HAL Id: tel-01647210https://tel.archives-ouvertes.fr/tel-01647210

Submitted on 24 Nov 2017

HAL is a multi-disciplinary open accessarchive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come fromteaching and research institutions in France orabroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, estdestinée au dépôt et à la diffusion de documentsscientifiques de niveau recherche, publiés ou non,émanant des établissements d’enseignement et derecherche français ou étrangers, des laboratoirespublics ou privés.

Estimation des taux de mutation : implications pour ladiversification et l’évolution du phytoplancton eucaryote

Marc Krasovec

To cite this version:Marc Krasovec. Estimation des taux de mutation : implications pour la diversification et l’évolutiondu phytoplancton eucaryote. Génétique des plantes. Université Pierre et Marie Curie - Paris VI, 2016.Français. �NNT : 2016PA066371�. �tel-01647210�

  1  

Thèse de doctorat

Université Pierre et Marie Curie

Ecole doctorale « Complexité du vivant », ED 515

Estimation des taux de mutation :

implications pour la diversification et

l’évolution du phytoplancton eucaryote

Marc Krasovec

Le 19 Octobre 2016, à Banyuls sur mer

Gwenaël Piganeau Université Pierre et Marie Curie Directeur de thèse

Sophie Sanchez-Ferandin Université Pierre et Marie Curie Directeur de thèse

Vincent Laudet Université Pierre et Marie Curie Président de Jury

Laurent Duret CNRS, UMR 5558 Rapporteur

Olivier Tenaillon INSERM, UMR 1137 Rapporteur

Delphine Sicard INRA, UMR 1083 Examinateur

  2  

  3  

Remerciements

Ma plus profonde gratitude va à mes deux directrices de thèse, Gwenaël

Piganeau et Sophie Sanchez-Ferandin, pour m’avoir donné l’opportunité de réaliser

cette thèse avec elles, et surtout pour le soutien indéfectible et permanent durant

ces trois années. Au-delà de la grande qualité de l’encadrement qu’elles m’ont

apporté, j’ai pris un grand plaisir à travailler avec elles pour leurs nombreuses

qualités aussi bien professionnelles que relationnelles.

Ces trois années de thèse passées avec Gwenaël et Sophie ont été pour moi

un grand épanouissement professionnel et personnel, et constituent une unique et

excellente expérience pour ma vie future.

Je tiens également à adresser mes remerciements aux membres du jury pour

avoir accepté d’évaluer mon travail, Laurent Duret, Olivier Tenaillon, Delphine Sicard

et Vincent Laudet, ainsi que les membres de mes comités de thèse, Delphine

Sicard, Jean-Paul Cadoret et Adam Erye-Walker.

Je tiens aussi à remercier le laboratoire de Biologie Intégrative des

Organismes Marins et l’équipe de génomique environnemental du phytoplancton

pour m’avoir accueilli et permis de réaliser cette thèse.

D’une manière plus générale, je remercie ma famille, en premier lieu ma mère

Christine sans laquelle je ne serais jamais allé aussi loin aussi bien dans mes études

que dans mes avancées personnelles, ainsi que mes frères et sœur Caroline, David,

Frédéric (ou Lélic) et mon frère jumeau, Gabriel, comme moi grand admirateur des

êtres vivants.

Aussi, nombreuses sont les personnes du laboratoire Arago qui m’ont aidé

dans mes travaux, en sein de l’équipe, Nigel Grimsley, Hervé Moreau, Evelyne

Derelle, Sheree Yau, et enfin une grande reconnaissance pour Elodie Desgranges

et Claire Hemon, mes deux collègues de bureau et de laboratoire.

  4  

Je remercie également les membres de la plateforme cytométrie, David

Pecqueur et Christophe Salmeron, toujours disponibles pour venir à la rescousse

d’un cytomètre en panne.

Pour finir, je remercie mes différents amis, Florian, Sylvain, Alex (vous vous

reconnaitrez) et les doctorants du laboratoire pour les discussions, les soirées avec

une mention spéciale pour les gaming-night, et les amitiés qui resteront bien après la

fin de cette thèse.

