carboné

3.3.1.4.1. Organisation et régulation par GalR du cluster galKTEMlacSZ

Deux opérons sont impliqués dans le métabolisme des sucres chez S. thermophilus:

l’opéron galKTEM codant les enzymes de la voie Leloir et l’opéron lacSZ qui code le

transporteur LacS et la β-galactosidase LacZ (Figure 23). Ces deux opérons sont regroupés en

un cluster galKTEMlacSZ qui est conservé chez les différentes souches de S. thermophilus

(Vaillancourt et al., 2002; Vaughan et al., 2001).


48

Chez la plupart des souches de S. thermophilus, la plus faible expression de l’opéron

galKTEM par rapport à l’opéron lacSZ serait due à une déficience du promoteur situé en

amont du gène galK. Ceci aurait pour conséquence la faible activité de galactokinase

provoquant ainsi l’incapacité de la plupart des souches de S. thermophilus à métaboliser le

galactose (Vaillancourt et al., 2004; Vaughan et al., 2001). Il a également été montré que la

faible expression de cette opéron serait due à une faible interaction entre le ribosome et le site

de fixation du ribosome (RBS) de l’ARNm du gène galK (Vaillancourt et al., 2002).

Figure 23: Organisation du cluster gal-lac chez S. thermophilus

Le cluster galKTEMlacSZ est composé de l’opéron galKTEM et de l’opéron lacSZ. Le gène galR,

codant une protéine régulatrice, est orienté de façon divergente par rapport au reste du cluster. Quatre

promoteurs sont représentés par les flèches fines et trois terminateurs sont représentés par les boucles.

L’orientation des gènes est indiquée par la pointe de la flèche épaisse. galE: UDP-glucose 4-

épimérase; galK: galactokinase; galM: galactose mutarotase; galR: régulateur transcriptionnel GalR;

galT: galactose-1-P uridylyltransferase; lacS: transporteur du lactose; lacZ: β-galactosidase

(Vaillancourt et al., 2002).

A proximité de l’opéron galKTEM et en amont du gène galK se trouve le gène galR,

orienté de façon divergente par rapport à galK (Figure 23). Le gène galR code la protéine

GalR qui régulerait positivement les deux opérons galKTEM et lacSZ en présence de lactose,

tandis qu’elle autorégulerait négativement son expression (Vaughan et al., 2001).

En plus de la régulation par GalR de lacSZ chez S. thermophilus, l’expression de

l’opéron lacSZ est aussi réprimée par la protéine de contrôle CcpA (Catabolite control protein

A) et par la protéine HPr (Histidine-containing phophocarrier protein) (Geertsma et al., 2005).

3.3.1.4.2. Régulation par les protéines CcpA et HPr

La régulation du transport des sucres implique la phosphorylation de la protéine HPr et

du régulateur de transcription CcpA.

La protéine HPr peut-être phosphorylée de deux manières différentes: sur la sérine en

position 46 (HPr-Ser-P) ou sur l’histidine en position 15 (HPr-His-P) (Gunnewijk et Poolman,

2000). Selon la phosphorylation, la protéine HPr a un effet différent dans la régulation du

transport du lactose (Figure 24). En présence d’excès de lactose au début de la croissance, la


49

forme HPr-Ser-P est dominante. En interagissant avec la protéine CcpA, elle forme un

complexe, CcpA-HPr-Ser-P, qui peut se fixer sur une séquence d’ADN spécifique: l’élément

de répression catabolique (erc). Cette séquence permet la répression des gènes lacSZ

(Geertsma et al., 2005; Gunnewijk et Poolman, 2000; Hols et al., 2005). Par ailleurs, la

protéine CcpA régule positivement trois enzymes clés de la glycolyse: la Ldh, la

phosphofructokinase (Pfk) et la pyruvate kinase (Pyk) (van den Bogaard et al., 2000).

Figure 24: Régulation du transport du lactose chez S. thermophilus Au début de la croissance, le lactose en excès favorise la phosphorylation de HPr sur la sérine 46

(HPr-Ser-P). Elle forme un complexe avec la protéine CcpA puis se fixe sur la séquence erc en amont

du gène lacS. Stimulé par ce complexe, la séquence erc inhibe la transcription de l’opéron lacSZ.

Lorsque la concentration en lactose diminue, la sérine est déphosphorylée et HPr est phosphorylée par

l’enzyme I au niveau de l’histidine permettant ainsi d’obtenir une activité différente de la protéine

HPr. Le taux de HPr-Ser-P diminue et la transcription de l’opéron lacSZ augmente. En parallèle, le

taux de HPr-His-P augmente et stimule l’échange lactose/galactose. HPr-His-P transfère son

phosphate au domaine IIA du transporteur LacS, ce qui permet d’augmenter son activité de transport.

ARN pol: Acide RiboNucléique polymérase; ATP: Adénosine TriPhosphate; CcpA: Catabolite control

protein A; erc: élément de répression catabolique; EI: Enzyme I; His: Histidine; HPr: Histidine

Phophocarrier protein; P: Phosphate; PEP: Phospho-énolpyruvate; Ser: Sérine (modifié d’après

Gunnewijk and Poolman, 2000).

Au cours de la croissance, la concentration en lactose diminue, la répression par CcpA

et le taux de HPr-Ser-P diminue. Il en résulte une augmentation de l’expression de l’opéron

lacSZ, et donc une augmentation de la biosynthèse du transporteur LacS. En parallèle, la

Système de

transport

LacS

H+

Galactose

LactoseLactose

H+

Galactose

Symport

Antiport

IIA

P

LactoseLactose

IIA

P

HPr-His-P HPr

EI EI-P

PEP Pyruvate

HPr-Ser-P

ATP

ADP

Hpr-Ser kinase Hpr-Ser phosphatase

HPr-Ser-P

CcpA

Opéron lacSZ erc-10 -35

ARN polTranscription


50

concentration de la protéine HPr-His-P augmente pour devenir la forme dominante. Cette

protéine stimule l’échange lactose/galactose en phosphorylant le C-terminal du domaine IIA

du transporteur LacS (Figure 24). En augmentant le nombre de transporteurs et la vitesse de

transport du lactose, S. thermophilus peut compenser la diminution du lactose dans le milieu

(Geertsma et al., 2005; Gunnewijk et Poolman, 2000; Hols et al., 2005).

3.3.2. Métabolisme azoté de S. thermophilus

Contrairement au métabolisme carboné, le métabolisme azoté de S. thermophilus est

moins connu. Le lait comprend des composés azotés de deux types classés selon leur

solubilité. La fraction soluble correspond aux molécules azotées non protéiques comme les

acides aminés libres, les petits peptides, les vitamines du groupe B, les bases azotées et l’urée.

La fraction non soluble est composée de molécules azotées de hauts poids moléculaires tels

que les peptides constitués de plus de huit résidus, les caséines et les protéines solubles issues

des glandes mammaires. Le lait étant pauvre en acides aminés libres et en petits peptides et

S. thermophilus étant auxotrophe pour certains acides aminés, la croissance en lait implique

(1) d’hydrolyser les caséines, (2) d’internaliser et/ou de dégrader les peptides résultants et (3)

de synthétiser de novo des acides aminés (Hols et al., 2005).

3.3.2.1. Besoins en acides aminés

S. thermophilus requiert un apport exogène d’acides aminés pour sa croissance. Les

besoins en acides aminés dépendent des souches (Letort et Juillard, 2001).

La faible concentration en acides aminés libres dans le lait implique que la biosynthèse

de novo d’acides aminés devient nécessaire pour la croissance en lait de S. thermophilus.

L’analyse du génome de deux souches, CNRZ1066 et LMG18311, a montré la présence de la

plupart des gènes codant les enzymes nécessaires à la synthèse des acides aminés, ce qui leur

permettrait de synthétiser la plupart des acides aminés dont elles ont besoin (Hols et al.,

2005). Des expériences d’omission ont montré qu’une majorité des souches de

S. thermophilus (13/15) testées ne pouvaient croître sans glutamate (Letort et Juillard, 2001).

De plus, la présence d’un cluster cbs-cblB(cglB)-cysE (également appelé cysM2-metB2-

cysE2) chez ces souches serait impliqué dans la synthèse des acides aminés soufrés, présents

en faible quantité dans le lait (Herve-Jimenez et al., 2008; Hols et al., 2005; Liu et al., 2009).

La plupart des souches de S. thermophilus sont capables de croître avec comme seule

source d’acides aminés un mélange de glutamine, méthionine, leucine, valine et histidine. Ce


51

qui implique que la plupart des voies de synthèse des autres acides aminés sont fonctionnelles

(Hols et al., 2005). De plus, il a été montré que, même s’ils ne sont pas essentiels à la

croissance, l’ajout de leucine, valine, méthionine et cystéine stimule la croissance de

S. thermophilus (Garault et al., 2000; Hols et al., 2005; Letort et Juillard, 2001).

3.3.2.2. Système protéolytique

Le système protéolytique de S. thermophilus est composé d’une protéase ancrée dans

la paroi membranaire (PrtS) capable de dégrader les caséines, de systèmes de transport de

peptides et d’acides aminés libérés et de peptidases intracellulaires nécessaires à la

dégradation des peptides dérivés de la caséine (Hols et al., 2005) (Figure 25).

Etant donné que PrtS est la seule protéase qui a été identifiée chez S. thermophilus, sa

présence ou son absence sont essentiels pour déterminer le profil protéolytique ou non-

protéolytique des souches de S. thermophilus (Delorme et al., 2010; Galia et al., 2009;

Shahbal et al., 1991). La protéase PrtS est essentielle pour la croissance de S. thermophilus

lorsqu’il est présent seul dans le lait. Cependant en co-culture avec Lb. bulgaricus,

S. thermophilus est capable de croître en utilisant les peptides libérés par Lb. bulgaricus

(Courtin et al., 2002). Ceci pourrait expliquer l’absence de PrtS chez de nombreuses souches

de S. thermophilus (Shahbal et al., 1991). Après clivage de la séquence signal par le système

Sec, la protéase PrtS est ancrée de manière covalente dans la paroi de la bactérie par le motif

LPXTG grâce à la sortase A (SrtA) qui est ancrée dans la membrane (Figure 25) (Chang et

al., 2012; Delorme et al., 2010; Fernandez-Espla et al., 2000). Deux types d’hydrolyse des

caséines par PrtS ont été identifiés: (i) PrtS clive préférentiellement après un résidu basique

(arginine, lysine et histidine) agissant en cela comme la trypsine mais avec une activité

étendue à l’histidine et (ii) PrtS clive après un résidu hydrophobe (leucine, phénylalanine,

méthionine et tyrosine), activité ressemblant à l’activité chymotrypsine (Chang et al., 2014).


52

Figure 25: Système protéolytique de S. thermophilus (1) Export de la protéase PrtS immature par le système Sec et ancrage de la protéase PrtS dans la paroi

par clivage du motif LPXTG (partie noire de PrtS immature supprimée) par la sortase A (SrtA). (2)

Hydrolyse par PrtS de la caséine en oligopeptides. Ces derniers sont hydrolysés par la peptidase

extracellulaire PepX. (3) Internalisation des oligopeptides par les systèmes de transport Ami, Ots et

DtpT. (4) Hydrolyse des oligopeptides en acides aminés libres par les peptidases intracellulaires

(Awussi et al., en préparation).

Le transport des peptides ou acides aminés chez S. thermophilus est assuré par le

système DtpT (Proton dependant di-tripeptide transporteur), Ami et Ots (Figure 25) (Garault

et al., 2000; Jameh et al., 2016). Le système Ami est un transporteur de type ABC qui assure

le transport des oligopeptides jusqu’à 23 résidues (Garault et al., 2000). Il est constitué de

deux protéines, AmiC et AmiD, qui forment le canal, de deux ATPases, AmiE et AmiF, qui

fournissent l’énergie nécessaire au transport et de la protéine OBP (Oligopeptide binding

proteins). Chez la souche LMD-9, neuf transporteurs de type ABC ont pu être identifiés: 2

transporteurs d’oligopeptides opp, 3 transporteurs d’acides aminés polaires, 2 transporteurs

d’acides aminés ramifiés, 1 transporteur de la glutamine et 1 transporteur

spermidine/putrescine (Goh et al., 2011). Le système DtpT est spécialisé dans le transport

d’une large variété de di- et tri-peptides (Hols et al., 2005). Il a été montré que ce système

serait surexprimé en fin de phase de croissance en lait (Herve-Jimenez et al., 2008). Ce

système a été identifié chez toutes les souches provenant de la collection de 30 souches de

Paroi

Membrane

Cytoplasme

Milieu

extracellulaire

Système

Ami

Système

Ots

Système

DtpTSec

PrtS

PrtS

Forme

immature

Forme

mature

SrtA

1

PepX

Caséine

23

Systèmes de transport des

oligopeptides

Acides aminés libres

PepO

Endopeptidases

PepF

Oligopeptidases

PepB

PepQ

Peptidases

proline-spécifiques

PepP

PepX

PepF

Aminopeptidases

non-spécifiques

PepB

PepA

Aminopeptidases spécifiques

PepM

PepS

PepV

Di- et tri-

peptidases

PepT

4


53

l’équipe PB2P et l’analyse des protéines a montré qu’il était bien conservé (98 à 100 %

d’identité parmi les souches) (Jameh et al., 2016). Le système Ots (Oligopeptide Transporter)

est un transporteur de type ABC peptide/nickel qui permet le passage d’oligopeptides (di-et

tri-peptides). Il est constitué de OtsB et OtsC qui forment le canal de transport, OtsD une

double ATPase fournissant l’énergie et OtsA appartenant à la famille des « peptide/nickel

binding proteins » (Jameh et al., 2016).

Une peptidase (PepX) ancrée dans la paroi ainsi qu’une quinzaine de peptidases

intracellulaires ont pu être identifiées chez S. thermophilus (Hafeez et al., 2015, 2013; Rul et

Monnet, 1997). Une fois internalisés dans la cellule, les peptides sont hydrolysés en acides

aminés libres par l’action des peptidases intracellulaires. Elles incluent des aminopeptidases

générales (large spécificité: PepC et PepN), des aminopeptidases spécifiques (PepA, PepS et

PepM), des oligopeptidases (PepF et PepB), une endopeptidase (PepO), des di- et tri-

peptisases (PepV et PepT) et des peptidases spécifique à la proline (PepX, PepQ et PepP)

(Figure 25) (Goh et al., 2011; Hols et al., 2005).

3.3.3. Métabolisme de l’oxygène de S. thermophilus

S. thermophilus est une bactérie anaérobie, il n’utilise pas l’oxygène, cependant il peut

croître en présence d’oxygène et de faible concentration de ROS (Reactive Oxygen Species)

grâce à des enzymes antioxydantes permettant de dégrader les ROS (Thibessard et al., 2001,

2004).

Chez S. thermophilus, il existe deux systèmes responsables du maintien du potentiel

redox: le système glutathion (GSH/Gr/Grx) et le système thioredoxine (TRX/TrxR). Le

tripeptide glutathion (GSH) possède un rôle protecteur des cellules contre le stress oxydant.

En présence de peroxyde d’hydrogène (H2O2) ou de peroxyde organique (ROOH), du

glutathion disulfure (GSSG) est formé par oxydation de molécule de GSH (2GSH + ROOH

GSSG+ ROH + H2O). Le GSSG est réduit en deux molécules de GSH par l’enzyme

glutathion réductase (GR) à l’aide de NADPH (Hols et al., 2005). Le système thioredoxine

comporte deux thioredoxines (trxA1 et trxA2) et deux thioredoxine réductases (trxB1 et trxB2)

ainsi qu’une glutaredoxine (nrdH) (Bolotin et al., 2004; Hols et al., 2005). Les deux systèmes,

thioredoxine et glutathion, sont responsables de la réduction intracellulaire de disulfides et

jouent un rôle contre le stress oxydatif.


54

S. thermophilus possède une unique « H2O-forming NADH oxidase » codée par nox2

et qui réduit l’oxygène en eau (Bolotin et al., 2004). Une manganèse superoxyde dismutase,

codée par le gène sodA, permet de maintenir une concentration intracellulaire faible de ROS

en convertissant les anions superoxyde en molécule d’oxygène et en peroxyde d’hydrogène

(Chang et Hassan, 1997; Hols et al., 2005). Il a été montré que des protéines impliquées dans

l’équilibre du fer intracellulaire, codées par les gènes sufD et iscU sont produites lors de stress

oxydant et participeraient à la protection de S. thermophilus contre les ROS (Thibessard et al.,

2004).

3.4. Utilisation de S. thermophilus en industrie laitière

En industrie laitière, S. thermophilus est couramment utilisé en tant que ferment

notamment dans la production de yaourts et de fromages à pâte pressée cuite.

3.4.1. Production de yaourt

En France, l’appellation « yaourt » est réservée aux laits fermentés par Lb. bulgaricus

et S. thermophilus, deux bactéries lactiques thermophiles. Au moment de la vente au

consommateur, le produit fini doit contenir 0,7 % d’acide lactique au minimum et contenir 10

millions de bactéries de chaque espèce vivantes par gramme de produit (Codex Alimentarius

[norme n°A-11 (a)(1975)] et la législation française [Décret n°88-1203 du 30 décembre 1988

relatif aux laits fermentés et au yaourt ou yoghourt])

La fabrication du yaourt repose sur les interactions entre S. thermophilus et

Lb. bulgaricus. Ces deux bactéries interagissent en une symbiose complexe appelée la proto-

coopération. Bien que ces bactéries sont capables de fermenter le lait en cultures seules, la

fermentation en co-culture stimule leur métabolisme.

S. thermophilus se développe rapidement dans le lait et le rend anaérobie et légèrement

acide par la production de L-lactate. Il produit de l’acide formique, de l’acide pyruvique, de

l’acide folique et du CO2 qui stimulent la croissance de Lb. bulgaricus (Crittenden et al.,

2003; Sieuwerts et al., 2008). Ce dernier acidifie davantage le lait et par consommation des

protéines du lait, libère des peptides et des acides aminés servant à la croissance de

S. thermophilus (Sieuwerts et al., 2008). Par leur action synergique, les deux bactéries

fermentent la quasi-totalité du lactose du lait en acide lactique. Le yaourt est parfumé par du


55

diacétyle, majoritairement produit par S. thermophilus, et par de l’acétaldéhyde,

majoritairement produit par Lb. bulgaricus (Béal et Sodini, 2003; Prescott et al., 2013).

L’acidification du lait est provoquée par l’excrétion, dans le milieu extracellulaire,

d’acide lactique. Il en résulte une modification de la texture du lait qui conduit à la

gélification des caséines du lait en milieu acide. Le caractère acide modifie la durée de

conservation à froid du produit. Un lait pasteurisé se conserve quelques jours à froid alors

qu’un lait fermenté peut être conservé jusqu’à 30 jours à 4°C. La fermentation lactique permet

d’augmenter la stabilité du produit par un effet pH et un effet de compétition. En effet, un

yaourt a un pH inférieur ou égal à 4, ce qui empêche le développement des bactéries

d’altération et de la plupart des bactéries pathogènes qui sont sensibles aux pH acides. De

plus, la forte concentration des bactéries lactiques présentes permet de créer une compétition

vis-à-vis de ces bactéries indésirables, ce qui limite leur croissance. Il en découle une durée de

vie du produit plus importante qu’un lait pasteurisé (Béal et Sodini, 2003; Prescott et al.,

2013; Tamime et Robinson, 2007).

Les laits fermentés ont des propriétés nutritionnelles et organoleptiques particulières.

Les produits de fermentation secondaires, tels que l’acétaldéhyde sont responsables des

propriétés organoleptiques des yaourts (Hols et al., 2005). La fermentation lactique permet

également d’augmenter la digestibilité du lactose et des protéines, qui sont dégradés par les

bactéries lactiques (EFSA, 2010).

3.4.2. Production de fromage

En industrie fromagère, S. thermophilus est principalement utilisé dans l’affinage des

fromages à pâte pressée cuite, comme l’emmental ou le gruyère et de certains fromages à pâte

molle (Fox et al., 2004).

Il permet une acidification du caillé, cependant l’effet est modéré par l’effet tampon du

caillé, qui favorise l’effet de synérèse de celui-ci (expulsion d’eau hors du caillé). Le pH

suffisamment bas ainsi que le taux d’extrait sec suffisamment élevé, permet de faire subir au

fromage une longue période d’affinage. L’affinage contribue aux propriétés organoleptiques

du produit. Les propriétés rhéologiques du fromage sont le résultats de la protéolyse des

protéines du fromage par les enzymes libérées par les bactéries lactiques (Accolas et al.,

1980).


56

Pour l’industrie fromagère, le catabolisme des acides aminés par les flores

technologiques est une réaction importante pour la formation de composés aromatiques

donnant leurs arômes aux produits fromagers. S. thermophilus possède une activité glutamate

déshydrogénase qui permet de produire de l’α-kétoglutarate à partir du glutamate, ce qui

permet de cataboliser les acides aminés et donc de produire les composés aromatiques utiles à

la flaveur des fromages. A partir des trois acides aminés suivants: la leucine, la phénylalanine

et la méthionine, S. thermophilus est capable de produire des α-cétoacides donnant de la

flaveur aux fromages (Helinck et al., 2004; Peralta et al., 2016).


57

4. S. thermophilus, vers un nouveau probiotique?

Cette partie est écrite sous forme de revue de littérature qui sera soumise au Journal of

Functional Foods:

Ophélie Uriot, Sylvain Denis, Maira Junjua, Yvonne Roussel, Annie Dary-Mourot and

Stéphanie Blanquet-Diot. Streptococcus thermophilus: from yogurt starter to a new promising

probiotic candidate?

Pour être reconnus comme probiotiques, il est généralement admis que les micro-

organismes doivent survivre au passage du TGI et avoir des effets bénéfiques sur la santé de

l’hôte (Hill et al., 2014; Miquel et al., 2015). Après une présentation générale des

probiotiques et de S. thermophilus, cette revue fait un état de l’art des connaissances autour de

ces deux critères essentiels pour l’obtention d’une appellation probiotique (survie, effets

santé) et l’obtention d’éventuelle allégation santé.

Les études sur la capacité de survie de S. thermophilus au passage du TGI sont

classées en trois catégories: les essais cliniques chez l’Homme, les expérimentations sur

modèles animaux et les tests in vitro. Ces études ont montré que S. thermophilus pouvait

survivre au passage du TGI humain et animal mais qu’il disparaissait rapidement du TGI

lorsqu’il n’était plus consommé (García-Hernández et al., 2012; Lick et al., 2001). Les tests in

vitro ont montré une grande variabilité dans la tolérance de S. thermophilus aux stress

rencontrés lors du passage au travers du TGI et donc une survie souche-dépendante (Junjua et

al., 2016). Ceci pourrait résulter de la grande diversité de stratégies utilisées par

S. thermophilus pour résister aux stress dus, entre autres, aux pH acides et aux sels biliaires

(Zotta et al., 2008a).

Cette revue recense également les études disponibles relatant les effets bénéfiques de

S. thermophilus sur l’hôte et sur les mécanismes d’actions associés. Ces études montrent que

S. thermophilus peut jouer un rôle dans la réduction de l’intolérance au lactose (Mater et al.,

2006) et préviendrait des maladies telles que les gastrites chroniques (Rodríguez et al., 2009)

et les diarrhées associées aux rotavirus (Saavedra et al., 1994). De plus, il aurait une activité

anti-oxydante (Ito et al., 2015) et anti-inflammatoire intéressante (Donkor et al., 2012).


58

Cette revue met en avant l’intérêt de S. thermophilus en tant que probiotique mais elle

souligne surtout la nécessité d’approfondir le niveau de connaissances sur les effets

bénéfiques et sur les mécanismes d’actions de S. thermophilus sur la santé de l’hôte. En effet,

la majorité des études qui concernent S. thermophilus sont souvent réalisées soit avec un

mélange de probiotiques soit en yaourt, limitant ainsi les données disponibles sur les effets de

S. thermophilus seul. Ces données sont nécessaires pour confirmer son statut de probiotique,

surtout s’il est envisagé d’élaborer des aliments fonctionnels contenant S. thermophilus et

bénéficiant d’une allégation santé.


59

Streptococcus thermophilus: from yogurt starter to a new promising

probiotic candidate?

Ophélie Uriot1,2

, Sylvain Denis1, Maira Junjua

2, Yvonne Roussel

2, Annie Dary-Mourot

2,*,†

and Stéphanie Blanquet-Diot1,*

1EA 4678 CIDAM, Conception, Ingénierie et Développement de l’Aliment et du Médicament,

Faculté de Pharmacie, Université d’Auvergne, 63000 Clermont-Ferrand, France

2URAFPA, Unité de Recherche Animal et Fonctionnalités des Produits Animaux, Equipe

Protéolyse et Biofonctionnalité des Protéines et des Peptides, Université de Lorraine, 54506

Vandoeuvre-les-Nancy, France

* co-senior authors

† Corresponding author

Pr Annie Dary-Mourot, URAFPA, Université de Lorraine, Faculté des Sciences et

Techniques, Campus Aiguillettes, 54506 Vandoeuvre-les-Nancy, France

Tel: 03 83 68 42 67; Fax: 03 83 68 24 68

E-mail: [email protected]


61

Abstract

Probiotics are defined as live microorganisms that when administered in adequate

amount confer a health benefit to the host. To be considered as a probiotic, a bacterial strain

must not only be safe but also should survive in the human gastrointestinal tract and show

health benefits for its host. Streptococcus thermophilus is a gram positive bacterium widely

used in dairy fermentations for the production of yogurt and cheeses. In contrast with other

lactic acid bacteria, the probiotic status of S. thermophilus still remains questioned. The aim

of this review is to give an update of all the human trials, in vivo assays in animal models and

in vitro experiments that have assessed the resistance of S. thermophilus to gastrointestinal

stresses and have investigated its health positive effects. The underlying mechanisms of action

will be also described and the probiotic status of the bacteria will be debated with respect to

the available literature.

Key words: S. thermophilus, gastrointestinal survival, probiotics,


63

1. Introduction

The original hypothesis of the positive role played by certain bacteria was first

introduced by Élie Metchnikoff, who wrote in 1907 that “ A reader who has little knowledge

about such matters may be surprised by my recommendation to absorb large quantities of

microbes, as a general belief is that microbes are harmful. This belief is erroneous. There are

many useful microbes, amongst which the lactic bacilli have honorable place.” and “The

dependence of the intestinal microbes on the food makes it possible to adopt measures to

modify the flora in our bodies and to replace the harmful microbes by useful microbes.”

(Metchnikoff, 1907). From Metchnikoff till date, the probiotic concept has drastically evolved

and different definitions of probiotics have been proposed (Table 1). For example, in 1953,

the word “probiotika” was used by Werner Kollath to designate organic and inorganic

supplements necessary to restore health to patients suffering from a form of malnutrition

caused by the consumption of highly refined food (Kollath, 1953). One year later, Ferdinand

Vergin proposed that probiotics were the opposite of antibiotics (Vergin, 1954). In 1965, the

work of Lilly and Stillwell (Lilly and Stillwell, 1965) gave a new dimension to the definition

of probiotics. They observed that certain secretions of Colpidium campylum increased

consistently the growth of Tetrahymena pyriformis and consequently defined probiotic as “the

secretions of one microorganism which stimulate the growth of another microorganism”.

Similarly, in 1971, Sperti used the term probiotics to refer to tissue extracts capable of

stimulating microbial growth (Sperti, 1971). In 1974, the word probiotic was used for the first

time to describe a microbial feed/food supplement and defined as “organisms and substances

contributing to the intestinal microbial balance” (Parker, 1974). In 1992, Fuller removed the

word “substances” from the probiotic’s definition and emphasized on their viability defining

probiotics as “live microbial feed supplements which beneficially affect the host animal by

improving microbial balance” (Fuller, 1992). Considering that this definition was not wide

enough to cover the entire indigenous microflora, another definition was proposed by

Havenaar and Huis in‘t Veld (Havenaar and Huis in’t Veld, 1992). According to them,

“probiotics are the viable mono- or mixed microbial cultures which when applied to animal or

man have beneficial effects on their host by improving the properties of indigenous

microflora”. In 1996, the cultured dairy products were also added in the probiotic concept and

Schaafsma defined them as “living microorganisms which when ingested in certain numbers

exert health benefits beyond inherent basic nutrition” (Schaafsma, 1996). This definition was

confirmed in 2002 by the Food and Agriculture Organization (FAO) of the United Nations


64

and World Health Organization working group (FAO/WHO, 2002) stating that probiotics are

“live microorganisms which when administered in adequate amounts, confer a health benefit

on the host”, and reconfirmed by the FAO in 2006. In 2014, this definition was revised with

minor grammatical correction by an expert panel of the International Scientific Association

for Probiotics and Prebiotics as, “live microorganisms that, when administrated in adequate

amounts, confer a health benefit on the host” (Hill et al., 2014). In 2015, a framework was

also proposed for the characterization of novel probiotic bacteria and the assessment of their

safety and efficacy in accordance with European health policy (Miquel et al., 2015).

Table 1: Evolutionary stages of probiotic definitions (adapted from Vasiljevic and Shah,

2008)

Year Description Sources

1907 First hypothesis of a positive role for certain bacteria Metchnikoff, 1907

1953 First use of the word “probiotika” which appoints organic and

inorganic supplements necessary to restore health

Kollath, 1953

1954 Probiotics are defined as opposite of antibiotics Vergin, 1954

1955 Probiotics can be effective against the deleterious effects of

antibiotics

Kolb, 1955

1965 Substances secreted by one microorganism which stimulate the

growth of another one

Lilly and Stillwell,

1965

1971 Tissue extracts able to stimulate microbial growth Sperti, 1971

1973 Compounds that build resistance to infections in the host but do not

inhibit the growth of microorganisms in vitro

Fujii and Cook,

1973

1974 Organisms and substances contributing to the microbial balance in

the intestine

Parker, 1974

1992 Live microbial feed supplements which beneficially affect the host

animal by improving microbial balance

Fuller, 1992

1992 Viable mono- or mixed culture of live microorganisms which, when

applied to animals or man, have a beneficial effect on the host by

improving the properties of the indigenous microflora

Havenaar and Huis

in’t Veld, 1992

1996 Live microbial culture or cultured dairy product which beneficially

influence the health and nutrition of the host

Salminen, 1996

1996 Living microorganisms which, upon ingestion in certain numbers,

exert health benefits beyond inherent basic nutrition

Schaafsma, 1996

1999 Microbial cell preparations or components of microbial cells that

have a beneficial effect on the health and well-being of the host

Salminen et al.,

1999

2001 A preparation or a product containing viable, defined

microorganisms in sufficient numbers, which alter the microflora

(by implantation or colonization) in a compartment of the host and

in this way exert beneficial health effects on this host

Schrezenmeir and

de Vrese, 2001

2002 Live microorganisms which when administered in adequate

amounts, confer a health benefit on the host

FAO/WHO, 2002

2014 Grammatical adjustment of the FAO/WHO definition: live

microorganisms that, when administered in adequate amounts,

confer a health benefit on the host

Hill et al., 2014

2015 List of criteria that should be assessed to obtain marketing

authorization and health claim for probiotic bacteria in accordance

with European health policy

Miquel et al., 2015


65

Numerous health benefits resulting from the ingestion of probiotics have been

claimed. Some of them were observed in animal models and are expected to occur in humans

as well, while others have been specifically proved through human trials (Table 2). Some of

the main health related benefits of probiotic consumption are: prevention and treatment of

diarrhea symptoms, prevention of irritable bowel diseases, colitis and necrotizing enterocolitis

and relief in lactose intolerance (Di Cerbo et al., 2016; Hill et al., 2014; Nagpal et al., 2012;

Vasiljevic and Shah, 2008). In addition, certain probiotic bacteria have been recommended for

the treatment of extra-intestinal pathologies such as atopic dermatitis, hypercholesterolemia or

allergies (Boyle and Tang, 2006; Di Cerbo et al., 2016; Vasiljevic and Shah, 2008). Overall,

these health effects are highly strain-dependent and there is not a single probiotic strain which

can confer all the benefits previously reported (Senok et al., 2005; Shah, 2007). Even if

certain mechanisms began to be described in the literature, such as the anti-pathogenic

activities, which include direct antagonism, immunomodulation and competitive exclusion

(Preidis et al., 2011), all the mechanisms of action of probiotics are far from being elucidated.

However, it is yet known that after their consumption probiotics may exert their beneficial

actions by influencing the intestinal luminal environment, epithelial and mucosal barrier

function as well as immune system (Nagpal et al., 2012).

It is widely admitted that probiotics must survive through the human gastrointestinal

tract (GIT) to exert their beneficial health effects. Therefore, they must resist to

gastrointestinal stresses, such as low pH, bile salts and pancreatic secretions. Besides, the dose

required for a probiotic effect is still debated, due to fluctuations depending on both the strain

and the target. Nevertheless, the minimal concentration of cells needed to obtain a clinical

effect was quoted to be 106 CFU/mL in the small bowel and 10

8 CFU/mL in the colon

(Minelli and Benini, 2008). Probiotics can be commercialized as freeze dried or encapsulated

microorganisms (in form of tablet, capsule or powder) or integrated into food products

(Foligné et al., 2013). Hitherto, fermented food and especially dairy products are the main

vectors of probiotic administration to humans (Nagpal et al., 2012). The mode of

administration can highly affect the persistence of the probiotic in the human GIT (Blanquet-

Diot et al., 2012; Pitino et al., 2012; Possemiers et al., 2010).


66

Table 2: Main bacterial and yeast probiotics and their health effects, as observed in

animal models or during human trials

Effects on health Strains Human

trial

Animal

models

References

Prevention of diarrhea B. bifidum (LMG-P17500) Yes Beniwal et al., 2003;

Bowen et al., 2007;

Canani et al., 2007;

Di Cerbo et al., 2016;

Korpela et al., 2016;

O’Callaghan and van Sinderen, 2016;

Saavedra et al., 1994, 2004;

Shah, 2007;

Trabelsi et al., 2016

B. breve (K-110) Yes Yes

B. infantis (CECT7210) Yes Yes

B. lactis (B94; Bb12) Yes

B. longum (SBT-2828) Yes Yes

Lb. acidophilus (CERELA; DSM21007;

GP1B; La-5; LMG-P17549)

Yes Yes

Lb. bulgaricus (LMG-P17550) Yes Yes

Lb. casei (CERELA; DN-114001;

Shirota)

Yes Yes

Lb. fermentum (353; KLD) Yes

Lb. plantarum (2017405; TN8) Yes Yes

Lb. reuteri (DSM-12246; DSM-17938) Yes

Lb. rhamnosus (35; E/N; GG; Oxy; Pen) Yes Yes

S. boulardii (It) Yes

S. thermophilus (LMG-P17503) Yes Yes

Prevention of

inflammatory bowel

diseases

B. breve (M-16V) Yes Guandalini et al., 2010;


Shah, 2007

B. longum Yes

B. infantis Yes

Lb. acidophilus Yes

Lb. plantarum Yes Yes

Lb. casei Yes

Lb. bulgaricus Yes

S. thermophilus Yes

Prevention of gastric

diseases and H. pylori

infections

B. bifidum Yes Di Cerbo et al., 2016;

Hauser et al., 2015;

Hurduc et al., 2009;

Shah, 2007;

Wang and Huang, 2014

B. breve (Bb99) Yes

B. lactis (Bb12) Yes

B. longum (HY8001) Yes

Lb. acidophilus (HY2177; La5; LB; NAS) Yes

Lb. casei (DG; DN-114001; HY2743,

Shirota)

Yes

Lb. gasseri (OLL2716) Yes

Lb. johnsonii (La1; No1088) Yes Yes

Lb. paracasei (F19) Yes

Lb. reuteri (ATCC55730;

ATCCPTA6475; DSM17938)

Yes

Lb. rhamnosus (GG; LC705) Yes

P. freundenreichii subsp. shermanii (JS) Yes

S. boulardii Yes

S. thermophilus (B-1) Yes

Oral health effect Lb. brevis (CD2) Yes Campus et al., 2014;

Hasslöf et al., 2013;

Näse et al., 2001;

Stensson et al., 2014;

Teanpaisan and Piwat, 2014

Lb. paracasei (F19; SD1) Yes

Lb. reuteri (ATCC55730) Yes

Lb. rhamnosus (GG) Yes

Alleviation of lactose

intolerance

Lb. bulgaricus Yes EFSA, 2010

S. thermophilus Yes

Prevention of respiratory

tract infections

B. lactis (Bi-07) Yes Di Cerbo et al., 2016;

Guillemard et al., 2010;

Leyer et al., 2009;

Makino et al., 2010

Lb. acidophilus (NCFM) Yes

Lb. bulgaricus (OLL1073R-1) Yes

Lb. casei (DN-114001) Yes

Lb. pentosus (b240) Yes


67

Effects on health Strains Human

trial

Animal

models

References

Prevention of urogenital

infections

Lb. acidophilus (LA02) Yes Di Cerbo et al., 2016

Lb. brevis (CD2) Yes

Lb. fermentum (LF10; LF15; LN99; RC-

14)

Yes

Lb. gasseri (LN40; Lba EB01-DSM

14869)

Yes

Lb. plantarum (FV9; LP01; P17630) Yes

Lb. reuteri (CRL1324) Yes

Lb. rhamnosus (GR-1; Lbp PB01-DSM

14870; LN113)

Yes

Lb. salicinius (FV2) Yes

P. acidilactici (LN23) Yes

Prevention of allergy and

dermatitis

B. adolescentis Yes Di Cerbo et al., 2016;

Giovannini et al., 2007;

Koyama et al., 2010;

Shah, 2007;

West et al., 2009

B. bifidum Yes

B. breve (BR03) Yes

Lb. acidophilus (L-92) Yes

Lb. casei (DN-114001; Shirota) Yes

Lb. gasseri (SBT0270;SBT0274) Yes

Lb. paracasei (F19; LP-33) Yes

Lb. reuteri (CRL1098) Yes

Lb. rhamnosus (GG; GR-1) Yes

Lb. salivarius (LS01) Yes

Antimutagenic and

anticarcigenic properties

B. animalis (DN-173010) Yes Di Cerbo et al., 2016;


Shah, 2007

B. lactis (Bb12; LAFTI-B94) Yes Yes

B. infantis (ATCC15697) Yes

B. longum (25; 913; BB536) Yes

E. faecalis Yes

Lb. acidophilus (145; LAFTI-L10;

NCFM)

Yes Yes

Lb. brevis (CD2) Yes

Lb. bulgaricus (291) Yes

Lb. casei (CRL431) Yes

Lb. rhamnosus (GG; LC705) Yes Yes

P. freundenreichii subsp Shermanii Yes

S. thermophilus (DN-001158; F4; V3) Yes

Antioxidant activities B. bifidum (ATCC29521) Yes Bouhafs et al., 2015;

Di Cerbo et al., 2016;

Ito et al., 2003, 2008, 2015;

Terahara et al., 2001;

Tian et al., 2015;

Vieira et al., 2015;

Wang et al., 2016

B. lactis (DSMZ23032) Yes

B. longum (51A) Yes

Lb. acidophilus (DSMZ23033) Yes

Lb. brevis (DSMZ23034) Yes

Lb. bulgaricus (2038) Yes

Lb. plantarum (BJ0021) Yes

Lb. rhamnosus (CCFM1107) Yes

S. thermophilus (YIT2001) Yes

Modulation of the immune

system

B. breve (YIT4064) Yes Ogita et al., 2015;

Palma et al., 2015;

Shah, 2007

Lb. casei (Shirota) Yes

Lb. rhamnosus (OLL2838) Yes

S. boulardii (LV01) Yes

S. cerevisiae (CNCMI-3856; LV02;

UFMG905)

Yes

Hypocholesterolemic

effect

B. lactis Yes Di Cerbo et al., 2016

Lb. acidophilus (L1) Yes

Lb. plantarum (CECT7527; CECT7528;

CECT7529)

Yes

Lb. reuteri (NCIMB 30242) Yes


68

Many of probiotics currently used come from human intestine. Among them, it can be

found lactic acid bacteria (LAB) such as Lactobacillus (e.g., Lactobacillus (Lb.) acidophilus,

Lb. rhamnosus and Lb. casei), Bifidobacterium (e.g., Bifidobacterium (B.) lactis, B. bifidum

and B. breve) or Enterococci (e.g., Enterococcus (E.) faecalis) and some species of fungi

(e.g., Saccharomyces (S.) boulardii and S. cerevisiae). Among LAB, Streptococcus (S.)

thermophilus or Lb. delbrueckii subsp. bulgaricus, which are traditionally used in dairy

production, have not been considered as probiotics during a long time by most scientists as

they were not expected to survive in the GIT (Senok et al., 2005). However, in 2010, yogurt

which is the product of milk fermentation by these two bacteria has obtained the European

Food Safety Agency (EFSA) scientific substantiation of health claim for lactose digestion

improvement. The target population is individuals with maldigestion and the yogurt should

contain at least 108 CFU live starter microorganisms per gram of fermented product (EFSA,

2010). Even if yogurt properties are recognized by EFSA, the probiotic status of

S. thermophilus itself is still questioned.

In this context, the aim of the present review is to give an update on the probiotic

status of S. thermophilus by summarizing the current published information related to its

ability to survive in the digestive environment and its beneficial effects on host health.

2. S. thermophilus: a key LAB in dairy production

S. thermophilus is a Gram-positive bacterium showing ovoid cells occurring in pairs or

in short chains. It is a thermophilic bacterium with an optimal growth temperature of 42°C

and an aero-tolerant anaerobe organism. S. thermophilus belongs to the salivarius group

which also includes S. salivarius and S. vestibularis (Facklam, 2002; Gao et al., 2014). The

genome of S. thermophilus is about 1.8 Mb (Bai et al., 2016; Bolotin et al., 2004; Makarova

et al., 2006; Sun et al., 2011), making it among the smallest genomes by comparison to other

LAB and other Streptococcus strains. Genetic studies indicate that S. thermophilus

individualized from other pathogenic Streptococcus species about 7,000 years ago (Delorme

et al., 2010, Rasmussen et al., 2008). Since the S. thermophilus species diverged from their

pathogenic relatives, they have lost most of the genes responsible for virulence and have

acquired several genes useful for living in milk (Hols et al., 2005). Analysis of different

S. thermophilus genomes revealed genes acquired through horizontal transfer events and

encoding various proteins, such as proteins involved in bacteriocin biosynthesis or

efflux/uptake pumps, cell-envelope protease and proteins involved in peptide uptake or in


69

exopolysaccharide biosynthesis (Bolotin et al., 2004; Delorme et al., 2010; Liu et al., 2009;

Rasmussen et al., 2008).

S. thermophilus is the only Streptococcus species used in food industry. Because it has

been consumed by humans for centuries without giving any diseases, it is also the only

Streptococcus species to be recognized as a Generally Recognized As Safe bacterium by the

Food and Drug Administration (FDA). Adapted to milk, S. thermophilus is one of the basic

starter bacteria of yogurt and is the second most important species of industrial LAB after

Lactococcus lactis. Besides the traditional use of S. thermophilus in preparation of yogurt, it is

used in production of several cheese varieties such as Emmental, Camembert, Brie,

Mozzarella and Parmesan (Fox et al., 2004; Hols et al., 2005). In yogurt production, the main

role of S. thermophilus is a rapid acidification related to lactic acid production, but also the

production of secondary fermentation products such as formate (Perez et al., 1991),

acetaldehyde or diacetyle which contribute to the aromatic and textural properties of the

fermented products. In a yogurt starter culture, the interactions between S. thermophilus and

Lb. bulgaricus are described by the ecological term proto-cooperation (Hols et al., 2005)

which is a symbiotic relationship between the two species. S. thermophilus produces CO2 and

formic acid which stimulate the growth of Lb. bulgaricus while Lb. bulgaricus hydrolyses

milk proteins releasing peptides and amino acids that improve S. thermophilus growth

(Sieuwerts et al., 2008). In cheese industry, S. thermophilus is mainly used in the refining of

hard cheeses through the production of aromatic compounds from amino acids due to its

glutamate dehydrogenase activity (Helinck et al., 2004).

3. Survival of S. thermophilus in the digestive environment

For a probiotic strain, survival in the human GIT is often considered as a key factor to

ensure the assigned health effect. Studies on the survival of S. thermophilus in the digestive

environment were performed in different models: in human, in animal and in vitro (Table 3).

Each model brings specific information on the survival of S. thermophilus as described below.


70

Table 3: Overview of S. thermophilus survival studies in the digestive environment: human trials, in vivo assays in animal models and in

vitro experiments

Studies Materiels and Methods Mains results

Human Subjects Feeding strategies Enumeration

Pochart et al., 1989 10 healthy adults single intake of 430 g of yogurt Viable count by plating from duodenal

samples

1.6×103 bacteria/g detected at 90 min in all the volunteers. 10

9 cells of the total 10

11

ingested cells survived the stomach and reached the small intestine

Pedrosa et al., 1995 33 elderly peoples 240 g of yogurt twice a day, during

12 days

Viable count by plating from gastric,

duodenal and fecal samples

No viable S. thermophilus detected in the gastric, duodenal and fecal samples

Venturi et al., 1999 20 UCr patients 3 g of VSL-3 twice a day, during 1

year

Viable count by plating from fecal

samples

7.88 log10 CFU/g of feces reached at days 20 and then remaining stable throughout the

study. Disappeared 15 days after treatment suspension

Brigidi et al., 2003 10 healthy adults

10 IBD-patients

250 g of yogurt/day or 6 g of VSL-

3/day, during 10 days or 2 months

Direct quantitative PCR detection in

fecal samples

Healthy patients: reached 4×105 cells/g of feces (3 days, yogurt) or 5×10

6 cells/g of

feces (13 days, VSL-3); disappeared 6-9 days after treatment suspension

IBD-patients: reached 107 cells/g of feces after 2 months (VSL-3)

del Campo et al.,

2005

114 healthy adults 375 g/day of pasteurized or fresh

yogurt during 2 weeks

PCR detection in fecal samples No S. thermophilus detected in the fecal samples

Mater et al., 2005 13 healthy adults 125 mL of yogurt thrice a day,

during 12 days


samples

6.3×104 CFU/g of feces detected in 82 % of samples

Elli et al., 2006 20 healthy adults 125 g of yogurt twice a day, during

1 week

Viable count by plating, PCR detection

in fecal samples

5.6 log10 CFU/g of feces detected on day 7 in only one subject

Ballesta et al., 2008 Healthy adults Pasteurized or fresh yogurt, during

75 days

Viable count by plating, DNA detection

in fecal samples

No viable S. thermophilus detected in the fecal samples

García-Hernández et

al., 2012

30 healthy adults 250 g of yogurt/day, during 4

weeks

Viable count by DVC-FISH from fecal

samples

Between 3.11 and 3.72 log10 CFU/g detected in week 2, between 3.46 and 4.48 log10

CFU/g in week 3 and between 3.76 and 4.66 log10 CFU/g in week 4. Disappeared 4

weeks after treatment suspension

Animal Models Feeding strategies Enumeration Mains results

Lick et al., 2001 6 fistulated

Göttingen minipigs

single intake of 600 g yogurt Viable count by plating and PCR

detection from ilea digesta

Between 106 and 10

7 CFU/g of digesta detected between 3 and 6 h. Disappeared

rapidly after 8 h

Dilmi-Bouras and

Sadoun, 2002

12 male rabbit 10 mL of yogurt twice a day,

during 4 days

Viable count by plating from gastric,

duodenal and fecal samples

5.2×108 CFU/mL of gastric samples and 6×10

6 CFU/mL of duodenal samples reached

after 1 h and 2 h, resp., and remaining stable throughout the study. 9.0×107 CFU/mL

reached after 72 h in fecal samples. Disappeared 96 h after treatment suspension

Drouault et al., 2002 6 GF-mice single intake of 0.5 mL milk

cultures


samples

Did not multiply and did not settle in GIT of mice. Transited with the meal.

Mater et al., 2006 GF- and HMA-mice single intake of 0.5 mL milk

cultures

Viable count by plating from small

intestine and colon samples

107-10

8 CFU/g reached after 2.5 h then disappeared after 10 h in the small intestine

and 106-10

7 CFU/g reached after 2.5 h in the colon of the GF-mice. 10

7-10

8 CFU/g

reached after 1 h then disappeared after 6 h in the small intestine and reached 107

CFU/g after 2.5 h in the colon of the HMA-mice

Iyer et al., 2010a 32 male albino mice 30 g of fermented milk/day during

20 days

Viable count by plating and PCR

detection in small and large intestine

and fecal samples

No viable cell detected in the small intestine. 5 log10 CFU/g detected in the large

intestine and 8 log10 CFU/g of feces. Disappeared gradually after the end of the

feeding period

Thomas et al., 2011 19 GF-rats single intake of 1 mL milk cultures Viable count by plating from fecal

samples

Colonized the ileum and the colon. 109-10

10 CFU/g of feces reached in week 1 with

lactose and 108-10

9 CFU/g of feces in week 3 without lactose

Ben-Yahia et al.,

2012

23 male GF-rats single intake of 1 mL of milk

cultures


samples

Colonized the GIT without lactose: progressively to 2×108 CFU/g of feces; with

lactose: enhancement to 7.1×109 CFU/g of feces


71

Studies Materiels and Methods Mains results

In vitro Strains Models Enumeration

Marteau et al., 1997 ST20 TIM model: dynamic stomach and

small intestinal model

Duration of digestion 6 h at 37°C.

Kinetics of gastric and intestinal pH.

Viable count by plating

Survival decreased rapidly and dropped below 1 % after 70 min in the gastric

compartment. 12 % survival at 70 min in the duodenal compartment and < 5 %

survival at 120 min in the ileal compartment and the count remained stable

Vinderola and

Reinheimer, 2003

8 strains Simulated gastric juice: pH 2 or 3.

Bile salts: 0.3, 0.5 or 1 %

Incubation 37°C for 3 h (pH) or 24 h

(bile salts). Viable count by plating

Loss of 4-5.3 log10 CFU/mL for 6 strains and > 6 log10 CFU/mL for 2 strains at pH 3.

Loss of > 6 log10 CFU/mL for the 8 strains at pH 2 (3 h). Inhibition of growth at 0.5 %

and 1 % of bile and growth < 10 % at 0.3 % bile (24 h)

Mozzi et al., 2009 CRL1190 and M16 GS model (mouth and stomach

model)

Duration of digestion 2.5 h at 37°C.

Kinetics of gastric pH. Viable count by

plating

8.6 log10 CFU/mL detected at pH 4.4 and 7.4 log10 CFU/mL at pH 3 for CRL1190 and

8.7 log10 CFU/mL at pH 4.4 and 8.0 log10 CFU/mL at pH 3 for M16. No significant

loss

Boke et al., 2010 2 high and 2 low

EPS-producing

strains

pH tolerance 2, 2.5, 3 or 6.2; bile

salts resistance: 0.15 or 0.3 %

Incubation 40°C for 2 h. Viable count

by plating from samples

No viable cell detected at pH 2-2.5 and < 7 % survival with 0.15 % and 0.3 % bile

salts for low EPS-producing strains. 30-45 % survival at pH 2 and 71 % survival with

0.3 % bile salts for high EPS-producing

Iyer et al., 2010a RD102 and RD104 pH 2, 3 or 4; bile salts: 0.5, 1 or

2%. Gastrointestinal stress: gastric

juice pH 1.5, 2 or 3 with or without

pancreatic juice 0.5, 1 or 2 % of

bile salts

Incubation 37°C for 2 h (pH); 3 h (bile

salts); 3 h (gastrointestinal stress).


Few or no viability loss at different pH (2 h) and different bile concentrations (3 h) for

both strains.

Few or no viability loss at pH 2 and 3 with or without pancreatic juice for both strains.

Total loss of viability at pH 1.5 with or without the pancreatic juice for both strains

for gastrointestinal stress conditions

Ziarno, 2010 12 strains Simulated gastric juice: pH 2.4;

simulated duodenal juice: 17 g/L

bile

Incubation 37°C for 5 h (gastric) or 6 h

(duodenum). Viable count by plating

Loss of 1.6 to 3.8 log10 CFU/mL after 5 h in gastric fluid.

Loss of 2.6 to 3.8 log10 CFU/mL after 6 h in duodenal fluid

García-Hernández et

al., 2012

CECT801 Simulated gastric juice: pH 2;

simulated pancreatic juice: pH 8

Incubation for 3 h or 6 h. Viable count

by DVC-FISH

10.9 % survival after 3 h in the simulated gastric juice and decreased of 15 % of

survival in the simulated pancreatic juice after 6 h

Fang et al. , 2013 Cold- or non-

shocked BCRC

14085

Simulated gastric juice: pH 2, 2.5,

2.8 or 3. Bile salts: 2 %

Incubation 37°C for 4 h or 12 h. Viable

count by plating

No viable cell detected at pH 2 after 1 h and at pH 2.5 after 1-2 h for cold- or non-

shocked strains. Detected few or no viability loss at pH 2.8 and 3 and with 2 % bile

salts

Ziar et al., 2014 TA040 Bile salts: 0, 2, 3, 4 g/L, six

different carbohydrates (5 g/L)


by plating

Loss of 0.5 to 1.5 log10 CFU/mL with 3 or 4 g/L bile. Bacterial survival more affected

in the presence of glucose (loss of 2 log10 CFU/mL at 4 g/L bile) than with lactose,

raffinose, lactulose, pectin or lactulose

Junjua et al., 2016 30 strains pH 2 and 4; bile salts: 0.5 g/L of

sodium cholate and 0.5 g/L of

sodium deoxycholate

Incubation 37°C for 1 h (stress).

DO600nm measure for 20 h (post-stress)

Comparison between non-stressed and stressed cell. Revealed great diversity of

resistance to the GIT stress between strains

Kebouchi et al., 2016 LMD-9 BSM: 0, 0.25, 0.5, 1, 1.5, 2, 3, 4, 5,

and 10 mM


by plating.

Significant loss of 5 log10 CFU/mL observed at 3 mM and no viable cell detected for

concentration higher than 3 mM

Uriot et al., 2016 4 strains; 2 food

matrix: non- and

fermented milk

TIM model: dynamic stomach and

small intestinal model

Duration of digestion 5 h at 37°C.

Kinetics of gastric and intestinal pH.


Loss of viability when gastric pH reached 2.5 at 45 min and global loss of 2-4 log10

CFU for 3 tolerant strains. At the end of digestion, counts below 1 log10 CFU for the

CNRZ21 sensitive strain in all the digestive compartments. 6.1 and 8.5 log10 units for

the sensitive and the 3 tolerant strains, resp., in the cumulative ileal effluents. Higher

survival in fermented milk (1.6 %) vs non-fermented milk (0.4 %) for LMD-9

DVC: Direct viable count; BSM: equimolar bile salt mixture containing sodium taurocholate, sodium cholate, and sodium deoxycholate; EPS: Exopolysaccharide; FISH: Fluorescent in situ

hybridization; GF: germ-free; GIT: Gastro-intestinal tract; GS: in vitro gastric system; HMA: human microbiota associated; IBD: inflammatory bowel diseases; PCR; Polymerase chain reaction;

TIM: TNO gastrointestinal model; UCr: ulcerative colitis in remission; VSL-3: preparation of probiotics


72

3.1. Human trials

To investigate the survival of probiotics in human digestive environment, clinical trials

are obviously the ideal way. However, these studies remain costly and heavy to implement

since they must meet very strict criteria. The survival of S. thermophilus during transit

through the human GIT remained controversial for a long period. Several studies suggested

that S. thermophilus did not survived the passage of the human GIT (Ballesta et al., 2008; del

Campo et al., 2005; Pedrosa et al., 1995) while other ones showed the opposite (Elli et al.,

2006; García-Hernández et al., 2012; Mater et al., 2005; Pochart et al., 1989; Venturi et al.,

1999). In the studies from Pedrosa et al. (1995), Del Campo et al. (2005) and Ballesta et al.

(2008), fecal samples were collected from volunteers after consumption of yogurt. Detection

of S. thermophilus was done by plating on agar or by specific polymerase chain reaction

(PCR), but no cell could be detected in the feces of volunteers. On the contrary, Pochart et al.

(1989) established that S. thermophilus S85 had the capacity to survive the passage through

the upper GIT, with at least 109 of the total 10

11 ingested cells that could survive the stomach

and reach the small intestine. Other studies detected viable S. thermophilus in the feces of the

volunteers at concentrations ranging between 3.5 and 5.6 log10 CFU/g of feces after ingestion

of 10-11 log10 CFU (Elli et al., 2006; García-Hernández et al., 2012; Mater et al., 2005;

Venturi et al., 1999). The concentration of viable S. thermophilus in the feces rapidly

increased to reach a plateau. Yet, one or two weeks after suspension of yogurt consumption,

S. thermophilus counts dropped below the detection limit (García-Hernández et al., 2012;

Venturi et al., 1999). Similar results were obtained using a PCR-detection method, with

S. thermophilus disappearing completely from feces 3-9 days after stopping consumption

(Brigidi et al., 2003). At least two different elements may explain the contradictory results

between the detection and the non-detection of viable S. thermophilus in feces presented

above: the type of medium used to detect S. thermophilus living cells in the feces during

plating, and the strains used in these experiments. Indeed, Elli et al. (2006) have shown that

the detection of S. thermophilus in feces was strongly dependent on the medium used, and it

was observed in vitro (see below) that the survival of S. thermophilus in the digestive tract

strongly varied from a strain to another (Junjua et al., 2016; Uriot et al., 2016).

These studies showed that S. thermophilus can survive the passage through the human

GIT and be found alive in the feces of people after consumption. It quickly disappeared after

cessation of ingestion, compared to other LAB still present in the feces when S. thermophilus

has already disappeared (Venturi et al., 1999). Nevertheless, very few data are available on


73

the survival of S. thermophilus throughout the different compartments of the human GIT and

none of these studies has investigated the survival of the bacteria when ingested alone (only

within a yogurt or a mix of probiotic bacteria). In addition, based on published data in

humans, it is most of time impossible to calculate a specific survival rate for S. thermophilus.

3.2. In vivo studies in animal models

Animal experimentation provides a good alternative to human clinical studies and can

be used to predict what would happen in human GIT and apprehend what mechanisms are

involved. However, animal digestive physiology remains different from that of human and the

results obtained in animals cannot be directly transposed to humans. To determine the

capacity of S. thermophilus to survive digestive conditions, different animal models were

used: minipigs (Lick et al., 2001), rabbits (Dilmi-Bouras and Sadoun, 2002), mice (Drouault

et al., 2002; Iyer et al., 2010a; Mater et al., 2006) and rats (Ben-Yahia et al., 2012; Thomas et

al., 2011). The results obtained in the first three models matched those found in humans:

S. thermophilus survived through the GIT and quickly disappeared from feces samples after

cessation of consumption. The results obtained by Mater et al. (2006) suggested that the

disappearance of S. thermophilus from the GIT may be due to competition with intestinal

microbiota. In their study, the survival of S. thermophilus FBI3 was evaluated in germ-free

(GF) and human-microbiota associated (HMA) mice. When S. thermophilus was no longer

administered, it disappeared faster from the small intestine of HMA-mice (6 h) than from that

of GF-mice (10 h). Nevertheless, these results must be considered with caution as other

studies in germ-free animals have found contradictory results. Drouault et al. (2002)

concluded that S. thermophilus FBI3 was not able to settle in GF-mice while S. thermophilus

LMD-9 and LMG18311 were colonizing the ileum and colon of GF-rats and colonization was

improved by lactose ingestion (Ben-Yahia et al., 2012; Thomas et al., 2011). Thomas et al.

(2011) and Ben Yahia et al. (2012) also underlined the importance of glycolytic enzymes and

lactose transporters in the ability of S. thermophilus to adapt to the digestive environment and

colonize the GIT of rats.

Taken together, these data showed that in vivo studies in animals may provide helpful

additional information, not only on S. thermophilus survival in the GIT environment but also

on the factors required to improve its survival or its metabolic state. Nevertheless, the results

obtained seemed to vary depending on the animal models and therefore should be confirmed

before extrapolation to the human situation.


74

3.3. In vitro experiments

For ethical, regulatory, technical and cost reasons, in vitro assays can be

advantageously used as an alternative to in vivo experiments. Such in vitro assays have

allowed a better understanding of the effect of selective parameters of digestion, such as pH

and bile salts, on S. thermophilus survival.

Depending on the strains and pH conditions (from 1.5 to 4), large variations in

S. thermophilus survival was observed (Boke et al., 2010; Fang et al., 2013; García-

Hernández et al., 2012; Iyer et al., 2010a; Junjua et al., 2016; Mozzi et al., 2009; Vinderola

and Reinheimer, 2003; Ziarno, 2010). However, overall, most of strains were sensitive to pH

equal or lower than 3. Similarly, the resistance of S. thermophilus to bile salts (bovine or

porcine bile salts) was shown to be widely strain-dependant (Boke et al., 2010; Fang et al.,

2013; García-Hernández et al., 2012; Iyer et al., 2010a; Junjua et al., 2016; Vinderola and

Reinheimer, 2003) even if most of the strains were sensitive to bile salts concentrations higher

than 0.5 % w/v. Kebouchi et al. (2016) have further investigated the effect of different

concentrations of bile salts (0, 0.25, 0.5, 1, 1.5, 2, 3, 4, 5 and 10 mM) including taurine-

conjugated bile salts (tauracholate) and unconjugated bile salts (cholate and deoxycholate) on

S. thermophilus LMD-9 and showed that the strain was resistant to bile salts up to 3 mM (eq

1.5 %). In addition, Ziar et al. (2014) and Boke et al. (2010) have shown that carbon sources

and bacterial factors may influence the ability of S. thermophilus to survive to pH and bile

stresses. Bacterial survival was more affected by bile salts in the presence of glucose

compared to lactose, mannitol, raffinose, pectin or lactulose. In particular, they showed that

S. thermophilus TA040 displayed the same population level with 4 g/L bile or without bile

when lactose was added to the incubation medium (Ziar et al., 2014). Boke et al. (2010) also

showed that two high exopolysaccharide (EPS)-producing S. thermophilus strains had a better

resistance to acid pH and bile salts than the two low EPS-producing strains.

Interestingly, Junjua et al. (2016) have classified into six categories thirty strains of

S. thermophilus according to their tolerance to acidic pH, bile salts and H2O2 as well as their

adhesion capacity to HT29-MTX intestinal epithelial cells. Adhesion capacity is an important

criterion for probiotic strains as it may increase their ability to colonize the digestive tract.

According to Junjua et al. (2016), class 1 (8 strains) and 2 (5 strains) possess low adhesion

capacity and low resistance to bile salts and H2O2. Members of class 3 (4 strains) and 4 (8

strains) resisted well to bile salts and H2O2 but had a low capacity of adhesion. The two


75

strains of class 5 resisted well to acid stress and displayed the higher adhesion capacities. The

three strains that were able to resist to pH 2 constituted the class 6.

Even if they bring valuable information about S. thermophilus sensitivity to specific

parameters of digestion, such simple in vitro conditions remain far from the complexity of

human digestive physiology. Alternatively, dynamic in vitro models which more closely

reproduce the human digestive environment may be used. Then, the survival capacity of

S. thermophilus was evaluated in the dynamic multi-compartmental TNO gastrointestinal

model (TIM) which is currently the most complete simulator of the human stomach and small

intestine (Blanquet-Diot et al., 2012; Minekus et al., 1995). This model integrates the main

parameters of human digestion such as pH, body temperature, gastric and ileal deliveries,

peristaltic mixing and transit, gastric, biliary and pancreatic secretions, passive absorption of

water and digestion products (Blanquet-Diot et al., 2012). In this model, Marteau et al. (1997)

have shown that 12 % of ingested S. thermophilus ST20 were able to reach the duodenum,

while less than 5 % were recovered in the ileal effluents. Among the four LAB strains tested

(S. thermophilus, B. bifidum, Lb. acidophilus and Lb. bulgaricus), S. thermophilus was the

more sensitive to gastrointestinal passage. In another recent study using the same in vitro

model, Uriot et al. (2016) have confirmed the low survival rate of S. thermophilus strains,

especially in the small intestine, with recovery percentages in the ileal effluents less than 1 %.

Nevertheless, it is important to mention that bacterial amounts in the ileal effluents of the TIM

ranged from 6 to 8.5 CFU log10, which is supposed to be high enough to exert a probiotic

activity (Minelli and Benini, 2008). These experiments in the TIM system also confirmed that

the survival of S. thermophilus is highly strain-dependent: three of the tested strains LMD-9,

PB18O and EBLST20 showed significantly higher survival capacities to GIT conditions than

the fourth one CNRZ21 (Uriot et al., 2016). This difference was attributed to the lack of heat

shock protein and urease functions in CNRZ21. This study also showed that the way how

bacteria are administered has an important impact on their survival in the GIT.

S. thermophilus LMD-9 survived better to gastric and small intestinal conditions when

administered as fermented milk (1.6 %) rather than delivered as non-fermented milk (0.4 %).

Fermented milk may therefore be considered as a good vehicle for S. thermophilus strains.

Even if, like for animal models, the results obtained in in vitro models cannot directly

be extrapolated to the human, these studies showed their potential to better understand the

effect of gastrointestinal parameters, nutritional sources, mode of administration or bacterial

strains on the survival of S. thermophilus. In particular, dynamic multi-compartmental in vitro


76

digestion models, such as the TIM or the Simulator of the Human Intestinal Microbial

Ecosystem (SHIME) (Marzorati et al., 2014; Molly et al., 1993) may be useful to better

understand the behavior of probiotics in the successive environments of the human GIT and

how they respond to the main physicochemical digestive parameters (such as acid stress, bile,

oxygen level or fluid shear) in a physiological temporal-spatial fashion.

4. Acid and bile resistance mechanisms in S. thermophilus

As described above, the survival of S. thermophilus in the human GIT seemed to be

widely strain-dependent. This suggests than some strains of S. thermophilus have developed

resistance mechanisms to the main stresses encountered in the digestive environment, such as

acid pH and bile.

The responses of gram positive bacteria to acidic stress are less documented that those

of gram negative bacteria. Cotter and Hill (2003) describe the acidity resistance of gram

positive bacteria as “a combination of constitutive and inducible strategies which result in the

removal of protons (H+), alkalization of the external environment, changes in the composition

of the cell envelope, production of general shock proteins and chaperones, expression of

transcriptional regulators, and responses to changes in cell density”. Few data are available

on the mechanisms of acid resistance of S. thermophilus. Arena et al. (2006) suggested that in

response to acid stress, S. thermophilus tries to maintain pH homeostasis, reduces intracellular

lactic acid and increases ammonium concentration through over-expression of H+-ATPase,

up-regulation of lactate dehydrogenase and up-regulation of urease, respectively. Despite this

study, the role of urease in S. thermophilus acid tolerance remains controversial. In

accordance to Arena et al. (2006), Uriot et al. (2016) found that S. thermophilus CNRZ21

which is devoid of urease activity has a much lower survival in the TIM system than the three

other strains that express it. On the opposite, in the study by Junjua et al. (2016), only some of

the thirty S. thermophilus strains analyzed which show a low resistance to acidic pH possess

urease activity, as determined by Uriot et al. (2016). In addition, Zotta et al. (2008b) and

Arioli et al. (2010) showed that urease is not very active at low acidic pH (closed to that

found in the human stomach) but rather have a metabolic role by optimizing the activity of

S. thermophilus glycolytic enzymes. Other factors have been proposed to be involved in acid

resistance, as they were found to be over-expressed under low pH: the chaperone GroEL and

GroES which are involved in protein repair, acidic shock proteins (Asp or Hsp in the

literature), peroxide resistance protein Dpr, general stress protein 24, translation elongation


77

factor (EF) G, Tu and Ts, phosphoglycerate mutase and cell division protein DivIVA (Arena

et al., 2006; González-Márquez et al., 1997; Zotta et al., 2008a). The role of Hsp in acid

tolerance is strengthened by the study of Tian et al. (2012) who showed that under acid

condition (pH 3), the survival of L. lactis ML23 was improved when cells were harboring a

plasmid carrying the shsp gene of S. thermophilus St-QC. When combining the data obtained

by Uriot et al. (2016) and Junjua et al. (2016), it can also be observed that there is an obvious

correlation between Hsp and acid tolerance: the three S. thermophilus strains that are able to

survive under pH 2 harbor Hsp (LMD-9, PB180 and PB302) and 16 out of the 20 most

resistant strains to pH 4 possess Hsp. Lastly, the amino acid decarboxylase (Trip et al., 2012)

and antioxidant pathway such as manganese-dependent superoxide dismutase (MnSOD, sodA

gene) (Bruno-Bárcena et al., 2010) may also have a role in the acid resistance of

S. thermophilus. Most of these proteins involved in stress response (such as SodA, GroEL,

EF-Tu) were also found to be overproduced in feces of rats mono-associated with

S. thermophilus LMD-9 compared to milk (Rul et al., 2011).

Bile resistance mechanisms of S. thermophilus are even less studied than those of acid

resistance. As for acidity, production of Hsp could be used by S. thermophilus to resist to the

deleterious effect of bile salts (Tian et al., 2012). Besides, it has been recently shown that two

sortase-dependant proteins, PrtS and MucBP, found in the bacterial cell surface allow a better

survival in presence of bile salts (Kebouchi et al., 2016).

Then, the collected data suggest that the resistance strategies of S. thermophilus to acid

and bile are composed of an assembly of different mechanisms. This may explain the wide

variability of tolerance to gastrointestinal stresses encountered among S. thermophilus strains.

5. Beneficial health effects of S. thermophilus

A number of recent studies performed in humans or in animals have shown that

S. thermophilus can have beneficial effects on host health, as described below.

5.1. Alleviation of lactose intolerance

Lactose intolerance is the inability of adults and children to digest milk sugar lactose,

due to a deficiency in the brush border enzyme β-galactosidase. Individuals with lactose

intolerance suffer from excessive flatulence, abdominal pains and diarrheas. In 2010, EFSA

has granted a health claim to yogurt for improvement of lactose digestion. The claim was

formulated as follows: “Live yogurt cultures in yogurt improve digestion of lactose in yogurt


78

in individuals with lactose maldigestion” (EFSA, 2010). This claim is based on 14 human

intervention studies. These studies have shown enhanced digestion of lactose by people with

lactose intolerance or a reduction of symptoms caused by lactose maldigestion, when

consuming fresh yoghurt compared to pasteurized yoghurt with reduced or no live bacteria.

To bear the claim, yogurt must contain at least 108 CFU live starter microorganisms

(Lb. bulgaricus and S. thermophilus) per gram of fermented product. In addition, it is

important to underline that the claim is recognized for yogurt, but not attributed to

S. thermophilus alone. In order to better understand the specific role of S. thermophilus in

lactose intolerance, several studies have been performed in animal models. In GF mice,

S. thermophilus FBI3 was able to produce in the GIT an active β-galactosidase which can

degrade lactose (Drouault et al., 2002). After oral administration of S. thermophilus to GF-

mice receiving lactose (4.5 % wt/vol) as drinking water, a significant diminution of lactose in

the feces of mice was observed compared to control mice not fed with the bacteria. Further

works showed that β-galactosidase production from S. thermophilus FBI3 was detected in the

second half of the small intestine but not in the colon of HMA-mice (Mater et al., 2006).

Then, even if the beneficial effect of yoghurt on alleviation of lactose intolerance is

well established by clinical studies, there are strong proofs in animals, but no definite ones in

humans, that this effect can be specifically attributed to S. thermophilus.

5.2. Prevention of chronic gastritis

Studies on animal models have shown that S. thermophilus could prevent the

development of gastritis, an inflammatory disease of the stomach. In the study by Rodríguez

et al. (2009), milk fermented by S. thermophilus CRL1190 given for seven days was found to

protect mice against gastritis induced by the administration of acetylsalicylic acid, a non-

steroidal anti-inflammatory drug. The strain produces EPS that could stimulate the immune

system and has an inhibitory effect on ulcer in the host (Rodríguez et al., 2009). Further

studies conducted by the same authors (Rodríguez et al., 2010) indicated that the EPS

produced by S. thermophilus CRL1190 have the same effect than the Omeprazole drug used

for the treatment of gastritis.

As animal studies showed very promising results regarding the use of a specific

S. thermophilus strain in the prevention of chronic gastritis, it would be interesting to

investigate such beneficial effects in humans. A natural therapy using purified EPS or milk

fermented by S. thermophilus CRL1190 would be a relevant alternative to proton-pump


79

inhibitors, such as Omeprazole, whose use is restricted by undesirable side effects and drug

interactions.

5.3. Prevention of diarrhea

Acute diarrhea is a serious cause of infant mortality that can result from viral

(rotavirus) or bacterial infections in the gut. Saavedra et al. (1994) showed that formula

combining B. bifidum and S. thermophilus reduced the incidence of rotavirus-associated

diarrhea in infant aged 5-24 months from 31 % (control, 26 children) to 7 % (treated group,

29 children). In another study from the same group (Saavedra et al., 2004), healthy infant

aged 3-24 months supplemented with live B. lactis and S. thermophilus were less susceptible

to develop colitis and used antibiotics less frequently. Canani et al. (2007) also showed in 571

children aged 3-36 months that those fed with a mix of 4 bacteria, S. thermophilus,

Lb. bulgaricus, Lb. acidophilus and B. bifidum have shorter events of acute diarrhea (70 h

versus 115 h).

Antibiotic-associated diarrhea (AAD) is the most common adverse effect of antibiotic

therapy. Scarce studies have investigated the effectiveness of yoghurt consumption in the

prevention of AAD. In the studies of Beniwal et al. (2003), adult patients receiving yogurt

seemed less prone to diarrhea than control ones (12 % versus 24 %). On the opposite, a

placebo randomized study on 369 patients failed to demonstrate that yogurt had a positive

effect on AAD both in children and in adults (Conway et al., 2007). These contradictory

results may be due to differences in strains or patients. In a recent meta-analysis by Patro-

Golab et al. (2015), the authors concluded that there is insufficient evidence to support or

refute the use of yoghurt in preventing AAD, given the small number of trials and participants

as well as the methodological limitations of the included trials.

To conclude, up to date, there are some evidences that yoghurt consumption can

reduce the incidence of infectious diarrhea, but not that of AAD. In any case, the beneficial

role of S. thermophilus in preventing diarrhea is not yet clearly established.


80

Table 4: Characterization of some bacteriocins produced by S. thermophilus

Thermophilin 110 1277 13 347 580 81 9 A ST-1 T

S. thermophilus

strains

ST110 SBT1277 SFi13 347 580 81 LMD-9 ST134 ACA-DC0001 ACA-DC 0040

References Gilbreth and

Somkuti, 2005

Kabuki et al., 2007 Marciset et al.,

1997

Villani et al.,

1995

Mathot et al.,

2003

Ivanova et al., 1998 Fontaine and

Hols, 2008

Ward and

Somkuti, 1995

Aktypis and

Kalantzopoulos, 2003

Aktypis et al.,

1998

Classification ND Lantibiotic Class IIa Class IIa ND ND Class IIa Class IIa Class IV Class II

MW (Da) 4000-4500 3700 ND 2500-6200 ND 4500 ND 1700 30000 2500

Enzyme sensitivity Protease sensitive

Inactivated by α-

amylase

Proteinase K and

trypsin sensitive

ND α-chymotrypsin,

trypsin, protease

K sensitive Pepsin resistant

Protease and α-

amylase sensitive

Catalase and lipase resistant

Proteinase K and

pronase E sensitive

ND Protease sensitive

Amyloglucosidase,

lysozyme and β-amylase resistant

Pronase and

trypsin sensitive

Protease and α-

amylase sensitive

Lysozyme and lipase resistant

Heat sensitivity Stable after 1h at

100°C

Activity

maintained after 1h at 130°C

ND Stable after 1h at

100°C. 50 % of activity loss after

15 min at 121°C

Not heat-resistant

Inactive after 1 h at 60°C

Not heat-resistant

Inactive after 15 min at 60°C

ND Stable after 1 h at

100°C

Not heat-

resistant Inactive after 10

min at 60°C

Inactive after 20

min at 121°C

pH tolerance ND Active between pH3 and pH10

ND ND ND Active between pH3 and pH10

ND Active between pH3 and pH7

Active between pH3 and pH10

Active between pH1 and pH9

Antimicrobial

activities

E. faecalis L. lactis

Lb. bulgaricus

P. acidilactici

S. thermophilus

C. butylicum

C. sprogenes Lb. acidophilus

Lb. helveticus

M. lacticum S. thermophilus

B. cereus C. botulinum

L. monocytogenes

LAB

S. thermophilus

E. faecalis L. lactis

L. monocytogenes

S. thermophilus

B. cereus

C. butyricum

C. sporogenes

E. faecalis

B. cereus B. subtilis

E. coli

E. faecalis

Lb. monocytogenes S. typhimurium

L. monocytogenes

S. thermophilus

S. thermophilus S. aureus L. innocua

E. faecalis

LAB C. sporogenes

C. tyrobutyricum

No antimicrobial

activity

S. aureus

S. epidermidis

L. innocua

L. monocytogenes Lb. gasseri

S. aureus

E. coli

Pseudomonas Salmonella

C. sporogenes

E.coli

Lb. bulgaricus

Lb. helveticus S. aureus

E. coli

L. lactis

L. monocytogenes

Lb. helveticus S. aureus

LAB

P. damnosus

S. aureus

C. sporogenes

C. tyrobutyrium

E. faecalis

L. innocua S. carnosus

HT: heat treatment; LAB: lactic acid bacteria; MW: molecular weight; ND: Not determined


81

6. Possible mechanisms of action of S. thermophilus on the host health

6.1. Antimicrobial activity

S. thermophilus is able to synthesize thermophilins which are bacteriocins, small

peptides able to inhibit the growth or kill closely related bacteria (Dortu and Thonart, 2009).

Hitherto, ten thermophilins have been identified from ten different strains of S. thermophilus

(Table 4). Thermophilins have been shown to have in vitro inhibitory activities against LAB

but also against Gram positive pathogenic strains such as E. faecalis, Clostridium (C.)

botulinum, Staphylococcus aureus and Listeria monocytogenes (Fontaine and Hols, 2008;

Rossi et al., 2013). For example, thermophilin 1277, which is produced by S. thermophilus

SBT1277, shows an antimicrobial activity against several LAB and food spoilage bacteria

including C. butylicum, C. sporogenes and Bacillus cereus. Production of thermophilins

represents a significant interest for conservation in food industry because it may limit the

proliferation of pathogenic bacteria in dairy products fermented by S. thermophilus (Rossi et

al., 2013).

In the context of infection with C. difficile, mice treated with viable S. thermophilus

exhibited 46 % less weight loss compared with untreated controls (Kolling et al., 2012). The

treatment also led to lower diarrheal severity, lower pathology scores and decrease in toxin

production. An inverse correlation between the levels of luminal lactic acid and abundance of

C. difficile was also observed, suggested that lactic acid produced by S. thermophilus may

impact pathogen growth in the murine system.

Antimicrobial activity is a main trait of probiotic properties. S. thermophilus is able to

produce thermophilins, but as a part of probiotic criteria, it would be necessary to test whether

these bacteriocins could be produced in the GIT in in vitro or in vivo assays and be effective

against pathogenic bacteria. S. thermophilus also produces lactic acid, another antimicrobial

compound, but this trait, shared by all LAB, is not specific to this bacterium.

6.2. Antioxidant activity

Some promising antioxidant activities of S. thermophilus have been observed in both

in vitro and in vivo models. Among 49 strains of LAB, S. thermophilus YIT2001 showed the

highest inhibitory activity against lipid peroxidation in liposomes treated by ferrous iron (Ito

et al., 2003). Feeding iron-overloaded mice for 2 weeks with S. thermophilus YIT2001 caused

a decrease in lipid peroxide in the colonic mucosa of the animals. The authors suggested that


82

S. thermophilus YIT2001 may act as a scavenger of reactive oxygen or free radicals or may

increase antioxidant capacities of intestinal content, but seemed not to work through removal

of iron (Ito et al., 2003). This strain was also able to prevent oxidative injuries to the colonic

mucosa and improve the disease activity index in dextran sulfate sodium (DSS) induced

colitis mice, as well as reduce associated anemia (Ito et al., 2008). In a last study by the same

authors (Ito et al., 2015), S. thermophilus YIT2001 showed the ability to inhibit low density

lipoprotein (LDL) oxidation and reduced aortic fatty lesions in hyperlipidemic hamsters.

S. thermophilus 1131 also had an inhibiting effect on LDL oxidation in blood samples

collected from one human volunteer (Terahara et al., 2001). The underlying mechanisms of

such antioxidant effects are not yet known but could be related to the activity of antioxidant

enzymes produced by S. thermophilus, like SOD or glutathione reductase (Amaretti et al.,

2013; Chang and Hassan, 1997). By using menadione (a superoxide-generating agent)-

sensitive mutants, Thibessard et al. (2004) have also characterized three genes (tgt, ossF and

ossG) in S. thermophilus CNRZ368 whose action might be specific to oxidative stress

defense.

Taken together, these studies indicated that S. thermophilus may have a beneficial

antioxidant effect both in vitro and in vivo in animals. Nevertheless, it should be underlined

that most of available studies involve a single strain of S. thermophilus: YIT2001. These

results open up new opportunities for the use of S. thermophilus in the prevention of various

diseases where oxidative stress has been shown to play a key role, such as ulcerative colitis,

colon cancer or artherosclerosis.

6.3. Immunomodulation

A number of in vitro studies have investigated the ability of S. thermophilus strains to

modulate the immune response of various human cell lines, such as intestinal HT-29 cells,

Peripheral Blood Mononuclear Cells (PBMCs), monocyte-derived Dendritic Cells (moDCs)

or human primary macrophages. Depending on the study and strain tested, either pro-

inflammatory or anti-inflammatory responses were obtained. Kekkonen et al. (2008) found

that S. thermophilus THS induced Th1 type cytokines Interleukin (IL)-12 and Interferon-

gamma (IFN-γ) as well as Tumor Necrosis Factor-alpha (TNF-α) in PMBCs. These results are

in accordance with those of Latvala et al. (2008) who showed that the same strain induced the

expression of pro-inflammatory (TNF-α, Il-12, IL-6, Chemokine CC Ligand -CCL- 20) and

Th1 type (Il-12 and IFN-γ) cytokines in moDCs. The same authors confirmed in a more


83

recent study (Latvala et al., 2011) that S. thermophilus THS is a strong inducer of IL-12 in

moDCs, PBMCs and macrophages. On the contrary, Latvala et al. (2011) showed that

S. thermophilus is a potent inducer of the anti-inflammatory IL-10 in macrophages. Such anti-

inflammatory effect was confirmed by the study of Junjua et al. (2016). Among 30

S. thermophilus strains of different origins, they found that most reduced the production of

pro-inflammatory IL-8 after co-incubation with HT-29 cells, while they induced the

production of IL-10 in PBMC. The authors calculated the ration of synthesis IL-10/IL-12 and

showed that three strains (CNRZ21, CNRZ160 and PB5MJ) displayed a strong and promising

in vitro anti-inflammatory potential with a ratio higher than 100. Such a value appeared to be

similar or higher than the one reported for Faecalibacterium prausnitzii, a commensal

bacteria displaying one of the best anti-inflammatory properties (Sokol et al., 2008). Ogita et

al. (2011b) suggested that modulation of Th1/Th17 balance would be one of the mechanisms

used by S. thermophilus ST28 to exert an anti-inflammatory effect. They showed that heat-

killed S. thermophilus ST28 suppressed IL-17 production in murine splenocytes stimulated

with Transforming Growth Factor-beta (TGF-β) plus IL-6. This in vitro effect was confirmed

in vivo in DSS-treated mice where oral treatment by the strain decreased the production of IL-

17 and the percentages of Th17 cells in lamina propria lymphocytes (Ogita et al., 2011a).

Lastly, in a study designed to follow a large number of cytokines (IL-2, IL-4, IL-6, IL-10, IL-

12, IL-17, IFN-γ, TGF- β), Donkor et al. (2012) concluded that S. thermophilus St1275

induced significant secretion of both pro- and anti-inflammatory cytokines from PBMC.

Interestingly, Del Carmen et al. (2014) have observed that introducing a gene expressing an

antioxidant enzyme enhances the anti-inflammatory activity of S. thermophilus strains.

Hitherto, there is no consensus in the literature about the immunomodulatory

properties of S. thermophilus that seem to be widely dependent on both the strain tested and

the type of cells used. If the anti-inflammatory properties of some specific strains of

S. thermophilus are further demonstrated, they could be involved in the development of novel

therapeutic products that prevent pathologies where inflammation plays a key role, such as

inflammatory bowel diseases.

6.4. Effect on intestinal barrier function

Resta-Lenert and Barrett (2003) showed that exposure of intestinal cell monolayers

(both HT29 and caco-2 cell lines) to live (but not dead) S. thermophilus ATCC19258 and

Lb. acidophilus ATCC4356 prevents entero-invasive Escherichia coli (EIEC) induced


84

decrease in trans-epithelial resistance. The effect of the two bacteria on resistance was

accompanied by maintenance (actin, ZO-1) or enhancement (actinin, occluding) of

cytoskeletal and tight junctional protein phosphorylation. S. thermophilus and Lb. acidophilus

also enhanced the barrier function of naive epithelial cells not exposed to any pathogen. Apart

from their effect on barrier function, the authors showed that pretreatment with the two strains

limited the number of adhered and invasive EIEC. The ability of S. thermophilus to improve

intestinal barrier function was confirmed by an in vivo study in 35 healthy human subjects

(Del Piano et al., 2014). Supplementation with S. thermophilus ST10 and tara gum was able

to significantly decrease intestinal permeability, both in the small bowel and in the colon of

the volunteers. The authors observed a parallel increase in EPS concentration in the fecal

material. When embedded in tara gum, EPS would act by forming a film over the inner

surface of the bowel, therefore creating a mechanical barrier.

Scarce studies have shown the potential of S. thermophilus in improving epithelial

barrier function. Hyper-permeability has been associated with a variety of pathologic states

like infection, celiac disease, Crohn’s disease or type 1 diabete. Then, if the beneficial

properties of S. thermophilus are confirmed by further in vivo studies in humans, it opens up

new prospects of using this bacterium in the prevention of such pathologies.

6.5. Interactions with intestinal microbiota

There is no available study investigating the interactions between S. thermophilus and

the human intestinal microbiota. Nevertheless, García-Albiach et al. (2008) have evaluated

the effect of yoghurt on the gut microbiota of 79 healthy young adults. The main change

observed after yoghurt consumption was an increase in the levels of LAB and C. perfringens

to the detriment of Bacteroides.

Then, even if it is generally acknowledged that probiotics act through beneficial

modulation of gut microbiota, much remains to be done in that field.

7. Conclusion

Critical points to be classified as a probiotic strain are survival in gastrointestinal

conditions, non-pathogenicity, proved beneficial health effects and resistance to industrial

process (Miquel et al., 2015; Nagpal et al., 2012; Vasiljevic and Shah, 2008). The aim of this

review was to analyze the potential of S. thermophilus as a new promising probiotic

candidate.


85

Even if most of S. thermophilus strains are sensitive to acid pH and bile salts, human

studies have established their ability to survive passage through the GIT and transiently

colonize while ingested. In addition, some strains of S. thermophilus have the ability to adhere

to intestinal epithelial cells, which is an important criterion for probiotic strain selection. This

biological mechanism promoting interactions with the host leads to gut protection and

enhances colonization. With regards to safety, S. thermophilus is already considered as safe

by the FDA. A large number of in vivo studies in human or animal models have also shown

beneficial health effects for S. thermophilus, such as alleviation of lactose intolerance,

prevention of gastritis and prevention of infectious diarrhea. The mode of action of

S. thermophilus has been already investigated, by using in vitro assays and animal models.

The bacterium seems to act mainly through the production of antimicrobial compounds (such

as thermophilins), but also via its antioxidant and anti-inflammatory properties or its ability to

enhance epithelial barrier function. Nevertheless, the available data should be interpreted with

caution as in a substantial part of these studies S. thermophilus was administrated with another

LAB strain or within yoghurt. Moreover, both the survival and beneficial effects of

S. thermophilus are widely strain-dependent, suggested that probiotic candidates should be

carefully selected among the available strains. Even if some assumptions have been made

about mechanisms of action of S. thermophilus, they need to be confirmed in a larger number

of in vivo studies, first in animals then in human trials. In particular, there is almost no

information about interactions of the bacteria with human gut microbiota, even if microbiota

modulation is a generally acknowledged mode of action for probiotic strains. Lastly, the

resistance of S. thermophilus to industrial process is already well established, mainly in dairy

products. Dairy products such as fermented milk would then constitute an ideal vehicle for

administration of S. thermophilus to humans. In particular, yogurt or fermented milks are

highly consumed (about 2 kg of yoghurt per person worldwide) and benefit from favorable

public opinion.


86

References

Aktypis, A., Kalantzopoulos, G., 2003. Purification and characterization of thermophilin ST-1, a novel

bacteriocin produced by Streptococcus thermophilus ACA-DC 0001. Le Lait 83, 365–378.

doi:10.1051/lait:2003024

Aktypis, A., Kalantzopoulos, G., Huis in’t Veld, J.H., ten Brink, B., 1998. Purification and

characterization of thermophilin T, a novel bacteriocin produced by Streptococcus thermophilus

ACA-DC 0040. J. Appl. Microbiol. 84, 568–576.

Amaretti, A., di Nunzio, M., Pompei, A., Raimondi, S., Rossi, M., Bordoni, A., 2013. Antioxidant

properties of potentially probiotic bacteria: in vitro and in vivo activities. Appl. Microbiol.

Biotechnol. 97, 809–817. doi:10.1007/s00253-012-4241-7

Arena, S., D’Ambrosio, C., Renzone, G., Rullo, R., Ledda, L., Vitale, F., Maglione, G., Varcamonti,

M., Ferrara, L., Scaloni, A., 2006. A study of Streptococcus thermophilus proteome by

integrated analytical procedures and differential expression investigations. Proteomics 6, 181–

192. doi:10.1002/pmic.200402109

Arioli, S., Ragg, E., Scaglioni, L., Fessas, D., Signorelli, M., Karp, M., Daffonchio, D., De Noni, I.,

Mulas, L., Oggioni, M., Guglielmetti, S., Mora, D., 2010. Alkalizing reactions streamline

cellular metabolism in acidogenic microorganisms. PloS One 5, e15520.

doi:10.1371/journal.pone.0015520

Bai, Y., Sun, E., Shi, Y., Jiang, Y., Chen, Y., Liu, S., Zhao, L., Zhang, M., Guo, H., Zhang, H., Mu,

Z., Ren, F., 2016. Complete genome sequence of Streptococcus thermophilus MN-BM-A01, a

strain with high exopolysaccharides production. J. Biotechnol. 224, 45–46.

doi:10.1016/j.jbiotec.2016.03.003

Ballesta, S., Velasco, C., Borobio, M.V., Argüelles, F., Perea, E.J., 2008. [Fresh versus pasteurized

yogurt: comparative study of the effects on microbiological and immunological parameters, and

gastrointestinal comfort]. Enfermedades Infecc. Microbiol. Clínica 26, 552–557.

Beniwal, R.S., Arena, V.C., Thomas, L., Narla, S., Imperiale, T.F., Chaudhry, R.A., Ahmad, U.A.,

2003. A randomized trial of yogurt for prevention of antibiotic-associated diarrhea. Dig. Dis.

Sci. 48, 2077–2082.

Ben-Yahia, L., Mayeur, C., Rul, F., Thomas, M., 2012. Growth advantage of Streptococcus

thermophilus over Lactobacillus bulgaricus in vitro and in the gastrointestinal tract of

gnotobiotic rats. Benef. Microbes 3, 211–219. doi:10.3920/BM2012.0012

Blanquet-Diot, S., Denis, S., Chalancon, S., Chaira, F., Cardot, J.-M., Alric, M., 2012. Use of artificial

digestive systems to investigate the biopharmaceutical factors influencing the survival of

probiotic yeast during gastrointestinal transit in humans. Pharm. Res. 29, 1444–1453.

doi:10.1007/s11095-011-0620-5

Boke, H., Aslim, B., Alp, G., 2010. The role of resistance to bile salts and acid tolerance of

exopolysaccharides (EPSS) produced by yogurt starter bacteria. Arch. Biol. Sci. 62, 323–328.

doi:10.2298/ABS1002323B

Bolotin, A., Quinquis, B., Renault, P., Sorokin, A., Ehrlich, S.D., Kulakauskas, S., Lapidus, A.,

Goltsman, E., Mazur, M., Pusch, G.D., Fonstein, M., Overbeek, R., Kyprides, N., Purnelle, B.,

Prozzi, D., Ngui, K., Masuy, D., Hancy, F., Burteau, S., Boutry, M., Delcour, J., Goffeau, A.,

Hols, P., 2004. Complete sequence and comparative genome analysis of the dairy bacterium

Streptococcus thermophilus. Nat. Biotechnol. 22, 1554–1558. doi:10.1038/nbt1034

Bouhafs, L., Moudilou, E.N., Exbrayat, J.M., Lahouel, M., Idoui, T., 2015. Protective effects of

probiotic Lactobacillus plantarum BJ0021 on liver and kidney oxidative stress and apoptosis


87

induced by endosulfan in pregnant rats. Ren. Fail. 37, 1370–1378.

doi:10.3109/0886022X.2015.1073543

Bowen, J.M., Stringer, A.M., Gibson, R.J., Yeoh, A.S.J., Hannam, S., Keefe, D.M.K., 2007. VSL#3

probiotic treatment reduces chemotherapy-induced diarrhea and weight loss. Cancer Biol. Ther.

6, 1449–1454.

Boyle, R.J., Tang, M.L.K., 2006. The role of probiotics in the management of allergic disease. Clin.

Exp. Allergy J. Br. Soc. Allergy Clin. Immunol. 36, 568–576. doi:10.1111/j.1365-

2222.2006.02472.x

Brigidi, P., Swennen, E., Vitali, B., Rossi, M., Matteuzzi, D., 2003. PCR detection of Bifidobacterium

strains and Streptococcus thermophilus in feces of human subjects after oral bacteriotherapy and

yogurt consumption. Int. J. Food Microbiol. 81, 203–209.

Bruno-Bárcena, J.M., Azcárate-Peril, M.A., Hassan, H.M., 2010. Role of antioxidant enzymes in

bacterial resistance to organic acids. Appl. Environ. Microbiol. 76, 2747–2753.

doi:10.1128/AEM.02718-09

Campus, G., Cocco, F., Carta, G., Cagetti, M.G., Simark-Mattson, C., Strohmenger, L., Lingström, P.,

2014. Effect of a daily dose of Lactobacillus brevis CD2 lozenges in high caries risk

schoolchildren. Clin. Oral Investig. 18, 555–561. doi:10.1007/s00784-013-0980-9

Canani, R.B., Cirillo, P., Terrin, G., Cesarano, L., Spagnuolo, M.I., De Vincenzo, A., Albano, F.,

Passariello, A., De Marco, G., Manguso, F., Guarino, A., 2007. Probiotics for treatment of acute

diarrhoea in children: randomised clinical trial of five different preparations. BMJ 335, 340.

doi:10.1136/bmj.39272.581736.55

Chang, S.K., Hassan, H.M., 1997. Characterization of superoxide dismutase in Streptococcus

thermophilus. Appl. Environ. Microbiol. 63, 3732–3735.

Conway, S., Hart, A., Clark, A., Harvey, I., 2007. Does eating yogurt prevent antibiotic-associated

diarrhoea? A placebo-controlled randomised controlled trial in general practice. Br. J. Gen.

Pract. J. R. Coll. Gen. Pract. 57, 953–959. doi:10.3399/096016407782604811

Cotter, P.D., Hill, C., 2003. Surviving the Acid Test: Responses of Gram-Positive Bacteria to Low pH.

Microbiol. Mol. Biol. Rev. 67, 429–453. doi:10.1128/MMBR.67.3.429-453.2003

del Campo, R., Bravo, D., Cantón, R., Ruiz-Garbajosa, P., García-Albiach, R., Montesi-Libois, A.,

Yuste, F.-J., Abraira, V., Baquero, F., 2005. Scarce evidence of yogurt lactic acid bacteria in

human feces after daily yogurt consumption by healthy volunteers. Appl. Environ. Microbiol.

71, 547–549. doi:10.1128/AEM.71.1.547-549.2005

Del Carmen, S., de Moreno de LeBlanc, A., Martin, R., Chain, F., Langella, P., Bermúdez-Humarán,

L.G., LeBlanc, J.G., 2014. Genetically engineered immunomodulatory Streptococcus

thermophilus strains producing antioxidant enzymes exhibit enhanced anti-inflammatory

activities. Appl. Environ. Microbiol. 80, 869–877. doi:10.1128/AEM.03296-13

Del Piano, M., Balzarini, M., Carmagnola, S., Pagliarulo, M., Tari, R., Nicola, S., Deidda, F., Pane,

M., 2014. Assessment of the capability of a gelling complex made of tara gum and the

exopolysaccharides produced by the microorganism Streptococcus thermophilus ST10 to

prospectively restore the gut physiological barrier: a pilot study. J. Clin. Gastroenterol. 48 Suppl

1, S56-61. doi:10.1097/MCG.0000000000000254

Delorme, C., Bartholini, C., Bolotine, A., Ehrlich, S.D., Renault, P., 2010. Emergence of a Cell Wall

Protease in the Streptococcus thermophilus Population. Appl. Environ. Microbiol. 76, 451–460.

doi:10.1128/AEM.01018-09


88

Di Cerbo, A., Palmieri, B., Aponte, M., Morales-Medina, J.C., Iannitti, T., 2016. Mechanisms and

therapeutic effectiveness of lactobacilli. J. Clin. Pathol. 69, 187–203. doi:10.1136/jclinpath-

2015-202976

Dilmi-Bouras, A., Sadoun, D., 2002. Survie des ferments du yaourt dans le tube digestif du lapin. Le

Lait 82, 247–253. doi:10.1051/lait:2002007

Donkor, O.N., Ravikumar, M., Proudfoot, O., Day, S.L., Apostolopoulos, V., Paukovics, G.,

Vasiljevic, T., Nutt, S.L., Gill, H., 2012. Cytokine profile and induction of T helper type 17 and

regulatory T cells by human peripheral mononuclear cells after microbial exposure. Clin. Exp.

Immunol. 167, 282–295. doi:10.1111/j.1365-2249.2011.04496.x

Dortu, C., Thonart, P., 2009. Les bactériocines des bactéries lactiques : caractéristiques et intérêts pour

la bioconservation des produits alimentaires. Biotechnol Agron Soc Env. 13, 143–154.

Drouault, S., Anba, J., Corthier, G., 2002. Streptococcus thermophilus Is Able To Produce a -

Galactosidase Active during Its Transit in the Digestive Tract of Germ-Free Mice. Appl.

Environ. Microbiol. 68, 938–941. doi:10.1128/AEM.68.2.938-941.2002

EFSA, 2010. Scientific Opinion on the substantiation of health claims related to live yoghurt cultures

and improved lactose digestion (ID 1143, 2976) pursuant to Article 13(1) of Regulation (EC)

No 1924/2006. EFSA J. 8, 1763.

Elli, M., Callegari, M.L., Ferrari, S., Bessi, E., Cattivelli, D., Soldi, S., Morelli, L., Goupil Feuillerat,

N., Antoine, J.-M., 2006. Survival of Yogurt Bacteria in the Human Gut. Appl. Environ.

Microbiol. 72, 5113–5117. doi:10.1128/AEM.02950-05

Facklam, R., 2002. What Happened to the Streptococci: Overview of Taxonomic and Nomenclature

Changes. Clin. Microbiol. Rev. 15, 613–630. doi:10.1128/CMR.15.4.613-630.2002

Fang, S.-H., Lai, Y.-J., Chou, C.-C., 2013. The susceptibility of Streptococcus thermophilus 14085 to

organic acid, simulated gastric juice, bile salt and disinfectant as influenced by cold shock

treatment. Food Microbiol. 33, 55–60. doi:10.1016/j.fm.2012.08.012

FAO/WHO, 2002. Food and Agricultural Organization of the United Nations and World Health

Organization. Joint FAO/WHO working group report on drafting guidelines for the evaluation

of probiotics in food. Food Agric. Organ. U. N.

Foligné, B., Daniel, C., Pot, B., 2013. Probiotics from research to market: the possibilities, risks and

challenges. Curr. Opin. Microbiol. 16, 284–292. doi:10.1016/j.mib.2013.06.008

Fontaine, L., Hols, P., 2008. The inhibitory spectrum of thermophilin 9 from Streptococcus

thermophilus LMD-9 depends on the production of multiple peptides and the activity of

BlpG(St), a thiol-disulfide oxidase. Appl. Environ. Microbiol. 74, 1102–1110.

doi:10.1128/AEM.02030-07

Fox, P.F., McSweeney, P.H.L., Cogan, T.M., Guinee, T.P., 2004. Cheese: Chemistry, Physics and

Microbiology, 3rd Edition, Academic Press. ed. London.

Fujii, A., Cook, E.S., 1973. Probiotics. Antistaphylococcal and antifibrinolytic activities of omega-

guanidino acids and omega-guanidinoacyl-L-histidines. J. Med. Chem. 16, 1409–1411.