Pour citer quelques noms, je remercie bien sûr mon cher collègue de thèse

Hugo L et sa femme, Océane l’aristocrate, Sandrine et ses petits félins, Margot et

son congénère larvaire qui ont toujours des bonbons à me donner, mon premier

ministre imaginaire Mathieu que je remercie pour avoir effectué le déplacement,

Hugo B pour les discussions philosophiques sur Homo sapiens, Marine, Tatiana et

Remy, Mariana, Mathias qui va se faire séquencer, Nathalie, Brian et Elsa, Daniel.

A toutes les personnes évoquées ci-dessus, je vous suis reconnaissant

d’avoir supporté mes discussions parfois inutiles et inintéressantes sur les chats, les

chinchillas (dont Kalam et Glorfindel sont les plus beaux représentants), et mes

idées sensiblement peu démocratiques.

  5  

SOMMAIRE

Liste des abréviations 7

CHAPITRE 1: INTRODUCTION 9

1. Introduction générale 11

2. Les enjeux de la recherche sur les mutations 12

3. Les variations du taux de mutation 14

4. Les expériences d’accumulation de mutations 15 1. Les premières expériences de Terumi Mukai 15 2. L’effet des mutations sur la fitness 17

1. Les successeurs de Terumi Mukai 17 2. Paysage adaptatif 19

3. Interactions génotype-environnement 22 1. Les changements d’effet des mutations 22

2. Le stress et les hyper mutateurs 23

5. Les estimations directes du taux de mutation 24 1. Les variations inter génomiques du taux de mutation 24

1. La taille du génome 24 2. La taille efficace (Ne) 26 3. Le temps de génération 28 4. Le taux métabolique et la température

2. Les variations intra génomiques du taux de mutation 30 1. Le sens de la transcription et de la réplication 30 2. Le temps de réplication 31 3. Les régions codantes et le niveau d'expression 31 4. La composition en GC 31

6. Nouveaux modèles biologiques 35 1. L’importance écologique du phytoplancton 35

2. Présentation des espèces 36

1. Choix des modèles biologiques 36 2. Les Mamiellophyceae 40 3. Les Trebouxiophyceae 41

1. Présentation générale 41 2. Les transferts horizontaux de gènes 42

7. Les objectifs de thèse 45

  6  

CHAPITRE 2: EFFETS DES MUTATIONS SUR LA FITNESS 47 CHAPITRE 3: LE TAUX DE MUTATION CHEZ LES MAMIELLOPHYCEAE 61 CHAPITRE 4: LES TRANSFERTS HORIZONTAUX DE GENES: LE CAS DE PICOCHLORUM RCC4223 81 CHAPITRE 5: IMPACT DU TAUX DE MUTATION POUR

LES BIOTECHNOLOGIES 97 CHAPITRE 6: DISCUSSION ET CONCLUSION 113

1. Les variations de fitness indépendantes des mutations 115

1. La plasticité phénotypique 115 2. Les bactéries présentes dans les cultures d’O. tauri 117 3. Le rôle des variations structurelles sur le phénotype 118

2. Les limites à l’estimation du taux de mutation 120

3. Perspectives pour les EAMs 123

4. Conclusion générale 125

Annexes 127 Listes des figures et des tableaux 175

Bibliographie 181 Résumé 214                                

  7  

Liste des abréviations

a : Effet de la mutation sur la fitness

ADN : Acide désoxyribonucléique

ARN : Acide ribonucléique

CV : Variation de l’effet des mutations

ΔV : Changement de variance de la donnée de fitness

ΔM : Changement moyen de fitness par génération

EAM : Experience d’accumulation de mutations

G : Taille de génome

GCeq : Contenu en GC du génome à l’équilibre

Ge : Taille de génome codante

GxE : Interactions Genotype-Environement

HGT : Horizontal gene transfer

Μb : Mega base

MMR : Mismatch repair

Ne : Taille efficace de population

OmV1 : Ostreococcus mediterraneus Virus 1

PFGE : Pulsed-field gel electrophoresis

R1 : Taux de mutation de GC vers AT

R2 : Taux de mutation de AT vers GC

RCC : Roscoff culture collection

ROS : Reactive oxygen species

TCR : Transcription-coupled repair

U : Taux de mutation par génome

Uc : Taux de mutation caryotypique par génome

Ud : Taux de mutation délétères par génome

µ : Taux de mutation par nucléotide

  8  

  9  

CHAPITRE 1:

INTRODUCTION  

  10  

                                                                                               

  11  

1. Introduction générale

Depuis la publication de l’origine des espèces et du principe de la sélection

naturelle par Charles Darwin en 1859, des générations de biologistes ont étudié les

questions fondamentales qui entourent l’évolution et la diversité du vivant. A cette

époque, la génétique n’est pas connue et Darwin ignore les mécanismes qui

génèrent la variabilité et la diversité soumises à la sélection naturelle. Les lois de

Mendel sont redécouvertes en 1900, et en 1902 Walter Sutton propose la théorie

chromosomique de l’hérédité. L’existence des mutations est démontrée en 1911 par

Thomas Morgan en réalisant des expériences sur des drosophiles. Les mutations

sont le moteur de l’évolution et constituent la base du potentiel adaptatif des

espèces car elles constituent la principale source de diversité sur laquelle peut agir

la sélection. Les biologistes s’intéressent donc depuis longtemps aux rôles des

mutations, et les découvertes du début du 20ème siècle vont aboutir à la théorie

synthétique de l’évolution, en particulier avec les travaux de Sewall Wright, John B.

S. Haldane, Hermann J. Muller ou Julian Huxley (Haldane, 1949, 1937; Muller, 1928;

Wright, 1932). La découverte de l’ADN et de sa structure (Watson and Crick, 1953)

ouvrira la voie aux technologies de séquençage qui permettent d’observer

directement l’apparition des mutations sur un génome, leurs fréquences et leurs

distributions. Leurs effets sur la capacité de survie sont également explorés (Eyre-

Walker and Keightley, 2007; Haldane, 1937; Muller, 1950) pour comprendre les

différents processus évolutifs et adaptatifs des êtres vivants. La théorie neutraliste

de l’évolution de Kimura dans les années 1960 apporte une nouvelle vision de

l’évolution avec la mise en avant du hasard comme force aussi importante que la

sélection, la dérive génétique (Kimura, 1991, 1987, 1968). Il s’agit de la variation

aléatoire des fréquences alléliques dans une population (Charlesworth, 2009),

indépendamment de la sélection ou des migrations. La dérive est plus forte dans des

populations de petite taille, et donc de faible taille efficace (Wright, 1931), et peut

aller à l’encontre de la sélection naturelle (Charlesworth, 2009; Willi et al., 2006). Les

mutations sont soumises à ces forces évolutives et le taux de mutation subit lui

même la sélection naturelle ou le hasard de la dérive génétique.

  12  

2. Les enjeux de la recherche sur les mutations

La diversité que nous pouvons observer sur Terre au sein des trois empires

du vivant que sont les bactéries, les archées et les eucaryotes est issue des

processus de sélection et de mutations. Les mutations sont une altération de la

molécule d’ADN, à un niveau ponctuel ou chromosomique. Cette altération peut être

le remplacement d’un nucléotide par un autre, une insertion ou une délétion de

séquence, une cassure, une duplication, un réarrangement chromosomique ou

autres modifications de l’ADN. Nous pouvons distinguer deux origines aux

mutations: les mutations issues des erreurs de réplication d’une part, et issues de

facteurs mutagènes d’autres part (rayonnement ultra violet, stress oxydatifs ou

radioactivité par exemple); voir la revue de Maki, 2002 (Maki, 2002) et la Figure 1.