Fuller, R., 1992. History and development of probiotics., UK: Chapman & Hall. ed, Probiotics, the

scientific basis. In R. Fuller, London.

Gao, X.-Y., Zhi, X.-Y., Li, H.-W., Klenk, H.-P., Li, W.-J., 2014. Comparative Genomics of the

Bacterial Genus Streptococcus Illuminates Evolutionary Implications of Species Groups. PLoS

ONE 9, e101229. doi:10.1371/journal.pone.0101229


89

García-Albiach, R., Pozuelo de Felipe, M.J., José, M., de Felipe, P., Angulo, S., Morosini, M.-I.,

Bravo, D., Baquero, F., del Campo, R., 2008. Molecular analysis of yogurt containing

Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus in human intestinal

microbiota. Am. J. Clin. Nutr. 87, 91–96.

García-Hernández, J., Moreno, Y., Chuan, C., Hernández, M., 2012. In vivo study of the survival of

Lactobacillus delbrueckii subsp. bulgaricus CECT 4005T and Streptococcus thermophilus

CECT 801 by DVC-FISH after consumption of fermented milk. J. Food Sci. 77, M593-597.

doi:10.1111/j.1750-3841.2012.02918.x

Gilbreth, S.E., Somkuti, G.A., 2005. Thermophilin 110: a bacteriocin of Streptococcus thermophilus

ST110. Curr. Microbiol. 51, 175–182. doi:10.1007/s00284-005-4540-7

Giovannini, M., Agostoni, C., Riva, E., Salvini, F., Ruscitto, A., Zuccotti, G.V., Radaelli, G., Felicita

Study Group, 2007. A randomized prospective double blind controlled trial on effects of long-

term consumption of fermented milk containing Lactobacillus casei in pre-school children with

allergic asthma and/or rhinitis. Pediatr. Res. 62, 215–220. doi:10.1203/PDR.0b013e3180a76d94

González-Márquez, H., Perrin, C., Bracquart, P., Guimont, C., Linden, G., 1997. A 16 kDa protein

family overexpressed by Streptococcus thermophilus PB18 in acid environments. Microbiol.

Read. Engl. 143 ( Pt 5), 1587–1594.

Guandalini, S., Magazzù, G., Chiaro, A., La Balestra, V., Di Nardo, G., Gopalan, S., Sibal, A.,

Romano, C., Canani, R.B., Lionetti, P., Setty, M., 2010. VSL#3 improves symptoms in children

with irritable bowel syndrome: a multicenter, randomized, placebo-controlled, double-blind,

crossover study. J. Pediatr. Gastroenterol. Nutr. 51, 24–30.

doi:10.1097/MPG.0b013e3181ca4d95

Guillemard, E., Tondu, F., Lacoin, F., Schrezenmeir, J., 2010. Consumption of a fermented dairy

product containing the probiotic Lactobacillus casei DN-114001 reduces the duration of

respiratory infections in the elderly in a randomised controlled trial. Br. J. Nutr. 103, 58–68.

doi:10.1017/S0007114509991395

Hasslöf, P., West, C.E., Videhult, F.K., Brandelius, C., Stecksén-Blicks, C., 2013. Early intervention

with probiotic Lactobacillus paracasei F19 has no long-term effect on caries experience. Caries

Res. 47, 559–565. doi:10.1159/000350524

Hauser, G., Salkic, N., Vukelic, K., JajacKnez, A., Stimac, D., 2015. Probiotics for Standard Triple

Helicobacter pylori Eradication. Medicine (Baltimore) 94. doi:10.1097/MD.0000000000000685

Havenaar, R., Huis in’t Veld, J.H.J., 1992. Probiotics a general view, Elsevier Applied Science. ed,

The Lactic Acid Bacteria in Health And Disease. Wood BJB, London.

Helinck, S., Le Bars, D., Moreau, D., Yvon, M., 2004. Ability of thermophilic lactic acid bacteria to

produce aroma compounds from amino acids. Appl. Environ. Microbiol. 70, 3855–3861.

doi:10.1128/AEM.70.7.3855-3861.2004

Hill, C., Guarner, F., Reid, G., Gibson, G.R., Merenstein, D.J., Pot, B., Morelli, L., Canani, R.B., Flint,

H.J., Salminen, S., Calder, P.C., Sanders, M.E., 2014. Expert consensus document. The

International Scientific Association for Probiotics and Prebiotics consensus statement on the

scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 11, 506–514.

doi:10.1038/nrgastro.2014.66

Hols, P., Hancy, F., Fontaine, L., Grossiord, B., Prozzi, D., Leblond-Bourget, N., Decaris, B., Bolotin,

A., Delorme, C., Dusko Ehrlich, S., Guédon, E., Monnet, V., Renault, P., Kleerebezem, M.,

2005. New insights in the molecular biology and physiology of Streptococcus thermophilus


90

revealed by comparative genomics. FEMS Microbiol. Rev. 29, 435–463.

doi:10.1016/j.femsre.2005.04.008

Hurduc, V., Plesca, D., Dragomir, D., Sajin, M., Vandenplas, Y., 2009. A randomized, open trial

evaluating the effect of Saccharomyces boulardii on the eradication rate of Helicobacter pylori

infection in children. Acta Paediatr. Oslo Nor. 1992 98, 127–131. doi:10.1111/j.1651-

2227.2008.00977.x

Ito, M., Ohishi, K., Yoshida, Y., Okumura, T., Sato, T., Yokoi, W., Sawada, H., 2008. Preventive

effect of Streptococcus thermophilus YIT 2001 on dextran sulfate sodium-induced colitis in

mice. Biosci. Biotechnol. Biochem. 72, 2543–2547.

Ito, M., Ohishi, K., Yoshida, Y., Yokoi, W., Sawada, H., 2003. Antioxidative effects of lactic acid

bacteria on the colonic mucosa of iron-overloaded mice. J. Agric. Food Chem. 51, 4456–4460.

doi:10.1021/jf0261957

Ito, M., Oishi, K., Yoshida, Y., Okumura, T., Sato, T., Naito, E., Yokoi, W., Sawada, H., 2015. Effects

of lactic acid bacteria on low-density lipoprotein susceptibility to oxidation and aortic fatty

lesion formation in hyperlipidemic hamsters. Benef. Microbes 6, 287–293.

doi:10.3920/BM2014.0040

Ivanova, I., Miteva, V., Stefanova, T., Pantev, A., Budakov, I., Danova, S., Moncheva, P., Nikolova,

I., Dousset, X., Boyaval, P., 1998. Characterization of a bacteriocin produced by Streptococcus

thermophilus 81. Int. J. Food Microbiol. 42, 147–158.

Iyer, R., Tomar, S.K., Kapila, S., Mani, J., Singh, R., 2010a. Probiotic properties of folate producing

Streptococcus thermophilus strains. Food Res. Int. 43, 103–110.

doi:10.1016/j.foodres.2009.09.011

Junjua, M., Kechaou, N., Chain, F., Awussi, A.A., Roussel, Y., Perrin, C., Roux, E., Langella, P.,

Bermúdez-Humarán, L.G., Le Roux, Y., Chatel, J.-M., Dary-Mourot, A., 2016. A large scale in

vitro screening of Streptococcus thermophilus strains revealed strains with a high anti-

inflammatory potential. LWT - Food Sci. Technol. 70, 78–87. doi:10.1016/j.lwt.2016.02.006

Kabuki, T., Uenishi, H., Watanabe, M., Seto, Y., Nakajima, H., 2007. Characterization of a

bacteriocin, Thermophilin 1277, produced by Streptococcus thermophilus SBT1277. J. Appl.

Microbiol. 102, 971–980. doi:10.1111/j.1365-2672.2006.03159.x

Kebouchi, M., Galia, W., Genay, M., Soligot, C., Lecomte, X., Awussi, A.A., Perrin, C., Roux, E.,

Dary-Mourot, A., Le Roux, Y., 2016. Implication of sortase-dependent proteins of

Streptococcus thermophilus in adhesion to human intestinal epithelial cell lines and bile salt

tolerance. Appl. Microbiol. Biotechnol. 100, 3667–3679. doi:10.1007/s00253-016-7322-1

Kekkonen, R.-A., Kajasto, E., Miettinen, M., Veckman, V., Korpela, R., Julkunen, I., 2008. Probiotic

Leuconostoc mesenteroides ssp. cremoris and Streptococcus thermophilus induce IL-12 and

IFN-gamma production. World J. Gastroenterol. 14, 1192–1203.

Kolb, H., 1955. Die Behandlung akuter Infekte unter dem Gesichtswinkel der Prophylaxe chronischer

Leiden. Uber die Behandlung mit physiologischen bakterien. Bakterien Microecol Ther. 1, 15–

19.

Kollath, W., 1953. [Nutrition and the tooth system; general review with special reference to vitamins].

Dtsch. Zahnärztliche Z. 8, Suppl 7-16.

Kolling, G.L., Wu, M., Warren, C.A., Durmaz, E., Klaenhammer, T.R., Timko, M.P., Guerrant, R.L.,

2012. Lactic acid production by Streptococcus thermophilus alters Clostridium difficile

infection and in vitro Toxin A production. Gut Microbes 3, 523–529. doi:10.4161/gmic.21757


91

Korpela, K., Salonen, A., Virta, L.J., Kumpu, M., Kekkonen, R.A., de Vos, W.M., 2016. Lactobacillus

rhamnosus GG Intake Modifies Preschool Children’s Intestinal Microbiota, Alleviates

Penicillin-Associated Changes, and Reduces Antibiotic Use. PloS One 11, e0154012.


Koyama, T., Kirjavainen, P.V., Fisher, C., Anukam, K., Summers, K., Hekmat, S., Reid, G., 2010.

Development and pilot evaluation of a novel probiotic mixture for the management of seasonal

allergic rhinitis. Can. J. Microbiol. 56, 730–738. doi:10.1139/w10-061

Latvala, S., Miettinen, M., Kekkonen, R.A., Korpela, R., Julkunen, I., 2011. Lactobacillus rhamnosus

GG and Streptococcus thermophilus induce suppressor of cytokine signalling 3 (SOCS3) gene

expression directly and indirectly via interleukin-10 in human primary macrophages. Clin. Exp.

Immunol. 165, 94–103. doi:10.1111/j.1365-2249.2011.04408.x

Latvala, S., Pietila, T.-E., Veckman, V., Kekkonen, R.-A., Tynkkynen, S., Korpela, R., Julkunen, I.,

2008. Potentially probiotic bacteria induce efficient maturation but differential cytokine

production in human monocyte-derived dendritic cells. World J. Gastroenterol. 14, 5570-5583–

5582.

Leyer, G.J., Li, S., Mubasher, M.E., Reifer, C., Ouwehand, A.C., 2009. Probiotic effects on cold and

influenza-like symptom incidence and duration in children. Pediatrics 124, e172-179.

doi:10.1542/peds.2008-2666

Lick, S., Drescher, K., Heller, K.J., 2001. Survival of Lactobacillus delbrueckii subsp. bulgaricus and

Streptococcus thermophilus in the Terminal Ileum of Fistulated Gottingen Minipigs. Appl.


Lilly, D.M., Stillwell, R.H., 1965. Probiotics: growth-promoting factors produced by microorganisms.

Science 147, 747–748.

Liu, M., Siezen, R.J., Nauta, A., 2009. In silico prediction of horizontal gene transfer events in

Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation in yogurt

manufacturing. Appl. Environ. Microbiol. 75, 4120–4129. doi:10.1128/AEM.02898-08

Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavlov, A., Pavlova, N.,

Karamychev, V., Polouchine, N., Shakhova, V., Grigoriev, I., Lou, Y., Rohksar, D., Lucas, S.,

Huang, K., Goodstein, D.M., Hawkins, T., Plengvidhya, V., Welker, D., Hughes, J., Goh, Y.,

Benson, A., Baldwin, K., Lee, J.-H., Díaz-Muñiz, I., Dosti, B., Smeianov, V., Wechter, W.,

Barabote, R., Lorca, G., Altermann, E., Barrangou, R., Ganesan, B., Xie, Y., Rawsthorne, H.,

Tamir, D., Parker, C., Breidt, F., Broadbent, J., Hutkins, R., O’Sullivan, D., Steele, J., Unlu, G.,

Saier, M., Klaenhammer, T., Richardson, P., Kozyavkin, S., Weimer, B., Mills, D., 2006.

Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sci. U. S. A. 103, 15611–

15616. doi:10.1073/pnas.0607117103

Makino, S., Ikegami, S., Kume, A., Horiuchi, H., Sasaki, H., Orii, N., 2010. Reducing the risk of

infection in the elderly by dietary intake of yoghurt fermented with Lactobacillus delbrueckii

ssp. bulgaricus OLL1073R-1. Br. J. Nutr. 104, 998–1006. doi:10.1017/S000711451000173X

Marciset, O., Jeronimus-Stratingh, M.C., Mollet, B., Poolman, B., 1997. Thermophilin 13, a

nontypical antilisterial poration complex bacteriocin, that functions without a receptor. J. Biol.

Chem. 272, 14277–14284.

Marteau, P., Minekus, M., Havenaar, R., Huis in’t Veld, J.H., 1997. Survival of lactic acid bacteria in

a dynamic model of the stomach and small intestine: validation and the effects of bile. J. Dairy

Sci. 80, 1031–1037. doi:10.3168/jds.S0022-0302(97)76027-2


92

Marzorati, M., Vanhoecke, B., De Ryck, T., Sadaghian Sadabad, M., Pinheiro, I., Possemiers, S., Van

den Abbeele, P., Derycke, L., Bracke, M., Pieters, J., Hennebel, T., Harmsen, H.J., Verstraete,

W., Van de Wiele, T., 2014. The HMITM module: a new tool to study the Host-Microbiota

Interaction in the human gastrointestinal tract in vitro. BMC Microbiol. 14, 133.

doi:10.1186/1471-2180-14-133

Mater, D.D., Drouault-Holowacz, S., Oozeer, R., Langella, P., Anba, J., Corthier, G., 2006. β-

Galactosidase production by Streptococcus thermophilus is higher in the small intestine than in

the caecum of human-microbiota-associated mice after lactose supplementation. Br. J. Nutr. 96,

177–181.

Mater, D.D.G., Bretigny, L., Firmesse, O., Flores, M.-J., Mogenet, A., Bresson, J.-L., Corthier, G.,

2005. Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus survive

gastrointestinal transit of healthy volunteers consuming yogurt. FEMS Microbiol. Lett. 250,

185–187. doi:10.1016/j.femsle.2005.07.006

Mathot, A.G., Beliard, E., Thuault, D., 2003. Streptococcus thermophilus 580 produces a bacteriocin

potentially suitable for inhibition of Clostridium tyrobutyricum in hard cheese. J. Dairy Sci. 86,

3068–3074. doi:10.3168/jds.S0022-0302(03)73906-X

Metchnikoff, E., 1907. The prolongation of life; optimistic studies. Heinemann, London.

Minekus, M., Marteau, P., Havenaar, R., Huis in’t Veld, J.H., 1995. A multicompartmental dynamic

computer-controlled model simulating the stomach and small intestine. ATLA 197–209.

Minelli, E.B., Benini, A., 2008. Relationship between number of bacteria and their probiotic effects.

Microb. Ecol. Health Dis. 20, 180–183. doi:10.1080/08910600802408095

Miquel, S., Beaumont, M., Martín, R., Langella, P., Braesco, V., Thomas, M., 2015. A proposed

framework for an appropriate evaluation scheme for microorganisms as novel foods with a

health claim in Europe. Microb. Cell Factories 14, 48. doi:10.1186/s12934-015-0229-1

Molly, K., Vande Woestyne, M., Verstraete, W., 1993. Development of a 5-step multi-chamber

reactor as a simulation of the human intestinal microbial ecosystem. Appl. Microbiol.

Biotechnol. 39, 254–258.

Mozzi, F., Gerbino, E., Font de Valdez, G., Torino, M.I., 2009. Functionality of exopolysaccharides

produced by lactic acid bacteria in an in vitro gastric system. J. Appl. Microbiol. 107, 56–64.

doi:10.1111/j.1365-2672.2009.04182.x

Nagpal, R., Kumar, A., Kumar, M., Behare, P.V., Jain, S., Yadav, H., 2012. Probiotics, their health

benefits and applications for developing healthier foods: a review. FEMS Microbiol. Lett. 334,

1–15. doi:10.1111/j.1574-6968.2012.02593.x

Näse, L., Hatakka, K., Savilahti, E., Saxelin, M., Pönkä, A., Poussa, T., Korpela, R., Meurman, J.H.,

2001. Effect of long-term consumption of a probiotic bacterium, Lactobacillus rhamnosus GG,

in milk on dental caries and caries risk in children. Caries Res. 35, 412–420.

O’Callaghan, A., van Sinderen, D., 2016. Bifidobacteria and Their Role as Members of the Human

Gut Microbiota. Front. Microbiol. 7. doi:10.3389/fmicb.2016.00925

Ogita, T., Bergamo, P., Maurano, F., D’Arienzo, R., Mazzarella, G., Bozzella, G., Luongo, D.,

Sashihara, T., Suzuki, T., Tanabe, S., Rossi, M., 2015. Modulatory activity of Lactobacillus

rhamnosus OLL2838 in a mouse model of intestinal immunopathology. Immunobiology 220,

701–710. doi:10.1016/j.imbio.2015.01.004


93

Ogita, T., Nakashima, M., Morita, H., Saito, Y., Suzuki, T., Tanabe, S., 2011a. Streptococcus

thermophilus ST28 ameliorates colitis in mice partially by suppression of inflammatory Th17

cells. J. Biomed. Biotechnol. 2011, 378417. doi:10.1155/2011/378417

Ogita, T., Tanii, Y., Morita, H., Suzuki, T., Tanabe, S., 2011b. Suppression of Th17 response by

Streptococcus thermophilus ST28 through induction of IFN-γ. Int. J. Mol. Med. 28, 817–822.

doi:10.3892/ijmm.2011.755

Palma, M.L., Zamith-Miranda, D., Martins, F.S., Bozza, F.A., Nimrichter, L., Montero-Lomeli, M.,

Marques, E.T.A., Douradinha, B., 2015. Probiotic Saccharomyces cerevisiae strains as

biotherapeutic tools: is there room for improvement? Appl. Microbiol. Biotechnol. 99, 6563–

6570. doi:10.1007/s00253-015-6776-x

Parker, R.B., 1974. Probiotics, the other half of the story. Anim. Nutr. Health 29, 4–8.

Patro-Golab, B., Shamir, R., Szajewska, H., 2015. Yogurt for treating antibiotic-associated diarrhea:

Systematic review and meta-analysis. Nutr. Burbank Los Angel. Cty. Calif 31, 796–800.

doi:10.1016/j.nut.2014.11.013

Pedrosa, M.C., Golner, B.B., Goldin, B.R., Barakat, S., Dallal, G.E., Russell, R.M., 1995. Survival of

yogurt-containing organisms and Lactobacillus gasseri (ADH) and their effect on bacterial

enzyme activity in the gastrointestinal tract of healthy and hypochlorhydric elderly subjects.

Am. J. Clin. Nutr. 61, 353–359.

Perez, P.F., Antoni, G.L. de, Añon, M.C., 1991. Formate Production by Streptococcus thermophilus

Cultures. J. Dairy Sci. 74, 2850–2854. doi:10.3168/jds.S0022-0302(91)78465-8

Pitino, I., Randazzo, C.L., Cross, K.L., Parker, M.L., Bisignano, C., Wickham, M.S.J., Mandalari, G.,

Caggia, C., 2012. Survival of Lactobacillus rhamnosus strains inoculated in cheese matrix

during simulated human digestion. Food Microbiol. 31, 57–63. doi:10.1016/j.fm.2012.02.013

Pochart, P., Dewit, O., Desjeux, J.-F., Bourlioux, P., 1989. Viable starter culture, beta-galactosidase

activity, and lactose in duodenum after yogurt ingestion in lactase-deficient humans. Am. J.

Clin. Nutr. 49, 828–831.

Possemiers, S., Marzorati, M., Verstraete, W., Van de Wiele, T., 2010. Bacteria and chocolate: a

successful combination for probiotic delivery. Int. J. Food Microbiol. 141, 97–103.

doi:10.1016/j.ijfoodmicro.2010.03.008

Preidis, G.A., Hill, C., Guerrant, R.L., Ramakrishna, B.S., Tannock, G.W., Versalovic, J., 2011.

Probiotics, enteric and diarrheal diseases, and global health. Gastroenterology 140, 8–14.

doi:10.1053/j.gastro.2010.11.010

Rasmussen, T.B., Danielsen, M., Valina, O., Garrigues, C., Johansen, E., Pedersen, M.B., 2008.

Streptococcus thermophilus core genome: comparative genome hybridization study of 47

strains. Appl. Environ. Microbiol. 74, 4703–4710. doi:10.1128/AEM.00132-08

Resta-Lenert, S., Barrett, K.E., 2003. Live probiotics protect intestinal epithelial cells from the effects

of infection with Enteroinvasive Escherichia coli (EIEC). Gut 52, 988–997.

Rodríguez, C., Medici, M., Mozzi, F., Font de Valdez, G., 2010. Therapeutic effect of Streptococcus

thermophilus CRL 1190-fermented milk on chronic gastritis. World J. Gastroenterol. 16, 1622–

1630.

Rodríguez, C., Medici, M., Rodríguez, A.V., Mozzi, F., Font de Valdez, G., 2009. Prevention of

chronic gastritis by fermented milks made with exopolysaccharide-producing Streptococcus

thermophilus strains. J. Dairy Sci. 92, 2423–2434. doi:10.3168/jds.2008-1724


94

Rossi, F., Marzotto, M., Cremonese, S., Rizzotti, L., Torriani, S., 2013. Diversity of Streptococcus

thermophilus in bacteriocin production; inhibitory spectrum and occurrence of thermophilin

genes. Food Microbiol. 35, 27–33. doi:10.1016/j.fm.2013.02.006

Rul, F., Ben-Yahia, L., Chegdani, F., Wrzosek, L., Thomas, S., Noordine, M.-L., Gitton, C., Cherbuy,

C., Langella, P., Thomas, M., 2011. Impact of the Metabolic Activity of Streptococcus

thermophilus on the Colon Epithelium of Gnotobiotic Rats. J. Biol. Chem. 286, 10288–10296.

doi:10.1074/jbc.M110.168666

Saavedra, J.M., Abi-Hanna, A., Moore, N., Yolken, R.H., 2004. Long-term consumption of infant

formulas containing live probiotic bacteria: tolerance and safety. Am. J. Clin. Nutr. 79, 261–

267.

Saavedra, J.M., Bauman, N.A., Oung, I., Perman, J.A., Yolken, R.H., 1994. Feeding of

Bifidobacterium bifidum and Streptococcus thermophilus to infants in hospital for prevention of

diarrhoea and shedding of rotavirus. Lancet Lond. Engl. 344, 1046–1049.

Salminen, S., 1996. Uniqueness of probiotic strains. IDF Nutr. Newsl. 5, 16–18.

Salminen, S., Ouwehand, A., Benno, Y., Lee, Y.K., 1999. Probiotics: how should they be defined?

Trends Food Sci. Technol. 10, 107–110. doi:10.1016/S0924-2244(99)00027-8

Schaafsma, G., 1996. State-of-the-art concerning probiotic strains in milk products. IDF Nutr. Newsl.

5, 23–25.

Schrezenmeir, J., de Vrese, M., 2001. Probiotics, prebiotics, and synbiotics--approaching a definition.

Am. J. Clin. Nutr. 73, 361S–364S.

Senok, A.C., Ismaeel, A.Y., Botta, G.A., 2005. Probiotics: facts and myths. Clin. Microbiol. Infect. 11,

958–966. doi:10.1111/j.1469-0691.2005.01228.x

Shah, N.P., 2007. Functional cultures and health benefits. Int. Dairy J. 17, 1262–1277.

doi:10.1016/j.idairyj.2007.01.014

Sieuwerts, S., de Bok, F.A.M., Hugenholtz, J., van Hylckama Vlieg, J.E.T., 2008. Unraveling

microbial interactions in food fermentations: from classical to genomics approaches. Appl.

Environ. Microbiol. 74, 4997–5007. doi:10.1128/AEM.00113-08

Sokol, H., Pigneur, B., Watterlot, L., Lakhdari, O., Bermúdez-Humarán, L.G., Gratadoux, J.-J.,

Blugeon, S., Bridonneau, C., Furet, J.-P., Corthier, G., Grangette, C., Vasquez, N., Pochart, P.,

Trugnan, G., Thomas, G., Blottière, H.M., Doré, J., Marteau, P., Seksik, P., Langella, P., 2008.

Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut

microbiota analysis of Crohn disease patients. Proc. Natl. Acad. Sci. U. S. A. 105, 16731–

16736. doi:10.1073/pnas.0804812105

Sperti, G.S., 1971. Probiotics. AVI Publishing Co. Inc., West Point, Connecticut.

Stensson, M., Koch, G., Coric, S., Abrahamsson, T.R., Jenmalm, M.C., Birkhed, D., Wendt, L.-K.,

2014. Oral administration of Lactobacillus reuteri during the first year of life reduces caries

prevalence in the primary dentition at 9 years of age. Caries Res. 48, 111–117.

doi:10.1159/000354412

Sun, Z., Chen, X., Wang, J., Zhao, W., Shao, Y., Wu, L., Zhou, Z., Sun, T., Wang, L., Meng, H.,

Zhang, H., Chen, W., 2011. Complete genome sequence of Streptococcus thermophilus strain

ND03. J. Bacteriol. 193, 793–794. doi:10.1128/JB.01374-10


95

Teanpaisan, R., Piwat, S., 2014. Lactobacillus paracasei SD1, a novel probiotic, reduces mutans

streptococci in human volunteers: a randomized placebo-controlled trial. Clin. Oral Investig. 18,

857–862. doi:10.1007/s00784-013-1057-5

Terahara, M., Kurama, S., Takemoto, N., 2001. Prevention by lactic acid bacteria of the oxidation of

human LDL. Biosci. Biotechnol. Biochem. 65, 1864–1868.

Thibessard, A., Borges, F., Fernandez, A., Gintz, B., Decaris, B., Leblond-Bourget, N., 2004.

Identification of Streptococcus thermophilus CNRZ368 genes involved in defense against

superoxide stress. Appl. Environ. Microbiol. 70, 2220–2229.

Thomas, M., Wrzosek, L., Ben-Yahia, L., Noordine, M.-L., Gitton, C., Chevret, D., Langella, P.,

Mayeur, C., Cherbuy, C., Rul, F., 2011. Carbohydrate Metabolism Is Essential for the

Colonization of Streptococcus thermophilus in the Digestive Tract of Gnotobiotic Rats. PLoS


Tian, F., Chi, F., Wang, G., Liu, X., Zhang, Q., Chen, Y., Zhang, H., Chen, W., 2015. Lactobacillus

rhamnosus CCFM1107 treatment ameliorates alcohol-induced liver injury in a mouse model of

chronic alcohol feeding. J. Microbiol. Seoul Korea 53, 856–863. doi:10.1007/s12275-015-5239-

5

Tian, H., Tan, J., Zhang, L., Gu, X., Xu, W., Guo, X., Luo, Y., 2012. Increase of stress resistance in

Lactococcus lactis via a novel food-grade vector expressing a shsp gene from Streptococcus

thermophilus. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 43, 1157–1164.

doi:10.1590/S1517-838220120003000043

Trabelsi, I., Ktari, N., Ben Slima, S., Hamden, K., Ben Salah, R., 2016. Effect of a probiotic

Lactobacillus plantarum TN8 strain on trinitrobenzene sulphonic acid-induced colitis in rats. J.

Anim. Physiol. Anim. Nutr. doi:10.1111/jpn.12536

Trip, H., Mulder, N.L., Lolkema, J.S., 2012. Improved acid stress survival of Lactococcus lactis

expressing the histidine decarboxylation pathway of Streptococcus thermophilus CHCC1524. J.

Biol. Chem. 287, 11195–11204. doi:10.1074/jbc.M111.330704

Uriot, O., Galia, W., Awussi, A.A., Perrin, C., Denis, S., Chalancon, S., Lorson, E., Poirson, C.,

Junjua, M., Le Roux, Y., Alric, M., Dary, A., Blanquet-Diot, S., Roussel, Y., 2016. Use of the

dynamic gastro-intestinal model TIM to explore the survival of the yogurt bacterium

Streptococcus thermophilus and the metabolic activities induced in the simulated human gut.

Food Microbiol. 53, 18–29. doi:10.1016/j.fm.2015.05.007

Vasiljevic, T., Shah, N.P., 2008. Probiotics—From Metchnikoff to bioactives. Int. Dairy J., Milestone

Achievements in Dairy Science Research and their Current and Future Industrial Applications.

Proceedings of a Symposium marking the retirement of Professor Paul Jelen from active service

at University of Alberta, Canada 18, 714–728. doi:10.1016/j.idairyj.2008.03.004

Venturi, A., Gionchetti, P., Rizzello, F., Johansson, R., Zucconi, E., Brigidi, P., Matteuzzi, D.,

Campieri, M., 1999. Impact on the composition of the faecal flora by a new probiotic

preparation: preliminary data on maintenance treatment of patients with ulcerative colitis.

Aliment. Pharmacol. Ther. 13, 1103–1108.

Vergin, F., 1954. [Antibiotics and probiotics]. Hippokrates 25, 116–119.

Vieira, A.T., Galvão, I., Amaral, F.A., Teixeira, M.M., Nicoli, J.R., Martins, F.S., 2015. Oral

treatment with Bifidobacterium longum 51A reduced inflammation in a murine experimental

model of gout. Benef. Microbes 6, 799–806. doi:10.3920/BM2015.0015


96

Villani, F., Pepe, O., Mauriello, G., Salzano, G., Moschetti, G., Coppola, S., 1995. Antilisterial

activity of thermophilin 347, a bacteriocin produced by Streptococcus thermophilus. Int. J. Food

Microbiol. 25, 179–190.

Vinderola, C.G., Reinheimer, J.A., 2003. Lactic acid starter and probiotic bacteria: a comparative “in

vitro” study of probiotic characteristics and biological barrier resistance. Food Res. Int. 36, 895–

904. doi:10.1016/S0963-9969(03)00098-X

Wang, B., Xu, H., Xu, F., Zeng, Z., Wei, H., 2016. Efficacy of oral Bifidobacterium bifidum ATCC

29521 on microflora and antioxidant in mice. Can. J. Microbiol. 62, 249–262. doi:10.1139/cjm-

2015-0685

Wang, Y., Huang, Y., 2014. Effect of Lactobacillus acidophilus and Bifidobacterium bifidum

supplementation to standard triple therapy on Helicobacter pylori eradication and dynamic

changes in intestinal flora. World J. Microbiol. Biotechnol. 30, 847–853. doi:10.1007/s11274-

013-1490-2

Ward, D.J., Somkuti, G.A., 1995. Characterization of a bacteriocin produced by Streptococcus

thermophilus ST134. Appl. Microbiol. Biotechnol. 43, 330–335.

West, C.E., Hammarström, M.-L., Hernell, O., 2009. Probiotics during weaning reduce the incidence

of eczema. Pediatr. Allergy Immunol. Off. Publ. Eur. Soc. Pediatr. Allergy Immunol. 20, 430–

437. doi:10.1111/j.1399-3038.2009.00745.x

Ziar, H., Gérard, P., Riazi, A., 2014. Effect of prebiotic carbohydrates on growth, bile survival and

cholesterol uptake abilities of dairy-related bacteria. J. Sci. Food Agric. 94, 1184–1190.

doi:10.1002/jsfa.6395

Ziarno, M., 2010. Viability and cholesterol uptake by Streptococcus thermophilus cultures in artificial

GIT fluids. Acta Sci. Pol. Technol. Aliment. 9.

Zotta, T., Ricciardi, A., Ciocia, F., Rossano, R., Parente, E., 2008a. Diversity of stress responses in

dairy thermophilic streptococci. Int. J. Food Microbiol. 124, 34–42.


Zotta, T., Ricciardi, A., Rossano, R., Parente, E., 2008b. Urease production by Streptococcus

thermophilus. Food Microbiol. 25, 113–119. doi:10.1016/j.fm.2007.07.001

97

CHAPITRE 3: MéTHodEs d’éTudE du TRAnsCRIPToME bACTéRIEn dAns un EnvIRonnEMEnT CoMPlExE

Chapitre 3

MéTHodEs d’éTudE du TRAnsCRIPToME bACTéRIEn

dans un environnement complexe

Sommaire

5. Méthodes basées sur l’hybridation ................................................................................ 99

5.1. Technologie des puces à ADN ............................................................................................ 100

5.2. Technique SCOTS ............................................................................................................... 101

6. Méthodes basées sur les constructions génétiques ..................................................... 103

6.1. Méthode STM ...................................................................................................................... 103

6.2. Méthode IVET, R-IVET et DFI .......................................................................................... 105

Chapitre 3: Méthodes d’étude du transcriptome bactérien dans un environnement complexe

99

CHAPITRE 3: MéTHodEs d’éTudE du TRAnsCRIPToME

bactérien dans un environnement

complexe

Les bactéries, organismes de très petite taille et d’organisation simple, sont néanmoins

des systèmes complexes et dynamiques. Elles sont capables de s’adapter rapidement à un

nouvel environnement par la modification de leur métabolisme et la production de nouvelles

protéines.

Classiquement, les études sur la physiologie bactérienne sont réalisées in vitro en

conditions de laboratoires. Si ces analyses ont permis la compréhension de nombreux

mécanismes chez les bactéries, il est de plus en plus courant d’étudier la physiologie

bactérienne en conditions complexes telles que celles rencontrées dans leur niche écologique

ou dans le TGI. Des technologies sophistiquées ont été développées pour analyser les

fonctions bactériennes activées dans ces environnements. Ce sont des méthodes permettant

l’analyse du transcriptome (analyse des ARNs produits) et du protéome (analyse des protéines

produites). L’analyse du transcriptome englobe des techniques permettant la détection de

promoteurs induits ou la caractérisation des changements d’expression génique par la mise en

évidence de transcrits (ARNm).

Au regard des travaux réalisés dans cette thèse, ce chapitre présentera uniquement les

techniques de transcriptomique qui peuvent être séparées en deux catégories: les méthodes

basées sur l’hybridation et les méthodes basées sur des constructions génétiques (An et

Grewal, 2012). Ainsi les techniques d’analyse du transcriptome telles que le RNAseq, basée

sur du séquençage à haut débit, ainsi que les techniques d’analyse du protéome comme

l’électrophorèse bidimensionnelle sur gel ou encore les puces à protéines ne seront pas

présentées.

5. Méthodes basées sur l’hybridation

Les méthodes basées sur l’hybridation correspondent aux puces à ADN (« cDNA

microarrays ») et à la technique SCOTS (« Selective capture of transcribed sequences »).


100

5.1. Technologie des puces à ADN

La biopuce est une technique couramment utilisée. En plus des puces à ADN

présentées ici, il existe des biopuces à protéines (Atak et al., 2016; Gupta et al., 2016) et des

biopuces à cellules vivantes (Elad et al., 2008; Jonczyk et al., 2016) qui fonctionnent sur le

même principe.

Figure 26: Représentation du principe de la puce à ADN Les ARNs provenant des deux conditions expérimentales à comparer sont extraits puis sont convertis

en ADNc et marqués avec des fluorochromes différents. Les ADNc sont hybridés sur une puce qui

comprend un grand nombre d’oligonucléotides ou d’ADNc provenant de la bactérie étudiée. Après

hybridation sur la puce, les fluorochromes sont excités par un laser et la fluorescence émise est

mesurée.

Les puces à ADN sont constituées de sondes immobilisées sur un support solide. Ces

sondes sont des fragments d’ADN représentant la totalité ou une partie du génome étudié ou


101

encore de l’ADN codant pour des éléments de régulation tels que les petits ARN (Gomez et

al., 2011). Le principe de la puce est simple (Figure 26). Les ARNm des microorganismes

étudiés dans des conditions différentes sont extraits puis convertis en ADNc et marqués par

des fluorochromes. Lorsque les fluorochromes sont excités par un laser, un signal fluorescent

est émis au niveau des sondes lorsque les ADNc marqués sont hybridés à celles-ci. Il est ainsi

possible de comparer les niveaux d'ARNm produits par une bactérie cultivée dans des

conditions différentes. L’utilisation de puces à ADN permet de mesurer/comparer rapidement

les niveaux d’expression d’un grand nombre de gènes (génome complet) en même temps et

ceci en utilisant une faible quantité d’ADNc (Cao et al., 2011).

Cependant, cette technique est limitée par la difficulté à extraire des ARNm bactériens

de qualité suffisante à partir des conditions in vivo testées. L’ARNm bactérien a une demi-vie

courte et est extrait avec une grande quantité d’ARNr et d’ARN provenant de

l’environnement étudié. Les puces à ADN apparaissent alors peu adaptées à l’étude de l’état

physiologique des bactéries dans un système in vivo complexe, comme le TGI humain.

Cependant, cette technique a permis par exemple d’identifier les gènes exprimés par Vibrio

(V.) cholerae dans l’intestin grêle de lapin (Xu et al., 2003). De plus, des puces à ADN sont

utilisées pour étudier la diversité du microbiote intestinal (Tottey et al., 2013).

5.2. Technique SCOTS

La technique SCOTS permet de minimiser les facteurs limitant des puces à ADN dans

les systèmes in vivo. En effet, cette méthode s’affranchit de la faible quantité de cellules

bactériennes (contexte eucaryote-hôte) par l’amplification spécifique du transcriptome

bactérien.

Cette approche complexe consiste en la combinaison d’une hybridation soustractive à

des PCRs avec des amorces « taggées » permettant la capture des gènes bactériens exprimés

dans un environnement particulier (Figure 27) (Graham et Clark-Curtiss, 1999). Comme pour

la puce à ADN, l’ARN total bactérien et eucaryote est extrait et les ARNs sont ensuite

convertis en ADNc à l’aide d’amorces spécifiques. L’amorce du côté 3’ est composée d’une

séquence aléatoire tandis que l’amorce du côté 5’ contient un élément spécifique, le tag. Pour

identifier les gènes bactériens transcrits en réponse à leur environnement, l’ADNc bactérien

est séparé de l’ADNc non-bactérien par capture sélective. Les ADNc bactériens sont hybridés

avec de l’ADN bactérien biotinylé permettant leurs captures par des billes recouvertes de

streptavidine et leur retrait du mélange réactionnel. Ces ADNc sont ensuite récupérés pour


102

être amplifiés par PCR avec les amorces tag. Les ADNc enrichis sont ensuite clonés dans un

vecteur de clonage pour construire une banque de gènes activés ou réprimés dans l’hôte. Le

séquençage des inserts permet d’identifier la nature du gène transcrit dans les conditions

utilisées.

Figure 27: Représentation de la technique SCOTS (Selective capture of transcribed

sequence) A: Les ARN totaux bactériens et eucaryotes produits lors de la croissance dans deux conditions

différentes (in vitro et in vivo) sont extraits puis convertis en ADNc double brins taggés par

l’utilisation d’amorces 5’ spécifiques. Ces ADNc subissent une étape de normalisation permettant de

ne recueillir que les ADNc d’origine bactérienne. B. Etape d’hybridation soustractive visant à

recueillir les ADNc bactériens provenant de l’expression des gènes différemment exprimés entre les

deux conditions de croissance (d’après An et Grewal, 2012).

La technique SCOTS a été initialement développée pour identifier des gènes exprimés

par Mycobacterium tuberculosis dans les macrophages (Graham et Clark-Curtiss, 1999).

Depuis, elle a été essentiellement utilisée pour identifier les gènes de bactéries pathogènes

exprimés dans les conditions spécifiques d’infection de l’hôte (An et Grewal, 2012), comme

par exemple lors de l’étude des interactions entre le pathogène S. agalactiae avec les

macrophages (Guo et al., 2014) ou encore dans l’étude du pathogène Helicobacter pylori en

conditions gastriques (Graham et al., 2002). Même si elle a été utilisée principalement pour


103

étudier des interactions hôte/pathogènes, la technique SCOTS est applicable à tout type de

bactérie, il est donc envisageable de l’appliquer à des probiotiques. De plus, cette technique

peut-être utilisée dans l’environnement digestif puisque l’étude de Graham et al. (2002), citée

ci-dessus, a été réalisé dans l’estomac de rongeurs.

La technique SCOTS ne nécessite pas une grande quantité et qualité d’ARNm ou

d’informations génétiques préliminaires. A partir d’une faible quantité de cellules

bactériennes, les gènes exprimés « in vivo » peuvent être détectés. Cependant, il ne s’agit pas

de méthode de quantification pour l’étude d’expression des gènes. Toutefois, elle peut être

combinée avec les puces à ADN, permettant ainsi de quantifier les niveaux d’expression des

gènes exprimés dans des conditions complexes (An et Grewal, 2012).

6. Méthodes basées sur les constructions génétiques

Les méthodes basées sur les constructions génétiques comprennent la méthode STM

(Signature-Tagged Mutagenesis) et les techniques de capture de promoteurs comme la DFI

(Differential Fluorescence Induction), la technique IVET (In vivo expression technology) et

une technique dérivée, le R-IVET (Recombinase-based in vivo expression technology)

6.1. Méthode STM

Des méthodes ont été développées afin de permettre l’identification de gènes exprimés

dans des conditions complexes. La méthode STM est une technique basée sur le principe de

sélection négative, qui consiste à construire une banque de mutants par insertion de

transposons au hasard dans le génome de la bactérie. Les transposons portent une séquence

tag unique flanquée de deux séquences conservées (fixation d’amorces) ce qui permet une

reconnaissance individuelle du mutant après amplification par PCR (Hensel et al., 1995). Une

banque de mutants est ainsi générée, chaque clone portant une mutation différente (Figure

28). Cette banque est alors testée dans les conditions étudiées (environnement complexe

comme l’environnement digestif) puis les clones sont isolés sur milieu gélosé et ils seront

comparés à la banque initiale. Pour cela, les séquences tag de la banque initiale et des clones

récupérés sont amplifiées et marquées. Ces séquences sont hybridées sur des membranes

marquées avec l’ADN génomique de la banque initiale. Comme il s’agit d’une méthode à

sélection négative, l’absence de signal pour un tag chez les mutants récupérés indique que le

gène muté est important pour la survie de la bactérie dans l’hôte puisque la mutation empêche

l’expression du gène.


104

Cependant, le besoin de transposons utilisables dans la souche et le nombre de

transposons nécessaires pour couvrir l’ensemble du génome de la bactérie imposent une limite

technique à la méthode. Cette technique a été récemment utilisée chez V. vulcanicus

(Yamamoto et al., 2015) et chez Pseudomonas aeruginosa (Kukavica-Ibrulj et Levesque,

2015) et a permis de mettre en évidence de nombreux facteurs de virulence chez ces bactéries.

Comme pour les autres techniques, la technique STM a été principalement utilisée dans le

cadre de l’étude des interactions hôte/pathogènes. Mais récemment, elle a été développée chez

Lb. casei pour identifier les gènes impliqués dans la colonisation du TGI du lapin (Licandro-

Seraut et al., 2014). Ceci montre que cette technique peut-être utilisée chez des organismes

non-pathogènes pour l’étude de gènes exprimés en conditions complexes telles que celles

rencontrées dans le tractus digestif.

Figure 28: Représentation de la technique STM (Signature tagged mutagenesis) Une banque de mutants est produite par l’introduction, au hasard, de séquences tag via des transposons

dans le génome de la bactérie. La banque de mutants (pool mutants) est testée, dans cet exemple chez

la souris, puis les mutants sont récupérés sur milieu solide. Les ADNs des mutants récupérés et du

« pool mutants » sont amplifiés au niveau du tag et marqués. Les tags marqués vont être hybridés sur

des membranes marquées avec l’ADN génomique du « pool mutants ». L’absence de signal pour un

tag signifie que le gène est exprimé dans la condition testée (d’après West et al., 2003).


105

6.2. Méthode IVET, R-IVET et DFI

Ces techniques permettent de révéler les gènes actifs dans des environnements

complexes par un système de piège de promoteur. Les techniques R-IVET et DFI sont

dérivées de la technique IVET. Initialement, ces techniques ont été développées pour

identifier les gènes de virulence de pathogènes, elles ont également été utilisées chez des

bactéries non-pathogènes (Bron et al., 2004). Bien que nécessitant de lourdes manipulations

génétiques (clonage, mutagénèse et transformation), les technologies IVET et R-IVET ne

nécessitent aucun équipement particulier pour identifier les gènes activés contrairement aux

techniques de puces à ADN et DFI et ne nécessitent aucune extraction préalable d’ARNs.

Cependant, ces méthodes nécessitent tout d’abord de construire le plasmide de fusion

transcriptionnelle, puis de créer la banque d’ADN génomique avec un nombre important de

clones pour recouvrir autant que possible la totalité du génome de la souche étudiée.

6.2.1. Technologie IVET

La technologie IVET a été développée par Mahan et ses collaborateurs en 1993 chez

Salmonella typhimurium. Cette première construction était basée sur l’auxotrophie d’une

souche à la purine. Sans ce facteur, la bactérie ne peut se développer dans le milieu. Une

fusion transcriptionnelle du gène purA, codant une enzyme nécessaire à la biosynthèse de la

purine, avec un gène rapporteur a été réalisée dans un plasmide, ces deux gènes étant démunis

de leur promoteur (Figure 29). Des fragments d’ADN (inserts) provenant du génome de la

bactérie ont été clonés au hasard en amont de cet « opéron ». Le plasmide est ensuite introduit

dans la bactérie auxotrophe. Parmi les transformants, lorsqu’un promoteur est actif dans

l’insert d’ADN cloné, il y a complémentation et le clone peut croître sur un milieu sans

purine. Dans des conditions spécifiques, les promoteurs induits peuvent être déterminés par

l’expression du gène purA et un séquençage du fragment d’ADN cloné en amont du gène

purA permet d’identifier le promoteur qui a été actif dans les conditions utilisées (Mahan et

al., 1993). Par la suite, le gène codant un facteur de croissance essentiel, comme purA, a été

remplacé par un gène de résistance à un antibiotique (Mahan et al., 1995). L’utilisation de

l’antibiotique permet de recouvrer les clones qui possèdent un promoteur actif en amont du

gène de résistance à un antibiotique. Cependant, la dose d’antibiotique doit être évaluée avec

précision, afin de permettre l’expression des promoteurs induits de manière faible ou

transitoire. En effet, si la pression de sélection est trop forte, ces clones ne pourront produire


106

suffisamment d’enzyme d’inactivation de l’antibiotique et ces clones seront par conséquent

contre-sélectionnés (Gomez et al., 2011).

L’IVET a également été mis au point chez d’autres bactéries telles que Pseudomonas

fluorescens avec le gène panB impliqué dans la biosynthèse de pantothénate (Rainey, 1999),

E. coli avec le gène cat impliqué dans la résistance au chloramphénicol (Khan et Isaacson,

2002) ou encore Borrelia burgdorferi avec le pncA impliqué dans la virulence (Ellis et al.,

2013).

Figure 29: Représentation du principe de la technique IVET Cette technique implique la construction d’un vecteur qui comprend un gène codant un facteur

essentiel de croissance (egf) cloné en amont d’un gène rapporteur (rep), ces deux gènes sont démunis

de leur promoteur. En amont de cette construction sont clonés des fragments d’ADN (Pivi) (étape 1),

puis le vecteur est intégré dans le chromosome (étape 2). Les clones portant un promoteur (Pivi) actif

sont complémentés dans une condition spécifique (étape 3) ce qui permet de sélectionner les clones

avec une activité promotrice (étape 4). Les clones identifiés peuvent repasser une seconde fois dans les

conditions testées afin d’éliminer les faux positifs (étape 5) (Rediers et al., 2005).

6.2.2. Méthode DFI

Cette technique a été développée pour palier au marquage définitif des clones par la

technique IVET et pour suivre l’activation des gènes bactériens par la production de

fluorescence grâce au marqueur GFP (Green fluorescent protein) (Valdivia et Falkow, 1996).

Elle permet de suivre en temps réel l’induction de promoteur par la mesure de fluorescence


107

chez une cellule unique et avec une localisation spatio-temporelle dans un contexte

d’infection (Bongaerts et al., 2002). Cette technique peut être couplée à une technique de tri

cellulaire par cytométrie de flux (FACS), ce qui permet un criblage à haut débit des clones de

façon semi-automatique.

Cette technique a été développée chez Salmonella enterica permettant l'identification

de promoteurs bactériens induits dans des sites anatomiques distincts (le foie et la rate) et à

des stades différents de l'infection, chez des souris infectées (Bumann et Valdivia, 2007).

La DFI requiert de nombreuses manipulations génétiques car pour être utilisée, il est

nécessaire de construire une banque d’ADN génomique dans un plasmide portant le gène de

la GFP. De plus, la DFI nécessite un matériel particulier lié à la technologie FACS et à

l’utilisation de la GFP qui doit être optimisée pour une utilisation dans la bactérie d’intérêt.

6.2.3. Technologie R-IVET

La technologie R-IVET est une variante de la technologie IVET qui permet de détecter

les promoteurs activés faiblement ou transitoirement. La construction génétique possède deux

éléments: (i) un plasmide recombinant qui possède un gène de recombinase à site spécifique

démuni de son promoteur et (ii) une cassette constituée d’un marqueur, généralement un gène

de résistance à un antibiotique, encadré de part et d’autre par des sites reconnus

spécifiquement par la recombinase du plasmide. Des fragments d’ADN provenant du génome

de la bactérie étudiée sont clonés en amont de la recombinase afin d’identifier les promoteurs

qui sont induits dans les conditions étudiées. Les clones d’intérêt sont criblés par la présence

ou l’absence du gène marqueur dans la cassette. Comme la réaction d’excision est

irréversible, dès qu’un promoteur sur le fragment d’ADN à analyser est induit, il y a perte du

phénotype marqueur et ceci permet à la technologie R-IVET de détecter une activité

promotrice faible ou même transitoire (Bron et al., 2004).

Le modèle R-IVET développé par Bron et al. (2004) consiste en l’excision d’un gène

rapporteur, le gène de résistance à l’érythromycine, par la recombinase Cre lorsqu’une activité

promotrice est induite sur l’insert cloné en amont de la recombinase préalablement démuni de

son promoteur (Bron et al., 2004). Cette construction correspond au crible de sélection

négatif, lorsqu’un promoteur est induit, le phénotype du gène marqueur est perdu. En

revanche, la construction réalisée par Hanin et al. (2010) correspond à un crible de sélection


108

positif. En effet, la construction est une succession de deux gènes de résistance (i) à

l’érythromycine et (ii) à la tétracycline antibiotiques. L’induction d’un promoteur entraine

l’excision du gène de résistance à l’érythromycine par la recombinase Cre permettant ainsi

l’expression du gène de résistance à la tétracycline jusque là inactif (Hanin et al., 2010).

L’induction d’un promoteur entraine donc un changement du phénotype de résistance aux

antibiotiques, permettant ainsi d’identifier les clones dont un promoteur a été induit dans les

conditions testées.

La technologie R-IVET a été utilisée chez des organismes pathogènes et non-

pathogènes tels que E. coli (Tuntufye et al., 2012), E. faecalis (Frank et al., 2012; Hanin et

al., 2010), L. lactis (Bachmann et al., 2008), Lb. plantarum (Bron et al., 2004) ou encore

V. cholerae (Lee et al., 1999; Osorio et al., 2005). Cette technologie a permis d’identifier des

gènes spécifiquement activés dans des conditions complexes telles que le TGI (Bron et al.,

2004), le système urinaire (Hanin et al., 2010) ou encore environnement laitier tel que le

fromage (Bachmann et al., 2008).

Dans ces travaux de thèse, deux constructions R-IVET ont été mis au point: un crible à

sélection négative et un crible à sélection positive chez S. thermophilus LMD-9. Le crible

négatif développé chez S. thermophilus permet d’identifier les gènes par perte d’un gène

rapporteur, ici un gène de résistance à un antibiotique, la spectinomycine. Tandis, que le

crible positif permet d’identifier les gènes par l’expression d’un gène rapporteur. Ces deux

constructions génétiques sont détaillées ci-après dans la partie expérimentale de la thèse (voir

Chapitre 1 page 111 pour le crible négatif et Chapitre 3 page 153 pour le crible positif).

109

Seconde partie ‒ travaux expérimentaux ‒

Seconde PARTIE

— Travaux expérimentaux —

Chapitre 1 : Développement du R-IVET chez S. thermophilus

111

Chapitre1: développement de la recombinase-based in vivo expression technology (r-ivet) chez

Streptococcus thermophilus

Chapitre 1

Développement de la recombinase-based in vivo

expression technology (R-IVET) chez

Streptococcus thermophilus

Introduction à la publication 1

Les probiotiques, micro-organismes vivants ayant un effet bénéfique pour la santé de

l’hôte, présentent un intérêt dans le traitement préventif et curatif de certaines maladies et

peuvent donc constituer une alternative intéressante à des traitements médicaux qui peuvent

entrainer des effets indésirables. Cependant, pour bénéficier du titre de probiotiques et obtenir

une allégation santé, il est nécessaire de fournir des preuves de l’efficacité du probiotique en

s’appuyant sur de multiples études scientifiques.

Des études ont mis en évidence des effets santés intéressants chez S. thermophilus, ce

qui fait de lui un candidat prometteur au statut de probiotique. Mais avant qu’il ne soit

reconnu en tant que probiotique, des études doivent être effectuées pour déterminer sa survie,

appréhender sa physiologie dans le TGI et pour évaluer son aptitude à exercer des fonctions

probiotiques in situ. Pour étudier le comportement de bactéries dans des environnements

complexes tels que le TGI, différentes approches peuvent être employées comme l’analyse

protéomique, les puces à ADN ou encore le séquençage d’ARN. Des analyses protéomiques

ont déjà été réalisées chez des rats gnotobiotiques afin d’étudier la physiologie de

S. thermophilus dans l’environnement digestif. Les résultats ont révélé une augmentation

importante de la glycolyse, ce qui suggère que le métabolisme carboné jouerait un rôle clé


112

dans l’adaptation de S. thermophilus dans le TGI (Rul et al., 2011; Thomas et al., 2011). Il est

important de noter que ces différentes techniques n’apportent pas la même d’information sur

la bactérie, c’est pourquoi l’utilisation de plusieurs méthodes peut s’avérer judicieux pour

mieux comprendre la physiologie de S. thermophilus. En outre, celles citées précédemment

sont des approches globales qui permettent d’analyser un niveau moyen d’expression (au

niveau de la population bactérienne) et non de détecter des changements transitoires et

individuels d’expression. Pour apporter des informations supplémentaires sur la physiologie

de S. thermophilus lors de son passage dans le TGI, nous avons décidé d’utiliser la

technologie R-IVET. La technologie R-IVET est une technique de piégeage de promoteur qui

permet d’identifier les gènes activés par l’excision d’un gène rapporteur dans des

environnements complexes tels que les sols, les aliments fermentés ou le TGI (Bachmann et

al., 2010; Rediers et al., 2005).

L’objectif de cette étude a été de construire les éléments génétiques constituant le R-

IVET et de la mettre en place chez S. thermophilus. Puis, nous avons validé sa fonctionnalité

par l’utilisation de promoteur connu en déterminant si le gène rapporteur pouvait être délété

en condition de culture. Puis, l’outil R-IVET a été testé dans un environnement complexe, le

TGI de souris.

Ma contribution à ce travail a été de déterminer la cinétique d’activation, grâce à

l’outil R-IVET, du promoteur de l’opéron lactose (plac) au cours de la croissance de

S. thermophilus en milieu M17 en présence de lactose et de glucose.


113

Publication 1

Development of the recombinase-based in vivo expression technology in Streptococcus

thermophilus and validation using the lactose operon promoter

2014. Journal of Applied Microbiology

M. Junjua1, W. Galia

1, N. Gaci

1, O. Uriot

1, M. Genay

1, H. Bachmann

2,3, M. Kleerebezem

2,4,

A. Dary1 and Y. Roussel

1

1 Unité de Recherche, ‘Animal & Fonctionnalités des Produits Animaux’, Equipe ‘Protéolyse et

Biofonctionnalités des Protéines et des Peptides’, UC INRA 340, Université de Lorraine, Vandoeuvre-

lès-Nancy, France

2 NIZO food research, Health Department, Ede, the Netherlands

3 VU University Amsterdam, Systems Bioinformatics, Faculty of Earth and Life Sciences,

Amsterdam, the Netherlands

4 Wageningen University, Host Microbe Interactomics Group, Wageningen, the Netherlands


115


116


117


118


119


120


121


122


123


124


125


126


127

Commentaire de la publication 1

L’objectif de cette étude a été de développer pour la première fois l’outil R-IVET chez

S. thermophilus. Pour cela, nous avons construit les deux éléments génétiques formant le R-

IVET : la cassette chromosomique et le plasmide. Après avoir vérifié la stabilité des éléments

génétiques, nous avons validé le fonctionnement de l’outil R-IVET en utilisant trois

promoteurs de S. thermophilus et en vérifiant la délétion de la cassette dans différentes

conditions de culture in vitro. Enfin, l’outil a été testé dans le TGI de souris, où le promoteur

de l’opéron lactose a été utilisé.

► Construction des deux éléments génétiques constituant l’outil R-IVET chez

S. thermophilus

L’outil R-IVET avait déjà été mis en place chez d’autres bactéries lactiques, comme

Lb. plantarum et L. lactis, afin d’identifier les gènes induits respectivement dans le TGI de

souris ou dans le fromage, respectivement (Bachmann et al., 2008, 2010; Bron et al., 2004).

Pour développer la technologie R-IVET chez S. thermophilus, nous avons construit deux

nouveaux éléments génétiques en adaptant les vecteurs déjà disponibles chez la souche

S. thermophilus LMD-9, dont le génome a été entièrement séquencé (Makarova et al., 2006).

Le premier élément génomique est la cassette chromosomique constituée du gène de

résistance à la spectinomycine flanqué des sites loxP qui sont reconnus par la recombinase

Cre et qui est introduit dans le chromosome de S. thermophilus LMD-9 (Figure 30).

L’overlapping PCR a été utilisée pour assembler les différents fragments d’ADN requis pour

générer le fragment constituant la cassette R-IVET. Ce fragment a ensuite été introduit dans

des cellules compétentes de LMD-9 et intégré au chromosome par recombinaison homologue

au niveau du gène STER_0891 qui code un transporteur de glucose. Avant de poursuivre les

analyses, la présence de la cassette R-IVET a été confirmée par PCR dans des clones

résistants à la spectinomycine et la cassette a été séquencée pour vérifier la construction et

l’absence de mutation dans celle-ci. Un clone recombinant, dont la séquence a été confirmée,

a été choisi et nommé STUL5001. Cette souche mutante constitue le premier élément de

l’outil R-IVET. Puis, le second élément de l’outil R-IVET, le plasmide pULNcreB (Figure

30), a été construit en clonant le gène de la recombinase site-spécifique cre, dépourvu de son

promoteur, dans le plasmide p+Ghost9TR

(Fontaine et al., 2010). Le plasmide a également été


128

séquencé dans les deux sens pour vérifier la construction et l’absence de mutation.

L’expression du gène cre, suite à l’introduction d’une séquence promotrice en amont de ce

gène conduit à l’excision de la cassette et à la perte de la résistance à la spectinomycine. Ceci

marque de manière définitive le clone dont le promoteur s’est exprimé (Figure 30).

Figure 30: Principe de la technique R-IVET à sélection négative La technique R-IVET est constituée de deux éléments. Le premier est la cassette chromosomique

constituée du gène de résistance à la spectinomycine flanqué de deux sites loxP. Le second est le

plasmide pULNcreB qui possède la recombinase cre qui reconnait les sites loxP de la cassette.

Lorsqu’une activité promotrice est détectée, la recombinase Cre est produite, ce qui entraine l’excision

du gène specR. Le clone devient alors sensible à la spectinomycine.

► Validation de l’outil R-IVET chez S. thermophilus

Cet outil a été validé in vitro mais aussi in vivo. Dans un premier temps, nous avons

cherché à vérifier que l’intégration de la cassette n’avait pas d’impact sur la bactérie étant

donné que le fragment constituant la cassette est introduit à l’intérieur du gène STER_0891.

Des suivis de croissance réalisés en milieu M17 supplémenté en glucose (0,5 % w/v) ou en

lactose (2 % w/v) n’ont révélé aucune différence significative entre la souche sauvage LMD-9

et la souche mutante STUL5001. La position de la cassette n’affecte donc pas la croissance de

la souche en milieu riche et complexe tel que le M17. La stabilité de la cassette R-IVET a été

t 0891 0893

0892

specR

loxP loxP

0890

specR

loxP loxP

specR

loxP loxP

Pas d’activité

promotrice

Activité

promotrice

CreCre

loxP

loxP

specR

Gène de résistance à la

spectinomycine (specR)

ori

pULNcreB

Gène de résistance à

l’érythromycine

(eryR)

Gène de recombinase (cre)

démuni de son promoteur

Insert ADN

(promoteur ?)

Gène de

réplication


129

évaluée et les résultats obtenus montrent qu’après 30 générations en milieu non-sélectif, le

phénotype et le génotype de la souche STUL5001 restent inchangés.

Sur le plasmide R-IVET pULNcreB et en amont du gène de la recombinase cre se

trouvent plusieurs sites de restriction pouvant être utilisés pour cloner des inserts d’ADN. Les

promoteurs de trois gènes - le promoteur de la protéase prtS, le promoteur de la protéine hsp

et celui de l’opéron lactose lac – ont été clonés dans le site de restriction BglII, localisé en

amont du gène cre. Nous avons choisi ces gènes car ils sont induits lors de la croissance en

milieu M17 (González-Márquez et al., 1997; Liu et al., 2009), ils sont donc idéaux pour tester

notre système en condition in vitro. Avec ces gènes, nous nous attendions à observer la

délétion de la cassette R-IVET dans le chromosome de S. thermophilus STUL5001. Les

clones issus de la transformation des cellules compétentes de STUL5001 avec les différents

plasmides ont été sélectionnés sur milieu M17 contenant de l’érythromycine. Les colonies

obtenues ont été repiquées sur du milieu contenant de la spectinomycine afin de vérifier leur

phénotype en présence de l’antibiotique et vérifier si notre système fonctionne. Les résultats

observés correspondent aux résultats attendus, les clones sont sensibles à la spectinomycine ce

qui prouvent que la cassette R-IVET a été délétée, ce qui a été confirmé par PCR et

séquençage. Avec le promoteur de l’opéron lactose, une activation de 38 % a été observée en

présence de glucose et différente de l’activation de 100 % en présence de lactose. En

observant la cinétique d’activation du promoteur plac en présence de lactose ou de glucose,

nous avons pu observer, qu’après la phase de latence, l’activation du promoteur plac se fait

rapidement et de façon optimale en présence de lactose alors qu’elle est plus lente en présence

de glucose. Ces résultats montrent que le système R-IVET peut également être utilisé pour

suivre une cinétique d’activation d’un promoteur mais uniquement en concentration

cumulative d’activation du promoteur.

Finalement, nous avons testé notre système in vivo dans le TGI de souris avec le

promoteur plac. Le système a été trouvé fonctionnel, nous avons pu montrer une activité de

100 % du promoteur plac 6 h après le gavage. L’opéron lactose de S. thermophilus est donc

actif lors du passage au travers du TGI, ce qui est en concordance avec des études précédentes

réalisées chez les souris et les rats (Ben-Yahia et al., 2012; Drouault et al., 2002; Mater et al.,

2006; Rul et al., 2011; Thomas et al., 2011).


130

► Conclusions et perspectives

L’outil R-IVET que nous avons développé ici est fonctionnel et pourra donc être

utilisé par la suite pour identifier des gènes de S. thermophilus spécifiquement exprimés dans

le tractus digestif et essayer de comprendre son état physiologique dans ces conditions.

L’utilisation de cette technologie dans le même but a d’ailleurs été couronnée de succès chez

Lb. plantarum et L. lactis (Bachmann et al., 2008; Bron et al., 2004). Pour cela, il nous faudra

construire une banque d’ADN génomique de S. thermophilus en amont du gène cre pour nous

permettre d’identifier les gènes actifs en conditions digestives, soit avec un modèle animal,

souris ou rats, soit avec un modèle de digestion artificiel comme le système TIM (Blanquet-

Diot et al., 2012; Minekus et al., 1995) (publication 2 et 3). Cependant, quelques ajustements

sont à envisager pour améliorer et permettre une utilisation plus aisée de notre système

concernant notamment le mode de sélection des clones. En effet, l’élaboration de notre crible

négatif implique une sélection des clones d’intérêt en deux temps. Premièrement, il faut

récupérer les clones à la sortie du tractus digestif, sur un milieu contenant de l’érythromycine

de préférence afin de sélectionner les clones possédant toujours le plasmide R-IVET. Et

deuxièmement, il faut effectuer des repiquages des colonies sur deux milieux de sélection: un

contenant de la spectinomycine afin d’identifier les clones dont le gène de résistance à la

spectinomycine a été excisé (aucune croissance) et l’autre contenant de l’érythromycine

servant de sauvegarde de la colonie et permettant ainsi de poursuivre les analyses sur les

plasmides des clones sensible à la spectinomycine. Le crible négatif devient alors limitant, car

il implique le repiquage d’un grand nombre de colonies pour identifier les clones d’intérêt et

limite donc le nombre d’échantillons pouvant être prélevé. L’élaboration d’un crible de

sélection positif permettrait d’éviter la double étape de sélection réduisant ainsi le temps

expérimental et permettant ainsi d’augmenter le volume d’échantillonnage (publication 3).

Dans la publication suivante, les capacités de survie de S. thermophilus ont été

évaluées en condition digestive simulée dans le modèle gastro-intestinal TIM. Une banque

d’ADN génomique a été construite à partir de l’outil R-IVET développé dans cet article. Cette

banque a été utilisée pour identifier les gènes spécifiquement activés dans les conditions

gastriques simulées (TIM).

Chapitre 2 : Etude la survie et de l’activité métabolique de S. thermophilus en conditions gastriques simulées

131

Chapitre 2: éTudE dE lA suRvIE ET dE l’ACTIvité métabolique de Streptococcus thermophilus en conditions

gastriques simulées

Chapitre 2

Étude dE lA suRvIE ET dE l’ACTIvITé MéTAbolIquE

de Streptococcus thermophilus

en conditions gastriques simulées


La définition des probiotiques (FAO/WHO, 2002) implique que les micro-organismes

doivent survivre aux conditions digestives, persister temporairement dans le tractus digestif et

présenter une activité qui doit se traduire par des effets positifs pour l’hôte. Des études in vitro

et in vivo montrent que S. thermophilus possède des propriétés bénéfiques telles qu’une

activité anti-oxydante ou anti-inflammatoire.

Lorsqu’ils sont ingérés, les probiotiques rencontrent lors du transit dans le TGI une

série de stress tels que le pH acide de l’estomac, les sels biliaires, les enzymes digestives ou

encore la compétition avec le microbiote résident. Contrairement aux autres bactéries

lactiques, comme Lactobacillus ou Bifidobacterium (B.), S. thermophilus n’est pas connu pour

sa haute tolérance aux stress du TGI (Conway et al., 1987; Marteau et al., 1997). Cependant,

des études ont montré que S. thermophilus survivait au passage au travers du TGI humain car

il était retrouvé vivant dans les selles de volontaires après consommation de yaourt (Elli et al.,

2006; García-Hernández et al., 2012; Mater et al., 2006). Cependant, peu de données sont

disponibles sur le comportement de S. thermophilus lors du passage dans les différents

compartiments du TGI humain. Des tests in vitro statiques évaluant la tolérance de

S. thermophilus aux pH acides ou aux sels biliaires montrent que la tolérance de


132

S. thermophilus est souche-dépendante (Junjua et al., 2016; Vinderola et Reinheimer, 2003;

Ziarno, 2010).

Pour le développement d’aliments fonctionnels, il est important de sélectionner des

souches qui ont un effet bénéfique pour la santé mais aussi qui survivent lors de la digestion.

Il est donc nécessaire d’obtenir plus d’informations sur la survie de S. thermophilus dans le

TGI humain, et sur la variabilité de la survie d’une souche à l’autre et de l’influence de la

matrice alimentaire. En utilisant un modèle de digestion artificielle plus dynamique et plus

réaliste que les tests in vitro statiques couramment utilisés dans la littérature, le système TIM

(Blanquet-Diot et al., 2012; Minekus et al., 1995), il serait possible d’obtenir plus

d’informations sur le comportement de S. thermophilus dans le TGI humain. De plus, en

étudiant le métabolisme de S. thermophilus dans l’environnement digestif humain simulé, il

serait possible de mieux comprendre les mécanismes et stratégies de survie mis en place par

S. thermophilus lors du passage du TGI.

Lors de cette étude, nous avons criblé la collection de 30 souches de S. thermophilus

de l’équipe PB2B pour des fonctions qui pourraient avoir un rôle important dans la résistance

au stress gastrique. Puis, nous avons étudié la capacité de survie de quatre souches de

S. thermophilus en utilisant le modèle de digestion gastro-intestinal TIM et évalué l’influence

de la matrice alimentaire. Enfin, nous avons étudié le métabolisme de S. thermophilus dans le

compartiment gastrique du TIM en utilisant le système R-IVET développé dans l’étude

précédente (Junjua et al., 2014).


133

Publication 2

Use of the dynamic gastro-intestinal model TIM to explore the survival of the yogurt

bacterium Streptococcus thermophilus and the metabolic activities induced in the

simulated human gut

2016. Food Microbiology

O. Uriot a, b, c

, W. Galia a, b

, A. A. Awussi a, b

, C. Perrin a, b

, S. Denis c, S. Chalancon

c,

E. Lorson a, b

, C. Poirson a, b

, M. Junjua a, b

, Y. Le Roux a, b

, M. Alric c, A. Dary

a, b,

S. Blanquet-Diot c, 1

, Y. Roussel a, b, *, 1

a Université de Lorraine, Unité de Recherche Animal et Fonctionnalités des Produits

Animaux, Equipe Protéolyse et Biofonctionnalité des Protéines et des Peptides, Vandoeuvre-

lès-Nancy, F-54506, France

b INRA, UR AFPA Unité Sous Contrat 340, Vandoeuvre-lès-Nancy, F-54506, France

c Clermont Université, Université d'Auvergne, Centre de Recherche en Nutrition Humaine

Auvergne, EA 4678 CIDAM, ‘Conception Ingénierie et Développement de l'Aliment et du

Médicament’, BP 10448, 63000, Clermont-Ferrand, France


135


136


137


138


139


140


141


142


143


144


145


146


147


Dans un premier temps, l’objectif de cette étude était de cribler la collection de 30

souches de S. thermophilus de l’équipe PB2B pour des fonctions pouvant être impliquées

dans la résistance au stress acide. Puis, dans un second temps, la capacité de survie de 4

souches de S. thermophilus a été étudiée en utilisant le modèle dynamique de digestion

artificielle, le système TIM, en évaluant (i) l’impact de la souche et (ii) l’influence de la

matrice alimentaire (lait fraichement inoculé et lait fermenté). Enfin, après avoir construit une

banque génomique de clones R-IVET, nous avons étudié grâce à cette technologie le

métabolisme de S. thermophilus dans le compartiment gastrique du système TIM.

► Crible de la collection de souches de S. thermophilus et sélection de 4 souches pour la

suite de l’étude

Les 30 souches de S. thermophilus de la collection de l’équipe PB2P ont été criblées

pour la fonction uréase, la fonction décarboxylase des acides aminés et pour la production de

la protéine de stress au choc thermique Hsp (Heat shock protein). Ces fonctions pourraient

être impliquées dans la résistance aux stress acides. En effet, l’activité uréase chez

S. salivarius constitue un mécanisme majeur dans le maintien de l’équilibre homéostasique du

pH dans la cavité buccale (Chen et al., 1998; Geng et al., 2011). Des études précédentes ont

montré que chez S. thermophilus l’activité uréase aurait plus un rôle métabolique que de

réponse au stress acide, en procurant aux bactéries dioxyde de carbone et ammoniac et serait

un système de modulation du pH intracellulaire favorisant l’activité enzymatique impliquée

dans l’utilisation du lactose (Arioli et al., 2007, 2010; Monnet et al., 2005). Ceci pourrait

expliquer la haute fréquence à laquelle l’uréase est retrouvée dans les souches de

S. thermophilus (toutes les souches de la collection sauf chez CNRZ21), confirmant les

résultats des études précédentes (Mora et al., 2002; Zotta et al., 2008b). Au contraire,

l’activité décarboxylase (glutamate, tyrosine et arginine) n’a été retrouvée que chez quelques

souches, traduisant l’acquisition de ces gènes certainement par transfert horizontal (Calles-

Enriquez et al., 2010; Rossi et al., 2011). En comparant nos résultats avec ceux d’une autre

étude sur la même collection (Junjua et al., 2016), aucune corrélation entre la possession de

ces gènes et la résistance aux pH acides n’a pu être mise en évidence. Nos résultats montrent

également que 60 % des souches de notre collection possèdent la protéine de stress Hsp, dont

la surexpression en milieu acide a déjà été observée auparavant (González-Márquez et al.,

1997).


148

A partir de ces résultats et de ceux obtenus dans l’autre étude de criblage (Junjua et al.,

2016), 4 souches ont été choisies afin de déterminer leur survie en conditions digestives

humaines simulées dans le TIM. Trois des quatre souches possèdent la protéine Hsp et

l’activité uréase et des profils de résistance aux stress acides et biliaires différents: la souche

LMD-9 possédant une bonne résistance au pH acide et dans laquelle a été mis au point l’outil

R-IVET, la souche PB18O montrant une résistance intermédiaire aux deux stress et la souche

EBLST20 montrant la meilleure résistance aux sels biliaires. Enfin, la souche CNRZ21, car

elle ne présente ni activité uréase, ni protéine Hsp et appartient aux souches les plus sensibles

aux stress acides et biliaires. Il est intéressant de noter que cette souche particulièrement

sensible au stress gastro-intestinal dans l’étude de criblage est celle qui néanmoins possède la

plus forte activité anti-inflammatoire in vitro (ratio IL-10/IL-12 le plus élevé) (Junjua et al.,

2016).

► Survie de S. thermophilus en conditions digestives humaines simulées

La variabilité des capacités de survie en conditions digestives humaines simulées

(TIM) a été déterminée en utilisant les 4 souches citées précédemment. Pour cela les souches

ont été resuspendues dans du lait après culture en milieu LM17 puis administrées. Le système

TIM a été programmé pour reproduire la digestion d’un adulte sain ayant consommé du lait.

Les résultats de survie obtenus montrent une différence entre les 4 souches de

S. thermophilus. En effet, trois souches sont résistantes et une souche est plus sensible. Il

s’agit de la souche CNRZ21. La survie de S. thermophilus semble affectée dans la partie

gastrique du TIM lorsque le pH atteint des valeurs inférieures ou égales à 2 et dans les trois

compartiments de l’intestin grêle en présence des sels biliaires. La souche CNRZ21 montre

globalement une survie inférieure de plusieurs log10 UFC (environ 2,5 log10 UFC dans

l’estomac, 4; 6 et 7 log10 UFC dans le duodénum, le jéjunum et l’iléum respectivement et

environ 2 log10 UFC dans les effluents iléaux) par rapport aux trois souches plus résistantes

après le passage dans le TIM. L’ensemble des résultats obtenus sont en accord avec ceux

obtenus dans des tests in vitro simples réalisés auparavant (Boke et al., 2010; Fang et al.,

2013; Junjua et al., 2016; Ziarno, 2010). Marteau et al. (1997) a montré en utilisant le système

TIM que S. thermophilus était le plus sensible des probiotiques testés, Lb. bulgaricus, Lb.

acidophilus et B. bifidum. Cependant, en tenant compte des variables expérimentales, nous

pouvons tout de même observer que la survie de la souche de S. thermophilus utilisée dans


149

l’étude de Marteau et al. (1997) est supérieure à celles que nous avons pu observer dans notre

étude.

La différence observée entre nos résultats et ceux de Marteau et al. (1997) suggère que

la matrice pourrait avoir une influence sur la survie de S. thermophilus, ce qui a déjà été

démontré dans des études précédentes pour d’autres microorganismes (Blanquet-Diot et al.,

2012; Bove et al., 2013; Pitino et al., 2012; Possemiers et al., 2010). Nous avons donc

cherché à étudier l’influence de la matrice alimentaire sur la survie de la souche LMD-9.

Cette souche a été choisie car c’est avec celle-ci que l’outil R-IVET a été développé. Nous

avons donc mis en culture la souche LMD-9 dans du lait et introduit dans le système TIM le

lait fermenté obtenu. Nos résultats confirment l’hypothèse émise puisque la survie de

S. thermophilus est significativement plus élevée lorsqu’il est introduit en lait fermenté qu’en

lait liquide. Ceci pourrait s’expliquer par un pré-conditionnement de la souche au stress acide

lors de sa croissance en lait (pH acide en lait fermenté due à la production d’acide lactique).

► Etude du métabolisme de S. thermophilus dans l’environnement gastrique

Pour étudier l’activité métabolique de S. thermophilus dans l’environnement gastrique,

une banque R-IVET d’ADN génomique à partir de l’outil R-IVET mis en place

précédemment (publication 1: Junjua et al., 2014) a été construite. La banque a été réalisée en

clonant des fragments d’ADN génomique provenant de la digestion partielle de

S. thermophilus LMD-9, par l’enzyme de restriction sau3AI, dans le site de restriction BglII

situé en amont du gène cre dans le plasmide pULNcreB (Figure 1 de la publication 2). Cette

banque de clone a été introduite dans le compartiment gastrique du système TIM en présence

de lait liquide. Si un promoteur est présent sur l’insert d’ADN cloné dans le plasmide

pULNcreB et s’active, alors la recombinase cre est transcrite, ce qui va entrainer l’excision

par recombinaison du gène marqueur, le gène de résistance à la spectinomycine, et va

marquer la cellule de manière définitive. Notre système a permis de mettre en évidence deux

promoteurs activés en condition gastrique après 1 h de digestion, celui du gène hisS

(STER_1950) codant une histidine-ARNt synthétase et celui du gène STER_1406 codant un

composant d’un transporteur de type ABC. Seul le gène hisS a pu être réactivé lors d’un

second passage de ces clones dans le compartiment gastrique du système TIM.


150


Nos résultats sur la survie de S. thermophilus dans le TGI humain simulé ont permis

d’apporter des données complémentaires à celles déjà présentes dans la littérature. Nous

avons pu montrer une différence entre les 4 souches testées, ce qui confirme le fait que la

survie de S. thermophilus en conditions digestives humaines est souche dépendante. Malgré

une certaine sensibilité des souches aux différents stress digestifs, nous avons pu montrer que

la survie pouvait être améliorée par le changement de matrice alimentaire. Il serait donc

intéressant d’évaluer la survie de la souche CNRZ21 lorsqu’elle est administrée en lait

fermenté. De plus, nous avons étudié une matrice simple, le lait ou le lait fermenté, mais

quand est-il de la survie de S. thermophilus lorsqu’il est administré en présence d’une matrice

plus complexe, comme le yaourt ou encore un repas complet? En effet, la culture en lait de

S. thermophilus en co-culture avec Lb. bulgaricus (yaourt) modifierait la réponse régulatrice

de S. thermophilus par rapport à une croissance en lait en monoculture (lait fermenté)

(Thevenard et al., 2011). Ceci implique une différence de comportement qui pourrait avoir

une influence sur les capacités de survie de S. thermophilus lors de son passage dans le TGI.

De plus une étude, réalisée dans le système TIM, a montré une différence dans la survie de la

levure Saccharomyces cerevisiae lors de son passage dans le TIM selon qu’elle était

administrée avec de l’eau ou avec un repas complet (composé de légumes, viande de bœuf,

pomme de terre, lait, pain et compote de pomme) (Blanquet-Diot et al., 2012). L’ingestion de

S. thermophilus avec un repas complet pourrait donc modifier sa survie et donc permettre

d’obtenir des valeurs plus réalistes puisque la consommation de yaourt (S. thermophilus et

Lb. bulgaricus) y est souvent associée. Par ailleurs, afin d’améliorer la survie de

S. thermophilus des méthodes telles que l’encapsulation peuvent également être envisagées

(Amakiri et Thantsha, 2016; Anselmo et al., 2016; D’Orazio et al., 2015). Dans cette étude,

nous avons apporté des données supplémentaires concernant la survie de S. thermophilus dans

l’estomac et l’intestin grêle, mais quand est-il de la survie de la bactérie dans le colon et de

son interaction avec le microbiote intestinal. Il serait donc intéressant d’évaluer la survie de

S. thermophilus dans un système reproduisant l’environnement colique humain comme le

système ARCOL. Dans l’étude suivante (publication 3), la survie de S. thermophilus a pu être

évaluée en système batch colique simple.

Lors du passage dans le compartiment gastrique du TIM, la technologie R-IVET a

permis de mettre en évidence deux gènes, le gène hisS et le gène STER_1406. Le peu de

clones que nous avons obtenu était attendu. En effet, le R-IVET permet d’identifier les gènes


151

spécifiquement activés dans les conditions complexes étudiées. En effet, les gènes activés lors

de la phase de culture pré-expérience sont éliminés par la contre-sélection, ce qui limite le

nombre de gènes à identifier. De plus, la banque que nous avons construite n’était

représentative du génome de S. thermophilus LMD-9 qu’à hauteur de 85 %. Et enfin,

l’identification des gènes activés grâce à un crible négatif est limitant, comme précédemment

expliqué (commentaire publication 1) et un biais peut être instauré par rapport au jugement de

la croissance ou non de certains clones. Pour poursuivre notre étude sur la physiologie de

S. thermophilus dans l’ensemble du TGI, il est indispensable d’améliorer notre banque R-

IVET (i) en mettant au point un crible positif pour sélectionner les clones d’intérêt

directement, nous permettant ainsi d’effectuer un plus grand nombre d’échantillonnage et de

nous affranchir de la double sélection des clones et (ii) en construisant une banque d’ADN

génomique plus représentative du génome de S. thermophilus LMD-9 (publication 3).

153

CHAPITRE 3: oPTIMIsATIon dE l’ouTIl R-IVET et validation en condtions digestive simulées

Chapitre 3

oPTIMIsATIon dE l’ouTIl R-IVET Et Validation

en conditions digestives simulées


Pour mieux comprendre le comportement de S. thermophilus dans l’environnement

digestif humain, un outil R-IVET a été développé chez S. thermophilus LMD-9 (publication

1). Cette souche a été choisie car son génome est entièrement séquencé (Makarova et al.,

2006). Une première étude du comportement de S. thermophilus en conditions digestives

humaines simulées a été réalisée suite à la création d’une première banque R-IVET et le

passage de celle-ci dans le compartiment gastrique du système in vitro TIM. Cette étude a

permis de mettre en évidence deux gènes spécifiquement activés en conditions gastrique

simulées, le gène hisS codant une histidine-ARNt synthétase et le gène STER_1406 codant un

composant d’un transporteur de type ABC (publication 2).

Cependant, cette étude a mis en évidence deux limites à cette première banque.

Premièrement, cette banque n’était pas assez représentative du génome de S. thermophilus

LMD-9. En effet, selon la formule de Clarke et Carbon, seuls 85 % du génome étaient

représentés dans cette banque (publication 2). Deuxièmement, le moyen de sélection des

clones, basé sur un crible négatif (excision de la cassette chromosomique du gène de

résistance à la spectinomycine) est un écueil important à l’identification des clones activés car

il implique de repiquer des milliers de clones pour espérer repérer des clones activés dans les

conditions testées.

Chapitre 3: Optimisation de l’outil R-IVET et validation en conditions digestives simulées

154

Le nombre d’échantillonnages par expérience est donc limité. C’est dans ce contexte

qu’un nouveau crible à été construit, basé sur un crible positif. Ce crible devrait permettre la

sélection directe des clones d’intérêt et donc d’augmenter le nombre d’échantillons prélevés et

analysés par expériences.

Le travail exposé dans l’article 3 (qui est en préparation) a constitué en l’optimisation

du système R-IVET chez S. thermophilus LMD-9 par la création d’un crible positif de

sélection. Une nouvelle banque R-IVET plus représentative du génome de S. thermophilus

(taux de recouvrement supérieur à 99 %) a été construite en utilisant la souche mutante

porteuse de la nouvelle cassette chromosomique. Cette nouvelle banque a été utilisée pour

identifier des gènes spécifiquement activés en conditions digestives humaines simulées dans

l’ensemble du système TIM. Grâce au nouveau mode d’identification des clones d’intérêt, des

prélèvements pourront être effectués dans tous les compartiments du système (estomac et trois

compartiments de l’intestin grêle: duodénum, jéjunum and iléum) à différent temps. La

banque R-IVET a également été utilisée pour identifier les gènes spécifiquement activés en

présence du microbiote intestinal, en utilisant un système batch statique.


155

Publication 3

Use of the R-IVET Technology to identify in Streptococcus thermophilus genes

specifically expressed under simulated human digestion conditions and in presence of

intestinal microbiota

En cours de rédaction

Uriot Ophéliea,b

, Wessam Galiaa, Yvonne Roussel

a, Emilie Lorson

a, Sylvain Denis

b, Sandrine

Chalanconb, Monique Alric

b, Stéphanie Blanquet-Diot

b,* and Annie Dary-Mourot

a,*

a Université de Lorraine, Unité de Recherche Animal et Fonctionnalités des Produits

Animaux, Equipe Protéolyse et Biofonctionnalité des Protéines et des Peptides, Vandoeuvre-

lès-Nancy, F-54506, France

b Clermont Université, Université d'Auvergne, Centre de Recherche en Nutrition Humaine

Auvergne, EA 4678 CIDAM, ‘Conception Ingénierie et Développement de l'Aliment et du

Médicament’, BP 10448, 63000, Clermont-Ferrand, France

* co-senior authors


157

Abstract:

Streptococcus thermophilus is a lactic acid bacterium used for the production of yogurt and

cheese. Some interesting health effects have been revealed by in vitro and in vivo studies. To

confirm its probiotic status, it is important to understand its behavior in the gastrointestinal

tract. The aim of this study was to set-up and validates a new R-IVET chromosomal cassette

with a positive selection in S. thermophilus LMD-9. Then, a new RIVET library was built in

S. thermophilus, more representative of the whole genome. This library was used to identify

the bacterial genes that were specifically activated in the human digestive environment by

using the gastric and small intestinal system TIM (TNO gastrointestinal Model) and in batch

cultures of human intestinal microbiota. In these different models, genes involved in nutrient

transport and metabolism, protein synthesis, stress response and regulatory pathway were

identified. Two main results can be underlined. The first is that the R-IVET technology has

permitted the detection of the expression of genes of unknown function never detected before.

The second is that it appeared that in presence of the colic microbiota S. thermophilus could

adapt its physiology to resist aggression exerted by the other bacteria through the expression

of genes involved in the transport of antimicrobial peptide or one partner of the CRISPR

immune system. By cons, in the TIM stomach compartment, S. thermophilus could more

adapt its metabolism to resist to acidic stressful environment conditions, especially through

the expression of regulators involved in stress response.

Keywords: R-IVET, TIM system, intestinal microbiota, S. thermophilus


159

1. Introduction

The lactic acid bacterium Streptococcus thermophilus is widely used as a starter for

the production of yogurt and cheese, mainly for its high-production of lactic acid and for its

capacity to produce secondary fermentation products with aromatic and textural properties

(Iyer et al., 2010b). The very long history of S. thermophilus use in the dairy industry led to

the GRAS (Generally Recognized As Safe) status assignment by the American Food and

Drug Administration and the QPS (Qualified Presumption of Safety) status by the European

Food Safety Authority (EFSA).While health claim was attributed in 2010 by the EFSA to live

yoghurt cultures to improve lactose digestion, the status of S. thermophilus as a probiotic

(Guarner et al., 2005; Hill et al., 2014) has still to be proved. S. thermophilus can survive the

passage through the human gastro-intestinal tract (GIT) and be found alive in the feces after

consumption of yogurts (Elli et al., 2006; García-Hernández et al., 2012; Mater et al., 2005).

In vitro and in vivo studies also suggested that S. thermophilus would possess other health

properties than lactose digestion improvement such as immuno-modulation and antioxidant

functions (Del Carmen et al., 2014; Ito et al., 2008; Junjua et al., 2016; Ogita et al., 2011a,

2011b; Rodríguez et al., 2010; Terahara et al., 2001). However, additional information on the

physiological status and probiotic functions of S. thermophilus in the human GIT are needed

before assigning a probiotic allegation to certain strains of S. thermophilus.

Scarce proteomic investigations have already been performed to establish the

physiological status of S. thermophilus during passage through the GIT of gnotobiotic rats and

have highlighted the importance of glycolysis pathway (Rul et al., 2011; Thomas et al., 2011).

Another strategies based on the analysis of bacterial transcriptome can be used to assess the

behavior of S. thermophilus in the GIT, such as the recombinase-based in vivo expression

technology (R-IVET). R-IVET is a promoter-trapping technology allowing the identification

of genes specifically activated in particular complex environments such as the human gut.

This technology is based on the ability of a site-specific recombinase (such as Cre) to catalyze

the recombination of a reporter fragment flanked by two recombinase-recognition sites (such

as loxP) (Camilli et al., 1994; Junjua et al., 2014). In a previous work from the laboratory, we

showed by using the R-IVET technology in S. thermophilus LMD-9, that the hisS gene was

specifically activated under human gastric simulated conditions (Uriot et al., 2016). However,

there is yet no available data on S. thermophilus gene activation in response to physico-

chemical and biotic (gut microbiota) conditions found in the human small and large intestine.

Chapitre 3: Optimisation de l’outil R-IVET et validationen conditions digestives simulées

160

To answer this question, we used in the present study two complementary in vitro

models: the dynamic multi-compartmental TIM (TNO gastrointestinal model) system which

closely simulates the physico-chemical conditions found in the human stomach and small

intestine (Guerra et al., 2012; Minekus et al., 1995) and batch cultures of human intestinal

microbiota. The TIM model is composed of four compartments: the stomach, duodenum,

jejunum and ileum. It reproduces based on in vivo data collected from human volunteers the

main parameters of digestion, such as body temperature, kinetics of gastric and intestinal pH,

transit time, sequential supply of digestive enzymes and bile salts and passive absorption of

nutrients and water.

The first objective of this work was to optimize our R-IVET tool by (i) designing and

validating a new R-IVET chromosomal cassette that allows a positive screen and (ii) by

constructing a new R-IVET library more representative of the genomic DNA of

S. thermophilus LMD-9. Then, this new R-IVET tool was used to identify which

S. thermophilus genes are specifically activated during transit through the gastric and small

intestinal compartments of the TIM model and in the presence of intestinal microbiota.

2. Materials and methods

2.1. Bacterial strains, culture and transformation conditions

The bacterial strains and plasmids used in this work are listed in Table 1.

S. thermophilus LMD-9 from the American Type Culture Collection (Manassas, VA, USA)

was used to implement the R-IVET system. S. thermophilus strains were stored at -80°C in

reconstituted skim milk (10 %, w/v), and grown at 42°C under anaerobic conditions

(AnaeroGen, Oxoid, Basingstoke, UK) in M17 medium (Terzaghi and Sandine, 1975)

supplemented with 2 % (w/v) lactose (LM17) or in 10 % (w/v) milk (powdered semi-

skimmed milk, fast dissolution, Régilait). When needed, antibiotics purchased from Sigma

(Saint Quentin Fallavier, France) were added at the following concentrations: 300 µg/mL for

spectinomycin, 20 µg/mL for streptomycin, 1 mg/mL for kanamycin or 5 µg/mL for

erythromycin. S. thermophilus naturally competent cells were prepared in Chemically Defined

Medium as described by Gardan et al. (2009). For long term storage at -80°C, competent cells

were stored in 10 % (w/v) milk or pelleted by centrifugation, suspended in 1/10 volume of the

initial culture supplemented with glycerol (14 %) and frozen in liquid nitrogen.

Escherichia coli TOP10 (Invitrogen, Breda, the Netherlands) was used as intermediate

cloning host. E. coli TOP10 was grown in aerobic conditions at 37°C in LB (Luria Bertani)


161

medium, supplement or not with 300 µg/mL of erythromycin. Chimio-transformations of this

strain were performed according to the manufacturer instructions.

Table-1: Bacterial strains and plasmid used in the present study

2.2. Primers, enzymes, PCR conditions and DNA extraction

Polymerase chain reactions (PCR) were carried out in a Mastercycler pro thermocycler

(Eppendorf, Hambourg, Germany). Oligonucleotides used as primers were purchased from

Eurogentec (Seraing, Belgium) and their sequences are described in Table 2. Analytical PCRs

were performed as described by Junjua et al. (2014). Plasmid DNA was isolated from E. coli

cells using a Miniprep Kit (Fermentas, Villebon sur Yvette, France) according to the

manufacturer instructions. S. thermophilus genomic DNA was extracted from 10 mL

overnight LM17 culture according to Fischer and co-workers (Fischer et al., 1997) and was

used as target DNA for PCRs. DNA fragments were separated by electrophoresis in 1 %

agarose gels using 0.5× TBE buffer at 100V. The molecular weight markers 1-kb and 100-bp

DNA ladders from Fermentas were used. Gels were stained with ethidium bromide and

imaged using a GelDoc-It Imaging System (Bio-Rad, Marne-la-Coquette, France). If not

indicated, the enzymes used in this work were purchased from New England Biolabs

(Leusden, The Netherlands) and used according to the manufacturer recommendations. DNA

fragments were purified using the High Pure DNA purification Kit (Roche Molecular

Biochemicals, Mannheim, Germany) according to the manufacturer recommendations.

Relevant markers and characteristics Reference or source

Strains

S. thermophilus LMD-9 Wild-type strain that has been entirely sequenced ATCC BAA-491

Makarova et al., 2006

S. thermophilus STUL5002 LMD-9 derivative with the prom-loxP-kanR fragment in the

STER_0891 locus (STER_RS04415)

The present study

S. thermophilus STUL5003 LMD-9 derivative with the prom-loxP-specR-loxP-kanR

fragment in the STER_0891 locus (STER_RS04415)

The present study

S. thermophilus TIL1193 LMD-9feoB::aphA3 Gardan et al., 2009

E. coli TOP10 One Shot® TOP10 chemically competent E. coli cells Invitrogen

Plasmid

pULNcreB pG+host9TR derivative containing promoterless recombinase

cre gene

Junjua et al., 2014

pSET4S Replication function of pG+host3 and pUC19 Takamatsu et al., 2001

pULNcreB-plac pULNcreB derivative containing the promoter of the lactose

operon plac cloned in the BglII site upstream of cre

Junjua et al., 2014


162

Table-2: Oligonucleotides used in the present study with their relevant characteristics

# Sequence 5’→3’ Characteristics

1 ATCCGTAAAACCATCAAATCTTAATT Amplification of the UP#1 fragment from S. thermophilus LMD-9 with #2

(1204 pb) Used in the first overlapping PCR with #8 (3783 pb)

2 TCCCCAAGCAAAAATTGGAAC Used with #1

3 TCCAATTTTTGCTTGGGGACCAGCGAACCATTTGAG

Amplification of the promoter (prom) of kanamycin resistance gene from S. thermophilus TIL1193 with #4 (525 pb)

4 TCTACAGTATTTAAAGATACCCC Used with #3

5 GTATCTTTAAATACTGTAGAATAACTTCGTATA

GCATACATTATACGAAGTTATAAACAGGAA* Amplification of the promoterless kanamycin resistance gene (kanR) from S. thermophilus TIL1193 with #6 (1032 pb)

6 GTTGCGGATGTACTTCAGAAAAG Used with #5, #11 and #17

7 TTTCTGAAGTACATCCGCAACGTAATGTTTGGTGTAGGTAATA

Amplification of the DOWN#1 fragment from S. thermophilus LMD-9 with #2 (1146 pb)

8 TTAAACCAATCTGTCCTCGGG Used with #1 and with #7

9 GGAACAAAAGCACCCACACT Confirmation of prom-loxP-kanR presence in S. thermophilus STUL5002 and sequencing with #10 (4319 pb)

10 TTAGGCTGGATGGCATAACC Used with #9

11 CTACGAGACCTACTTAGCGC Amplification of the UP#2 fragment from S. thermophilus STUL5002 with

#12 (1088 pb)

Used in the second overlapping PCR with #6 (3421 pb)

12 CTAGTTATCTACACGACGGGGAGTCAATAACTTCGTATAATGTATGC

Used with #11

13 TGACTCCCCGTCGTGTAGATAAC Amplification of the spectinomycin resistance gene (specR) from pSET4S

and sequencing of the S. thermophilus STUL5003 cassette with #14 (1200 pb)

14 CGCTACGATAACGCCTGTTT Used with #13

15 AAACAGGCGTTATCGTAGCGGCTTCTGGAGCTCAATTGAA

Amplification of the las operon transcriptional terminator Tlas with #16 (252 pb)

16 CTAAAGCTGACGGGGTAAAC Used with #15

17 GTTTACCCCGTCAGCTTTAGATAACTTCGTATA

GCATACATTATACGAAGTTATAAAGAGGAA* Amplification of the loxP-DOWN#2 fragment from S. thermophilus STUL5002 with #6 (947 pb)

18 GCTTCTGGAGCTCAATTGAAAG Amplification of the insert in the recombinant plasmid derived from

pULNcreB with #19 (variable but >460 pb)

19 ATTCAACTTGCACCATGCCG Used with #18

20 CGAAATAAGAGTAATATAGAG Sequencing of the S. thermophilus STUL5003 cassette with #21 (490 pb)

21 TAGTATCGACGGAGCCGATT Used with #20

22 CCAGGACAATAACCTTATAGC Sequencing of the S. thermophilus STUL5003 cassette with #23 (536 pb)

Test for presence or absence of the loxP-specR fragment in the R-IVET

cassette with #29 (with loxP-specR: 2091 pb; without loxP-specR: 628 pb)

23 TCCTCCTCACTATTTTGATTAGTACC Used with #22

24 AATAGGTACTAATCAAAATAGTGAGG Sequencing of the S. thermophilus STUL5003 cassette with #25 (433 pb)

25 TTTGCTTGGTAAAGCATTATGG Used with #24

26 GGAGAGAATATTGAATGGACTAATG Sequencing of the S. thermophilus STUL5003 cassette with #27 (455 pb)

27 TCTAAAGCTGACGGGGTAAA Used with #26

28 TATAGTTTACCCCGTCAGCTTTAG Sequencing of the S. thermophilus STUL5003 cassette with #29 (445 pb)

29 GAAAGAGCCTGATGCACTCC Used with #22 and #28

30 CTCATGAGTGAGGCCGATG Sequencing of the S. thermophilus STUL5003 cassette with #31 (484 pb)

31 CAGGCTTGATCCCCAGTAAG Used with #30

32 TGGTATGACATTGCCTTCTG Sequencing of the S. thermophilus STUL5003 cassette with #33 (426 pb)

33 TGCAAGTAAAATTGCACCTGTT Used with #32

(*): Sequences in bold and italics correspond to loxP sites

2.3. Construction of the prom-loxP-specR-loxP-kanR fragment and obtainment of

S. thermophilus STUL5003

The strategy used to construct the S. thermophilus STUL5003 mutant strain containing

the chromosomal prom-loxP-specR-loxP-kanR cassette is presented in Figure 1. Each

fragment amplification was performed using the Phusion high-fidelity DNA polymerase

(Finnzymes, Thermo Scientific, Espoo, Finland) under the conditions already described

(Junjua et al., 2014).


163

In the first series of PCR (Fig. 1a to 1c), the intermediate strain STUL5002 containing

a prom-loxP-kanR cassette was built. The four fragments UP#1, prom (promoter region of the

kanR gene), loxP-kanR and DOWN#1 were amplified individually using the primer couples

#1#2, #3#4, #5#6 and #7#8, respectively (Fig. 1a). Genomic DNA of the strain LMD-9 was

used as template to amplify the UP#1 and the DOWN#1 fragments. Genomic DNA of the

strain TIL1193 (Table 1, Gardan et al., 2009) was used as template to amplify the prom and

the loxP-kanR fragments, kanR encoding a 3′5″-aminoglycoside phosphotransferase of type

III (aphA3). Specific annealing temperatures were set at 56.9°C for the amplifications of the

three fragments UP#1, prom and loxP-kanR and 62.7°C for the amplification of DOWN#1. In

the second amplification phase (Fig. 1b), an overlapping PCR was carried out with primers

#1#8 using the four fragments UP#1, prom, loxP-kanR and DOWN#1 mixed together in

equimolar concentrations. About thirty ng of the resulting amplified fragments were used for

the transformation of LMD-9 competent cells. A kanamycin-resistant clone was selected and

confirmed to have the prom-loxP-kanR fragment at the STER_0891 locus by colony PCR

with primers #9#10 and named STUL5002 (Fig. 1c).The prom-loxP-kanR fragment and

junction regions with the chromosome were sequenced to check that no mutation had

occurred during the construction of the mutant.

In the second series of PCR (Fig. 1d to 1f), we built the strain STUL5003 containing a

prom-loxP-specR-loxP-kanR cassette. The four fragments UP#2, specR, Tlas and loxP-

DOWN#2 were amplified individually using primer couples #11#12, #13#14, #15#16 and

#17#6, respectively (Fig. 1d). Genomic DNA of the strain STUL5002 was used as template to

amplify the UP#2 and the loxP-DOWN#2 fragments. The terminator Tlas fragment was

amplified from the plasmid pULNcreB (Junjua et al., 2014). The plasmid pSET4S (Table 1,

Takamatsu et al., 2001) was used to amplify the specR gene encoding a spectinomycine

adenyltransferase. Specific annealing temperatures were set at 62.7°C for the amplification of

the four fragments. In the second amplification phase (Fig. 1e), an overlapping PCR was

carried out with primers #11#6 using the four fragments UP#2, specR, Tlas and loxP-

DOWN#2 mixed together in equimolar concentrations. About thirty ng of the resulting

amplified fragments were used for the transformation of STUL5002 competent cells (Fig. 1f).

The spectinomycin-resistant transformants were tested for the presence of the desired

chromosomal cassette and one of them selected and named STUL5003.


164

a)

b)

c)

d)

e)

loxP

#1

DOWN#1

#8

UP#1

prom

kanR

#1

#3

#6

kanR

#2

prom

#4

loxP#5

#7

DOWN#1

#8

UP#1

#11

specR

Tlas

DOWN#2

#6

UP#2

loxP

loxP

prom kanRUP#1 DOWN#1

#11

#15

#14

specR

#12

Tlas

#16

loxP#17

DOWN#2

#6

UP#2

#13



165

f)

Figure-1: Construction of the S. thermophilus mutant STUL5003.

The STUL5003 chromosomal construction was cloned into the locus STER_0891 (t0891).

The first three steps represent the construction of the STUL5002 mutant by overlapping PCR.

The first set of PCRs is presented in a), the overlapping PCR in b) and the resulting

construction on the chromosome of the STUL5002 mutant in c). The three following steps

illustrated the construction of STUL5003 mutant. The second set of PCRs is presented in d),

the overlapping PCR in e) and the resulting chromosomal construction of the STUL5003

mutant in f). Numerical values indicated in italics in genes are corresponding to locus tags as

described in the annotated sequence of the LMD-9 chromosome (NC_008532_1).

Oligonucleotides used as amplification primers are indicated as black arrows and labeled with

their # numbers as detailed in Table 2. UP and DN regions correspond to upstream and

downstream sequences flanking the fragment to clone, respectively. specR gene encodes a

spectinomycin adenyltransferase conferring resistance to spectinomycin. kanR gene encodes a

3′5″-aminoglycoside phosphotransferase of type III conferring resistance to kanamycin. prom

fragment correspond to the promoter region of the kanR gene. The grey triangle corresponds

to the loxP sequence.

2.4. Construction of the R-IVET library

The R-IVET library was constructed in the STUL5003 strain. The genomic DNA of

S. thermophilus LMD-9 was partially digested with the restriction enzyme AluI. The DNA

fragments were ligated with the T4DNA ligase to the plasmid pULNcreB (Junjua et al., 2014)

digested by the restriction enzyme SmaI and dephosphorylated with calf intestinal alkaline

phosphatase. DNA digestions were checked by electrophoresis and digested DNA was

purified using purification kit. Cells of E. coli TOP10 were transformed with the ligated

plasmids. The resulting clones were pooled and plasmids DNAs were extracted using the

Miniprep kit. The plasmids DNAs were introduced by natural transformation into

S. thermophilus STUL5003. The resulting clones were pooled and resuspended in LM17

containing 11.6 % glycerol and constituted the S. thermophilus R-IVET library stored in

aliquots at -80°C.

2.5. Identification of S. thermophilus functions induced in the TIM system

In vitro digestions were performed in the dynamic multi-compartimental TIM system

(TNO, Zeist, The Netherlands) which allows a very realistic simulation of in vivo

t 0891 0893

0892

kanRspecRprom

loxP loxP

Tlas

0890

Excisable fragment

R-IVET cassette



166

physiological reactions occurring within the lumen of the human stomach and the three

segments of the small intestine (duodenum, jejunum and ileum). This model and the simulated

parameters are described elsewhere (Blanquet-Diot et al., 2012; Minekus et al., 1995). To

avoid any microbial contamination, the TIM system is washed with detergent and sterilized

by steaming at 105°C for 35 min before each experiment. In the present study, the TIM

system was programmed according to in vivo data to reproduce the digestion of milk in a

healthy human adult (Table 3) with a total duration of 240 min. The R-IVET library cells

were pre-cultured during 10 h in milk supplemented with erythromycin at 5 µg/mL. Then, the

library was cultured overnight in 300 mL of milk supplemented with spectinomycin 300

µg/mL and streptomycin 20 µg/mL. Before introduction into the TIM stomach (initial

fermented meal), the fermented product was homogenized by vortexing at room temperature

for 5 min. Samples were collected from the initial meal (T0) and regularly during digestion in

the stomach (30, 60, 90 and 120 min), duodenum (30, 60 and 120 min), jejunum (30, 60, 120

and 180 min) and ileum (60, 120 and 180 min). Ileal effluents were kept on ice and collected

as pools of period covering 0-60, 60-120, 120-180 and 180-240 min. At the end of digestion

the gastro-intestinal residue was also collected. Samples were 10-fold diluted and appropriate

dilutions were plated onto LM17 agar (viable count) and onto LM17 agar supplemented with

mixed of 1 mg/mL of kanamycin and 5 µg/mL of erythromycin (activated clones selection:

SpecSKan

R clones).Three independent experiments were performed.

Table-3: Parameters of the TIM model when simulating the digestion of milk by a

healthy adult.

Compartment Volume (mL)

at initial time

pH/time (min) Secretion t1/2

(min)

coefficient

Stomach 310 5.9/0, 4.2/20, 2.8/40, 2.1/60,

1.8/90, 1.7/120, 1.7/240

0.25 mL/min of pepsin (500 U/mL),

0.25 mL/min lipase (75 U/mL) or HCl (3M)

if necessary

30 1

Duodenum 40 Maintained at 6.0 0.5 mL/min of bile porcine extract (4 %

w/w during the first 30 min of digestion and

then 2 % w/w), 0.25 mL/min of porcine pancreatin (14.1 %

w/w),

0.25 mL/min of intestinal electrolyte solution or NaHCO3 (1M) if necessary

Jejunum 105 Maintained at 6.8 0.25 mL/min of NaHCO3 (1M) if necessary

Ileum 110 Maintained at 7.2 0.25 mL/min of NaHCO3 (1M) if necessary 160 1.6

A power exponential equation (f=1-2-(t/t1/2)β

where f represents the fraction of meal delivered, t the time of

delivery, t1/2 the half-time of delivery, and β a coefficient describing the shape of the curve) was used for the

computer control of gastric and ileal deliveries.


167

2.6. Identification of S. thermophilus functions induced in the presence of intestinal

microbiota

To investigate the functions of S. thermophilus induced in the presence of intestinal

microbiota, the R-IVET library was incubated for 24 h under anaerobiosis with human fecal

samples treated as described below. Fresh feces from a healthy volunteer were used to prepare

the inoculum under strictly anaerobic conditions in a vinyl anaerobic chamber (Coy, Grass

Lake, MI, USA). Stools (~50 g) were mixed with 350 mL of a 200 mM sodium phosphate

buffer and filtered through a double layer of gauze. Ten milliliter of the fecal suspension were

rapidly transferred to 50 mL crimp vials, flushed with CO2 and filled with 20 mL of nutritive

medium. The nutritive medium contained various carbohydrate, protein, lipid, mineral and

vitamin sources, as previously described by Thévenot et al. (2015). The experiments were

performed in duplicate with the feces of two volunteers. For each fecal sample, 6 vials were

prepared and sealed: two control vials without R-IVET cells and four vials containing 1 mL of

R-IVET culture (as described in 2.7.). The vials were incubated at 37°C during 24 h and

stirred at 140 rpm. Samples (1 mL) were collected at 2 h, 4 h and 24 h. Samples were 10-fold

diluted and appropriate dilutions were plated onto LM17 agar supplemented with a mix of

spectinomycin 300 µg/mL and streptomycin 20 µg/mL (viable count) and onto LM17 agar

supplemented with a mix of kanamycin 1 mg/mL and erythromycin 5 µg/mL (activated

clones selection).

2.7. Sequence analysis

SpecSKan

R clones were further analyzed by PCR using primers #22 and #29 (Table 2).

Detection of a 628-bp amplicon confirmed that the loxP-specR fragment of the R-IVET

cassette had been deleted as a consequence of the induction of the promoter located in the

recombinant plasmid. The plasmid insert of each deleted clone was amplified with primers

#18 and #19 (Table 2). Amplified DNA was purified and sequenced using the #18 primer by

the Genewiz Company (Takeley, United Kingdom). The nucleotide sequences were analyzed

by the NCBI BLASTn using the annotated genome sequence of the wild type S. thermophilus

LMD-9 strain (Makarova et al., 2006). A promoter prediction was performed on the

sequences of the R-IVET inserts whose genomic sequence were located within a gene by

using the online promoter prediction tools Softberry BPROM (Solovyev and Salamov, 2011)

and the phiSITE PromoterHunter (Klucar et al., 2010).


168

2.8. Statistical analyses

Data were analyzed using a two-way repeated measures analysis of variance

(ANOVA) followed by a Bonferroni test. The statistical analysis was performed using

GraphPad Prism software 7.01 (GraphPad Software, Inc., San Diego, CA). Results were

expressed as means ± SEM. Differences were considered statistically significant when P <

0.05. The survival rates of the R-IVET library in the TIM system was compared to that of a

theoretically transit marker provided by the computer. The comparison was performed in each

compartment independently of the other and at each time of sampling independently of other

times. For the survival rates in the batch cultures, the comparison was performed between

volunteer 1 and volunteer 2 at each time of sampling independently of other times.

3. Results and discussion

3.1. Improvement of the R-IVET tool in S. thermophilus

In previous works the functionality of the R-IVET technology to detect a promoter

activity, and consequently a specific gene expression, has been established either in the TGI

of mice or in the TIM (Junjua et al., 2014; Uriot et al., 2016). Nevertheless, two problems

remain pending the screen allowing the selection of the activated R-IVET clones and the

representativeness of the genomic library constructed (Uriot et al., 2016). The screening of

the activated R-IVET clones was initially based on the loss of an antibiotic resistance (Bron et

al., 2004): when the recombinase Cre was active, it led to the excision of the specR gene

which conferred the spectinomycin resistance. This type of screening implied the plating of a

great number of colonies to expect selecting some activated clones. Furthermore, in the

genomic library first constructed the probability that each gene of the S. thermophilus genome

was present at least one time was only of 0.85. Consequently, a new screen system of R-IVET

activated clones allowing their positive selection was designed and subsequently a new

genomic library was constructed.

3.1.1. Construction of the strain STUL5003 with a chromosomal cassette allowing

positive selection of activated R-IVET clones and validation of its

functionality

As detailed in Figure 1, a chromosomal cassette consisting of 2 resistance genes

(specR and kanR), was inserted into the locus STER_0891 of S. thermophilus LMD-9 genome

to obtain the mutant strain STUL5003. This new cassette consisted in the promoter (called


169

prom) of the kanR gene conferring kanamycin resistance, followed by a loxP site, the

spectinomycin resistance gene specR with its own promoter and terminator, the Tlas

terminator, another loxP site and the promoterless kanR. It was expected that under the

expression of the Cre recombinase the specR gene would be excised, and the kanR correctly

positioned to be expressed under the promoter prom.

To validate the functionality of this positive screen, the plasmid pULNcreB-plac

containing the promoter of the lactose operon (plac) (Junjua et al., 2014) was introduced into

the STUL5003 strain leading to the STUL5003-plac strain. As the promoter plac is inducible

by lactose, it was expected that, following the expression of the recombinase Cre, all the

colonies of the STUL5003-plac strain grown with lactose would have lost the specR gene and

expressed the kanR gene. Consequently, all of them were expected to harbor a SpecSKan

R

phenotype. Conversely, in the same growth conditions, the SpecRKan

S phenotype was

expected for all the colonies of our control strain STUL5003. Hence, 60 randomly chosen

colonies of each of these two strains were grown on five different agar media, LM17 medium

without antibiotic (control), LM17 medium supplemented with erythromycin (to confirm the

presence of the pULNcreB-plac plasmid which has the ermE gene conferring erythromycin

resistance), LM17 supplemented with spectinomycin, or with kanamycin or with both of

them. As expected, none of the 60 colonies of the strain STUL5003 was able to grow in the

presence of erythromycin and/or kanamycin, while they grew in the presence of

spectinomycin as well as on the control medium. Therefore, they displayed a SpecRKan

SEry

S

phenotype, as expected. Conversely, all the colonies of the strain STUL5003-plac exhibited a

SpecSKan

REry

R phenotype, because they were capable to grow on the control and also in the

presence on erythromycin, kanamycin or both, but not with spectinomycin.

The STUL5003 chromosomal cassette was sequenced (Table 2) to ensure that no

mutation had occurred during the construction of the mutant strain STUL5003. When

compared with the theoretical sequence of the R-IVET cassette, two mutations were detected.

The first corresponded to the replacement of a cytosine by a guanine in the prom region and

the second was the deletion of a cytosine in the transcription terminator of the specR gene.

With regards to the position of these mutations as well as the phenotype of the STUL5003-

plac strain colonies, as exposed above, we concluded that these mutations have no impact on

the functionality of our R-IVET tool. Hence, the presence/absence of the loxP-specR

excisable fragment (Fig. 1) was checked by PCR in randomly chosen colonies of strains

STUL5003 and STUL5003-plac. In each colony (6/6) of the strain STUL5003, an amplicon


170

of 2,091 pb was observed as expected since the loxP-specR was present, whereas an amplicon

of 628 pb was detected in each colony (3/3) of the strain STUL5003-plac, as loxP-specR was

absent. Finally, the sequencing of the three -plac amplicons confirmed that the chromosomal

cassette was deleted, as expected.

To conclude on this part, the use of the two resistance genes specR and kanR on the

chromosomal cassette of the strain STUL5003 allowed a positive screening of the R-IVET

recombinant clones activated under certain conditions. Furthermore, by adding erythromycin

in the selection medium already containing kanamycin, the activated clones could be selected

while ensuring the stability of the R-IVET plasmid.

3.1.2. Construction of the R-IVET library

A genomic library was constructed by cloning AluI DNA fragments of the

S. thermophilus LMD-9 genome into the SmaI site of the pULNcreB. This site is located

upstream the gene cre. E. coli TOP10 was used as an intermediate cloning host, and the

plasmid DNA was isolated from the 72,000 clones selected and introduced into

S. thermophilus STUL5003 by natural transformation. A total of approximately of 114,600

colonies were selected on LM17 supplemented with erythromycin. Hence, PCRs were

performed on plasmids of 56 randomly chosen R-IVET clones to (i) assess the proportion of

recombinant clones and (ii) establish the sequences of the inserts to evaluate the recovery of

the LMD-9 strain genome. The results showed that 37.5 % of the R-IVET clones possessed an

insert. This allowed us to estimate that approximately 43,000 clones of our R-IVET library

had an insert with an average size of 500 pb. From these data, the genome coverage was

estimated using the Clarke and Carbon formula and was found to be higher than 99.99 %

(Clarke and Carbon, 1976). The analyses of the insert sequences revealed that the

corresponding fragment came from different parts of the genome of S. thermophilus and that

no specific genomic region appeared to be over- or underrepresented.

3.2. Optimization of the counter selection conditions

In order to eliminate recombinant clones containing a promoter induced during the

growth of the strain before its inoculation into the TIM system or batch cultures and that

would display a SpecSKan

R phenotype, the pre-selection conditions had to be optimized, i.e.,

to eliminate the SpecSKan

R and select the Spec

RKan

S clones. To this end, different

concentrations of antibiotics and different time exposures of the R-IVET library to the


171

antibiotics were tested. Three different mixes of antibiotics were tested: 300 µg/mL or 500

µg/mL of spectinomycin or a mix of spectinomycin 300 µg/mL and streptomycin 20 µg/mL.

Likewise, three different conditions of cultures in milk were tested: (i) the antibiotics were

added to the cultures three hours before coagulation of the milk, corresponding to the

cessation of growth (condition 1); (ii) the antibiotics were added at the beginning of the

growth and the cultivation was stopped when the milk had coagulated (condition 2) and (iii)

the antibiotics were added at the beginning of the growth and the cultures were incubated

overnight (condition 3). Appropriate dilutions of each sample were plated onto LM17 agar

supplemented with erythromycin (medium 1), a mix of spectinomycine 300 µg/mL and

streptomycin 20 µg/mL (medium 2), and a mix of kanamycin 1 mg/mL and erythromycin 5

µg/mL (medium 3). In each experiment, the number of colonies growing on medium 1 and 2

was not significantly different. Consequently, we focused only on the results obtained with

medium 1 and 3. Furthermore, as the growth of the R-IVET library appeared to be very slow

in the presence of spectinomycin 500 µg/mL, this condition was left. In condition 1, when

counter selection was realized either with spectinomycin 300 µg/mL or with a mix of

spectinomycin 300 µg/mL and streptomycin 20 µg/mL, 0.15 % and 0.03 % of the colonies

growing on medium 1 were also present on medium 3, respectively. Under condition 2, results

appeared slightly better since 0.08 % of the colonies growing on medium 1 also grew on

medium 3 for the counter selection using 300 µg/mL spectinomycin, against 0.015 % for the

counter selection using the mix of spectinomycin 300 µg/mL and streptomycin 20 µg/mL.

Similar results were obtained under condition 3. Finally, for each condition of counter

selection tested, the deletion of the loxP-specR fragment of the chromosomal cassette was

detected as well as the presence of an insert on pULNcreB in the 10 clones randomly selected.

Therefore, it appeared that the counter selection using a mix

spectinomycin/streptomycin was the most efficient. Based on these results and for

convenience further easy handling, it was decided to grow the R-IVET library overnight in

milk in the presence of spectinomycin/streptomycin. Nevertheless, as it seemed not possible

to completely eliminate the KanR clones, it was also chosen to systematically analyze the

clones KanR obtained at the beginning of the experiments (T0).


172

Table-4: Survival rates and number of R-IVET clones analyzed in each compartment of

the TIM system and in the batch cultures

TIM compartment

Time

(min)

Survival rate (log10 CFU) Number of R-IVET

clones analyzed Transit marker R-IVET library

Test meal 0 10.85 ± 0.06a 10.85 ± 0.06

a 288

Stomach 30 10.55 ± 0.06a 10.49 ± 0.05

a 288

60 10.27 ± 0.07a 9.57 ± 0.16

a 215

90 9.96 ± 0.07a 6.97 ± 0.56

b 34

120 9.68 ± 0.08a 3.17 ± 1.62

b 0

Duodenum 30 9.84 ± 0.06a 9.31 ± 0.09

a 7

60 9.75 ± 0.06a 8.87 ± 0.13

a 20

120 9.48 ± 0.06a 2.46 ± 1.23

b 0

Jejunum 30 10.30 ± 0.06a 8.16 ± 0.12

a 1

60 10.32 ± 0.06a 7.77 ± 0.32

b 0

120 10.22 ± 0.06a 5.22 ± 0.76

b 0

180 9.97 ± 0.06a 2.57 ± 1.29

b 0

Ileum 60 10.27 ± 0.05a 7.63 ± 0.55

a 0

120 10.28 ± 0.07a 4.71 ± 2.35

b 0

180 10.17 ± 0.10a 4.42 ± 2.21

b 0

Ileal effluent 0-60 0-60 10.00 ± 0.06a 7.94 ± 0.19

b 1

Ileal effluent 0-120 0-120 10.41 ± 0.06a 7.99 ± 0.19

b 0

Ileal effluent 0-180 0-180 10.61 ± 0.06a 8.00 ± 0.19

b 0

Ileal effluent 0-240 0-240 10.72 ± 0.06a 8.00 ± 0.19

b 0

Global survival Tf 10.85 ± 0.06a 8.19 ± 0.30

b 0

Batch cultures Time (h) Survival rate (log10 CFU) Number of R-IVET

clones analyzed

Volunteer 1 0 8.39 ± 0.05a 96

2 8.43 ± 0.04a 158

4 8.31 ± 0.01a 155

24 5.85 ± 0.09b 1

Volunteer 2 0 8.29 ± 0.03a 96

2 8.38 ± 0.03a 140

4 8.41 ± 0.03a 67

24 4.77 ± 0.04c 0

Values are given as means of log10 CFU ± SEM (n=3 for the TIM system and n=4 for the

batch culture). In the TIM compartments, the values obtained at each time for R-IVET library

were compared to those of the transit marker (expressed as equivalent of log10 CFU). In the

batch cultures, values obtained at each time were compared to that at T0 and between each

volunteer. Different letters indicate statistically significant differences (ANOVA and

Bonferroni test, P < 0.05).

3.3. Survival of S. thermophilus in the TIM system and in batch cultures

The survival kinetics of the S. thermophilus R-IVET library was monitored during its

passage through the compartments of the gastro-intestinal TIM model. Bacterial survival was

not significantly different from the transit marker values during the first hour of digestion in

the stomach compartment (Table 4). On the contrary, significant bacterial mortality was

observed from 90 min when the pH fell below 1.8, with a loss of 3 log10 CFU and 6 log10

CFU at 90 and 120 min, respectively. This loss of viability from 90 min in the stomach was in


173

accordance with previous results obtained with the LMD-9 wild type strain, when

administered in a fermented milk, like in this study (Uriot et al., 2016). However, when

compared with the strain LMD-9, the survival of the R-IVET genomic library cells appeared

to be lower than that of the wild type LMD-9 strain by at least 3 log10 in the stomach

compartment.

Monitoring of R-IVET library cell numbers in the three compartments of the small

intestine showed that the ability to survive of these clones was also affected in the post-gastric

conditions (Table 4). The survival rates of the library showed a significant decrease in all the

small intestinal compartments from 120 min digestion, with a loss of 7 log10 units in the

duodenum and approximately 5 log10 units in the jejunum and ileum. Bacterial cells which

have survived the whole digestive process are recovered in the ileal effluents of the TIM

model. For the R-IVET library, the final counts reached 8.2 log10 units (when the number of

bacterial cells in the ileal effluents and in the gastrointestinal residue are added), indicating

that 1.55×108 CFU could reach the colon. The library survival in the ileal effluents was lower

by at least 1.3 log10 compared to that of the wild type strain (Uriot et al., 2016). Two

hypotheses can be raised to explain such results. The first is that the interruption of the

STER_0891 locus has impacted the survival capacity of S. thermophilus in the GIT. The

second is that during the construction of the STUL5003 strain, mutation in the genome which

may lead to a decrease in the survival capacity in the TIM has occurred. Since a link between

the interruption of the STER_0891 locus and a decrease in survival capacity in the TIM model

was not observed our previous results (Uriot et al., 2016), the second hypothesis seems the

most likely.

Lastly, the survival kinetic of the S. thermophilus R-IVET library was monitored in

batch culture of human intestinal microbiota (Table 4). During the first four hours, the

survival rates of the R-IVET library remained unchanged and no significant difference was

observed between the two volunteers. However, after 24 hours incubation, the number of

viable S. thermophilus R-IVET cells significantly decreased of approximately of 2.5 and 3.5

log10 CFU for volunteer 1 and 2, respectively. The final survival rate was significantly

different (P < 0.0001) between the two volunteers. These results are in accordance with a

previous study performed in animal models where S. thermophilus was detected during the

early hours and then disappeared after 6 or 10 hours (Lick et al., 2001; Mater et al., 2006).

Thus, S. thermophilus appeared to constitute a transit bacterial flora which does not have the

capacity to colonize even temporarily in the colon, certainly due to competition with resident


174

microbiota. It should be underlined that in the present experiments, no nutrient or carbon

source was added to the cultures (batch cultures). In previous studies in animal models lactose

was shown to significantly improve the survival capacity of S. thermophilus in the GIT (Ben-

Yahia et al., 2012; Thomas et al., 2011).

3.4. Sequence analyses and identification of S. thermophilus functions induced in the

TIM system and in presence of intestinal microbiota

After transit through the TIM model or following incubation in the presence of

intestinal microbiota, 1,467 clones SpecSKan

R were analyzed further (Table 4). Among them,

480 were selected at the time T0 of the three experiments in the TIM and the two assays in

batch cultures. All the 1,467 clones displayed the deletion of the fragment loxP-specR in their

chromosomal cassette as expected, and an insert located upstream of gene cre on their

pULNcreB. The sequences of the 1,467 inserts were established and revealed either (i) the

presence of a single or a multiple insert upstream of the gene cre which may contain

promoters already identified during the sequencing of the genome of the strain LMD-9, and

(ii) the presence of sens or antisens sequences which could contain promoter and/or were

located inside a gene. The presence of multiple inserts probably resulted from the method

employed to set-up the R-IVET genomic library, since it was decided to dephosphorylate the

vector pULNcreB after SmaI digestion, instead of the inserts.

Analyses of the inserts of the 480 clones isolated at T0 revealed that about 50 %

consisted of multiple inserts. Seventy two promoters from different genes were identified and

observed three times on average on the simple inserts. Most of these genes were involved in

basic cellular functions. For example, they encoded the PepS aminopeptidase, the subunit III

of DNA polymerase III, the ATP subunit of Clp protease, a DNA/RNA helicase or DNA

polymerase I. Such results are consistent with what was expected. Indeed, during its growth in

milk, the bacterium had to develop an active and basic metabolism, to use the nutrients in the

culture medium and multiply. We speculate that the detection of these genes at T0 only

illustrated the impossibility to completely eliminate these clones using the counter selection

condition applied, the use of antibiotic genes for selection remaining a problem in

S. thermophilus.

From the analyses of the remaining 987 inserts obtained from the TIM model or from

the batch cultures of intestinal microbiota, once having removed the genes as well as the

multiple inserts detected at the different T0, 24 and 11 promoter sequences were identified in


175

the TIM stomach and in batch cultures, respectively (Table 5 and 6). Antisens and intragenic

sequences were also identified. Promoter prediction software had shown that one or more

sequences could serve as promoter in all the identified sequences that are located within a

gene. Altogether, these two results led to the conclusion that they could encode small non

coding RNA or belong to region containing downstream a small ORF. The S. thermophilus

genome is known to contain small ORF encoding peptides involved in regulation such as

quorum sensing (Ibrahim et al., 2007a, 2007b). No genes have been identified from the small

intestine of the TIM. This could be linked to the loss of survival rate in presence of bile.

Indeed, the number of activated R-IVET clones that can be recovered being already weak, the

significant drop in survival of the genomic library from duodenum, i.e., in presence of bile,

might have contributed to the non-selection of activated clones. This could constitute a limit

using of the TIM in studies involving the R-IVET technology. As shown in tables 5 and 6,

genes identified in the TIM and in batch cultures are mainly involved in nutrient transport and

metabolism, stress or protein synthesis and several (3 in the TIM and 3 in the batch cultures),

hypothetical proteins have been observed. Finally, genes involved in various functions

(designated as other functions) have been identified. These different categories of genes as

well as the potential antisens RNA have been already observed in other studies using the R-

IVET technology, e.g. in Lactobacillus plantarum (Bron et al., 2004) or Enterococcus

faecalis (Frank et al., 2012; Hanin et al., 2010).

Then, the first conclusion that can be drawn from these results is that the bacteria were

metabolically active under the stressful conditions tested, since genes involved in cellular

metabolism and protein synthesis have been identified in the TIM stomach and in batch

cultures of intestinal microbiota.

To go further inside the description of activated genes, two regulators were identified

in the TIM stomach, the STER_0901 and the STER_1693 genes (Table 5). The STER_0901

gene belongs to the transcriptional regulator of LysR family whose members are involved in

the regulation of metabolism including that of amino acid production, the response to

oxidative stress or quorum sensing (Maddocks and Oyston, 2008). The search of specific

domain in the protein encoded by the STER_1693 gene revealed a HTH-XRE domain (first

60 amino acids) involved in xenobiotic responses (DNA binding proteins belonging to the

family of xenobiotic response element transcriptional regulators).


176

Table-5: S. thermophilus LMD-9 loci identified using R-IVET technology during the

passage through the TIM model

(a): annotation locus dating from 01-28-2014; (

b): annotation locus dating from 07-30-2015 on NCBI. (*): DNA

sequence of the insert corresponds to an internal sequence of the gene. Into bracket are presented the

conserved protein domains identified in the hypothetical proteins. S: stomach. Blue: regulator; green:

stress; grey: hypothetical protein; orange: protein synthesis; white: others and yellow: nutrient transport and

metabolism.

Gene description Locus

STER_a

(STER_RS0)b

Position of the

insert

Sens /

antisens

Compartment /

time (min)

S30 S60 S90 30S ribosomal protein S15 0208 (1025) 176108-176450 sens + + Non-canonical purine NTP pyrophosphatase 0303 (1470) 261471-261718 sens +

Hypothetical protein (DNA-directed RNA polymerase

subunit delta)/ hypothetical protein (DUF3816 family protein)

0345/0346

(1680/1685)

299728-300628 sens +

Branched-chain amino acid ABC-type transport system,

permease component

0399 (1945) 350432-350646 sens +

Predicted amydohydrolase 0498 (2445) 445501-446444 sens + + Panthothenate kinase 0851 (4190) 785950-784770 sens +

LysR family transcriptional regulator 0901 (4465) 833783-832788 sens +

Zn-dependant alcohol dehydrogenase 0949 (4695) 879316-879396 sens + Hypothetical protein (phasin protein superfamily) 1048 (5200) 974176-973220 sens +

Ribonuclease III/ chromosome segregation protein SMC 1272/1271

(6280/6275)

1183558-1182467 sens +

Hypothetical protein (nitroreductase-like protein family) 1319 (6515) 1228286-1227465 sens + +

Hypothetical protein 1559 (7665) 1464744-1463769 sens +

Transcriptional regulator (helix-turn-helix XRE-family like protein)

1693 (8275) 1582297-1583056 sens + +

rRNA-5S ribosomal RNA/ tRNA-Val r0082/t0083

(0415/0420)

71512-71726 sens +

r0071/t0072

(0830/0835)

145721-145935 sens +

r0022/t0023 (0110/0115)

23850-24064 sens +

r0412/t0413

(2015/2020)

364159-364373 sens +

rRNA-5S ribosomal RNA/ tRNA-Asn r0184/t0185

(0895/0900)

151527-151756 sens +

r1781/t1780 (8710/8705)

1662586-1662357 sens +

tRNA(Ile)-lysidine synthase TilS/MesJ 0012 (0060) 11781-12762 sens +

Hypothetical protein/ DNA mismatch repair protein MutL 0071/0072 (0360/0365)

59053-59640 sens +

KxxxW cyclic peptide radical SAM maturase 1356 (6690) 1261748-1260748 sens +

2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase

1814 (8865) 1695365-1694980 sens +

tRNA-binding protein 1824 (8910) 1701896-1701414 sens + NUDIX family hydrolase 0336 (1630) 289981-289188 antisens +

ABC transporter ATP-binding protein 1921 (9415) 1784222-1783251 antisens + +

Glycosyl transferase family 3 0853 (4200) 785950-785039 antisens + Pseudogene : PadR family transcriptional regulator 1965 (9615) 1818077-1817746 antisens +

tRNA methyltransferase, TrmA family (23S rRNA (uracil-5)-

methyltransferase RumA

*0423 (2070) 368157-369151 sens + +

3-phosphoglycerate dehydrogenase *1487 (7310) 1392951-1392865 sens +

Glutamate-tRNA ligase *1793 (8770) 1677638-1677046

1677399-167706

sens +

ISL3 family transposase *0569 (2805) 513865-513496 sens + +

*0631 (3095) 573221-573608 sens + +

*0849 (4180) 783047-783434 sens + + *1162 (5735) 1071215-1071610 sens + +

*1556 (7650) 1460020-1460416 sens + +

Hypothetical protein *1642 (8055) 1534778-1534351 sens + + Peptide ABC transporter permease *1408 (6925) 1316650-1316193 sens +

NAD(P)-dependant oxidoreductase *1444 (7105) 1352291-1352194 sens +

tRNA (uridine(34)/cytosine(34)/5-carboxymethyl aminomethyluridine(34)-2'-O)-methyltransferase TrmL

*0313 (1520) 270267-270471 sens +

PFL family protein *0157 (0760) 129819-130812 sens +

DNA internalization-related competence protein ComEC/Rec2

*1520 (7480) 1425795-1426019 antisens +

F0F1 ATP synthase subunit gamma *0520 (2550) 467311-467205 antisens +

N-acetylglucosamine-6-phosphate deacetylase *0537 (2635) 483279-483109 antisens +


177

Table-6: S. thermophilus LMD-9 loci identified using R-IVET batch cultures with

human intestinal microbiota

(a): annotation locus dating from 01-28-2014; (

b): annotation locus dating from 07-30-2015 on NCBI.

(*): DNA sequence of the insert corresponds to an internal sequence of the gene. Into brackets are

presented the conserved protein domains identified in the hypothetical proteins. Green: stress; grey:

hypothetical protein; orange: protein synthesis; white: others and yellow: nutrient transport and

metabolism.

Four genes involved in stress responses were identified, 2 in the TIM gastric

compartmentand 2 in batch cultures. In the TIM stomach, the gene STER_0303 might be

involved in protecting the cell against mutagenesis because of the presence of a HAM1

domain in the last 200 amino-acid residue protein. In Saccharomyces cerevisiae,

overexpression of the ham1 gene reversed the growth arrest caused by BrdU (which

modulates expression of particular genes and eventually causes arrest cell division of yeast

cells) and blocked incorporation of BrdU into genomic DNA (Takayama et al., 2007).The

second is included in a clone which contains an insert comprising a gene encoding a

hypothetical protein (STER_0071) and 40 bp located before the start codon of the gene

STER_0072 which encodes the protein MutL of the mismatch repair system. Bioinformatics

Gene description Locus

STER_a

(STER_RS0)b

Position of the insert Sens /

antisens

Phosphate-binding protein 1006 (4960) 927153-928187 Sens

30S ribosomal protein S18 1726 (8440) 1616742-1616519 Sens

50S ribosomal protein L4 1906 (9340) 1768760-1767847 Sens

CRISPR-associated endoribonuclease Cas6 0972 (4800) 897115-898049 Sens

Hypothétical protein 0743 (3645) 675866-675075 Sens

Pseudogene : NADPH-dependant FMN reductase 1805 (8815) 1685778-1686716 Sens

ABC permease transporter 0572 (2820) 517756-517057 Sens

ABC permease transporter 1347 (6650) 1253799-1254182 Sens

Pseudogene: lantibiotic transporter 0133 (0660) 109357-109530 Sens

Hypothetical protein ---- (9395) 1778945-1778758 Sens

Hypothetical protein (phasin protein superfamily) 1048 (5200) 974176-973220 Sens

Ferrous iron transport protein B/ iron transporter FeoA 0654/0653

(3225/3220)

594581-593569 Antisens

IS256 family transposase 0367 (1780) 319645-319138 Antisens

0888 (4395) 820824-820651 Antisens

0881 (4360) 810934-810748 Antisens

0883 (4370) 815635-815808 Antisens

1-phosphofructokinase 0445 (2180) 389930-389309 Antisens

Peptide synthetase *0335 (1630) 287711-288710 Sens

tRNA methyltransferase, TrmA family (23S rRNA (uracil-

5-)-methyltransferase RumA

*0423 (2070) 368157-369151 Sens

ABC transporter *0471 (2315) 418458-419267 Sens

KxxxW cyclic peptide radical SAM maturase *1356 (6690) 1260895-1260614 Sens

Peroxiredoxin *1470 (7230) 1375130-1374976 Sens

Membrane protein *1724 (8430) 1614761-1614899 Sens

Zinc ribbon domain-containing protein *0131 (0650) 107081-107488 Sens

Hypothetical protein *1579 (7760) 1479868-1480392 Antisens

tRNA uridine-5-carboxymethylaminomethyl (34) synthesis

enzyme MnmG

*1978 (9670) 1828970-1829158 Antisens


178

analyses of the sequence extending from the end of STER_0071 gene at the end of the insert

revealed the presence of a promoter correctly located upstream of the gene STER_0072.

Furthermore, a clone containing a multi-insert corresponding to the promoter region of the

hypothetical protein STER_0071 has been also found to be activated (data not shown).

Consequently, altogether these results showed that at least one (probably the STER_0071

gene) and perhaps both genes (STER_0071 and STER_0072) were activated in the gastric

compartment of the TIM. Interestingly, none of the genes are known to be involved in acid

stress resistance. This can be explained by the fact that the R-IVET library has been grown in

milk until the end of fermentation where the pH is still acid. Therefore, the genes known to be

involved in acidic stress resistance such as GroEL, GroES or Hsp (Arena et al., 2006; Zotta et

al., 2008a) have been likely to be expressed during the culture phase and the corresponding

clones eliminated during the counter-selection applied before the inoculation of the TIM.

Finally, in batch cultures, two genes (STER_0572 and STER_1347) encoding two ABC type

permeases have been identified and contain a protein domain SalY (200 last amino-acid

residue protein) that is involved in the transport of antimicrobial peptide.

Hypothetical proteins were identified in the TIM stomach as well as in the presence of

intestinal microbiota. These proteins are relatively well conserved in S. thermophilus (%

identity > 80 %). For some of them, conserved domains have been identified. For example,

the gene STER_1048 (Table 6) encodes a protein which displays a domain belonging to the

superfamily of phasins. In many bacteria, these genes are involved in the formation and

intracellular accumulation of polyhydroxyalkanoates under adverse conditions, which allows

cells to increase their fitness and resistance to stress (de Almeida et al., 2007).

Among the genes classified in the category “other functions”, several have to be

underlined. The first one is the gene STER_1356 (Table 5) encoding a KxxxW cyclic peptide

radical SAM (S-adenosyl-L-methionine) maturase. The radical SAM enzyme catalyses the

cleavage of the carbon-sulfur bond of SAM which produces 5’-deoxyadenosyl (dAdo) radical

which are involved in the first steps of metabolism, DNA repair or in the biosynthesis of

vitamins and/or coenzymes (Ding et al., 2016). The second is the STER_1814 gene (Table 5)

which displays a DapD_Ac domain that could be involved in the L-lysine biosynthetic

pathway (Schuldt et al., 2009).The third is the gene STER_0972 (Table 6) encoding CRISPR-

associated endoribonuclease Cas6 which is an actor of the immune system CRISPR, involved

in the protection of the cells against foreign DNA, such as plasmid or virus DNA

(Hochstrasser and Doudna, 2015).


179

4. Conclusion

To conclude this work, the technology R-IVET applied to S. thermophilus allowed to

identify genes which were induced (i) in the gastric compartment of the TIM which simulates

the human digestive conditions and (ii) in presence of feces microbiota in batch cultures. If

genes of various functions were identified, several conclusions can be drawn. The first is that

the R-IVET technology has permit to detect the expression of genes coding unknown

proteins, and so, to progress perhaps in the understanding of the role of these genes. If we

considered the STER_0572, STER_1317 and STER_0972 genes, it appeared that in presence

of the colic microbiota which respectively encodes 2 ABC permeases possibly involved in the

transport of antimicrobial peptide and the CRISPR-associated endoribonuclease Cas6,

S. thermophilus could adapt its physiology to resist aggression exerted by the other bacteria. It

was not the case for the TIM stomach compartment, where S. thermophilus has to resist to

acidic stressful environment conditions especially through the expression of regulators

involved in stress response.


180

References

Arena, S., D’Ambrosio, C., Renzone, G., Rullo, R., Ledda, L., Vitale, F., Maglione, G., Varcamonti,

M., Ferrara, L., Scaloni, A., 2006. A study of Streptococcus thermophilus proteome by

integrated analytical procedures and differential expression investigations. Proteomics. 6, 181–

192. doi:10.1002/pmic.200402109




Blanquet-Diot, S., Denis, S., Chalancon, S., Chaira, F., Cardot, J.-M., Alric, M., 2012. Use of artificial

digestive systems to investigate the biopharmaceutical factors influencing the survival of

probiotic yeast during gastrointestinal transit in humans. Pharm. Res. 29, 1444–1453.

doi:10.1007/s11095-011-0620-5

Bron, P.A., Grangette, C., Mercenier, A., de Vos, W.M., Kleerebezem, M., 2004. Identification of

Lactobacillus plantarum Genes That Are Induced in the Gastrointestinal Tract of Mice. J.

Bacteriol. 186, 5721–5729. doi:10.1128/JB.186.17.5721-5729.2004

Camilli, A., Beattie, D.T., Mekalanos, J.J., 1994. Use of genetic recombination as a reporter of gene

expression. Proc. Natl. Acad. Sci. U. S. A. 91, 2634–2638.

Clarke, L., Carbon, J., 1976. A colony bank containing synthetic CoI EI hybrid plasmids

representative of the entire E. coli genome. Cell 9, 91–99. doi:10.1016/0092-8674(76)90055-6

de Almeida, A., Nikel, P.I., Giordano, A.M., Pettinari, M.J., 2007. Effects of granule-associated

protein PhaP on glycerol-dependent growth and polymer production in poly(3-

hydroxybutyrate)-producing Escherichia coli. Appl. Environ. Microbiol. 73, 7912–7916.

doi:10.1128/AEM.01900-07

Del Carmen, S., de Moreno de LeBlanc, A., Martin, R., Chain, F., Langella, P., Bermúdez-Humarán,

L.G., LeBlanc, J.G., 2014. Genetically engineered immunomodulatory Streptococcus

thermophilus strains producing antioxidant enzymes exhibit enhanced anti-inflammatory

activities. Appl. Environ. Microbiol. 80, 869–877. doi:10.1128/AEM.03296-13

Ding, W., Ji, X., Li, Y., Zhang, Q., 2016. Catalytic Promiscuity of the Radical S-adenosyl-L-

methionine Enzyme NosL. Front. Chem. 4. doi:10.3389/fchem.2016.00027

Elli, M., Callegari, M.L., Ferrari, S., Bessi, E., Cattivelli, D., Soldi, S., Morelli, L., Goupil Feuillerat,

N., Antoine, J.-M., 2006. Survival of Yogurt Bacteria in the Human Gut. Appl. Environ.


Fischer, G., Decaris, B., Leblond, P., 1997. Occurrence of deletions, associated with genetic instability

in Streptomyces ambofaciens, is independent of the linearity of the chromosomal DNA. J.

Bacteriol. 179, 4553–4558.

Frank, K.L., Barnes, A.M.T., Grindle, S.M., Manias, D.A., Schlievert, P.M., Dunny, G.M., 2012. Use

of Recombinase-Based In Vivo Expression Technology To Characterize Enterococcus faecalis

Gene Expression during Infection Identifies In Vivo-Expressed Antisense RNAs and Implicates

the Protease Eep in Pathogenesis. Infect. Immun. 80, 539–549. doi:10.1128/IAI.05964-11

García-Hernández, J., Moreno, Y., Chuan, C., Hernández, M., 2012. In vivo study of the survival of

Lactobacillus delbrueckii subsp. bulgaricus CECT 4005T and Streptococcus thermophilus

CECT 801 by DVC-FISH after consumption of fermented milk. J. Food Sci. 77, M593-597.

doi:10.1111/j.1750-3841.2012.02918.x


181

Gardan, R., Besset, C., Guillot, A., Gitton, C., Monnet, V., 2009. The Oligopeptide Transport System

Is Essential for the Development of Natural Competence in Streptococcus thermophilus Strain

LMD-9. J. Bacteriol. 191, 4647–4655. doi:10.1128/JB.00257-09

Guarner, F., Perdigon, G., Corthier, G., Salminen, S., Koletzko, B., Morelli, L., 2005. Should yoghurt

cultures be considered probiotic? Br. J. Nutr. 93, 783. doi:10.1079/BJN20051428

Guerra, A., Etienne-Mesmin, L., Livrelli, V., Denis, S., Blanquet-Diot, S., Alric, M., 2012. Relevance

and challenges in modeling human gastric and small intestinal digestion. Trends Biotechnol. 30,

591–600. doi:10.1016/j.tibtech.2012.08.001

Hanin, A., Sava, I., Bao, Y., Huebner, J., Hartke, A., Auffray, Y., Sauvageot, N., 2010. Screening of in

vivo activated genes in Enterococcus faecalis during insect and mouse infections and growth in

urine. PloS One 5, e11879. doi:10.1371/journal.pone.0011879

Hill, C., Guarner, F., Reid, G., Gibson, G.R., Merenstein, D.J., Pot, B., Morelli, L., Canani, R.B., Flint,

H.J., Salminen, S., Calder, P.C., Sanders, M.E., 2014. Expert consensus document. The

International Scientific Association for Probiotics and Prebiotics consensus statement on the

scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 11, 506–514.

doi:10.1038/nrgastro.2014.66

Hochstrasser, M.L., Doudna, J.A., 2015. Cutting it close: CRISPR-associated endoribonuclease

structure and function. Trends Biochem. Sci. 40, 58–66. doi:10.1016/j.tibs.2014.10.007

Ibrahim, M., Guillot, A., Wessner, F., Algaron, F., Besset, C., Courtin, P., Gardan, R., Monnet, V.,

2007a. Control of the Transcription of a Short Gene Encoding a Cyclic Peptide in Streptococcus

thermophilus: a New Quorum-Sensing System? J. Bacteriol. 189, 8844–8854.

doi:10.1128/JB.01057-07

Ibrahim, M., Nicolas, P., Bessières, P., Bolotin, A., Monnet, V., Gardan, R., 2007b. A genome-wide

survey of short coding sequences in streptococci. Microbiol. Read. Engl. 153, 3631–3644.

doi:10.1099/mic.0.2007/006205-0

Ito, M., Ohishi, K., Yoshida, Y., Okumura, T., Sato, T., Yokoi, W., Sawada, H., 2008. Preventive

effect of Streptococcus thermophilus YIT 2001 on dextran sulfate sodium-induced colitis in

mice. Biosci. Biotechnol. Biochem. 72, 2543–2547.

Iyer, R., Tomar, S.K., Singh, A.K., 2010b. Response surface optimization of the cultivation conditions

and medium components for the production of folate by Streptococcus thermophilus. J. Dairy

Res. 77, 350–356. doi:10.1017/S0022029910000166

Junjua, M., Galia, W., Gaci, N., Uriot, O., Genay, M., Bachmann, H., Kleerebezem, M., Dary, A.,

Roussel, Y., 2014. Development of the recombinase-based in vivo expression technology in

Streptococcus thermophilus and validation using the lactose operon promoter. J. Appl.

Microbiol. 116, 620–631. doi:10.1111/jam.12376

Junjua, M., Kechaou, N., Chain, F., Awussi, A.A., Roussel, Y., Perrin, C., Roux, E., Langella, P.,

Bermúdez-Humarán, L.G., Le Roux, Y., Chatel, J.-M., Dary-Mourot, A., 2016. A large scale in

vitro screening of Streptococcus thermophilus strains revealed strains with a high anti-

inflammatory potential. LWT - Food Sci. Technol. 70, 78–87. doi:10.1016/j.lwt.2016.02.006

Klucar, L., Stano, M., Hajduk, M., 2010. phiSITE: database of gene regulation in bacteriophages.

Nucleic Acids Res. 38, D366–D370. doi:10.1093/nar/gkp911

Lick, S., Drescher, K., Heller, K.J., 2001. Survival of Lactobacillus delbrueckii subsp. bulgaricus and

Streptococcus thermophilus in the Terminal Ileum of Fistulated Gottingen Minipigs. Appl.



182

Maddocks, S.E., Oyston, P.C.F., 2008. Structure and function of the LysR-type transcriptional

regulator (LTTR) family proteins. Microbiol. Read. Engl. 154, 3609–3623.

doi:10.1099/mic.0.2008/022772-0

Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavlov, A., Pavlova, N.,

Karamychev, V., Polouchine, N., Shakhova, V., Grigoriev, I., Lou, Y., Rohksar, D., Lucas, S.,

Huang, K., Goodstein, D.M., Hawkins, T., Plengvidhya, V., Welker, D., Hughes, J., Goh, Y.,

Benson, A., Baldwin, K., Lee, J.-H., Díaz-Muñiz, I., Dosti, B., Smeianov, V., Wechter, W.,

Barabote, R., Lorca, G., Altermann, E., Barrangou, R., Ganesan, B., Xie, Y., Rawsthorne, H.,

Tamir, D., Parker, C., Breidt, F., Broadbent, J., Hutkins, R., O’Sullivan, D., Steele, J., Unlu, G.,

Saier, M., Klaenhammer, T., Richardson, P., Kozyavkin, S., Weimer, B., Mills, D., 2006.

Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sci. U. S. A. 103, 15611–

15616. doi:10.1073/pnas.0607117103


Galactosidase production by Streptococcus thermophilus is higher in the small intestine than in

the caecum of human-microbiota-associated mice after lactose supplementation. Br. J. Nutr. 96,

177–181.

Mater, D.D.G., Bretigny, L., Firmesse, O., Flores, M.-J., Mogenet, A., Bresson, J.-L., Corthier, G.,

2005. Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus survive

gastrointestinal transit of healthy volunteers consuming yogurt. FEMS Microbiol. Lett. 250,

185–187. doi:10.1016/j.femsle.2005.07.006

Minekus, M., Marteau, P., Havenaar, R., Huis in’t Veld, J.H., 1995. A multicompartmental dynamic

computer-controlled model simulating the stomach and small intestine. ATLA 197–209.


thermophilus ST28 ameliorates colitis in mice partially by suppression of inflammatory Th17

cells. J. Biomed. Biotechnol. 2011, 378417. doi:10.1155/2011/378417

Ogita, T., Tanii, Y., Morita, H., Suzuki, T., Tanabe, S., 2011b. Suppression of Th17 response by

Streptococcus thermophilus ST28 through induction of IFN-γ. Int. J. Mol. Med. 28, 817–822.

doi:10.3892/ijmm.2011.755

Rodríguez, C., Medici, M., Mozzi, F., Font de Valdez, G., 2010. Therapeutic effect of Streptococcus

thermophilus CRL 1190-fermented milk on chronic gastritis. World J. Gastroenterol. 16, 1622–

1630.

Rul, F., Ben-Yahia, L., Chegdani, F., Wrzosek, L., Thomas, S., Noordine, M.-L., Gitton, C., Cherbuy,

C., Langella, P., Thomas, M., 2011. Impact of the Metabolic Activity of Streptococcus

thermophilus on the Colon Epithelium of Gnotobiotic Rats. J. Biol. Chem. 286, 10288–10296.

doi:10.1074/jbc.M110.168666

Schuldt, L., Weyand, S., Kefala, G., Weiss, M.S., 2009. The three-dimensional Structure of a

mycobacterial DapD provides insights into DapD diversity and reveals unexpected particulars

about the enzymatic mechanism. J. Mol. Biol. 389, 863–879. doi:10.1016/j.jmb.2009.04.046

Solovyev, V., Salamov, A., 2011. Automatic Annotation of Microbial Genomes and Metagenomic

Sequences. In Metagenomics and its Applications in Agriculture, Biomedicine and

Environmental Studies. Nova Sci. Publ., Ed. R.W. Li 61–78.

Takamatsu, D., Osaki, M., Sekizaki, T., 2001. Thermosensitive suicide vectors for gene replacement

in Streptococcus suis. Plasmid 46, 140–148. doi:10.1006/plas.2001.1532


183

Takayama, S., Fujii, M., Kurosawa, A., Adachi, N., Ayusawa, D., 2007. Overexpression of HAM1

gene detoxifies 5-bromodeoxyuridine in the yeast Saccharomyces cerevisiae. Curr. Genet. 52,

203–211. doi:10.1007/s00294-007-0152-z

Terahara, M., Kurama, S., Takemoto, N., 2001. Prevention by lactic acid bacteria of the oxidation of

human LDL. Biosci. Biotechnol. Biochem. 65, 1864–1868.

Terzaghi, B.E., Sandine, W.E., 1975. Improved medium for lactic streptococci and their

bacteriophages. Appl. Microbiol. 29, 807–813.

Thévenot, J., Cordonnier, C., Rougeron, A., Le Goff, O., Nguyen, H.T.T., Denis, S., Alric, M.,

Livrelli, V., Blanquet-Diot, S., 2015. Enterohemorrhagic Escherichia coli infection has donor-

dependent effect on human gut microbiota and may be antagonized by probiotic yeast during

interaction with Peyer’s patches. Appl. Microbiol. Biotechnol. 99, 9097–9110.

doi:10.1007/s00253-015-6704-0

Thomas, M., Wrzosek, L., Ben-Yahia, L., Noordine, M.-L., Gitton, C., Chevret, D., Langella, P.,

Mayeur, C., Cherbuy, C., Rul, F., 2011. Carbohydrate Metabolism Is Essential for the

Colonization of Streptococcus thermophilus in the Digestive Tract of Gnotobiotic Rats. PLoS


Uriot, O., Galia, W., Awussi, A.A., Perrin, C., Denis, S., Chalancon, S., Lorson, E., Poirson, C.,

Junjua, M., Le Roux, Y., Alric, M., Dary, A., Blanquet-Diot, S., Roussel, Y., 2016. Use of the

dynamic gastro-intestinal model TIM to explore the survival of the yogurt bacterium

Streptococcus thermophilus and the metabolic activities induced in the simulated human gut.

Food Microbiol. 53, 18–29. doi:10.1016/j.fm.2015.05.007

Zotta, T., Ricciardi, A., Ciocia, F., Rossano, R., Parente, E., 2008. Diversity of stress responses in

dairy thermophilic streptococci. Int. J. Food Microbiol. 124, 34–42.



185


Dans un premier temps, l’objectif de cette étude était d’améliorer le système R-IVET

développé chez S. thermophilus LMD-9 par la création d’un nouveau crible de sélection

positif. Puis, dans un second temps, une banque R-IVET a été construite à partir du nouveau

crible, plus représentative du génome de la souche LMD-9. Enfin, cette nouvelle banque a été

utilisée pour identifier des gènes spécifiquement activés (i) en conditions digestives humaines

simulées sur l’ensemble du système TIM et (ii) en présence de microbiote intestinal en

système batch statique.

► Construction et validation du nouveau crible R-IVET à sélection positive

L’outil R-IVET mis au point précédemment a été amélioré par la construction d’une

nouvelle cassette chromosomique permettant une sélection positive des clones R-IVET, selon

le même principe que celui qui avait été développé chez Enterococcus (E.) faecalis (Hanin et

al., 2010). Cette cassette est constituée de deux gènes rapporteurs: le gène de résistance à la

spectinomycine (specR) et le gène de résistance à la kanamycine (kanR) (Figure 31). Le gène

specR est flanqué de sites loxP spécifiquement reconnus par la recombinase Cre dont le gène

est présent sur le plasmide R-IVET, pULNcreB. Le gène kanR est démuni de son promoteur

qui est cloné en amont du gène specR, empêchant ainsi son expression lorsque le gène specR

est présent. Le terminateur du gène specR n’étant pas assez fort pour empêcher la

transcription du gène kanR, un second terminateur a été cloné à la suite du gène specR, le

terminateur de l’opéron lactose Tlas de L. lactis. Lorsque le gène specR est présent le

phénotype de la souche est donc spectinomycine résistant et kanamycine sensible

(SpecRKan

S). A l’inverse lorsque le gène specR est délété (activité promotrice au niveau de

l’insert cloné dans le plasmide pULNcreB), la souche est spectinomycine sensible et

kanamycine résistant (SpecSKan

R) (Figure 31).


186

Figure 31: Principe de fonctionnement de l’outil R-IVET à sélection positive L’outil R-IVET est constitué de deux éléments. Le premier est la cassette chromosomique constituée

du gène de résistance à la spectinomycine (specR) flanqué de deux sites loxP suivi du gène de

résistance à la kanamycine (kanR). Le second est le plasmide pULNcreB qui possède la recombinase

Cre qui reconnait les sites loxP de la cassette. Lorsqu’il n’y a pas d’activité promotrice dans le

fragment cloné en amont du gène cre, le gène specR s’exprime et sa présence empêche l’expression du

gène kanR, le clone est spectinomycine résistant et kanamycine sensible. Lorsqu’un fragment ayant

une activité promotrice est cloné en amont du gène cre, la production de la recombinase Cre entraine

l’excision du gène specR, le gène kanR peut s’exprimer. Le clone devient alors sensible à la

spectinomycine et résistant à la kanamycine.

Ces phénotypes ont été validés grâce à l’utilisation de deux souches: (i) la souche

possédant la cassette chromosomique non délétée (STUL5003) et (ii) la souche possédant la

cassette délétée (STUL5003-plac). Pour chaque condition, 60 colonies, prises au hasard, ont

été repiquées sur des milieux de sélection contenant soit de la spectinomycine soit de la

kanamycine. Les phénotypes observés correspondent à ceux attendus: croissance de 100 %

des colonies de la souche STUL5003 de phénotype SpecRKan

S sur les milieux contenant de la

spectinomycine et aucune croissance sur le milieu supplémenté en kanamycine et à l’inverse

croissance de 100 % des colonies de la souche STUL5003-plac de phénotype SpecSKan

R sur

les milieux contenant de la kanamycine et aucune croissance sur le milieu supplémenté en

spectinomycine. De plus, un des milieux testés contenait un mélange de kanamycine et

d’érythromycine, la croissance sur ce milieu des colonies de la souche STUL5003-plac

t 0891 0893

0892

kanRspecRprom

loxP loxP

Tlas

0890

Excisable fragment

R-IVET cassette

Pas d’activité

promotrice

Activité

promotrice

CreCre

loxP

specR

ori

pULNcreB

Gène de résistance à

l’érythromycine

(eryR)

Gène de recombinase (cre)

démuni de son promoteur

Insert ADN

(promoteur ?)

Gène de

réplication

kanRspecRprom

loxP loxP

Tlas

kanRspecRprom

loxP loxP

Tlas

kanRprom

loxP


187

indique qu’il est possible de sélectionner directement les clones ayant une cassette

chromosomique délétée, suite à une expression de la recombinase Cre, tout en s’assurant que

le plasmide persiste dans le clone. Une fois le phénotype confirmé pour les deux souches, la

séquence de la cassette a été déterminée et a permis de vérifier que la structure était bien celle

attendue. Deux mutations ont été identifiées: une cytosine remplacée par une guanine au

niveau de la région prom et une délétion d’une cytosine au niveau du terminateur du gène

specR. Au vue, des résultats des phénotypes, il s’avère que ces deux mutations n’ont aucun

impact sur la fonctionnalité de notre système.

► Construction d’une nouvelle banque R-IVET chez S. thermophilus

La première banque construite chez S. thermophilus STUL5001 (publication 1) n’était

représentative du génome de la souche LMD-9 dans la mesure où selon la formule de Clarke

et Carbon, la probabilité que chaque gène soit représenté au moins une fois n’était que de

0,85. Aussi, après avoir amélioré notre outil R-IVET par le développement d’un système de

sélection positive, la seconde étape a été de construire une banque plus représentative du

génome de S. thermophilus LMD-9.

L’ADN génomique de la souche LMD-9 a été partiellement digéré par l’enzyme de

restriction AluI. Les fragments obtenus ont été clonés en amont du gène de la recombinase

Cre présent sur le plasmide pULNcreB au niveau de site de restriction SmaI. Puis, les

plasmides obtenus ont été utilisés pour transformer E. coli TOP10 qui sert d’intermédiaire de

clonage (72 000 transformants obtenus). Une analyse par PCR de ces transformants a montré

que la banque réalisée chez E. coli serait très représentative du génome de LMD-9

(> 99,99 %, si on considère que la taille moyenne d’insert est de 500 pb, selon la formule de

Clarke et Carbon, 1976). Les plasmides ont donc été extraits de la banque E. coli et introduits

chez S. thermophilus STUL5003 par transformation naturelle. Une banque contenant environ

144 600 clones a été ainsi obtenue. Une analyse PCR, effectuée sur 56 clones pris au hasard, a

montré que seuls 37,5 % des clones analysés possédaient un insert ce qui représente environ

43 000 clones recombinants. Cette estimation a permis d’évaluer le pourcentage de

recouvrement du génome à une valeur supérieur à 99,99 % (taille moyenne d’insert utilisé

pour le calcul 500 pb, Clarke et Carbon, 1976). Les inserts de ces 21 clones ont été séquencés

et l’analyse par BLASTn a révélé que ces fragments provenaient de régions différentes du


188

génome de la souche LMD-9 montrant ainsi qu’aucune région du génome n’était sur-

représentée ou sous-représentée dans la banque R-IVET.

► Survie de la banque R-IVET dans l’environnement digestif humain simulé

Avant d’identifier des gènes activés dans l’environnement digestif, le taux de survie de

la banque a été évalué sur l’ensemble du système TIM et dans les cultures batch. Dans le

système TIM, la survie de la banque R-IVET a été évaluée comparativement à un marqueur

de transit non-absorbable qui représente la survie d’un microorganisme si celui-ci n’est

soumis qu’au dynamisme du système. Ainsi, nous avons pu déterminer que la survie de la

banque R-IVET était affectée dans l’estomac du TIM à partir de 90 min lorsque le pH atteint

des valeurs de 1,8, dans le duodénum à partir de 120 min, dans le jéjunum à partir de 60 min

et dans l’iléum à partir de 120 min. En fin de digestion, 8,19 log10 UFC sont retrouvés dans les

effluents iléaux du modèle TIM et peuvent atteindre le colon (sur un inoculum initial de 10,85

log10 UFC). De plus, la comparaison de ces résultats avec ceux obtenus pour la souche LMD-

9 en lait fermenté lors de l’étude précédente (publication 2) montre que la survie de la banque

R-IVET est plus faible que celle de la souche sauvage. En effet, une différence statistique a pu

être observée dans l’estomac à 120 min (P < 0,001), dans le duodénum à 120 min (P < 0,001),

dans le jéjunum à 180 min (P < 0,001) et dans les sorties iléales dès la première heure (P <

0,0001). Deux hypothèses peuvent expliquer de tels résultats: (i) l’interruption du gène

STER_0891 par la cassette R-IVET à un impact sur les capacités de survie de S. thermophilus

lors de son passage dans le TGI et (ii) lors de la construction de la souche STUL5003, des

mutations dans le génome on été engendrées entrainant une plus faible tolérance aux stress du

TGI.

Dans les systèmes batch inoculés avec le microbiote intestinal, nous avons pu montrer

une survie presque identique de la banque R-IVET entre les deux donneurs. Seule, une

différence de survie d’environ 1 log10 UFC (P < 0,0001) a pu être observée à 24 h (5,85 ±

0,09 log10 UFC pour le volontaire 1 et 4,77 ± 0,04 log10 UFC). Ces résultats concordent avec

ceux obtenus lors des expérimentations animales effectuées chez la souris, le lapin ou chez le

cochon nain. Lors de ces expériences, S. thermophilus disparaissait quelques heures (8 à 96 h)

après l’arrêt de sa consommation (Dilmi-Bouras et Sadoun, 2002; Iyer et al., 2010; Lick et al.,

2001; Mater et al., 2006). Les études de survie effectuées chez l’homme montrent également

que S. thermophilus disparait entre 6 jours et 4 semaines après arrêt de l’ingestion (Brigidi et


189

al., 2003; García-Hernández et al., 2012; Venturi et al., 1999). La différence entre les études

in vivo et nos résultats s’explique certainement par le fait que nous avons utilisé des cultures

batch où il n’y pas d’apport de nutriments supplémentaires au cours de l’expérience. Cela peut

exacerber la compétition entre la flore résidente, le microbiote, et la flore en transit,

S. thermophilus. De plus, le milieu nutritif ne contient pas de sources carbonées directement

utilisables par S. thermophilus. Le lactose apporté par la culture en lait peut également être

métabolisé par les bactéries du microbiote intestinal, le rendant ainsi moins disponible pour

S. thermophilus. Or, des études chez l’animal ont préalablement montré que la survie de

S. thermophilus dans le tractus intestinal pourrait être améliorée par la présence de lactose

(Ben-Yahia et al., 2012; Rul et al., 2011; Thomas et al., 2011).

► Etude du métabolisme de S. thermophilus dans l’environnement digestif humain

simulé

En parallèle de l’étude de survie, des gènes spécifiquement activés dans

l’environnement digestif in vitro ont été recherchés. Afin d’identifier ces gènes, les clones

SpecSKan

R ont été sélectionnés sur un milieu contenant de la kanamycine et de

l’érythromycine. Après avoir vérifié par PCR la délétion du gène specR au sein de la cassette

chromosomique, l’insert cloné en amont du gène cre a été amplifié et séquencé. Les gènes

correspondant aux promoteurs activés dans l’environnement digestif ont été identifiés en

utilisant le programme BLASTn. Des gènes activés ont pu être identifiés dans le

compartiment gastrique du TIM ainsi que dans les systèmes batch inoculés avec le microbiote

intestinal. Cependant, dans les trois parties de l’intestin grêle du TIM, aucun gène actif n’a pu

être identifié. Ceci pouvant s’expliquer par le fait que les taux de survie diminuent dans

l’intestin grêle en présence de bile. En effet, le nombre de clones R-IVET activés identifiés,

étant déjà faible, diminue lorsque les taux de survie dans les compartiments de l’intestin grêle

diminuent. Les gènes identifiés dans l’estomac du TIM ont différentes fonctions: transport et

métabolisme des nutriments, regulation transcriptionnelle, réponse au stress, synthèse

protéique ainsi que d’autres fonctions variées. Des gènes codant des protéines hypothétiques

ont également été détectés. Les deux gènes impliqués dans la réponse aux stress (STER_0303

et STER_0072) ainsi que les deux régulateurs (STER_0901 et STER_1693) qui seraient

induit suite à un stress ou en réponse un changement environnemental, peuvent traduire une

adaptation de la cellule aux stress acides rencontrées dans l’estomac. Dans les systèmes batch,


190

les gènes identifiés ont pour fonctions le transport et le métabolisme de nutriments, la

synthèse protéique, la réponse au stress et les mécanismes de défense (perméases impliquées

dans le transport de peptides antimicrobiens). Comme précédemment, des gènes codant des

protéines hypothétiques ont été identifiés. Deux gènes en particuliers se démarquent, les gènes

STER_0572 et STER_1347, ce sont deux perméases qui pourraient être impliquées dans le

transport de peptides antimicrobiens. Ce qui peut traduire une réponse à la présence des

microorganismes du microbiote intestinal. De plus, des séquences anti-sens et intra-géniques

ont été identifiées et l’analyse bioinformatique montre qu’ils contiendraient une séquence

promotrice. De telles séquences ont pu être identifiées dans l’étude de Hanin et al. (2010),

portant sur l’identification des gènes activés chez E. faecalis par l’utilisation de la technologie

R-IVET dans un modèle in vitro (urine) et in vivo chez la souris dans un modèle de péritonite.

Les auteurs suggèrent que ces régions pourraient correspondre à des ARN antisens ou à de

petites ORF. En effet, en analysant les 6 phases de lecture de l’ADN de petites ORF ont pu

être identifiées (Ibrahim et al., 2007b, 2007a), malheureusement aucune fonction n’a pu leur

être attribuée.


Lors de cette étude, un nouveau crible a été construit ainsi qu’une nouvelle banque

plus représentative du génome de la souche LMD-9. Cette banque nous a permis de mettre en

évidence des gènes spécifiquement induits dans l’environnement digestif humain simulé. Ces

gènes ont des fonctions diverses telles que le transport et le métabolisme de nutriments, la

synthèse protéique ou la réponse au stress. Une différence a pu être observée entre le système

TIM et les cultures en système batch. En effet, dans l’estomac du TIM, les gènes identifiés

traduisent une adaptation au stress (acide) rencontré dans l’estomac. Alors que dans les

cultures batch, en plus d’une adaptation à l’environnement, des gènes qui seraient impliqués

dans les mécanismes de défenses contre les microorganismes du microbiote intestinal. Des

études ont montré qu’en réponse à l’acidité (pH 5), S. thermophilus impliquerait la

surexpression de plusieurs protéines telles que la protéine de stress au choc acide Hsp ou Asp

(Acidic shock protein), la protéine de résistance contre les peroxydes Dpr, les protéines de

stress générale 24, GroEL et GroES, ou encore l’uréase (Arena et al., 2006; Zotta et al.,

2008a). Ces protéines ne sont pas identifiées avec l’analyse R-IVET. En effet ces protéines

sont exprimées lors d’un stress acide modéré (pH 5) comme celui présent dans le lait fermenté


191

et donc les promoteurs correspondants sont éliminés par l’étape de contre-sélection effectuée

avant l’administration de la banque R-IVET dans le système TIM ou dans les cultures batch.

La protéine GroEL, l’enzyme superoxide dismutase (sodA), impliquée dans la réponse au

stress, ainsi que d’autres gènes (notamment ceux impliqués dans le métabolisme carboné), ont

également été identifiés comme étant surexprimé par S. thermophilus suite à son passage dans

le TGI de rat (Rul et al., 2011). Cependant, la comparaison doit être effectuée avec

précaution, car il a été montré que S. thermophilus est capable de coloniser le tractus digestif

de rat germ-free (Ben-Yahia et al., 2012; Rul et al., 2011; Thomas et al., 2011) alors que ce

n’est pas le cas chez l’homme (Brigidi et al., 2003; García-Hernández et al., 2012; Venturi et

al., 1999) ou encore chez d’autres modèles animaux (souris, lapins ou cochons nains) (Dilmi-

Bouras and Sadoun, 2002; Drouault et al., 2002; Iyer et al., 2010a; Lick et al., 2001).

Des données ont pu être également apportées sur la survie et le comportement de

S. thermophilus en présence du microbiote intestinal.

L’analyse effectuée devra être complétée notamment au travers de la confirmation de

l’expression des gènes dans l’environnement digestif. De plus, le modèle utilisé est un

système de culture en batch d’échantillons fécaux très simple, aucun apport nutritif n’est

apporté, aucune régulation du pH n’est réalisée et aucune élimination des métabolites produits

n’est effectuée entrainant leur accumulation dans le milieu. Il serait donc intéressant d’évaluer

la survie et le comportement de S. thermophilus dans un système reproduisant plus fidèlement

l’environnement colique humain, comme des systèmes in vitro basés sur le principe de la

fermentation en continu, tels que le système ARCOL de l’EA CIDAM. Comme cité

précédemment dans le commentaire de la publication 2, il serait également intéressant

d’évaluer la survie mais également le comportement de S. thermophilus en présence de

matrice plus complexe que le lait fermenté comme le yaourt ou un repas complet. Il serait

également intéressant d’associer à notre analyse spécifique (R-IVET), une analyse de la

réponse globale de S. thermophilus grâce à une technique comme celles décrites dans le

chapitre 3 de la synthèse bibliographique, ou une analyse du transcriptome par séquençage à

haut débit (RNA sequencing) ou encore une analyse du protéome dans les mêmes conditions.

193

Troisième partie ‒Conclusions et perspectives‒

Troisième PARTIE

— Conclusions et perspectives —

Conclusions et perspectives

195


Les travaux de recherche réalisés dans le cadre de ce doctorat sont le fruit d’une

collaboration entre le laboratoire EA CIDAM de l’Université d’Auvergne et l’équipe PB2P de

l’Université de Lorraine. Les objectifs de cette thèse ont été:

- d’évaluer la capacité de survie de plusieurs souches de S. thermophilus en

conditions digestives humaines simulées dans le modèle gastro-intestinal TIM

ainsi que l’influence du mode d’administration des souches.

- de développer l’outil R-IVET chez S. thermophilus LMD-9 puis de l’optimiser par

la construction d’un système de sélection positive.

- d’utiliser cet outil afin d’identifier des gènes bactériens spécifiquement exprimés

dans un environnement complexe comme le tractus digestif humain par

l’utilisation du système TIM reproduisant l’estomac et l’intestin grêle et des

systèmes de culture batch simples intégrant le microbiote intestinal humain.

► Etude de la survie de S. thermophilus dans l’environnement digestif

La survie dans l’environnement digestif humain est un des critères importants pour

qu’un microorganisme puisse bénéficier du statut de probiotique. Dans la littérature, il a été

montré que S. thermophilus pouvait survivre au passage du tractus digestif humain, puisqu’il

était retrouvé vivant dans les selles de volontaires sains (Elli et al., 2006; García-Hernández et

al., 2012; Mater et al., 2005; Pochart et al., 1989; Venturi et al., 1999). Cependant, ces

données ont été essentiellement obtenues dans les selles de volontaires lorsque

S. thermophilus était ingéré sous la forme de yaourt. Il n’y a donc que peu de données sur le

comportement de S. thermophilus tout au long du tractus digestif humain, lorsque celui-ci est


196

ingéré seul. Or cela est important pour étudier les effets positifs que peut avoir une flore en

transit telle que S. thermophilus sur la santé de l’hôte.

Dans ce contexte, le premier objectif de ce travail de thèse a été d’évaluer la survie de

S. thermophilus dans l’environnement digestif humain simulé grâce à l’utilisation du système

de digestion in vitro, le système TIM. Ce modèle reproduit le plus fidèlement possible les

conditions physico-chimiques rencontrées dans la lumière de l’estomac et des trois parties de

l’intestin grêle chez l’homme.

Dans ce travail, la survie de quatre souches de S. thermophilus a été évaluée dans le

système TIM. Ces quatre souches ont été sélectionnées à partir de la collection de 30 souches

de S. thermophilus de l’équipe PB2B. Ces souches ont été criblées pour la fonction uréase, la

fonction décarboxylase des acides aminés et pour la production de la protéine de stress au

choc thermique Hsp (Heat shock protein) (Uriot et al., 2016), ainsi que pour leur résistance au

stress acide, au stress biliaire et au stress oxydant (Junjua et al., 2016). Trois des quatre

souches, LMD-9, PB18O et EBLST20, ont été choisies car elles possèdent la protéine Hsp et

l’activité uréase ainsi qu’une bonne résistance aux stress acide et biliaire (profils différents de

résistance pour chacune des trois souches). La quatrième souche, CNRZ21, a été choisie car

particulièrement sensible lors des tests de pré-screening: elle ne présente ni activité uréase, ni

protéine Hsp et appartient aux souches les plus sensibles aux stress acide et biliaire.

L’évaluation de la survie des 4 souches de S. thermophilus dans le modèle gastro-intestinal

TIM en présence de lait (fraîchement inoculé) a permis de mettre en évidence que celle-ci est

affectée dans l’estomac lorsque le pH atteint des valeurs inférieures ou égales à 2 et en

présence des sécrétions intestinales dans les trois compartiments de l’intestin grêle. Il a aussi

été montré que la survie de S. thermophilus dans l’environnement digestif humain était souche

dépendante, les souches LMD-9, EBLST20 et PB18O ayant été beaucoup plus résistantes aux

stress gastro-intestinaux que la souche CNRZ21. En effet, par rapport aux trois souches plus

résistantes, la souche CNRZ21 montre globalement une survie inférieure de plusieurs log10

UFC. De plus, elle disparait rapidement dans le duodénum (240 min), le jéjunum (240 min) et

l’iléum (180 min). La différence de survie entre les différentes souches pourrait résulter de la

grande diversité de stratégies utilisées par S. thermophilus pour résister aux stress dus, entre

autres, aux pH acides et aux sels biliaires (Arena et al., 2006; Zotta et al., 2008a). D’autres

études, réalisées avec des tests in vitro beaucoup plus simples, avaient déjà suggéré que la

survie chez S. thermophilus était souche dépendante (Junjua et al., 2016; Vinderola et

Reinheimer, 2003; Ziarno, 2010). Il est intéressant de confirmer ces hypothèses dans le


197

système TIM, qui simule de façon plus fidèle que ces tests in vitro très simples les réactions

physico-chimiques se déroulant dans le système gastro-intestinal humain.

Les résultats de survie dans le TIM montrent que sur un inoculum de 1010-11

UFC entre

106 et 10

8 UFC de cellules viables sont susceptibles d’arriver au colon. Ces résultats sont en

accord avec des données de la littérature suggérant que la concentration minimale de

probiotiques vivants nécessaire pour avoir un effet santé serait de 106 UFC/mL dans l’intestin

grêle et de 108 UFC/mL dans le colon (Minelli et Benini, 2008). Pour apporter des éléments

supplémentaires de comparaison, la survie d’autres souches pourrait être évaluée in vitro,

notamment celle de souches ayant un potentiel effet santé, telles que celles de PB5MJ ou

CNRZ160 dont le potentiel anti-inflammatoire a été montré in vitro (Junjua et al., 2016), celle

de CRL1190 qui semble jouer un rôle protecteur contre les gastrites chroniques chez la souris

(Rodríguez et al., 2009, 2010) ou encore celle de YIT2001 dont le fort potentiel antioxydant a

été démontré in vitro et in vivo chez la souris (Ito et al., 2003, 2008, 2015). De plus, il est

important de souligner que les données de survie obtenues dans ces travaux, comme dans la

plupart des études recensées dans la littérature sont le résultat de dénombrements sur boîtes de

Pétri, ce qui ne permet que de décompter des bactéries viables-cultivables mais ne donne

aucune information sur les bactéries viables-non-cultivables. Par exemple, lors de tests in

vitro simples de résistance aux stress gastro-intestinaux, García-Hernández et al. (2012) ont

détecté, en utilisant la technique DVC-FISH (direct viable count and fluorescent in situ

hybridization), une survie de S. thermophilus légèrement supérieure, à celle déterminée par

comptage des UFC sur boîtes de Pétri. Ainsi, nos données pourraient être confrontées à celles

obtenues grâce à l’utilisation de méthodes alternatives telles que la cytométrie de flux. Cette

technique permet le comptage rapide de cellules ainsi que la caractérisation de leur état

physiologique (e.g. perméabilité membranaire, potentiel de membrane, pH intracellulaire…),

pour mieux appréhender le comportement de S. thermophilus dans l’environnement digestif

humain in vitro. Des travaux du laboratoire récemment publiés ont montré l’intérêt de coupler

cytométrie de flux et modèle TIM pour mieux appréhender l’état physiologique de bactéries

pathogènes comme les EHEC (Roussel et al., 2016), une telle technique pouvant également

s’appliquer au suivi de bactéries probiotiques.

L’influence du mode d’administration sur la survie de S. thermophilus dans

l’environnement digestif in vitro a également été évaluée en comparant les résultats obtenus

pour la souche LMD-9 lorsque celle-ci est introduite dans le TIM en lait fraîchement inoculé

ou en lait fermenté par la souche elle-même. Il a été ainsi mis en évidence que la survie de la


198

souche LMD-9 était améliorée dans l’estomac (+ 2 log10 UFC) et dans les effluents iléaux (+

0,3 log10 UFC) lorsqu’elle était administrée en lait fermenté. Ce résultat pourrait s’expliquer

par le fait que S. thermophilus s’adapte aux conditions acides lorsqu’elle fermente le lait

(augmentation de l’acidité lors de la fermentation suite à la production d’acide lactique). En

effet, des études ont montré qu’en présence d’un stress acide modéré (pH 5), il y aurait

surexpression chez S. thermophilus de protéines impliquées dans la réponse au stress telles

que la protéine de stress au choc acide Hsp ou Asp (Heat or Acidic shock protein), la protéine

de résistance contre les peroxydes Dpr, les protéines de stress général 24, GroEL et GroES, ou

encore l’uréase (Arena et al., 2006; Zotta et al., 2008a). Le pH utilisé lors de ces études était

plus élevé que celui du lait fermenté (pH < 4,6), on peut donc supposer que ces protéines sont

surexprimées lors de la fermentation du lait par S. thermophilus, pouvant conduire à une

amélioration de sa tolérance aux stress plus acides rencontrés dans l’estomac in vitro. Cette

hypothèse pourrait être confirmée en mesurant l’expression de ces gènes dans les deux

conditions d’administration (lait ou lait fermenté). La différence de survie pourrait également

s’expliquer par le fait que la souche LMD-9 n’est pas introduite dans les deux conditions, lait

et lait fermenté, dans la même phase de croissance, respectivement en phase exponentielle et

en phase stationnaire. En effet, il a été montré que les cellules de S. thermophilus en phase

stationnaire étaient généralement plus résistantes que les cellules en phase exponentielle lors

de stress thermique, acide, oxydative ou osmotique (Zotta et al., 2008a). Ces auteurs montrent

également une différence dans les profils protéiques obtenus en phase stationnaire et

exponentielle, les protéines de stress telles que DnaK, GroEL, GroES ou encore Asp étant

surexprimées en phase stationnaire. Enfin, il serait intéressant d’étudier si la préadaptation en

lait d’une souche plus sensible telle que CNRZ21 augmenterait sa tolérance aux conditions

gastro-intestinales, comme c’est le cas pour la souche LMD-9.

Les résultats obtenus lors de ce travail semblent indiquer que la survie de

S. thermophilus LMD-9 est influencée par le mode d’administration. Cet effet peut être lié

aux différences de pH ou de stade de croissance entre lait et lait fermenté comme discuté ci-

dessus ou à un effet matrice lui-même (e.g. différence de viscosité). Il serait intéressant

d’utiliser le potentiel du système TIM afin de mieux comprendre l’influence du mode

d’administration sur la survie de S. thermophilus dans le TGI. En effet, il a été précédemment

montré dans le TIM que la survie de la levure probiotique Saccharomyces cerevisiae CNCM-

I3856 était influencée par la matrice alimentaire (repas complet versus verre d’eau)

(Blanquet-Diot et al., 2012). Le système TIM peut en effet être paramétré pour reproduire les


199

conditions de digestions observées chez l’homme à jeun (verre d’eau) ou en situation

postprandiale, suite à l’ingestion de différents aliments (lait, yaourt, repas complet…). Dans

chacune de ces conditions, les valeurs de pH, les temps de transit et de vidanges gastriques et

iléales, les concentrations en enzymes et en bile ne sont pas les mêmes et sont adaptées en

fonction de données in vivo (Arroyo-López et al., 2014; Blanquet-Diot et al., 2012; Khalf et

al., 2010; Uriot et al., 2016; Villemejane et al., 2016). On pourrait donc évaluer la survie de

S. thermophilus en présence de différentes matrices alimentaires afin de définir les conditions

d’ingestion maximisant sa survie. De plus, la flexibilité du modèle TIM permet d’évaluer si la

survie du probiotique est influencée par la matrice en elle-même (e.g, présence de certains

ingrédients protecteurs comme les lipides, Leyral et Vierling, 2007) ou par les conditions de

digestion qui y sont associées (temps de transit, concentrations en enzymes,…).

Nous avons vu que l’administration en lait fermenté augmentait la survie de la souche

LMD-9, cependant d’autres moyens peuvent-être envisagés pour améliorer la survie de

S. thermophilus lors de son passage dans le TGI, comme la micro-encapsulation. En effet,

l’encapsulation de B. longum avec un composé végétal (Vegetal BM 297 ATO) a montré un

effet protecteur de la bactérie contre les stress gastro-intestinaux (près de 6 log10 de différence

entre les cellules encapsulées et les cellules non-encapsulées) (Amakiri et Thantsha, 2016).

Un effet similaire a pu être observé chez Bacillus coagulans, Lb. rhamnosus et B. animalis

(Anselmo et al., 2016; D’Orazio et al., 2015). L’encapsulation pourrait donc être une méthode

prometteuse pour augmenter la survie de S. thermophilus lors de son passage dans le TGI. Là

encore, le système TIM apparait être un modèle approprié pour des études comparatives

portant sur l’évaluation de la survie de S. thermophilus dans le contexte de micro-

encapsulation ou d’autres formes galéniques (Blanquet-Diot et al., 2012).

Enfin, en utilisant le lait fermenté comme mode d’administration, la survie de la

banque R-IVET (à sélection positive) a été évaluée en présence de microbiote intestinal dans

des systèmes batch simples. Il a ainsi été montré que la survie de la banque restait inchangée

pendant les 4 premières heures après inoculation mais que, après 24 h, la viabilité cellulaire

diminuait significativement. Ceci correspond aux résultats des études in vivo réalisées chez

l’animal (Dilmi-Bouras et Sadoun, 2002; Iyer et al., 2010; Lick et al., 2001; Mater et al.,

2006) et chez l’homme (Brigidi et al., 2003; García-Hernández et al., 2012; Venturi et al.,

1999) qui montrent que S. thermophilus ne colonise pas, ou de manière très transitoire, le

tractus digestif. Néanmoins, chez l’homme, il a été montré que dans certain cas

S. thermophilus peut persister jusqu’à quatre semaines après arrêt de la consommation de


200

yaourt (García-Hernández et al., 2012). Il est à noter qu’en raison des différents modes

opératoires mis en œuvre, des différentes souches étudiées, ainsi que des différentes méthodes

d’analyses employées, il reste difficile de réellement comparer les résultats de ces différentes

études. Les systèmes batch utilisés dans ce travail de thèse sont des systèmes clos où il n’y a

pas d’apport nutritif, accentuant ainsi l’effet de compétition des microorganismes pour les

nutriments du milieu, ce qui pourrait expliquer la disparition plus rapide de S. thermophilus

observée dans notre étude comparativement aux études in vivo chez l’homme.

Le système batch utilisé dans cette étude est un modèle extrêmement simple de

simulation du côlon, en particulier il n’y a pas de régulation du pH et les métabolites produits

par le microbiote s’accumulent dans le milieu fermentaire. Cependant, cette étude reste

informative car elle constitue une première approche de l’étude du comportement de

S. thermophilus en présence de microbiote intestinal humain. En effet, à ce jour, il n’existe

pas à notre connaissance de données sur l’interaction entre S. thermophilus et le microbiote

intestinal humain. Dans notre étude, nous n’avons pas étudié l’impact de S. thermophilus sur

le microbiote intestinal étant donné que le modèle de simulation utilisé était très simple. A cet

effet, il serait plus judicieux d’utiliser des modèles de simulation de l’environnement colique

plus réalistes tels que l’ARCOL, un système de fermentation de type semi-continu développé

par l’EA CIDAM, le système SHIME, développé par l’Université de Gand et simulant le TGI

de l’estomac au colon, le modèle colique à cellules immobilisées développé par l’ETH Zurich

ou le TIM-2 développé par le TNO (Cinquin et al., 2004; Cordonnier et al., 2015;

Mäkivuokko et al., 2005; Minekus et al., 1999; Molly et al., 1993; Venema et van den

Abbeele, 2013). Ainsi, la survie de différentes souches de S. thermophilus, comme celles déjà

étudiées dans le TIM, pourrait être évaluée dans l’un de ces modèles, permettant ainsi

d’obtenir des données sur les capacités de survie de S. thermophilus sur l’ensemble du TGI.

Lors de notre étude, effectuée à partir du microbiote fécal de deux volontaires différents

(homme âgé de 32 ans et femme âgée de 18 ans), nous avons pu observer une différence de

survie de S. thermophilus après 24 h (différence de 1 log10 UFC entre les deux volontaires).

Cette différence peut s’expliquer par le fait que le microbiote intestinal est propre à un

individu (Qin et al., 2010; Rambaud et al., 2004). Ces résultats sont bien sûr à confirmer avec

un nombre plus importants de volontaires.


201

► Etude du comportement de S. thermophilus dans l’environnement digestif

Lors de ce travail, la technologie R-IVET a été mise en place chez S. thermophilus. La

première construction possède un crible de sélection négatif (Junjua et al., 2014). Il permet

d’identifier les gènes activés par la perte d’un gène rapporteur, ici le gène de résistance à la

spectinomycine. En utilisant la souche mutante porteuse de la cassette chromosomique, une

première banque d’ADN génomique a été construite. Celle-ci a servi à rechercher des gènes

activés en conditions gastriques simulées (TIM). Le gène hisS (STER_1905) a ainsi pu être

identifié comme étant actif dans l’estomac du système TIM (Uriot et al., 2016). Néanmoins,

le crible à sélection négative ne permet l’identification des gènes que par une double étape de

sélection des clones d’intérêt, imposant une limite au nombre d’échantillons et de clones

pouvant être analysés.

Un nouveau crible a donc été mis au point chez S. thermophilus basé sur le principe de

la construction du crible développé chez E. faecalis (Hanin et al., 2010). Celui-ci permet

d’identifier les gènes activés par l’excision d’un gène rapporteur, ici le gène de résistance à la

spectinomycine, permettant ainsi l’expression d’un second gène rapporteur, ici le gène de

résistance à la kanamycine. Une seconde banque R-IVET a ensuite été construite, plus

représentative du génome de la souche LMD-9 que la première banque. Celle-ci permet

d’identifier les clones d’intérêt directement. Cette nouvelle banque a permis de rechercher des

gènes spécifiquement activés dans l’estomac et l’intestin grêle du TIM à différents temps,

ainsi qu’en systèmes batch simples inoculés avec un échantillon fécal humain. Dans l’estomac

du TIM, les gènes identifiés semble indiquer une adaptation aux stress gastriques notamment

par l’identification de régulateurs transcriptionnels (STER_0901 et STER_1693) qui seraient

induits en réponse à des stress (Maddocks et Oyston, 2008). Aucun gène activé n’a été

identifié dans les différents compartiments intestinaux du TIM. Ceci peut s’expliquer par la

perte de viabilité cellulaire dans l’intestin grêle in vitro. En effet, dans les trois compartiments

intestinaux du système TIM, lorsque la viabilité diminue on observe une diminution du

nombre de clones SpecRKan

R récupérés. Pour pouvoir analyser l’insert d’un clone dont la

cassette a été délétée, celui-ci doit survivre au stress gastro-intestinal mais il doit avant tout

être viable-cultivable, puisque les clones d’intérêt sont sélectionnés sur milieu gélosé. Il est

donc possible de supposer qu’une partie des clones R-IVET n’a pu être analysée car viables

mais non-cultivables. Au niveau des cultures batch, les gènes induits identifiés codent des

perméases impliquées dans le transport de peptides antimicrobiens (STER_0572 et

STER_1347) ainsi qu’un gène STER_0972 codant CRISPR-associated endoribonuclease


202

Cas6, impliqué dans la protection de la cellule contre l’ADN étranger (Hochstrasser et

Doudna, 2015), semblant suggérer une adaptation du métabolisme de S. thermophilus en

présence de microbiote intestinal.

La perspective immédiate de ce travail consiste en la confirmation des gènes identifiés

dans le système TIM et dans les cultures batch du microbiote intestinal par second passage de

ces gènes dans ces systèmes après avoir réintroduit le plasmide pULNcreB dans une cellule

qui possède encore la cassette R-IVET. Les résultats obtenus au cours de ce travail viennent

conforter de précédentes études in vitro ayant mis en évidence que lors de stress acide

modéré, S. thermophilus produirait des protéines contre le stress, comme celles identifiées

dans le compartiment gastrique du TIM (Arena et al., 2006; Zotta et al., 2008a). D’autres

travaux, réalisés chez le rat germ-free (fèces), ont montré par des approches de type

protéomique que S. thermophilus favoriserait la voie de la glycolyse lors de son passage dans

le TGI (Rul et al., 2011; Thomas et al., 2011). Cependant, il faut tenir compte du fait que chez

le rat germ-free, S. thermophilus colonise le TGI contrairement à l’homme où S. thermophilus

ne colonise pas ou que très brièvement l’environnement digestif (Brigidi et al., 2003; García-

Hernández et al., 2012). Vu les premiers résultats intéressants obtenus au cours de ce travail

de thèse dans des systèmes de cultures batch très simples, il serait également intéressant

d’étudier le comportement de S. thermophilus dans l’environnement colique à l’aide de

modèles in vitro plus complexes comme l’ARCOL ou le SHIME ou des modèles animaux à

flore humaine, combinés avec la technologie R-IVET ou d’autres méthodes d’analyse globale

du transcriptome et du protéome.

Le système R-IVET est une technique qui permet l’identification des gènes activés

dans des conditions spécifiques, comme celles rencontrées dans l’environnement digestif,

ainsi que des gènes induits faiblement ou transitoirement par le marquage définitif au niveau

de la cellule. Un des principaux avantages de la technologie R-IVET est qu’elle ne nécessite

aucune extraction préalable d’ARN ou de protéines. Grâce au système R-IVET, on peut

également envisager prochainement d’évaluer le comportement de S. thermophilus dans le

TIM en fonction de différentes matrices alimentaires, car si celles-ci influencent la survie de

la bactérie, elles doivent aussi probablement avoir un effet sur son état métabolique.

Cependant, la technique R-IVET ne permet pas d’avoir une vision globale du comportement

de S. thermophilus, ni d’obtenir un niveau d’expression des gènes identifiées. Pour obtenir ces

informations, l’outil R-IVET doit-être associé à une technique qui permet d’étudier la réponse

globale de S. thermophilus comme les puces à ADN, une technique d’analyse du


203

transcriptome par séquençage à haut débit comme le RNA sequencing ou encore une analyse

du protéome (Alcántara et Zúñiga, 2012; Atak et al., 2016; Cao et al., 2011; Gupta et al.,

2016). Néanmoins, ces études nécessitent une extraction d’ARNs ou de protéines en qualité et

quantité suffisante pour permettre l’analyse, ce qui nécessite une mise au point importante

dans le contexte d’un environnement digestif.

Pour savoir si les gènes identifiés par la technologie R-IVET sont indispensables à la

survie ou favorisent l’adaptation ou la tolérance de S. thermophilus aux stress rencontrés dans

le TGI humain, ces gènes pourraient être invalidés par mutation et la survie des mutants

obtenus comparée à celle de la souche sauvage. Ces gènes pourraient également être

recherchés chez des souches montrant des profils de résistance aux stress gastro-intestinaux

différents. Ainsi, il serait alors possible de mettre en évidence des marqueurs de survie

pertinents permettant la sélection de souches résistantes au passage dans le TGI et

potentiellement intéressantes pour de futures applications à visée probiotique. En effet,

certains effets santé déjà attribués à S. thermophilus nécessitent que la bactérie soit vivante,

tels que la production active de β-galactosidase (Mater et al., 2006) ou encore l’inhibition de

la peroxydation des lipides, qui augmente avec le nombre de cellules YIT2001 vivantes (Ito et

al., 2003). De plus, il a également été montré qu’un mélange de S. thermophilus ATCC19258

et Lb. acidophilus ATCC4356 vivantes limiterait l’adhésion et l’invasion des EIEC sur des

cellules intestinales humaines, alors qu’aucun effet n’a été observé avec des cellules

bactériennes inactivées par traitement thermique (Resta-Lenert et Barrett, 2003).

Par ailleurs, la capacité de l’outil R-IVET à identifier des promoteurs spécifiquement

activés dans chaque compartiment du système digestif laisse envisager la possibilité de

produire des protéines d’intérêt de manière ciblée dans le TGI par S. thermophilus. Par

exemple, la souche CRL1190 produit des EPS qui permettraient de prévenir les gastrites

chroniques chez les souris (Rodríguez et al., 2009). En associant les gènes codant ces EPS

avec un promoteur spécifiquement actif dans l’estomac, la production de ces EPS pourrait

alors être induite en conditions gastriques. Si d’autres gènes associés à des effets santé sont

identifiées, il serait alors possible d’induire ces gènes dans les compartiments du TGI où leur

action serait la plus bénéfique pour la santé de l’hôte.

Les informations recueillies au cours de ce travail de thèse permettent d’apporter de

plus amples connaissances sur le comportement de S. thermophilus dans le TGI humain. Ces

données sont importantes pour pouvoir statuer dans le futur sur le potentiel probiotique de


204

S. thermophilus. En effet, pour obtenir une allégation santé, les panels de décision requièrent

des informations telles que les antécédents d'utilisation sans risque, les interactions entre la

bactérie et le microbiote intestinal ainsi qu’avec la barrière intestinale, des informations sur le

métabolisme (production de toxine, résistance/production de bactériocine/antibiotiques,…) et

des preuves sur les effets bénéfiques pour la santé doivent être apportées au travers d’essais

cliniques humains (Hill et al., 2014; Miquel et al., 2015). Chez S. thermophilus, la majorité

des études sur les effets santé a été réalisée à ce jour à partir de modèles animaux et de

modèles in vitro. Il est donc nécessaire d’approfondir les connaissances dans ce domaine.

Lors d’une étude préliminaire réalisée par l’équipe PB2P, les souches PB5MJ, CNRZ160

ainsi que CNRZ21 ont montré une forte activité anti-inflammatoire (Junjua et al., 2016). Il

serait donc intéressant de tester les propriétés anti-inflammatoires de ces trois souches dans un

modèle in vivo (murin par exemple) d’inflammation de l’intestin. De plus, il pourrait être

intéressant d’étudier l’effet de S. thermophilus sur des microorganismes pathogènes. En effet,

S. thermophilus a déjà montré des effets protecteurs contre C. difficile et contre les EIEC (en

association avec Lb. acidophilus) chez la souris et sur modèles cellulaires (HT-29 et Caco-2),

respectivement (Kolling et al., 2012; Resta-Lenert et Barrett, 2003). L’effet antagoniste de

S. thermophilus vis-à-vis de microorganismes pathogènes en conditions digestives humaines

pourrait être ainsi évalué dans les modèles in vitro de l’EA CIDAM, comme cela l’a déjà été

fait précédemment avec des souches de levures probiotiques (Etienne-Mesmin et al., 2011).

En effet, bien que ces modèles ne puissent reproduire les phénomènes complexes comme

l’absorption active de nutriments, la complexité du brassage du chyme in vivo et bien sur le

contrôle du système nerveux et hormonal, ils restent très adaptés pour étudier des effets

probiotiques dans un contexte de digestion gastro-intestinale humaine simulée, surtout en

présence de pathogènes.

205

— Références bibliographiques —

Références bibliographiques

207


Accolas, J.P., Hemme, D., Desmazeaud, M.J., Vassal, L., Bouillanne, C., Veaux, M., 1980.

Les levains lactiques thermophiles: propriétés et comportement en technologie laitière.

Une revue. Le lait 60, 487–524.

Ahn, J., Yang, L., Paster, B.J., Ganly, I., Morris, L., Pei, Z., Hayes, R.B., 2011. Oral

Microbiome Profiles: 16S rRNA Pyrosequencing and Microarray Assay Comparison.

PLoS ONE 6. doi:10.1371/journal.pone.0022788

Aktypis, A., Kalantzopoulos, G., 2003. Purification and characterization of thermophilin ST-

1, a novel bacteriocin produced by Streptococcus thermophilus ACA-DC 0001. Le

Lait 83, 365–378. doi:10.1051/lait:2003024

Aktypis, A., Kalantzopoulos, G., Huis in’t Veld, J.H., ten Brink, B., 1998. Purification and

characterization of thermophilin T, a novel bacteriocin produced by Streptococcus

thermophilus ACA-DC 0040. J. Appl. Microbiol. 84, 568–576.

Alcántara, C., Zúñiga, M., 2012. Proteomic and transcriptomic analysis of the response to bile

stress of Lactobacillus casei BL23. Microbiol. Read. Engl. 158, 1206–1218.

doi:10.1099/mic.0.055657-0

Almeida, A., Possemiers, S., Boone, M.N., De Beer, T., Quinten, T., Van Hoorebeke, L.,

Remon, J.P., Vervaet, C., 2011. Ethylene vinyl acetate as matrix for oral sustained

release dosage forms produced via hot-melt extrusion. Eur. J. Pharm. Biopharm. Off.

J. Arbeitsgemeinschaft Für Pharm. Verfahrenstechnik EV 77, 297–305.

doi:10.1016/j.ejpb.2010.12.004

Amakiri, A.C., Thantsha, M.S., 2016. Survival of Bifidobacterium longum LMG 13197

microencapsulated in Vegetal or Vegetal-inulin matrix in simulated gastrointestinal

fluids and yoghurt. SpringerPlus 5, 1343. doi:10.1186/s40064-016-3010-y

Amaretti, A., di Nunzio, M., Pompei, A., Raimondi, S., Rossi, M., Bordoni, A., 2013.

Antioxidant properties of potentially probiotic bacteria: in vitro and in vivo activities.

Appl. Microbiol. Biotechnol. 97, 809–817. doi:10.1007/s00253-012-4241-7

An, R., Grewal, P.S., 2012. Comparative study of differential gene expression in closely

related bacterial species by comparative hybridization. Methods Mol. Biol. Clifton NJ

815, 103–119. doi:10.1007/978-1-61779-424-7_9


208

Anselmo, A.C., McHugh, K.J., Webster, J., Langer, R., Jaklenec, A., 2016. Layer-by-Layer

Encapsulation of Probiotics for Delivery to the Microbiome. Adv. Mater. Deerfield

Beach Fla. doi:10.1002/adma.201603270

Antoni, L., Nuding, S., Wehkamp, J., Stange, E.F., 2014. Intestinal barrier in inflammatory

bowel disease. World J. Gastroenterol. 20, 1165–1179. doi:10.3748/wjg.v20.i5.1165

Arena, S., D’Ambrosio, C., Renzone, G., Rullo, R., Ledda, L., Vitale, F., Maglione, G.,

Varcamonti, M., Ferrara, L., Scaloni, A., 2006. A study of Streptococcus thermophilus

proteome by integrated analytical procedures and differential expression

investigations. Proteomics 6, 181–192. doi:10.1002/pmic.200402109

Arioli, S., Monnet, C., Guglielmetti, S., Parini, C., De Noni, I., Hogenboom, J., Halami, P.M.,

Mora, D., 2007. Aspartate biosynthesis is essential for the growth of Streptococcus

thermophilus in milk, and aspartate availability modulates the level of urease activity.

Appl. Environ. Microbiol. 73, 5789–5796. doi:10.1128/AEM.00533-07

Arioli, S., Ragg, E., Scaglioni, L., Fessas, D., Signorelli, M., Karp, M., Daffonchio, D., De

Noni, I., Mulas, L., Oggioni, M., Guglielmetti, S., Mora, D., 2010. Alkalizing

reactions streamline cellular metabolism in acidogenic microorganisms. PloS One 5,

e15520. doi:10.1371/journal.pone.0015520

Arroyo-López, F.N., Blanquet-Diot, S., Denis, S., Thévenot, J., Chalancon, S., Alric, M.,

Rodríguez-Gómez, F., Romero-Gil, V., Jiménez-Díaz, R., Garrido-Fernández, A.,

2014. Survival of pathogenic and lactobacilli species of fermented olives during

simulated human digestion. Front. Microbiol. 5, 540. doi:10.3389/fmicb.2014.00540

Atak, A., Mukherjee, S., Jain, R., Gupta, S., Singh, V.A., Gahoi, N., K P, M., Srivastava, S.,

2016. Protein microarray applications: Autoantibody detection and posttranslational

modification. Proteomics 16, 2557–2569. doi:10.1002/pmic.201600104

Bachmann, H., de Wilt, L., Kleerebezem, M., van Hylckama Vlieg, J.E.T., 2010. Time-

resolved genetic responses of Lactococcus lactis to a dairy environment. Environ.

Microbiol. 12, 1260–1270. doi:10.1111/j.1462-2920.2010.02168.x

Bachmann, H., Kleerebezem, M., van Hylckama Vlieg, J.E.T., 2008. High-throughput

identification and validation of in situ-expressed genes of Lactococcus lactis. Appl.

Environ. Microbiol. 74, 4727–4736. doi:10.1128/AEM.00297-08

Bai, Y., Sun, E., Shi, Y., Jiang, Y., Chen, Y., Liu, S., Zhao, L., Zhang, M., Guo, H., Zhang,

H., Mu, Z., Ren, F., 2016. Complete genome sequence of Streptococcus thermophilus

MN-BM-A01, a strain with high exopolysaccharides production. J. Biotechnol. 224,

45–46. doi:10.1016/j.jbiotec.2016.03.003

Ballesta, S., Velasco, C., Borobio, M.V., Argüelles, F., Perea, E.J., 2008. [Fresh versus

pasteurized yogurt: comparative study of the effects on microbiological and

immunological parameters, and gastrointestinal comfort]. Enfermedades Infecc.

Microbiol. Clínica 26, 552–557.

Barker, R., Abrahamsson, B., Kruusmägi, M., 2014. Application and validation of an

advanced gastrointestinal in vitro model for the evaluation of drug product


209

performance in pharmaceutical development. J. Pharm. Sci. 103, 3704–3712.

doi:10.1002/jps.24177

Barroso, E., Van de Wiele, T., Jiménez-Girón, A., Muñoz-González, I., Martín-Alvarez, P.J.,

Moreno-Arribas, M.V., Bartolomé, B., Peláez, C., Martínez-Cuesta, M.C., Requena,

T., 2014. Lactobacillus plantarum IFPL935 impacts colonic metabolism in a simulator

of the human gut microbiota during feeding with red wine polyphenols. Appl.

Microbiol. Biotechnol. 98, 6805–6815. doi:10.1007/s00253-014-5744-1

Béal, C., Sodini, I., 2003. Fabrication des yaourts et des laits fermentés. Tech. Ing.

Bioprocédés.

Beniwal, R.S., Arena, V.C., Thomas, L., Narla, S., Imperiale, T.F., Chaudhry, R.A., Ahmad,

U.A., 2003. A randomized trial of yogurt for prevention of antibiotic-associated

diarrhea. Dig. Dis. Sci. 48, 2077–2082.




Blanquet, S., Zeijdner, E., Beyssac, E., Meunier, J.-P., Denis, S., Havenaar, R., Alric, M.,

2004. A dynamic artificial gastrointestinal system for studying the behavior of orally

administered drug dosage forms under various physiological conditions. Pharm. Res.

21, 585–591.

Blanquet-Diot, S., Denis, S., Chalancon, S., Chaira, F., Cardot, J.-M., Alric, M., 2012. Use of

artificial digestive systems to investigate the biopharmaceutical factors influencing the

survival of probiotic yeast during gastrointestinal transit in humans. Pharm. Res. 29,

1444–1453. doi:10.1007/s11095-011-0620-5

Boke, H., Aslim, B., Alp, G., 2010. The role of resistance to bile salts and acid tolerance of

exopolysaccharides (EPSS) produced by yogurt starter bacteria. Arch. Biol. Sci. 62,

323–328. doi:10.2298/ABS1002323B

Bolotin, A., Quinquis, B., Renault, P., Sorokin, A., Ehrlich, S.D., Kulakauskas, S., Lapidus,

A., Goltsman, E., Mazur, M., Pusch, G.D., Fonstein, M., Overbeek, R., Kyprides, N.,

Purnelle, B., Prozzi, D., Ngui, K., Masuy, D., Hancy, F., Burteau, S., Boutry, M.,

Delcour, J., Goffeau, A., Hols, P., 2004. Complete sequence and comparative genome

analysis of the dairy bacterium Streptococcus thermophilus. Nat. Biotechnol. 22,

1554–1558. doi:10.1038/nbt1034

Bongaerts, R.J.M., Hautefort, I., Sidebotham, J.M., Hinton, J.C.D., 2002. Green fluorescent

protein as a marker for conditional gene expression in bacterial cells. Methods

Enzymol. 358, 43–66.

Bonifait, L., de la Cruz Dominguez-Punaro, M., Vaillancourt, K., Bart, C., Slater, J., Frenette,

M., Gottschalk, M., Grenier, D., 2010. The cell envelope subtilisin-like proteinase is a

virulence determinant for Streptococcus suis. BMC Microbiol. 10, 42.

doi:10.1186/1471-2180-10-42

Bouhafs, L., Moudilou, E.N., Exbrayat, J.M., Lahouel, M., Idoui, T., 2015. Protective effects

of probiotic Lactobacillus plantarum BJ0021 on liver and kidney oxidative stress and


210

apoptosis induced by endosulfan in pregnant rats. Ren. Fail. 37, 1370–1378.

doi:10.3109/0886022X.2015.1073543

Bove, P., Russo, P., Capozzi, V., Gallone, A., Spano, G., Fiocco, D., 2013. Lactobacillus

plantarum passage through an oro-gastro-intestinal tract simulator: carrier matrix

effect and transcriptional analysis of genes associated to stress and probiosis.

Microbiol. Res. 168, 351–359. doi:10.1016/j.micres.2013.01.004

Bowen, J.M., Stringer, A.M., Gibson, R.J., Yeoh, A.S.J., Hannam, S., Keefe, D.M.K., 2007.

VSL#3 probiotic treatment reduces chemotherapy-induced diarrhea and weight loss.

Cancer Biol. Ther. 6, 1449–1454.

Boyle, R.J., Tang, M.L.K., 2006. The role of probiotics in the management of allergic disease.

Clin. Exp. Allergy J. Br. Soc. Allergy Clin. Immunol. 36, 568–576.

doi:10.1111/j.1365-2222.2006.02472.x

Brigidi, P., Swennen, E., Vitali, B., Rossi, M., Matteuzzi, D., 2003. PCR detection of

Bifidobacterium strains and Streptococcus thermophilus in feces of human subjects

after oral bacteriotherapy and yogurt consumption. Int. J. Food Microbiol. 81, 203–

209.

Bron, P.A., Grangette, C., Mercenier, A., de Vos, W.M., Kleerebezem, M., 2004.

Identification of Lactobacillus plantarum Genes That Are Induced in the

Gastrointestinal Tract of Mice. J. Bacteriol. 186, 5721–5729.

doi:10.1128/JB.186.17.5721-5729.2004

Bruno-Bárcena, J.M., Azcárate-Peril, M.A., Hassan, H.M., 2010. Role of antioxidant enzymes

in bacterial resistance to organic acids. Appl. Environ. Microbiol. 76, 2747–2753.

doi:10.1128/AEM.02718-09

Bulet, P., Stöcklin, R., Menin, L., 2004. Anti-microbial peptides: from invertebrates to

vertebrates. Immunol. Rev. 198, 169–184.

Bumann, D., Valdivia, R.H., 2007. Identification of host-induced pathogen genes by

differential fluorescence induction reporter systems. Nat. Protoc. 2, 770–777.

doi:10.1038/nprot.2007.78

Calles-Enriquez, M., Eriksen, B.H., Andersen, P.S., Rattray, F.P., Johansen, A.H., Fernandez,

M., Ladero, V., Alvarez, M.A., 2010. Sequencing and Transcriptional Analysis of the

Streptococcus thermophilus Histamine Biosynthesis Gene Cluster: Factors That Affect

Differential hdcA Expression. Appl. Environ. Microbiol. 76, 6231–6238.

doi:10.1128/AEM.00827-10

Camilli, A., Beattie, D.T., Mekalanos, J.J., 1994. Use of genetic recombination as a reporter

of gene expression. Proc. Natl. Acad. Sci. U. S. A. 91, 2634–2638.

Campus, G., Cocco, F., Carta, G., Cagetti, M.G., Simark-Mattson, C., Strohmenger, L.,

Lingström, P., 2014. Effect of a daily dose of Lactobacillus brevis CD2 lozenges in

high caries risk schoolchildren. Clin. Oral Investig. 18, 555–561. doi:10.1007/s00784-

013-0980-9


211

Canani, R.B., Cirillo, P., Terrin, G., Cesarano, L., Spagnuolo, M.I., De Vincenzo, A., Albano,

F., Passariello, A., De Marco, G., Manguso, F., Guarino, A., 2007. Probiotics for

treatment of acute diarrhoea in children: randomised clinical trial of five different

preparations. BMJ 335, 340. doi:10.1136/bmj.39272.581736.55

Cao, B., Li, R., Xiong, S., Yao, F., Liu, X., Wang, M., Feng, L., Wang, L., 2011. Use of a

DNA microarray for detection and identification of bacterial pathogens associated

with fishery products. Appl. Environ. Microbiol. 77, 8219–8225.

doi:10.1128/AEM.05914-11

Chang, O.K., Perrin, C., Galia, W., Saulnier, F., Miclo, L., Roux, E., Driou, A., Humbert, G.,

Dary, A., 2012. Release of the cell-envelope protease PrtS in the growth medium of

Streptococcus thermophilus 4F44. Int. Dairy J. 23, 91–98.

doi:10.1016/j.idairyj.2011.10.014

Chang, O.K., Roux, É., Awussi, A.A., Miclo, L., Jardin, J., Jameh, N., Dary, A., Humbert, G.,

Perrin, C., 2014. Use of a free form of the Streptococcus thermophilus cell envelope

protease PrtS as a tool to produce bioactive peptides. Int. Dairy J.

doi:10.1016/j.idairyj.2014.01.008

Chang, S.K., Hassan, H.M., 1997. Characterization of superoxide dismutase in Streptococcus

thermophilus. Appl. Environ. Microbiol. 63, 3732–3735.

Chen, J., Gaikwad, V., Holmes, M., Murray, B., Povey, M., Wang, Y., Zhang, Y., 2011.

Development of a simple model device for in vitro gastric digestion investigation.

Food Funct. 2, 174–182. doi:10.1039/c0fo00159g

Chen, Y.Y., Hall, T.H., Burne, R.A., 1998. Streptococcus salivarius urease expression:

involvement of the phosphoenolpyruvate:sugar phosphotransferase system. FEMS

Microbiol. Lett. 165, 117–122.

Cho, I., Blaser, M.J., 2012. The Human Microbiome: at the interface of health and disease.

Nat. Rev. Genet. 13, 260–270. doi:10.1038/nrg3182

Cinquin, C., Le Blay, G., Fliss, I., Lacroix, C., 2004. Immobilization of infant fecal

microbiota and utilization in an in vitro colonic fermentation model. Microb. Ecol. 48,

128–138. doi:10.1007/s00248-003-2022-7

Clarke, L., Carbon, J., 1976. A colony bank containing synthetic CoI EI hybrid plasmids

representative of the entire E. coli genome. Cell 9, 91–99. doi:10.1016/0092-

8674(76)90055-6

Conway, P.L., Gorbach, S.L., Goldin, B.R., 1987. Survival of lactic acid bacteria in the

human stomach and adhesion to intestinal cells. J. Dairy Sci. 70, 1–12.

doi:10.3168/jds.S0022-0302(87)79974-3

Conway, S., Hart, A., Clark, A., Harvey, I., 2007. Does eating yogurt prevent antibiotic-

associated diarrhoea? A placebo-controlled randomised controlled trial in general

practice. Br. J. Gen. Pract. J. R. Coll. Gen. Pract. 57, 953–959.

doi:10.3399/096016407782604811


212

Cordonnier, C., Thévenot, J., Etienne-Mesmin, L., Denis, S., Alric, M., Livrelli, V., Blanquet-

Diot, S., 2015. Dynamic In Vitro Models of the Human Gastrointestinal Tract as

Relevant Tools to Assess the Survival of Probiotic Strains and Their Interactions with

Gut Microbiota. Microorganisms 3, 725–745. doi:10.3390/microorganisms3040725

Cotter, P.D., Hill, C., 2003. Surviving the Acid Test: Responses of Gram-Positive Bacteria to

Low pH. Microbiol. Mol. Biol. Rev. 67, 429–453. doi:10.1128/MMBR.67.3.429-

453.2003

Courtin, P., Monnet, V., Rul, F., 2002. Cell-wall proteinases PrtS and PrtB have a different

role in Streptococcus thermophilus/Lactobacillus bulgaricus mixed cultures in milk.

Microbiology 148, 3413–3421.

Crittenden, R.G., Martinez, N.R., Playne, M.J., 2003. Synthesis and utilisation of folate by

yoghurt starter cultures and probiotic bacteria. Int. J. Food Microbiol. 80, 217–222.

Dawes, C., Pedersen, A.M.L., Villa, A., Ekström, J., Proctor, G.B., Vissink, A., Aframian, D.,

McGowan, R., Aliko, A., Narayana, N., Sia, Y.W., Joshi, R.K., Jensen, S.B., Kerr,

A.R., Wolff, A., 2015. The functions of human saliva: A review sponsored by the

World Workshop on Oral Medicine VI. Arch. Oral Biol. 60, 863–874.

doi:10.1016/j.archoralbio.2015.03.004

de Almeida, A., Nikel, P.I., Giordano, A.M., Pettinari, M.J., 2007. Effects of granule-

associated protein PhaP on glycerol-dependent growth and polymer production in

poly(3-hydroxybutyrate)-producing Escherichia coli. Appl. Environ. Microbiol. 73,

7912–7916. doi:10.1128/AEM.01900-07

de Almeida, P.D.V., Grégio, A.M.T., Machado, M.A.N., de Lima, A.A.S., Azevedo, L.R.,

2008. Saliva composition and functions: a comprehensive review. J. Contemp. Dent.

Pract. 9, 72–80.

De Weirdt, R., Coenen, E., Vlaeminck, B., Fievez, V., Van den Abbeele, P., Van de Wiele,

T., 2013. A simulated mucus layer protects Lactobacillus reuteri from the inhibitory

effects of linoleic acid. Benef. Microbes 4, 299–312. doi:10.3920/BM2013.0017

del Campo, R., Bravo, D., Cantón, R., Ruiz-Garbajosa, P., García-Albiach, R., Montesi-

Libois, A., Yuste, F.-J., Abraira, V., Baquero, F., 2005. Scarce evidence of yogurt

lactic acid bacteria in human feces after daily yogurt consumption by healthy

volunteers. Appl. Environ. Microbiol. 71, 547–549. doi:10.1128/AEM.71.1.547-

549.2005

Del Carmen, S., de Moreno de LeBlanc, A., Martin, R., Chain, F., Langella, P., Bermúdez-

Humarán, L.G., LeBlanc, J.G., 2014. Genetically engineered immunomodulatory

Streptococcus thermophilus strains producing antioxidant enzymes exhibit enhanced

anti-inflammatory activities. Appl. Environ. Microbiol. 80, 869–877.

doi:10.1128/AEM.03296-13

Del Piano, M., Balzarini, M., Carmagnola, S., Pagliarulo, M., Tari, R., Nicola, S., Deidda, F.,

Pane, M., 2014. Assessment of the capability of a gelling complex made of tara gum

and the exopolysaccharides produced by the microorganism Streptococcus

thermophilus ST10 to prospectively restore the gut physiological barrier: a pilot study.

J. Clin. Gastroenterol. 48 Suppl 1, S56-61. doi:10.1097/MCG.0000000000000254


213

Delorme, C., Bartholini, C., Bolotine, A., Ehrlich, S.D., Renault, P., 2010. Emergence of a

Cell Wall Protease in the Streptococcus thermophilus Population. Appl. Environ.


Denis, S., Sayd, T., Georges, A., Chambon, C., Chalancon, S., Santé-Lhoutellier, V.,

Blanquet-Diot, S., 2016. Digestion of cooked meat proteins is slightly affected by age

as assessed using the dynamic gastrointestinal TIM model and mass spectrometry.

Food Funct. 7, 2682–2691. doi:10.1039/c6fo00120c

Derzelle, S., Bolotin, A., Mistou, M.-Y., Rul, F., 2005. Proteome Analysis of Streptococcus

thermophilus Grown in Milk Reveals Pyruvate Formate-Lyase as the Major

Upregulated Protein. Appl. Environ. Microbiol. 71, 8597–8605.

doi:10.1128/AEM.71.12.8597-8605.2005

Di Cerbo, A., Palmieri, B., Aponte, M., Morales-Medina, J.C., Iannitti, T., 2016. Mechanisms

and therapeutic effectiveness of lactobacilli. J. Clin. Pathol. 69, 187–203.

doi:10.1136/jclinpath-2015-202976

Dilmi-Bouras, A., Sadoun, D., 2002. Survie des ferments du yaourt dans le tube digestif du

lapin. Le Lait 82, 247–253. doi:10.1051/lait:2002007

Ding, W., Ji, X., Li, Y., Zhang, Q., 2016. Catalytic Promiscuity of the Radical S-adenosyl-L-

methionine Enzyme NosL. Front. Chem. 4. doi:10.3389/fchem.2016.00027

Donkor, O.N., Ravikumar, M., Proudfoot, O., Day, S.L., Apostolopoulos, V., Paukovics, G.,

Vasiljevic, T., Nutt, S.L., Gill, H., 2012. Cytokine profile and induction of T helper

type 17 and regulatory T cells by human peripheral mononuclear cells after microbial

exposure. Clin. Exp. Immunol. 167, 282–295. doi:10.1111/j.1365-2249.2011.04496.x

D’Orazio, G., Di Gennaro, P., Boccarusso, M., Presti, I., Bizzaro, G., Giardina, S., Michelotti,

A., Labra, M., La Ferla, B., 2015. Microencapsulation of new probiotic formulations

for gastrointestinal delivery: in vitro study to assess viability and biological properties.

Appl. Microbiol. Biotechnol. 99, 9779–9789. doi:10.1007/s00253-015-6853-1

Dortu, C., Thonart, P., 2009. Les bactériocines des bactéries lactiques : caractéristiques et

intérêts pour la bioconservation des produits alimentaires. Biotechnol Agron Soc Env.

13, 143–154.

Drouault, S., Anba, J., Corthier, G., 2002. Streptococcus thermophilus Is Able To Produce a -

Galactosidase Active during Its Transit in the Digestive Tract of Germ-Free Mice.

Appl. Environ. Microbiol. 68, 938–941. doi:10.1128/AEM.68.2.938-941.2002

Du, H., Nie, Q., Holmes, W.R., 2015. The Interplay between Wnt Mediated Expansion and

Negative Regulation of Growth Promotes Robust Intestinal Crypt Structure and

Homeostasis. PLoS Comput. Biol. 11. doi:10.1371/journal.pcbi.1004285

Eckburg, P.B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M., Gill, S.R.,

Nelson, K.E., Relman, D.A., 2005. Diversity of the human intestinal microbial flora.

Science 308, 1635–1638. doi:10.1126/science.1110591


214

EFSA, 2010. Scientific Opinion on the substantiation of health claims related to live yoghurt

cultures and improved lactose digestion (ID 1143, 2976) pursuant to Article 13(1) of

Regulation (EC) No 1924/2006. EFSA J. 8, 1763.

Elad, T., Lee, J.H., Belkin, S., Gu, M.B., 2008. Microbial whole‐ cell arrays. Microb.

Biotechnol. 1, 137–148. doi:10.1111/j.1751-7915.2007.00021.x

Elashoff, J.D., Reedy, T.J., Meyer, J.H., 1982. Analysis of gastric emptying data.

Gastroenterology 83, 1306–1312.

Elli, M., Callegari, M.L., Ferrari, S., Bessi, E., Cattivelli, D., Soldi, S., Morelli, L., Goupil

Feuillerat, N., Antoine, J.-M., 2006. Survival of Yogurt Bacteria in the Human Gut.


Ellis, T.C., Jain, S., Linowski, A.K., Rike, K., Bestor, A., Rosa, P.A., Halpern, M.,

Kurhanewicz, S., Jewett, M.W., 2013. In vivo expression technology identifies a novel

virulence factor critical for Borrelia burgdorferi persistence in mice. PLoS Pathog. 9,

e1003567. doi:10.1371/journal.ppat.1003567

Englyst, H.N., Kingman, S.M., Hudson, G.J., Cummings, J.H., 1996. Measurement of

resistant starch in vitro and in vivo. Br. J. Nutr. 75, 749–755.

Etienne-Mesmin, L., Livrelli, V., Privat, M., Denis, S., Cardot, J.-M., Alric, M., Blanquet-

Diot, S., 2011. Effect of a New Probiotic Saccharomyces cerevisiae Strain on Survival

of Escherichia coli O157:H7 in a Dynamic Gastrointestinal Model. Appl. Environ.


Facklam, R., 2002. What Happened to the Streptococci: Overview of Taxonomic and

Nomenclature Changes. Clin. Microbiol. Rev. 15, 613–630.

doi:10.1128/CMR.15.4.613-630.2002

Fallingborg, J., Pedersen, P., Jacobsen, B.A., 1998. Small intestinal transit time and

intraluminal pH in ileocecal resected patients with Crohn’s disease. Dig. Dis. Sci. 43,

702–705.

Fang, S.-H., Lai, Y.-J., Chou, C.-C., 2013. The susceptibility of Streptococcus thermophilus

14085 to organic acid, simulated gastric juice, bile salt and disinfectant as influenced

by cold shock treatment. Food Microbiol. 33, 55–60. doi:10.1016/j.fm.2012.08.012

FAO/WHO, 2002. Food and Agricultural Organization of the United Nations and World

Health Organization. Joint FAO/WHO working group report on drafting guidelines for

the evaluation of probiotics in food. Food Agric. Organ. U. N.

Farrow, J.A., Collins, M.D., 1984. DNA base composition, DNA-DNA homology and long-

chain fatty acid studies on Streptococcus thermophilus and Streptococcus salivarius. J.

Gen. Microbiol. 130, 357–362. doi:10.1099/00221287-130-2-357

Fernandez-Espla, M.D., Garault, P., Monnet, V., Rul, F., 2000. Streptococcus thermophilus

Cell Wall-Anchored Proteinase: Release, Purification, and Biochemical and Genetic

Characterization. Appl. Environ. Microbiol. 66, 4772–4778.

doi:10.1128/AEM.66.11.4772-4778.2000


215

Fischer, G., Decaris, B., Leblond, P., 1997. Occurrence of deletions, associated with genetic

instability in Streptomyces ambofaciens, is independent of the linearity of the

chromosomal DNA. J. Bacteriol. 179, 4553–4558.

Foligné, B., Daniel, C., Pot, B., 2013. Probiotics from research to market: the possibilities,

risks and challenges. Curr. Opin. Microbiol. 16, 284–292.

doi:10.1016/j.mib.2013.06.008

Fontaine, L., Dandoy, D., Boutry, C., Delplace, B., de Frahan, M.H., Fremaux, C., Horvath,

P., Boyaval, P., Hols, P., 2010. Development of a versatile procedure based on natural

transformation for marker-free targeted genetic modification in Streptococcus

thermophilus. Appl. Environ. Microbiol. 76, 7870–7877. doi:10.1128/AEM.01671-10

Fontaine, L., Hols, P., 2008. The inhibitory spectrum of thermophilin 9 from Streptococcus

thermophilus LMD-9 depends on the production of multiple peptides and the activity

of BlpG(St), a thiol-disulfide oxidase. Appl. Environ. Microbiol. 74, 1102–1110.

doi:10.1128/AEM.02030-07

Foucaud, C., Poolman, B., 1992. Lactose transport system of Streptococcus thermophilus.

Functional reconstitution of the protein and characterization of the kinetic mechanism

of transport. J. Biol. Chem. 267, 22087–22094.

Fox, P.F., McSweeney, P.H.L., Cogan, T.M., Guinee, T.P., 2004. Cheese: Chemistry, Physics

and Microbiology, 3rd Edition, Academic Press. ed. London.

Frank, K.L., Barnes, A.M.T., Grindle, S.M., Manias, D.A., Schlievert, P.M., Dunny, G.M.,

2012. Use of Recombinase-Based In Vivo Expression Technology To Characterize

Enterococcus faecalis Gene Expression during Infection Identifies In Vivo-Expressed

Antisense RNAs and Implicates the Protease Eep in Pathogenesis. Infect. Immun. 80,

539–549. doi:10.1128/IAI.05964-11

Fujii, A., Cook, E.S., 1973. Probiotics. Antistaphylococcal and antifibrinolytic activities of

omega-guanidino acids and omega-guanidinoacyl-L-histidines. J. Med. Chem. 16,

1409–1411.

Fuller, R., 1992. History and development of probiotics., UK: Chapman & Hall. ed,

Probiotics, the scientific basis. In R. Fuller, London.

Galia, W., Perrin, C., Genay, M., Dary, A., 2009. Variability and molecular typing of

Streptococcus thermophilus strains displaying different proteolytic and acidifying

properties. Int. Dairy J. 19, 89–95.

Gao, X.-Y., Zhi, X.-Y., Li, H.-W., Klenk, H.-P., Li, W.-J., 2014. Comparative Genomics of

the Bacterial Genus Streptococcus Illuminates Evolutionary Implications of Species

Groups. PLoS ONE 9, e101229. doi:10.1371/journal.pone.0101229

Garault, P., Letort, C., Juillard, V., Monnet, V., 2000. Branched-chain amino acid

biosynthesis is essential for optimal growth of Streptococcus thermophilus in milk.

Appl. Environ. Microbiol. 66, 5128–5133.

García-Albiach, R., Pozuelo de Felipe, M.J., José, M., de Felipe, P., Angulo, S., Morosini,

M.-I., Bravo, D., Baquero, F., del Campo, R., 2008. Molecular analysis of yogurt


216

containing Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus

thermophilus in human intestinal microbiota. Am. J. Clin. Nutr. 87, 91–96.

García-Hernández, J., Moreno, Y., Chuan, C., Hernández, M., 2012. In vivo study of the

survival of Lactobacillus delbrueckii subsp. bulgaricus CECT 4005T and

Streptococcus thermophilus CECT 801 by DVC-FISH after consumption of fermented

milk. J. Food Sci. 77, M593-597. doi:10.1111/j.1750-3841.2012.02918.x

Gardan, R., Besset, C., Guillot, A., Gitton, C., Monnet, V., 2009. The Oligopeptide Transport

System Is Essential for the Development of Natural Competence in Streptococcus

thermophilus Strain LMD-9. J. Bacteriol. 191, 4647–4655. doi:10.1128/JB.00257-09

Garrett, D.A., Failla, M.L., Sarama, R.J., 1999. Development of an in vitro digestion method

to assess carotenoid bioavailability from meals. J. Agric. Food Chem. 47, 4301–4309.

Geertsma, E.R., Duurkens, R.H., Poolman, B., 2005. The activity of the lactose transporter

from Streptococcus thermophilus is increased by phosphorylated IIA and the action of

beta-galactosidase. Biochemistry (Mosc.) 44, 15889–15897. doi:10.1021/bi051638w

Geirnaert, A., Wang, J., Tinck, M., Steyaert, A., Van den Abbeele, P., Eeckhaut, V., Vilchez-

Vargas, R., Falony, G., Laukens, D., De Vos, M., Van Immerseel, F., Raes, J., Boon,

N., Van de Wiele, T., 2015. Interindividual differences in response to treatment with

butyrate-producing Butyricicoccus pullicaecorum 25-3T studied in an in vitro gut

model. FEMS Microbiol. Ecol. 91. doi:10.1093/femsec/fiv054

Geng, J., Huang, S.-C., Li, S., Hu, S., Chen, Y.-Y.M., 2011. Complete genome sequence of

the ureolytic Streptococcus salivarius strain 57.I. J. Bacteriol. 193, 5596–5597.

doi:10.1128/JB.05670-11

Gilbreth, S.E., Somkuti, G.A., 2005. Thermophilin 110: a bacteriocin of Streptococcus

thermophilus ST110. Curr. Microbiol. 51, 175–182. doi:10.1007/s00284-005-4540-7

Giovannini, M., Agostoni, C., Riva, E., Salvini, F., Ruscitto, A., Zuccotti, G.V., Radaelli, G.,

Felicita Study Group, 2007. A randomized prospective double blind controlled trial on

effects of long-term consumption of fermented milk containing Lactobacillus casei in

pre-school children with allergic asthma and/or rhinitis. Pediatr. Res. 62, 215–220.

doi:10.1203/PDR.0b013e3180a76d94

Goh, Y.J., Goin, C., O’Flaherty, S., Altermann, E., Hutkins, R., 2011. Specialized adaptation

of a lactic acid bacterium to the milk environment: the comparative genomics of

Streptococcus thermophilus LMD-9. Microb. Cell Factories 10 Suppl 1, S22.

doi:10.1186/1475-2859-10-S1-S22

Gomez, J.E., Clatworthy, A., Hung, D.T., 2011. Probing bacterial pathogenesis with genetics,

genomics, and chemical biology: past, present, and future approaches. Crit. Rev.

Biochem. Mol. Biol. 46, 41–66. doi:10.3109/10409238.2010.538663

González-Márquez, H., Perrin, C., Bracquart, P., Guimont, C., Linden, G., 1997. A 16 kDa

protein family overexpressed by Streptococcus thermophilus PB18 in acid

environments. Microbiol. Read. Engl. 143 ( Pt 5), 1587–1594.


217

Graham, J.E., Clark-Curtiss, J.E., 1999. Identification of Mycobacterium tuberculosis RNAs

synthesized in response to phagocytosis by human macrophages by selective capture

of transcribed sequences (SCOTS). Proc. Natl. Acad. Sci. U. S. A. 96, 11554–11559.

Graham, J.E., Peek, R.M., Krishna, U., Cover, T.L., 2002. Global analysis of Helicobacter

pylori gene expression in human gastric mucosa. Gastroenterology 123, 1637–1648.

Guandalini, S., Magazzù, G., Chiaro, A., La Balestra, V., Di Nardo, G., Gopalan, S., Sibal,

A., Romano, C., Canani, R.B., Lionetti, P., Setty, M., 2010. VSL#3 improves

symptoms in children with irritable bowel syndrome: a multicenter, randomized,

placebo-controlled, double-blind, crossover study. J. Pediatr. Gastroenterol. Nutr. 51,

24–30. doi:10.1097/MPG.0b013e3181ca4d95

Guarner, F., Perdigon, G., Corthier, G., Salminen, S., Koletzko, B., Morelli, L., 2005. Should

yoghurt cultures be considered probiotic? Br. J. Nutr. 93, 783.

doi:10.1079/BJN20051428

Guerra, A., Etienne-Mesmin, L., Livrelli, V., Denis, S., Blanquet-Diot, S., Alric, M., 2012.

Relevance and challenges in modeling human gastric and small intestinal digestion.

Trends Biotechnol. 30, 591–600. doi:10.1016/j.tibtech.2012.08.001

Guillemard, E., Tondu, F., Lacoin, F., Schrezenmeir, J., 2010. Consumption of a fermented

dairy product containing the probiotic Lactobacillus casei DN-114001 reduces the

duration of respiratory infections in the elderly in a randomised controlled trial. Br. J.

Nutr. 103, 58–68. doi:10.1017/S0007114509991395

Gunnewijk, M.G., Poolman, B., 2000. HPr(His approximately P)-mediated phosphorylation

differently affects counterflow and proton motive force-driven uptake via the lactose

transport protein of Streptococcus thermophilus. J. Biol. Chem. 275, 34080–34085.

doi:10.1074/jbc.M003513200

Guo, C.-M., Chen, R.-R., Kalhoro, D.H., Wang, Z.-F., Liu, G.-J., Lu, C.-P., Liu, Y.-J., 2014.

Identification of genes preferentially expressed by highly virulent piscine

Streptococcus agalactiae upon interaction with macrophages. PloS One 9, e87980.


Gupta, S., Manubhai, K.P., Kulkarni, V., Srivastava, S., 2016. An overview of innovations

and industrial solutions in Protein Microarray Technology. Proteomics 16, 1297–1308.

doi:10.1002/pmic.201500429

Hafeez, Z., Cakir-Kiefer, C., Girardet, J.-M., Jardin, J., Perrin, C., Dary, A., Miclo, L., 2013.

Hydrolysis of milk-derived bioactive peptides by cell-associated extracellular

peptidases of Streptococcus thermophilus. Appl. Microbiol. Biotechnol. 97, 9787–

9799. doi:10.1007/s00253-013-5245-7

Hafeez, Z., Cakir-Kiefer, C., Girardet, J.-M., Lecomte, X., Paris, C., Galia, W., Dary, A.,

Miclo, L., 2015. New Insights into the Proteolytic System of Streptococcus

thermophilus: Use of Isracidin To Characterize Cell-Associated Extracellular

Peptidase Activities. J. Agric. Food Chem. 63, 7522–7531.

doi:10.1021/acs.jafc.5b01647


218

Hanin, A., Sava, I., Bao, Y., Huebner, J., Hartke, A., Auffray, Y., Sauvageot, N., 2010.

Screening of in vivo activated genes in Enterococcus faecalis during insect and mouse

infections and growth in urine. PloS One 5, e11879.


Hasslöf, P., West, C.E., Videhult, F.K., Brandelius, C., Stecksén-Blicks, C., 2013. Early

intervention with probiotic Lactobacillus paracasei F19 has no long-term effect on

caries experience. Caries Res. 47, 559–565. doi:10.1159/000350524

Hauser, G., Salkic, N., Vukelic, K., JajacKnez, A., Stimac, D., 2015. Probiotics for Standard

Triple Helicobacter pylori Eradication. Medicine (Baltimore) 94.

doi:10.1097/MD.0000000000000685

Havenaar, R., Anneveld, B., Hanff, L.M., de Wildt, S.N., de Koning, B.A.E., Mooij, M.G.,

Lelieveld, J.P.A., Minekus, M., 2013. In vitro gastrointestinal model (TIM) with

predictive power, even for infants and children? Int. J. Pharm., Special Section:

Formulating Better Medicines for Children 457, 327–332.

doi:10.1016/j.ijpharm.2013.07.053

Havenaar, R., Huis in’t Veld, J.H.J., 1992. Probiotics a general view, Elsevier Applied

Science. ed, The Lactic Acid Bacteria in Health And Disease. Wood BJB, London.

Helinck, S., Le Bars, D., Moreau, D., Yvon, M., 2004. Ability of thermophilic lactic acid

bacteria to produce aroma compounds from amino acids. Appl. Environ. Microbiol.

70, 3855–3861. doi:10.1128/AEM.70.7.3855-3861.2004

Hens, B., Brouwers, J., Anneveld, B., Corsetti, M., Symillides, M., Vertzoni, M., Reppas, C.,

Turner, D.B., Augustijns, P., 2014. Gastrointestinal transfer: in vivo evaluation and

implementation in in vitro and in silico predictive tools. Eur. J. Pharm. Sci. Off. J. Eur.

Fed. Pharm. Sci. 63, 233–242. doi:10.1016/j.ejps.2014.07.008

Hensel, M., Shea, J.E., Gleeson, C., Jones, M.D., Dalton, E., Holden, D.W., 1995.

Simultaneous identification of bacterial virulence genes by negative selection. Science

269, 400–403.

Herve-Jimenez, L., Guillouard, I., Guedon, E., Gautier, C., Boudebbouze, S., Hols, P.,

Monnet, V., Rul, F., Maguin, E., 2008. Physiology of Streptococcus thermophilus

during the late stage of milk fermentation with special regard to sulfur amino-acid

metabolism. Proteomics 8, 4273–4286. doi:10.1002/pmic.200700489

Hill, C., Guarner, F., Reid, G., Gibson, G.R., Merenstein, D.J., Pot, B., Morelli, L., Canani,

R.B., Flint, H.J., Salminen, S., Calder, P.C., Sanders, M.E., 2014. Expert consensus

document. The International Scientific Association for Probiotics and Prebiotics

consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev.

Gastroenterol. Hepatol. 11, 506–514. doi:10.1038/nrgastro.2014.66

Hochstrasser, M.L., Doudna, J.A., 2015. Cutting it close: CRISPR-associated

endoribonuclease structure and function. Trends Biochem. Sci. 40, 58–66.

doi:10.1016/j.tibs.2014.10.007

Hoebler, C., Lecannu, G., Belleville, C., Devaux, M.-F., Popineau, Y., Barry, J.-L., 2002.

Development of an in vitro system simulating bucco-gastric digestion to assess the


219

physical and chemical changes of food. Int. J. Food Sci. Nutr. 53, 389–402.

doi:10.1080/0963748021000044732

Hols, P., Hancy, F., Fontaine, L., Grossiord, B., Prozzi, D., Leblond-Bourget, N., Decaris, B.,

Bolotin, A., Delorme, C., Dusko Ehrlich, S., Guédon, E., Monnet, V., Renault, P.,

Kleerebezem, M., 2005. New insights in the molecular biology and physiology of

Streptococcus thermophilus revealed by comparative genomics. FEMS Microbiol.

Rev. 29, 435–463. doi:10.1016/j.femsre.2005.04.008

Hugon, P., Lagier, J.-C., Colson, P., Bittar, F., Raoult, D., 2016. Repertoire of human gut

microbes. Microb. Pathog. doi:10.1016/j.micpath.2016.06.020

Hurduc, V., Plesca, D., Dragomir, D., Sajin, M., Vandenplas, Y., 2009. A randomized, open

trial evaluating the effect of Saccharomyces boulardii on the eradication rate of

Helicobacter pylori infection in children. Acta Paediatr. Oslo Nor. 1992 98, 127–131.

doi:10.1111/j.1651-2227.2008.00977.x

Ibrahim, M., Guillot, A., Wessner, F., Algaron, F., Besset, C., Courtin, P., Gardan, R.,

Monnet, V., 2007a. Control of the Transcription of a Short Gene Encoding a Cyclic

Peptide in Streptococcus thermophilus: a New Quorum-Sensing System? J. Bacteriol.

189, 8844–8854. doi:10.1128/JB.01057-07

Ibrahim, M., Nicolas, P., Bessières, P., Bolotin, A., Monnet, V., Gardan, R., 2007b. A

genome-wide survey of short coding sequences in streptococci. Microbiol. Read. Engl.

153, 3631–3644. doi:10.1099/mic.0.2007/006205-0

Ichim, T.E., Patel, A.N., Shafer, K.A., 2016. Experimental support for the effects of a

probiotic/digestive enzyme supplement on serum cholesterol concentrations and the

intestinal microbiome. J. Transl. Med. 14, 184. doi:10.1186/s12967-016-0945-2

Ito, M., Ohishi, K., Yoshida, Y., Okumura, T., Sato, T., Yokoi, W., Sawada, H., 2008.

Preventive effect of Streptococcus thermophilus YIT 2001 on dextran sulfate sodium-

induced colitis in mice. Biosci. Biotechnol. Biochem. 72, 2543–2547.

Ito, M., Ohishi, K., Yoshida, Y., Yokoi, W., Sawada, H., 2003. Antioxidative effects of lactic

acid bacteria on the colonic mucosa of iron-overloaded mice. J. Agric. Food Chem.

51, 4456–4460. doi:10.1021/jf0261957

Ito, M., Oishi, K., Yoshida, Y., Okumura, T., Sato, T., Naito, E., Yokoi, W., Sawada, H.,

2015. Effects of lactic acid bacteria on low-density lipoprotein susceptibility to

oxidation and aortic fatty lesion formation in hyperlipidemic hamsters. Benef.

Microbes 6, 287–293. doi:10.3920/BM2014.0040

Ivanova, I., Miteva, V., Stefanova, T., Pantev, A., Budakov, I., Danova, S., Moncheva, P.,

Nikolova, I., Dousset, X., Boyaval, P., 1998. Characterization of a bacteriocin

produced by Streptococcus thermophilus 81. Int. J. Food Microbiol. 42, 147–158.

Iyer, R., Tomar, S.K., Kapila, S., Mani, J., Singh, R., 2010a. Probiotic properties of folate

producing Streptococcus thermophilus strains. Food Res. Int. 43, 103–110.

doi:10.1016/j.foodres.2009.09.011


220

Iyer, R., Tomar, S.K., Singh, A.K., 2010b. Response surface optimization of the cultivation

conditions and medium components for the production of folate by Streptococcus

thermophilus. J. Dairy Res. 77, 350–356. doi:10.1017/S0022029910000166

Jameh, N., Galia, W., Awussi, A.A., Roux, E., Genay, M., Perrin, C., Dary-Mourot, A., 2016.

Characterization of a new peptide transport system in Streptococcus thermophilus.

Food Res. Int. 86, 34–45. doi:10.1016/j.foodres.2016.04.039

Johansson, M.E.V., Sjövall, H., Hansson, G.C., 2013. The gastrointestinal mucus system in

health and disease. Nat. Rev. Gastroenterol. Hepatol. 10, 352–361.

doi:10.1038/nrgastro.2013.35

Joly, C., Gay-Quéheillard, J., Léké, A., Chardon, K., Delanaud, S., Bach, V., Khorsi-Cauet,

H., 2013. Impact of chronic exposure to low doses of chlorpyrifos on the intestinal

microbiota in the Simulator of the Human Intestinal Microbial Ecosystem (SHIME)

and in the rat. Environ. Sci. Pollut. Res. Int. 20, 2726–2734. doi:10.1007/s11356-012-

1283-4

Jonczyk, R., Kurth, T., Lavrentieva, A., Walter, J.-G., Scheper, T., Stahl, F., 2016. Living

Cell Microarrays: An Overview of Concepts. Microarrays Basel Switz. 5.

doi:10.3390/microarrays5020011

Junjua, M., Galia, W., Gaci, N., Uriot, O., Genay, M., Bachmann, H., Kleerebezem, M., Dary,

A., Roussel, Y., 2014. Development of the recombinase-based in vivo expression

technology in Streptococcus thermophilus and validation using the lactose operon

promoter. J. Appl. Microbiol. 116, 620–631. doi:10.1111/jam.12376

Junjua, M., Kechaou, N., Chain, F., Awussi, A.A., Roussel, Y., Perrin, C., Roux, E., Langella,

P., Bermúdez-Humarán, L.G., Le Roux, Y., Chatel, J.-M., Dary-Mourot, A., 2016. A

large scale in vitro screening of Streptococcus thermophilus strains revealed strains

with a high anti-inflammatory potential. LWT - Food Sci. Technol. 70, 78–87.

doi:10.1016/j.lwt.2016.02.006

Kabuki, T., Uenishi, H., Watanabe, M., Seto, Y., Nakajima, H., 2007. Characterization of a

bacteriocin, Thermophilin 1277, produced by Streptococcus thermophilus SBT1277. J.

Appl. Microbiol. 102, 971–980. doi:10.1111/j.1365-2672.2006.03159.x

Kawamura, Y., Hou, X.G., Sultana, F., Liu, S., Yamamoto, H., Ezaki, T., 1995. Transfer of

Streptococcus adjacens and Streptococcus defectivus to Abiotrophia gen. nov. as

Abiotrophia adiacens comb. nov. and Abiotrophia defectiva comb. nov., respectively.

Int. J. Syst. Bacteriol. 45, 798–803. doi:10.1099/00207713-45-4-798

Kebouchi, M., Galia, W., Genay, M., Soligot, C., Lecomte, X., Awussi, A.A., Perrin, C.,

Roux, E., Dary-Mourot, A., Le Roux, Y., 2016. Implication of sortase-dependent

proteins of Streptococcus thermophilus in adhesion to human intestinal epithelial cell

lines and bile salt tolerance. Appl. Microbiol. Biotechnol. 100, 3667–3679.

doi:10.1007/s00253-016-7322-1

Kekkonen, R.-A., Kajasto, E., Miettinen, M., Veckman, V., Korpela, R., Julkunen, I., 2008.

Probiotic Leuconostoc mesenteroides ssp. cremoris and Streptococcus thermophilus

induce IL-12 and IFN-gamma production. World J. Gastroenterol. 14, 1192–1203.


221

Khalf, M., Dabour, N., Kheadr, E., Fliss, I., 2010. Viability of probiotic bacteria in maple sap

products under storage and gastrointestinal conditions. Bioresour. Technol. 101, 7966–

7972. doi:10.1016/j.biortech.2010.05.053

Khan, M.A., Isaacson, R.E., 2002. Identification of Escherichia coli genes that are

specifically expressed in a murine model of septicemic infection. Infect. Immun. 70,

3404–3412.

Khan, N.A., Roman, S., Peulen, O., Mion, F., 2009. Physiologie Digestive. Pradel.

Klucar, L., Stano, M., Hajduk, M., 2010. phiSITE: database of gene regulation in

bacteriophages. Nucleic Acids Res. 38, D366–D370. doi:10.1093/nar/gkp911

Kolb, H., 1955. Die Behandlung akuter Infekte unter dem Gesichtswinkel der Prophylaxe

chronischer Leiden. Über die Behandlung mit physiologischen bakterien. Bakterien

Microecol Ther. 1, 15–19.

Kollath, W., 1953. [Nutrition and the tooth system; general review with special reference to

vitamins]. Dtsch. Zahnärztliche Z. 8, Suppl 7-16.

Kolling, G.L., Wu, M., Warren, C.A., Durmaz, E., Klaenhammer, T.R., Timko, M.P.,

Guerrant, R.L., 2012. Lactic acid production by Streptococcus thermophilus alters

Clostridium difficile infection and in vitro Toxin A production. Gut Microbes 3, 523–

529. doi:10.4161/gmic.21757

Kong, F., Singh, R.P., 2010. A human gastric simulator (HGS) to study food digestion in

human stomach. J. Food Sci. 75, E627-635. doi:10.1111/j.1750-3841.2010.01856.x

Korpela, K., Salonen, A., Virta, L.J., Kumpu, M., Kekkonen, R.A., de Vos, W.M., 2016.

Lactobacillus rhamnosus GG Intake Modifies Preschool Children’s Intestinal

Microbiota, Alleviates Penicillin-Associated Changes, and Reduces Antibiotic Use.

PloS One 11, e0154012. doi:10.1371/journal.pone.0154012

Kotrba, P., Inui, M., Yukawa, H., 2001. Bacterial phosphotransferase system (PTS) in

carbohydrate uptake and control of carbon metabolism. J. Biosci. Bioeng. 92, 502–

517.

Koyama, T., Kirjavainen, P.V., Fisher, C., Anukam, K., Summers, K., Hekmat, S., Reid, G.,

2010. Development and pilot evaluation of a novel probiotic mixture for the

management of seasonal allergic rhinitis. Can. J. Microbiol. 56, 730–738.

doi:10.1139/w10-061

Krause, A.J., Henson, L.S., Reineccius, G.A., 2011. Use of a chewing device to perform a

mass balance on chewing gum components. Flavour Fragr. J. 26, 47–54.

doi:10.1002/ffj.2015

Kukavica-Ibrulj, I., Levesque, R.C., 2015. Essential genes in the infection model of

Pseudomonas aeruginosa-PCR-based signature-tagged mutagenesis. Methods Mol.

Biol. Clifton NJ 1279, 97–123. doi:10.1007/978-1-4939-2398-4_7

Larsson, K., Harrysson, H., Havenaar, R., Alminger, M., Undeland, I., 2016. Formation of

malondialdehyde (MDA), 4-hydroxy-2-hexenal (HHE) and 4-hydroxy-2-nonenal


222

(HNE) in fish and fish oil during dynamic gastrointestinal in vitro digestion. Food

Funct. 7, 1176–1187. doi:10.1039/c5fo01401h

Latvala, S., Miettinen, M., Kekkonen, R.A., Korpela, R., Julkunen, I., 2011. Lactobacillus

rhamnosus GG and Streptococcus thermophilus induce suppressor of cytokine

signalling 3 (SOCS3) gene expression directly and indirectly via interleukin-10 in

human primary macrophages. Clin. Exp. Immunol. 165, 94–103. doi:10.1111/j.1365-

2249.2011.04408.x

Latvala, S., Pietila, T.-E., Veckman, V., Kekkonen, R.-A., Tynkkynen, S., Korpela, R.,

Julkunen, I., 2008. Potentially probiotic bacteria induce efficient maturation but

differential cytokine production in human monocyte-derived dendritic cells. World J.

Gastroenterol. 14, 5570-5583–5582.

Lee, S.H., Hava, D.L., Waldor, M.K., Camilli, A., 1999. Regulation and temporal expression

patterns of Vibrio cholerae virulence genes during infection. Cell 99, 625–634.

Letort, C., Juillard, V., 2001. Development of a minimal chemically-defined medium for the

exponential growth of Streptococcus thermophilus. J. Appl. Microbiol. 91, 1023–

1029.

Levi, C.S., Lesmes, U., 2014. Bi-compartmental elderly or adult dynamic digestion models

applied to interrogate protein digestibility. Food Funct. 5, 2402–2409.

doi:10.1039/c4fo00478g

Leyer, G.J., Li, S., Mubasher, M.E., Reifer, C., Ouwehand, A.C., 2009. Probiotic effects on

cold and influenza-like symptom incidence and duration in children. Pediatrics 124,

e172-179. doi:10.1542/peds.2008-2666

Leyral, G., Vierling, E., 2007. Microbiologie et toxicologie des aliments: hygiène et sécurité

alimentaires. Doin.

Licandro-Seraut, H., Scornec, H., Pédron, T., Cavin, J.-F., Sansonetti, P.J., 2014. Functional

genomics of Lactobacillus casei establishment in the gut. Proc. Natl. Acad. Sci. U. S.

A. 111, E3101-3109. doi:10.1073/pnas.1411883111

Lick, S., Drescher, K., Heller, K.J., 2001. Survival of Lactobacillus delbrueckii subsp.

bulgaricus and Streptococcus thermophilus in the Terminal Ileum of Fistulated

Gottingen Minipigs. Appl. Environ. Microbiol. 67, 4137–4143.

doi:10.1128/AEM.67.9.4137-4143.2001

Lilly, D.M., Stillwell, R.H., 1965. Probiotics: growth-promoting factors produced by

microorganisms. Science 147, 747–748.

Liu, M., Siezen, R.J., Nauta, A., 2009. In silico prediction of horizontal gene transfer events

in Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation

in yogurt manufacturing. Appl. Environ. Microbiol. 75, 4120–4129.

doi:10.1128/AEM.02898-08

Lyng, E., Havenaar, R., Shastri, P., Hetsco, L., Vick, A., Sagartz, J., 2016. Increased

bioavailability of celecoxib under fed versus fasted conditions is determined by


223

postprandial bile secretion as demonstrated in a dynamic gastrointestinal model. Drug

Dev. Ind. Pharm. 42, 1334–1339. doi:10.3109/03639045.2015.1135935

Maddocks, S.E., Oyston, P.C.F., 2008. Structure and function of the LysR-type transcriptional

regulator (LTTR) family proteins. Microbiol. Read. Engl. 154, 3609–3623.

doi:10.1099/mic.0.2008/022772-0

Mahan, M.J., Slauch, J.M., Mekalanos, J.J., 1993. Selection of bacterial virulence genes that

are specifically induced in host tissues. Science 259, 686–688.

Mahan, M.J., Tobias, J.W., Slauch, J.M., Hanna, P.C., Collier, R.J., Mekalanos, J.J., 1995.

Antibiotic-based selection for bacterial genes that are specifically induced during

infection of a host. Proc. Natl. Acad. Sci. U. S. A. 92, 669–673.

Mainville, I., Arcand, Y., Farnworth, E.R., 2005. A dynamic model that simulates the human

upper gastrointestinal tract for the study of probiotics. Int. J. Food Microbiol. 99, 287–

296. doi:10.1016/j.ijfoodmicro.2004.08.020

Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavlov, A.,

Pavlova, N., Karamychev, V., Polouchine, N., Shakhova, V., Grigoriev, I., Lou, Y.,

Rohksar, D., Lucas, S., Huang, K., Goodstein, D.M., Hawkins, T., Plengvidhya, V.,

Welker, D., Hughes, J., Goh, Y., Benson, A., Baldwin, K., Lee, J.-H., Díaz-Muñiz, I.,

Dosti, B., Smeianov, V., Wechter, W., Barabote, R., Lorca, G., Altermann, E.,

Barrangou, R., Ganesan, B., Xie, Y., Rawsthorne, H., Tamir, D., Parker, C., Breidt, F.,

Broadbent, J., Hutkins, R., O’Sullivan, D., Steele, J., Unlu, G., Saier, M.,

Klaenhammer, T., Richardson, P., Kozyavkin, S., Weimer, B., Mills, D., 2006.

Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sci. U. S. A. 103,

15611–15616. doi:10.1073/pnas.0607117103

Makino, S., Ikegami, S., Kume, A., Horiuchi, H., Sasaki, H., Orii, N., 2010. Reducing the risk

of infection in the elderly by dietary intake of yoghurt fermented with Lactobacillus

delbrueckii ssp. bulgaricus OLL1073R-1. Br. J. Nutr. 104, 998–1006.

doi:10.1017/S000711451000173X

Mäkivuokko, H., Nurmi, J., Nurminen, P., Stowell, J., Rautonen, N., 2005. In vitro effects on

polydextrose by colonic bacteria and caco-2 cell cyclooxygenase gene expression.

Nutr. Cancer 52, 94–104. doi:10.1207/s15327914nc5201_12

Malagelada, J.R., Go, V.L., Summerskill, W.H., 1979. Different gastric, pancreatic, and

biliary responses to solid-liquid or homogenized meals. Dig. Dis. Sci. 24, 101–110.

Marciset, O., Jeronimus-Stratingh, M.C., Mollet, B., Poolman, B., 1997. Thermophilin 13, a

nontypical antilisterial poration complex bacteriocin, that functions without a receptor.

J. Biol. Chem. 272, 14277–14284.

Marieb, E.N., Hoehn, K., 2015. Anatomie et physiologie humaines. Pearson.

Marteau, P., Minekus, M., Havenaar, R., Huis in’t Veld, J.H., 1997. Survival of lactic acid

bacteria in a dynamic model of the stomach and small intestine: validation and the

effects of bile. J. Dairy Sci. 80, 1031–1037. doi:10.3168/jds.S0022-0302(97)76027-2


224

Marzorati, M., Vanhoecke, B., De Ryck, T., Sadaghian Sadabad, M., Pinheiro, I., Possemiers,

S., Van den Abbeele, P., Derycke, L., Bracke, M., Pieters, J., Hennebel, T., Harmsen,

H.J., Verstraete, W., Van de Wiele, T., 2014. The HMITM

module: a new tool to study

the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC

Microbiol. 14, 133. doi:10.1186/1471-2180-14-133

Marzorati, M., Vilchez-Vargas, R., Bussche, J.V., Truchado, P., Jauregui, R., El Hage, R.A.,

Pieper, D.H., Vanhaecke, L., Van de Wiele, T., 2016. High-fiber and high-protein

diets shape different gut microbial communities, which ecologically behave similarly

under stress conditions, as shown in a gastrointestinal simulator. Mol. Nutr. Food Res.

doi:10.1002/mnfr.201600150


Galactosidase production by Streptococcus thermophilus is higher in the small

intestine than in the caecum of human-microbiota-associated mice after lactose

supplementation. Br. J. Nutr. 96, 177–181.

Mater, D.D.G., Bretigny, L., Firmesse, O., Flores, M.-J., Mogenet, A., Bresson, J.-L.,

Corthier, G., 2005. Streptococcus thermophilus and Lactobacillus delbrueckii subsp.

bulgaricus survive gastrointestinal transit of healthy volunteers consuming yogurt.

FEMS Microbiol. Lett. 250, 185–187. doi:10.1016/j.femsle.2005.07.006

Mathot, A.G., Beliard, E., Thuault, D., 2003. Streptococcus thermophilus 580 produces a

bacteriocin potentially suitable for inhibition of Clostridium tyrobutyricum in hard

cheese. J. Dairy Sci. 86, 3068–3074. doi:10.3168/jds.S0022-0302(03)73906-X

Ménard, O., Cattenoz, T., Guillemin, H., Souchon, I., Deglaire, A., Dupont, D., Picque, D.,

2014. Validation of a new in vitro dynamic system to simulate infant digestion. Food

Chem. 145, 1039–1045. doi:10.1016/j.foodchem.2013.09.036

Mercuri, A., Passalacqua, A., Wickham, M.S.J., Faulks, R.M., Craig, D.Q.M., Barker, S.A.,

2011. The effect of composition and gastric conditions on the self-emulsification

process of ibuprofen-loaded self-emulsifying drug delivery systems: a microscopic

and dynamic gastric model study. Pharm. Res. 28, 1540–1551. doi:10.1007/s11095-

011-0387-8

Metchnikoff, E., 1907. The prolongation of life; optimistic studies,. Heinemann, London.

Meullenet, J.-F., Gandhapuneni, R.K., 2006. Development of the BITE Master II and its

application to the study of cheese hardness. Physiol. Behav. 89, 39–43.

doi:10.1016/j.physbeh.2006.05.012

Minekus, M., 2015. Chapter 5: The TNO Gastro-Intestinal Model (TIM), in: Verhoeckx, K.,

Cotter, P., López-Expósito, I., Kleiveland, C., Lea, T., Mackie, A., Requena, T.,

Swiatecka, D., Wichers, H. (Eds.), The Impact of Food Bioactives on Health. Springer

International Publishing, Cham, pp. 37–46.

Minekus, M., Alminger, M., Alvito, P., Ballance, S., Bohn, T., Bourlieu, C., Carrière, F.,

Boutrou, R., Corredig, M., Dupont, D., Dufour, C., Egger, L., Golding, M., Karakaya,

S., Kirkhus, B., Le Feunteun, S., Lesmes, U., Macierzanka, A., Mackie, A., Marze, S.,

McClements, D.J., Ménard, O., Recio, I., Santos, C.N., Singh, R.P., Vegarud, G.E.,

Wickham, M.S.J., Weitschies, W., Brodkorb, A., 2014. A standardised static in vitro


225

digestion method suitable for food - an international consensus. Food Funct. 5, 1113–

1124. doi:10.1039/c3fo60702j

Minekus, M., Marteau, P., Havenaar, R., Huis in’t Veld, J.H., 1995. A multicompartmental

dynamic computer-controlled model simulating the stomach and small intestine.

ATLA 197–209.

Minekus, M., Smeets-Peeters, M., Bernalier, A., Marol-Bonnin, S., Havenaar, R., Marteau, P.,

Alric, M., Fonty, G., Huis in’t Veld, J.H., 1999. A computer-controlled system to

simulate conditions of the large intestine with peristaltic mixing, water absorption and

absorption of fermentation products. Appl. Microbiol. Biotechnol. 53, 108–114.

Minelli, E.B., Benini, A., 2008. Relationship between number of bacteria and their probiotic

effects. Microb. Ecol. Health Dis. 20, 180–183. doi:10.1080/08910600802408095

Miquel, S., Beaumont, M., Martín, R., Langella, P., Braesco, V., Thomas, M., 2015. A

proposed framework for an appropriate evaluation scheme for microorganisms as

novel foods with a health claim in Europe. Microb. Cell Factories 14, 48.

doi:10.1186/s12934-015-0229-1

Miszczycha, S.D., Thévenot, J., Denis, S., Callon, C., Livrelli, V., Alric, M., Montel, M.-C.,

Blanquet-Diot, S., Thevenot-Sergentet, D., 2014. Survival of Escherichia coli

O26:H11 exceeds that of Escherichia coli O157:H7 as assessed by simulated human

digestion of contaminated raw milk cheeses. Int. J. Food Microbiol. 172, 40–48.


Molly, K., Vande Woestyne, M., Verstraete, W., 1993. Development of a 5-step multi-

chamber reactor as a simulation of the human intestinal microbial ecosystem. Appl.

Microbiol. Biotechnol. 39, 254–258.

Monnet, C., Mora, D., Corrieu, G., 2005. Glutamine synthesis is essential for growth of

Streptococcus thermophilus in milk and is linked to urea catabolism. Appl. Environ.

Microbiol. 71, 3376–3378. doi:10.1128/AEM.71.6.3376-3378.2005

Montalto, M., D’Onofrio, F., Gallo, A., Cazzato, A., Gasbarrini, G., 2009. Intestinal

microbiota and its functions. Dig. Liver Dis. Suppl., Bacteria, gas and functional

gastrointestinal disorders 3, 30–34. doi:10.1016/S1594-5804(09)60016-4

Mora, D., Fortina, M.G., Parini, C., Ricci, G., Gatti, M., Giraffa, G., Manachini, P.L., 2002.

Genetic diversity and technological properties of Streptococcus thermophilus strains

isolated from dairy products. J. Appl. Microbiol. 93, 278–287.

Mozzi, F., Gerbino, E., Font de Valdez, G., Torino, M.I., 2009. Functionality of

exopolysaccharides produced by lactic acid bacteria in an in vitro gastric system. J.

Appl. Microbiol. 107, 56–64. doi:10.1111/j.1365-2672.2009.04182.x

Nagpal, R., Kumar, A., Kumar, M., Behare, P.V., Jain, S., Yadav, H., 2012. Probiotics, their

health benefits and applications for developing healthier foods: a review. FEMS

Microbiol. Lett. 334, 1–15. doi:10.1111/j.1574-6968.2012.02593.x


226

Nakamura, K., Sakyragi, N., Takakuwa, A., Ayabe, T., 2016. Paneth cell α-defensins and

enteric microbiota in health and disease. Biosci. Microbiota Food Health 35, 57–67.

doi:10.12938/bmfh.2015-019

Nalin, T., Venema, K., Weinstein, D.A., de Souza, C.F.M., Perry, I.D.S., van Wandelen,

M.T.R., van Rijn, M., Smit, G.P.A., Schwartz, I.V.D., Derks, T.G.J., 2015. In vitro

digestion of starches in a dynamic gastrointestinal model: an innovative study to

optimize dietary management of patients with hepatic glycogen storage diseases. J.

Inherit. Metab. Dis. 38, 529–536. doi:10.1007/s10545-014-9763-y

Nardone, G., Compare, D., 2015. The human gastric microbiota: Is it time to rethink the

pathogenesis of stomach diseases? United Eur. Gastroenterol. J. 3, 255–260.

doi:10.1177/2050640614566846

Näse, L., Hatakka, K., Savilahti, E., Saxelin, M., Pönkä, A., Poussa, T., Korpela, R.,

Meurman, J.H., 2001. Effect of long-term consumption of a probiotic bacterium,

Lactobacillus rhamnosus GG, in milk on dental caries and caries risk in children.

Caries Res. 35, 412–420.

Nimalaratne, C., Savard, P., Gauthier, S.F., Schieber, A., Wu, J., 2015. Bioaccessibility and

digestive stability of carotenoids in cooked eggs studied using a dynamic in vitro

gastrointestinal model. J. Agric. Food Chem. 63, 2956–2962. doi:10.1021/jf505615w

Northfield, T.C., McColl, I., 1973. Postprandial concentrations of free and conjugated bile

acids down the length of the normal human small intestine. Gut 14, 513–518.

O’Callaghan, A., van Sinderen, D., 2016. Bifidobacteria and Their Role as Members of the

Human Gut Microbiota. Front. Microbiol. 7. doi:10.3389/fmicb.2016.00925

Ogita, T., Bergamo, P., Maurano, F., D’Arienzo, R., Mazzarella, G., Bozzella, G., Luongo,

D., Sashihara, T., Suzuki, T., Tanabe, S., Rossi, M., 2015. Modulatory activity of

Lactobacillus rhamnosus OLL2838 in a mouse model of intestinal immunopathology.

Immunobiology 220, 701–710. doi:10.1016/j.imbio.2015.01.004


thermophilus ST28 ameliorates colitis in mice partially by suppression of

inflammatory Th17 cells. J. Biomed. Biotechnol. 2011, 378417.

doi:10.1155/2011/378417

Ogita, T., Tanii, Y., Morita, H., Suzuki, T., Tanabe, S., 2011b. Suppression of Th17 response

by Streptococcus thermophilus ST28 through induction of IFN-γ. Int. J. Mol. Med. 28,

817–822. doi:10.3892/ijmm.2011.755

Ohno, H., 2016. Intestinal M cells. J. Biochem. (Tokyo) 159, 151–160.

doi:10.1093/jb/mvv121

Oomen, A.G., Rompelberg, C.J.M., Bruil, M.A., Dobbe, C.J.G., Pereboom, D.P.K.H., Sips,

A.J. a. M., 2003. Development of an in vitro digestion model for estimating the

bioaccessibility of soil contaminants. Arch. Environ. Contam. Toxicol. 44, 281–287.

doi:10.1007/s00244-002-1278-0


227

Osorio, C.G., Crawford, J.A., Michalski, J., Martinez-Wilson, H., Kaper, J.B., Camilli, A.,

2005. Second-Generation Recombination-Based In Vivo Expression Technology for

Large-Scale Screening for Vibrio cholerae Genes Induced during Infection of the

Mouse Small Intestine. Infect. Immun. 73, 972–980. doi:10.1128/IAI.73.2.972-

980.2005

Ouethrani, M., Van de Wiele, T., Verbeke, E., Bruneau, A., Carvalho, M., Rabot, S., Camel,

V., 2013. Metabolic fate of ochratoxin A as a coffee contaminant in a dynamic

simulator of the human colon. Food Chem. 141, 3291–3300.

doi:10.1016/j.foodchem.2013.05.157

Palma, M.L., Zamith-Miranda, D., Martins, F.S., Bozza, F.A., Nimrichter, L., Montero-

Lomeli, M., Marques, E.T.A., Douradinha, B., 2015. Probiotic Saccharomyces

cerevisiae strains as biotherapeutic tools: is there room for improvement? Appl.

Microbiol. Biotechnol. 99, 6563–6570. doi:10.1007/s00253-015-6776-x

Parker, R.B., 1974. Probiotics, the other half of the story. Anim. Nutr. Health 29, 4–8.

Patro-Golab, B., Shamir, R., Szajewska, H., 2015. Yogurt for treating antibiotic-associated

diarrhea: Systematic review and meta-analysis. Nutr. Burbank Los Angel. Cty. Calif

31, 796–800. doi:10.1016/j.nut.2014.11.013

Pedrosa, M.C., Golner, B.B., Goldin, B.R., Barakat, S., Dallal, G.E., Russell, R.M., 1995.

Survival of yogurt-containing organisms and Lactobacillus gasseri (ADH) and their

effect on bacterial enzyme activity in the gastrointestinal tract of healthy and

hypochlorhydric elderly subjects. Am. J. Clin. Nutr. 61, 353–359.

Peralta, G.H., Bergamini, C.V., Hynes, E.R., 2016. Aminotransferase and glutamate

dehydrogenase activities in lactobacilli and streptococci. Braz. J. Microbiol. 47, 741–

748. doi:10.1016/j.bjm.2016.04.005

Perez, P.F., Antoni, G.L. de, Añon, M.C., 1991. Formate Production by Streptococcus

thermophilus Cultures. J. Dairy Sci. 74, 2850–2854. doi:10.3168/jds.S0022-

0302(91)78465-8

Peterson, L.W., Artis, D., 2014. Intestinal epithelial cells: regulators of barrier function and

immune homeostasis. Nat. Rev. Immunol. 14, 141–153. doi:10.1038/nri3608

Pitino, I., Randazzo, C.L., Cross, K.L., Parker, M.L., Bisignano, C., Wickham, M.S.J.,

Mandalari, G., Caggia, C., 2012. Survival of Lactobacillus rhamnosus strains

inoculated in cheese matrix during simulated human digestion. Food Microbiol. 31,

57–63. doi:10.1016/j.fm.2012.02.013

Pochart, P., Dewit, O., Desjeux, J.-F., Bourlioux, P., 1989. Viable starter culture, beta-

galactosidase activity, and lactose in duodenum after yogurt ingestion in lactase-

deficient humans. Am. J. Clin. Nutr. 49, 828–831.

Poolman, B., 1993. Energy transduction in lactic acid bacteria. FEMS Microbiol. Rev. 12,

125–147.


228

Poolman, B., Royer, T.J., Mainzer, S.E., Schmidt, B.F., 1990. Carbohydrate utilization in

Streptococcus thermophilus: characterization of the genes for aldose 1-epimerase

(mutarotase) and UDPglucose 4-epimerase. J. Bacteriol. 172, 4037–4047.

Possemiers, S., Marzorati, M., Verstraete, W., Van de Wiele, T., 2010. Bacteria and

chocolate: a successful combination for probiotic delivery. Int. J. Food Microbiol. 141,

97–103. doi:10.1016/j.ijfoodmicro.2010.03.008

Possemiers, S., Pinheiro, I., Verhelst, A., Van den Abbeele, P., Maignien, L., Laukens, D.,

Reeves, S.G., Robinson, L.E., Raas, T., Schneider, Y.-J., Van de Wiele, T., Marzorati,

M., 2013. A dried yeast fermentate selectively modulates both the luminal and

mucosal gut microbiota and protects against inflammation, as studied in an integrated

in vitro approach. J. Agric. Food Chem. 61, 9380–9392. doi:10.1021/jf402137r

Preidis, G.A., Hill, C., Guerrant, R.L., Ramakrishna, B.S., Tannock, G.W., Versalovic, J.,

2011. Probiotics, enteric and diarrheal diseases, and global health. Gastroenterology

140, 8–14. doi:10.1053/j.gastro.2010.11.010

Prescott, L.M., Willey, J.M., Sherwood, L.M., Woolverton, C.J., 2013. Microbiologie, 4e

édition. ed. De Boeck, Bruxelles.

Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K.S., Manichanh, C., Nielsen, T., Pons, N.,

Levenez, F., Yamada, T., Mende, D.R., Li, J., Xu, J., Li, S., Li, D., Cao, J., Wang, B.,

Liang, H., Zheng, H., Xie, Y., Tap, J., Lepage, P., Bertalan, M., Batto, J.-M., Hansen,

T., Le Paslier, D., Linneberg, A., Nielsen, H.B., Pelletier, E., Renault, P., Sicheritz-

Ponten, T., Turner, K., Zhu, H., Yu, C., Li, S., Jian, M., Zhou, Y., Li, Y., Zhang, X.,

Li, S., Qin, N., Yang, H., Wang, J., Brunak, S., Doré, J., Guarner, F., Kristiansen, K.,

Pedersen, O., Parkhill, J., Weissenbach, J., Antolin, M., Artiguenave, F., Blottiere, H.,

Borruel, N., Bruls, T., Casellas, F., Chervaux, C., Cultrone, A., Delorme, C., Denariaz,

G., Dervyn, R., Forte, M., Friss, C., van de Guchte, M., Guedon, E., Haimet, F., Jamet,

A., Juste, C., Kaci, G., Kleerebezem, M., Knol, J., Kristensen, M., Layec, S., Le Roux,

K., Leclerc, M., Maguin, E., Melo Minardi, R., Oozeer, R., Rescigno, M., Sanchez, N.,

Tims, S., Torrejon, T., Varela, E., de Vos, W., Winogradsky, Y., Zoetendal, E., Bork,

P., Ehrlich, S.D., Wang, J., 2010. A human gut microbial gene catalogue established

by metagenomic sequencing. Nature 464, 59–65. doi:10.1038/nature08821

Rainey, P.B., 1999. Adaptation of Pseudomonas fluorescens to the plant rhizosphere.

Environ. Microbiol. 1, 243–257.

Rambaud, J.-C., Buts, J.-P., Corthier, G., Flourié, B., 2004. Flore microbienne intestinale,

Gastroentérologie - Hors collection. John Libbey Eurotext.

Rasmussen, T.B., Danielsen, M., Valina, O., Garrigues, C., Johansen, E., Pedersen, M.B.,

2008. Streptococcus thermophilus core genome: comparative genome hybridization

study of 47 strains. Appl. Environ. Microbiol. 74, 4703–4710.

doi:10.1128/AEM.00132-08

Rediers, H., Rainey, P.B., Vanderleyden, J., De Mot, R., 2005. Unraveling the Secret Lives of

Bacteria: Use of In Vivo Expression Technology and Differential Fluorescence

Induction Promoter Traps as Tools for Exploring Niche-Specific Gene Expression.

Microbiol. Mol. Biol. Rev. 69, 217–261. doi:10.1128/MMBR.69.2.217-261.2005


229

Resta-Lenert, S., Barrett, K.E., 2003. Live probiotics protect intestinal epithelial cells from

the effects of infection with Enteroinvasive Escherichia coli (EIEC). Gut 52, 988–997.

Rodes, L., Tomaro-Duchesneau, C., Saha, S., Paul, A., Malhotra, M., Marinescu, D., Shao,

W., Kahouli, I., Prakash, S., 2014. Enrichment of Bifidobacterium longum subsp.

infantis ATCC 15697 within the human gut microbiota using alginate-poly-L-lysine-

alginate microencapsulation oral delivery system: an in vitro analysis using a

computer-controlled dynamic human gastrointestinal model. J. Microencapsul. 31,

230–238. doi:10.3109/02652048.2013.834990

Rodríguez, C., Medici, M., Mozzi, F., Font de Valdez, G., 2010. Therapeutic effect of

Streptococcus thermophilus CRL 1190-fermented milk on chronic gastritis. World J.

Gastroenterol. 16, 1622–1630.

Rodríguez, C., Medici, M., Rodríguez, A.V., Mozzi, F., Font de Valdez, G., 2009. Prevention

of chronic gastritis by fermented milks made with exopolysaccharide-producing

Streptococcus thermophilus strains. J. Dairy Sci. 92, 2423–2434.

doi:10.3168/jds.2008-1724

Rossi, F., Gardini, F., Rizzotti, L., La Gioia, F., Tabanelli, G., Torriani, S., 2011. Quantitative

Analysis of Histidine Decarboxylase Gene (hdcA) Transcription and Histamine

Production by Streptococcus thermophilus PRI60 under Conditions Relevant to

Cheese Making. Appl. Environ. Microbiol. 77, 2817–2822. doi:10.1128/AEM.02531-

10

Rossi, F., Marzotto, M., Cremonese, S., Rizzotti, L., Torriani, S., 2013. Diversity of

Streptococcus thermophilus in bacteriocin production; inhibitory spectrum and

occurrence of thermophilin genes. Food Microbiol. 35, 27–33.

doi:10.1016/j.fm.2013.02.006

Roth, S., Franken, P., Sacchetti, A., Kremer, A., Anderson, K., Sansom, O., Fodde, R., 2012.

Paneth Cells in Intestinal Homeostasis and Tissue Injury. PLoS ONE 7.


Roussel, C., Cordonnier, C., Galia, W., Le Goff, O., Thévenot, J., Chalancon, S., Alric, M.,

Thevenot-Sergentet, D., Leriche, F., Van de Wiele, T., Livrelli, V., Blanquet-Diot, S.,

2016. Increased EHEC survival and virulence gene expression indicate an enhanced

pathogenicity upon simulated pediatric gastrointestinal conditions. Pediatr. Res.

doi:10.1038/pr.2016.144

Rul, F., Ben-Yahia, L., Chegdani, F., Wrzosek, L., Thomas, S., Noordine, M.-L., Gitton, C.,

Cherbuy, C., Langella, P., Thomas, M., 2011. Impact of the Metabolic Activity of

Streptococcus thermophilus on the Colon Epithelium of Gnotobiotic Rats. J. Biol.

Chem. 286, 10288–10296. doi:10.1074/jbc.M110.168666

Rul, F., Monnet, V., 1997. Presence of additional peptidases in Streptococcus thermophilus

CNRZ 302 compared to Lactococcus lactis. J. Appl. Microbiol. 82, 695–704.

Saavedra, J.M., Abi-Hanna, A., Moore, N., Yolken, R.H., 2004. Long-term consumption of

infant formulas containing live probiotic bacteria: tolerance and safety. Am. J. Clin.

Nutr. 79, 261–267.


230

Saavedra, J.M., Bauman, N.A., Oung, I., Perman, J.A., Yolken, R.H., 1994. Feeding of

Bifidobacterium bifidum and Streptococcus thermophilus to infants in hospital for

prevention of diarrhoea and shedding of rotavirus. Lancet Lond. Engl. 344, 1046–

1049.

Salles, C., Tarrega, A., Mielle, P., Maratray, J., Gorria, P., Liaboeuf, J., Liodenot, J.-J., 2007.

Development of a chewing simulator for food breakdown and the analysis of in vitro

flavor compound release in a mouth environment. J. Food Eng. 82, 189–198.

doi:10.1016/j.jfoodeng.2007.02.008

Salminen, S., 1996. Uniqueness of probiotic strains. IDF Nutr. Newsl. 5, 16–18.

Salminen, S., Ouwehand, A., Benno, Y., Lee, Y.K., 1999. Probiotics: how should they be

defined? Trends Food Sci. Technol. 10, 107–110. doi:10.1016/S0924-2244(99)00027-

8

Schaafsma, G., 1996. State-of-the-art concerning probiotic strains in milk products. IDF Nutr.

Newsl. 5, 23–25.

Schleifer, K.H., Ehrmann, M., Krusch, U., Neve, H., 1991. Revival of the species

Streptococcus thermophilus (ex Orla-Jensen, 1919) nom. rev. Syst. Appl. Microbiol.

14, 386–388.

Schrezenmeir, J., de Vrese, M., 2001. Probiotics, prebiotics, and synbiotics--approaching a

definition. Am. J. Clin. Nutr. 73, 361S–364S.

Schuldt, L., Weyand, S., Kefala, G., Weiss, M.S., 2009. The three-dimensional Structure of a

mycobacterial DapD provides insights into DapD diversity and reveals unexpected

particulars about the enzymatic mechanism. J. Mol. Biol. 389, 863–879.

doi:10.1016/j.jmb.2009.04.046

Selsted, M.E., Ouellette, A.J., 2005. Mammalian defensins in the antimicrobial immune

response. Nat. Immunol. 6, 551–557. doi:10.1038/ni1206

Senok, A.C., Ismaeel, A.Y., Botta, G.A., 2005. Probiotics: facts and myths. Clin. Microbiol.

Infect. 11, 958–966. doi:10.1111/j.1469-0691.2005.01228.x

Shah, N.P., 2007. Functional cultures and health benefits. Int. Dairy J. 17, 1262–1277.

doi:10.1016/j.idairyj.2007.01.014

Shahbal, S., Hemme, D., Desmazeaud, M., 1991. High cell wall-associated proteinase activity

of some Streptococcus thermophilus strains (H-strains) correlated with a high

acidification rate in milk. Le Lait 71, 351–357.

Sherwood, L., 2015. Physiologie humaine. De Boeck.

Sieuwerts, S., de Bok, F.A.M., Hugenholtz, J., van Hylckama Vlieg, J.E.T., 2008. Unraveling

microbial interactions in food fermentations: from classical to genomics approaches.


Simrén, M., Barbara, G., Flint, H.J., Spiegel, B.M.R., Spiller, R.C., Vanner, S., Verdu, E.F.,

Whorwell, P.J., Zoetendal, E.G., 2013. Intestinal microbiota in functional bowel


231

disorders: a Rome foundation report. Gut 62, 159–176. doi:10.1136/gutjnl-2012-

302167

Sivieri, K., Morales, M.L.V., Adorno, M.A.T., Sakamoto, I.K., Saad, S.M.I., Rossi, E.A.,

2013. Lactobacillus acidophilus CRL 1014 improved “gut health” in the SHIME

reactor. BMC Gastroenterol. 13, 100. doi:10.1186/1471-230X-13-100

Sokol, H., Pigneur, B., Watterlot, L., Lakhdari, O., Bermúdez-Humarán, L.G., Gratadoux, J.-

J., Blugeon, S., Bridonneau, C., Furet, J.-P., Corthier, G., Grangette, C., Vasquez, N.,

Pochart, P., Trugnan, G., Thomas, G., Blottière, H.M., Doré, J., Marteau, P., Seksik,

P., Langella, P., 2008. Faecalibacterium prausnitzii is an anti-inflammatory

commensal bacterium identified by gut microbiota analysis of Crohn disease patients.

Proc. Natl. Acad. Sci. U. S. A. 105, 16731–16736. doi:10.1073/pnas.0804812105

Solovyev, V., Salamov, A., 2011. Automatic Annotation of Microbial Genomes and

Metagenomic Sequences. In Metagenomics and its Applications in Agriculture,

Biomedicine and Environmental Studies. Nova Sci. Publ., Ed. R.W. Li 61–78.

Sperti, G.S., 1971. Probiotics. AVI Publishing Co. Inc., West Point, Connecticut.

Stensson, M., Koch, G., Coric, S., Abrahamsson, T.R., Jenmalm, M.C., Birkhed, D., Wendt,

L.-K., 2014. Oral administration of Lactobacillus reuteri during the first year of life

reduces caries prevalence in the primary dentition at 9 years of age. Caries Res. 48,

111–117. doi:10.1159/000354412

Sun, Z., Chen, X., Wang, J., Zhao, W., Shao, Y., Wu, L., Zhou, Z., Sun, T., Wang, L., Meng,

H., Zhang, H., Chen, W., 2011. Complete genome sequence of Streptococcus

thermophilus strain ND03. J. Bacteriol. 193, 793–794. doi:10.1128/JB.01374-10

Takahashi, N., Abbe, K., Takahashi-Abbe, S., Yamada, T., 1987. Oxygen sensitivity of sugar

metabolism and interconversion of pyruvate formate-lyase in intact cells of

Streptococcus mutans and Streptococcus sanguis. Infect. Immun. 55, 652–656.

Takamatsu, D., Osaki, M., Sekizaki, T., 2001. Thermosensitive suicide vectors for gene

replacement in Streptococcus suis. Plasmid 46, 140–148. doi:10.1006/plas.2001.1532

Takayama, S., Fujii, M., Kurosawa, A., Adachi, N., Ayusawa, D., 2007. Overexpression of

HAM1 gene detoxifies 5-bromodeoxyuridine in the yeast Saccharomyces cerevisiae.

Curr. Genet. 52, 203–211. doi:10.1007/s00294-007-0152-z

Tamime, A.Y., Robinson, R.K., 2007. Tamime and Robinson’s yoghurt : science and

technology. Woodhead Publishing Limited.

Teanpaisan, R., Piwat, S., 2014. Lactobacillus paracasei SD1, a novel probiotic, reduces

mutans streptococci in human volunteers: a randomized placebo-controlled trial. Clin.

Oral Investig. 18, 857–862. doi:10.1007/s00784-013-1057-5

Terahara, M., Kurama, S., Takemoto, N., 2001. Prevention by lactic acid bacteria of the

oxidation of human LDL. Biosci. Biotechnol. Biochem. 65, 1864–1868.

Terzaghi, B.E., Sandine, W.E., 1975. Improved medium for lactic streptococci and their

bacteriophages. Appl. Microbiol. 29, 807–813.


232

Thevenard, B., Rasoava, N., Fourcassié, P., Monnet, V., Boyaval, P., Rul, F., 2011.

Characterization of Streptococcus thermophilus two-component systems: In silico

analysis, functional analysis and expression of response regulator genes in pure or

mixed culture with its yogurt partner, Lactobacillus delbrueckii subsp. bulgaricus. Int.

J. Food Microbiol. 151, 171–181. doi:10.1016/j.ijfoodmicro.2011.08.019

Thévenot, J., Cordonnier, C., Rougeron, A., Le Goff, O., Nguyen, H.T.T., Denis, S., Alric,

M., Livrelli, V., Blanquet-Diot, S., 2015. Enterohemorrhagic Escherichia coli

infection has donor-dependent effect on human gut microbiota and may be

antagonized by probiotic yeast during interaction with Peyer’s patches. Appl.

Microbiol. Biotechnol. 99, 9097–9110. doi:10.1007/s00253-015-6704-0

Thibessard, A., Borges, F., Fernandez, A., Gintz, B., Decaris, B., Leblond-Bourget, N., 2004.

Identification of Streptococcus thermophilus CNRZ368 genes involved in defense

against superoxide stress. Appl. Environ. Microbiol. 70, 2220–2229.

Thibessard, A., Fernandez, A., Gintz, B., Leblond-Bourget, N., Decaris, B., 2001. Hydrogen

peroxide effects on Streptococcus thermophilus CNRZ368 cell viability. Res.

Microbiol. 152, 593–596.

Thomas, M., Wrzosek, L., Ben-Yahia, L., Noordine, M.-L., Gitton, C., Chevret, D., Langella,

P., Mayeur, C., Cherbuy, C., Rul, F., 2011. Carbohydrate Metabolism Is Essential for

the Colonization of Streptococcus thermophilus in the Digestive Tract of Gnotobiotic

Rats. PLoS ONE 6, e28789. doi:10.1371/journal.pone.0028789

Tian, F., Chi, F., Wang, G., Liu, X., Zhang, Q., Chen, Y., Zhang, H., Chen, W., 2015.

Lactobacillus rhamnosus CCFM1107 treatment ameliorates alcohol-induced liver

injury in a mouse model of chronic alcohol feeding. J. Microbiol. Seoul Korea 53,

856–863. doi:10.1007/s12275-015-5239-5

Tian, H., Tan, J., Zhang, L., Gu, X., Xu, W., Guo, X., Luo, Y., 2012. Increase of stress

resistance in Lactococcus lactis via a novel food-grade vector expressing a shsp gene

from Streptococcus thermophilus. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 43,

1157–1164. doi:10.1590/S1517-838220120003000043

Ting, Y., Jiang, Y., Lan, Y., Xia, C., Lin, Z., Rogers, M.A., Huang, Q., 2015. Viscoelastic

Emulsion Improved the Bioaccessibility and Oral Bioavailability of Crystalline

Compound: A Mechanistic Study Using in Vitro and in Vivo Models. Mol. Pharm. 12,

2229–2236. doi:10.1021/mp5007322

Tompkins, T.A., Mainville, I., Arcand, Y., 2011. The impact of meals on a probiotic during

transit through a model of the human upper gastrointestinal tract. Benef. Microbes 2,

295–303. doi:10.3920/BM2011.0022

Tottey, W., Denonfoux, J., Jaziri, F., Parisot, N., Missaoui, M., Hill, D., Borrel, G.,

Peyretaillade, E., Alric, M., Harris, H.M.B., Jeffery, I.B., Claesson, M.J., O’Toole,

P.W., Peyret, P., Brugère, J.-F., 2013. The human gut chip “HuGChip”, an explorative

phylogenetic microarray for determining gut microbiome diversity at family level.

PloS One 8, e62544. doi:10.1371/journal.pone.0062544


233

Trabelsi, I., Ktari, N., Ben Slima, S., Hamden, K., Ben Salah, R., 2016. Effect of a probiotic

Lactobacillus plantarum TN8 strain on trinitrobenzene sulphonic acid-induced colitis

in rats. J. Anim. Physiol. Anim. Nutr. doi:10.1111/jpn.12536

Trip, H., Mulder, N.L., Lolkema, J.S., 2012. Improved acid stress survival of Lactococcus

lactis expressing the histidine decarboxylation pathway of Streptococcus thermophilus

CHCC1524. J. Biol. Chem. 287, 11195–11204. doi:10.1074/jbc.M111.330704

Truchado, P., Van den Abbeele, P., Rivière, A., Possemiers, S., De Vuyst, L., Van de Wiele,

T., 2015. Bifidobacterium longum D2 enhances microbial degradation of long-chain

arabinoxylans in an in vitro model of the proximal colon. Benef. Microbes 6, 849–860.

doi:10.3920/BM2015.0023

Tuntufye, H.N., Lebeer, S., Gwakisa, P.S., Goddeeris, B.M., 2012. Identification of Avian

Pathogenic Escherichia coli Genes That Are Induced In Vivo during Infection in

Chickens. Appl. Environ. Microbiol. 78, 3343–3351. doi:10.1128/AEM.07677-11

Uriot, O., Galia, W., Awussi, A.A., Perrin, C., Denis, S., Chalancon, S., Lorson, E., Poirson,

C., Junjua, M., Le Roux, Y., Alric, M., Dary, A., Blanquet-Diot, S., Roussel, Y., 2016.

Use of the dynamic gastro-intestinal model TIM to explore the survival of the yogurt

bacterium Streptococcus thermophilus and the metabolic activities induced in the

simulated human gut. Food Microbiol. 53, 18–29. doi:10.1016/j.fm.2015.05.007

Vaillancourt, K., Bédard, N., Bart, C., Tessier, M., Robitaille, G., Turgeon, N., Frenette, M.,

Moineau, S., Vadeboncoeur, C., 2008. Role of galK and galM in Galactose

Metabolism by Streptococcus thermophilus. Appl. Environ. Microbiol. 74, 1264–

1267. doi:10.1128/AEM.01585-07

Vaillancourt, K., LeMay, J.-D., Lamoureux, M., Frenette, M., Moineau, S., Vadeboncoeur,

C., 2004. Characterization of a galactokinase-positive recombinant strain of

Streptococcus thermophilus. Appl. Environ. Microbiol. 70, 4596–4603.

doi:10.1128/AEM.70.8.4596-4603.2004

Vaillancourt, K., Moineau, S., Frenette, M., Lessard, C., Vadeboncoeur, C., 2002. Galactose

and lactose genes from the galactose-positive bacterium Streptococcus salivarius and

the phylogenetically related galactose-negative bacterium Streptococcus thermophilus:

organization, sequence, transcription, and activity of the gal gene products. J.

Bacteriol. 184, 785–793.

Valdivia, R.H., Falkow, S., 1996. Bacterial genetics by flow cytometry: rapid isolation of

Salmonella typhimurium acid-inducible promoters by differential fluorescence

induction. Mol. Microbiol. 22, 367–378.

Van den Abbeele, P., Roos, S., Eeckhaut, V., MacKenzie, D.A., Derde, M., Verstraete, W.,

Marzorati, M., Possemiers, S., Vanhoecke, B., Van Immerseel, F., Van de Wiele, T.,

2012. Incorporating a mucosal environment in a dynamic gut model results in a more

representative colonization by lactobacilli. Microb. Biotechnol. 5, 106–115.

doi:10.1111/j.1751-7915.2011.00308.x

van den Bogaard, P.T., Kleerebezem, M., Kuipers, O.P., de Vos, W.M., 2000. Control of

lactose transport, beta-galactosidase activity, and glycolysis by CcpA in Streptococcus

thermophilus: evidence for carbon catabolite repression by a non-


234

phosphoenolpyruvate-dependent phosphotransferase system sugar. J. Bacteriol. 182,

5982–5989.

van den Bogaard, P.T.C., Hols, P., Kuipers, O.P., Kleerebezem, M., de Vos, W.M., 2004.

Sugar utilisation and conservation of the gal-lac gene cluster in Streptococcus

thermophilus. Syst. Appl. Microbiol. 27, 10–17. doi:10.1078/0723-2020-00258

Van Wey, A.S., Cookson, A.L., Roy, N.C., McNabb, W.C., Soboleva, T.K., Wieliczko, R.J.,

Shorten, P.R., 2014. A mathematical model of the effect of pH and food matrix

composition on fluid transport into foods: An application in gastric digestion and

cheese brining. Food Res. Int. 57, 34–43. doi:10.1016/j.foodres.2014.01.002

Vanhaecke, L., Grootaert, C., Verstraete, W., Van de Wiele, T., 2009. Chemopreventive

effects from prebiotic inulin towards microbial 2-amino-1-methyl-6-

phenylimidazo[4,5-b]pyridine bioactivation. J. Appl. Microbiol. 106, 474–485.

doi:10.1111/j.1365-2672.2008.04015.x

Vasiljevic, T., Shah, N.P., 2008. Probiotics—From Metchnikoff to bioactives. Int. Dairy J.,

Milestone Achievements in Dairy Science Research and their Current and Future

Industrial Applications. Proceedings of a Symposium marking the retirement of

Professor Paul Jelen from active service at University of Alberta, Canada 18, 714–728.

doi:10.1016/j.idairyj.2008.03.004

Vaughan, E.E., van den Bogaard, P.T.C., Catzeddu, P., Kuipers, O.P., de Vos, W.M., 2001.

Activation of Silent gal Genes in the lac-gal Regulon of Streptococcus thermophilus.

J. Bacteriol. 183, 1184–1194. doi:10.1128/JB.183.4.1184-1194.2001

Veenhoff, L.M., Heuberger, E.H., Poolman, B., 2001. The lactose transport protein is a

cooperative dimer with two sugar translocation pathways. EMBO J. 20, 3056–3062.

doi:10.1093/emboj/20.12.3056

Venema, K., van den Abbeele, P., 2013. Experimental models of the gut microbiome. Best

Pract. Res. Clin. Gastroenterol., The Gut Microbiome 27, 115–126.

doi:10.1016/j.bpg.2013.03.002

Venturi, A., Gionchetti, P., Rizzello, F., Johansson, R., Zucconi, E., Brigidi, P., Matteuzzi, D.,

Campieri, M., 1999. Impact on the composition of the faecal flora by a new probiotic

preparation: preliminary data on maintenance treatment of patients with ulcerative

colitis. Aliment. Pharmacol. Ther. 13, 1103–1108.

Vergin, F., 1954. [Antibiotics and probiotics]. Hippokrates 25, 116–119.

Vermeiren, J., Possemiers, S., Marzorati, M., Van de Wiele, T., 2011. The gut microbiota as a

target for innovative drug development: perspectives and a case study of inflammatory

bowel diseases. Chapitre 17. In-Tech.

Vermeiren, J., Van den Abbeele, P., Laukens, D., Vigsnaes, L.K., De Vos, M., Boon, N., Van

de Wiele, T., 2012. Decreased colonization of fecal Clostridium

coccoides/Eubacterium rectale species from ulcerative colitis patients in an in vitro

dynamic gut model with mucin environment. FEMS Microbiol. Ecol. 79, 685–696.

doi:10.1111/j.1574-6941.2011.01252.x


235

Verwei, M., Minekus, M., Zeijdner, E., Schilderink, R., Havenaar, R., 2016. Evaluation of

two dynamic in vitro models simulating fasted and fed state conditions in the upper

gastrointestinal tract (TIM-1 and tiny-TIM) for investigating the bioaccessibility of

pharmaceutical compounds from oral dosage forms. Int. J. Pharm. 498, 178–186.

doi:10.1016/j.ijpharm.2015.11.048

Vieira, A.T., Galvão, I., Amaral, F.A., Teixeira, M.M., Nicoli, J.R., Martins, F.S., 2015. Oral

treatment with Bifidobacterium longum 51A reduced inflammation in a murine

experimental model of gout. Benef. Microbes 6, 799–806. doi:10.3920/BM2015.0015

Villani, F., Pepe, O., Mauriello, G., Salzano, G., Moschetti, G., Coppola, S., 1995.

Antilisterial activity of thermophilin 347, a bacteriocin produced by Streptococcus

thermophilus. Int. J. Food Microbiol. 25, 179–190.

Villemejane, C., Denis, S., Marsset-Baglieri, A., Alric, M., Aymard, P., Michon, C., 2016. In

vitro digestion of short-dough biscuits enriched in proteins and/or fibres using a multi-

compartmental and dynamic system (2): Protein and starch hydrolyses. Food Chem.

190, 164–172. doi:10.1016/j.foodchem.2015.05.050

Vinderola, C.G., Reinheimer, J.A., 2003. Lactic acid starter and probiotic bacteria: a

comparative “in vitro” study of probiotic characteristics and biological barrier

resistance. Food Res. Int. 36, 895–904. doi:10.1016/S0963-9969(03)00098-X

Walker, A.W., Duncan, S.H., Louis, P., Flint, H.J., 2014. Phylogeny, culturing, and

metagenomics of the human gut microbiota. Trends Microbiol. 22, 267–274.

doi:10.1016/j.tim.2014.03.001

Wang, B., Xu, H., Xu, F., Zeng, Z., Wei, H., 2016. Efficacy of oral Bifidobacterium bifidum

ATCC 29521 on microflora and antioxidant in mice. Can. J. Microbiol. 62, 249–262.

doi:10.1139/cjm-2015-0685

Wang, Y., Huang, Y., 2014. Effect of Lactobacillus acidophilus and Bifidobacterium bifidum

supplementation to standard triple therapy on Helicobacter pylori eradication and

dynamic changes in intestinal flora. World J. Microbiol. Biotechnol. 30, 847–853.

doi:10.1007/s11274-013-1490-2

Ward, D.J., Somkuti, G.A., 1995. Characterization of a bacteriocin produced by

Streptococcus thermophilus ST134. Appl. Microbiol. Biotechnol. 43, 330–335.

West, C.E., Hammarström, M.-L., Hernell, O., 2009. Probiotics during weaning reduce the

incidence of eczema. Pediatr. Allergy Immunol. Off. Publ. Eur. Soc. Pediatr. Allergy

Immunol. 20, 430–437. doi:10.1111/j.1399-3038.2009.00745.x

West, N.P., Sansonetti, P.J., Frankel, G., Tang, C.M., 2003. Finding your niche: what has

been learnt from STM studies on GI colonization. Trends Microbiol. 11, 338–344.

Wilson, C.G., 2010. The transit of dosage forms through the colon. Int. J. Pharm. 395, 17–25.

doi:10.1016/j.ijpharm.2010.04.044

Wlodarska, M., Kostic, A.D., Xavier, R.J., 2015. An integrative view of microbiome-host

interactions in inflammatory bowel diseases. Cell Host Microbe 17, 577–591.

doi:10.1016/j.chom.2015.04.008


236

Woda, A., Mishellany-Dutour, A., Batier, L., François, O., Meunier, J.-P., Reynaud, B., Alric,

M., Peyron, M.-A., 2010. Development and validation of a mastication simulator. J.

Biomech. 43, 1667–1673. doi:10.1016/j.jbiomech.2010.03.002

Worsöe, J., Fynne, L., Gregersen, T., Schlageter, V., Christensen, L.A., Dahlerup, J.F.,

Rijkhoff, N.J., Laurberg, S., Krogh, K., 2011. Gastric transit and small intestinal

transit time and motility assessed by a magnet tracking system. BMC Gastroenterol.

11, 145. doi:10.1186/1471-230X-11-145

Xu, Q., Dziejman, M., Mekalanos, J.J., 2003. Determination of the transcriptome of Vibrio

cholerae during intraintestinal growth and midexponential phase in vitro. Proc. Natl.

Acad. Sci. U. S. A. 100, 1286–1291. doi:10.1073/pnas.0337479100

Yamamoto, M., Kashimoto, T., Tong, P., Xiao, J., Sugiyama, M., Inoue, M., Matsunaga, R.,

Hosohara, K., Nakata, K., Yokota, K., Oguma, K., Yamamoto, K., 2015. Signature-

tagged mutagenesis of Vibrio vulnificus. J. Vet. Med. Sci. 77, 823–828.

doi:10.1292/jvms.14-0655

Yin, N., Du, H., Zhang, Z., Cai, X., Li, Z., Sun, G., Cui, Y., 2016. Variability of arsenic

bioaccessibility and metabolism in soils by human gut microbiota using different in

vitro methods combined with SHIME. Sci. Total Environ. 566–567, 1670–1677.

doi:10.1016/j.scitotenv.2016.06.071

Ziar, H., Gérard, P., Riazi, A., 2014. Effect of prebiotic carbohydrates on growth, bile survival

and cholesterol uptake abilities of dairy-related bacteria. J. Sci. Food Agric. 94, 1184–

1190. doi:10.1002/jsfa.6395

Ziarno, M., 2010. Viability and cholesterol uptake by Streptococcus thermophilus cultures in

artificial GIT fluids. Acta Sci. Pol. Technol. Aliment. 9.

Zoetendal, E.G., von Wright, A., Vilpponen-Salmela, T., Ben-Amor, K., Akkermans, A.D.L.,

de Vos, W.M., 2002. Mucosa-associated bacteria in the human gastrointestinal tract

are uniformly distributed along the colon and differ from the community recovered

from feces. Appl. Environ. Microbiol. 68, 3401–3407.

Zotta, T., Ricciardi, A., Ciocia, F., Rossano, R., Parente, E., 2008a. Diversity of stress

responses in dairy thermophilic streptococci. Int. J. Food Microbiol. 124, 34–42.


Zotta, T., Ricciardi, A., Rossano, R., Parente, E., 2008b. Urease production by Streptococcus

thermophilus. Food Microbiol. 25, 113–119. doi:10.1016/j.fm.2007.07.001

Etude de la survie et identification des fonctions ...

Documents

Transcript of Etude de la survie et identification des fonctions ...