Les mutations constituent un large enjeu pour la recherche en biologie et en

médecine. En recherche fondamentale, elles sont étudiées pour répondre à des

questions centrales sur l’évolution et les capacités d’adaptation des espèces. La

diversité génétique, en partie issues des mutations, est étudiée en écologie pour la

conservation des espèces menacées (Ellegren and Galtier, 2016). En médecine,

elles sont étudiées en raison de leurs implications dans différentes maladies

génétiques et cancers (Ding et al., 2015; Salk et al., 2010). Deux points essentiels

intéressent particulièrement les évolutionnistes et la communauté scientifique en

général:

Le premier est de savoir comment les mutations impactent la fitness des

organismes, c’est à dire leurs capacités de survie et de reproduction. L’effet des

mutations se définit alors comme avantageux (la fitness augmente), neutre (la

fitness ne change pas) ou délétère (la fitness diminue).

Le second point est de comprendre à quelles fréquences les mutations

apparaissent, et quels facteurs influencent le taux de mutation et ces éventuelles

variations aux différentes échelles.

"$!

Nous verrons donc dans un premier temps l’état de l’art sur notre

compréhension des effets des mutations sur la fitness et leurs rôles dans

l’adaptation, suivis d’une liste non exhaustive des facteurs qui expliquent en partie

les variations inter et intra génomiques du taux de mutation.

Ce travail de thèse s’inscrit pleinement dans ces deux problématiques, par

l’étude du taux de mutation et de l’effet des mutations sur la fitness en considérant

cinq espèces d’algues vertes (chlorophytes, plantae, eucaryotes) comme modèles

biologiques.

Figure 1. Processus de mutations, modifié de Gao et al., (Gao et al., 2016). Les mutations sont

issues des erreurs de réplication ou des facteurs mutationnels indépendants de la réplication. Dans

les deux cas, des mécanismes de réparations existent pour corriger une partie de ces mutations. Si la

mutation n’est pas réparée, elle peut être transmise ou non à la descendance en fonction du mode de

reproduction de l’organisme.

ADN intact

Lésion

ADN intact

Pas de dommages

Mutation

Réparation correcte

Réparation non correcte ou partielle

Absence de réparation

Lésion

Mutagènes endogènes ou exogènes

Dommage ADN

pré-réplication

Réplication

Résultat

post-réplication Pas de

mutation Mutation

Erreur de réplication

Mutation létale

Arrêt de la réplication

  14  

3. Les variations du taux de mutation

Au début des années 1960 apparaît la notion d’horloge moléculaire

(Bromham and Penny, 2003). L’horloge moléculaire avance l’hypothèse d’une

apparition constante et continue des mutations dans un génome. Cette horloge

moléculaire sera utilisée pour dater les phylogénies, mais des études vont invalider

cette hypothèse, avec des variations inter taxons (Britten, 1986; Bromham, 2009) et

intra taxon (Bousquet et al., 1992; Bromham et al., 1996) du taux de mutation. De

plus, les données actuelles montrent des variations importantes au sein d’une même

espèce, par exemple en fonction du mode de reproduction, où le taux de mutation

est plus fort dans une population asexuée (Henry et al., 2012; Neiman et al., 2010).

C’est aussi le cas pour différentes souches de Chlamydomonas reinhardtii (Ness et

al., 2015b) avec une variation d’un facteur 10 entre les taux de mutations les plus

bas et les plus hauts. En plus de ces variations inter espèces, il existent des

variations intra génomiques du taux de mutation, comme dans le génome

mitochondrial des angiospermes (Laroche et al., 1997), ou entre les organelles et

l’ADN nucléaire comme chez la drosophile ou Caenorhabditis elegans (Denver et al.,

2000; Haag-Liautard et al., 2008; Smith, 2015; Xu et al., 2012). Une revue chez les

mammifères expose les nombreuses variations du taux de mutation dans un

génome (Hodgkinson and Eyre-Walker, 2011), que ce soit aux échelles de sites

adjacents, ou de chromosomes entiers. Nous savons par exemple que le taux de

mutation est plus élevé au niveau du chromosome sexuel Y les chimpanzés par

rapport aux autres chromosomes (Consortium, 2005; Ebersberger et al., 2002). Au

niveau intra chromosomique, il a été montré que certains trinucléotides mutent

préférentiellement par rapport à d’autres (Ness et al., 2015b; Sung et al., 2015), ou

que les régions avec de petites séquences répétées mutent plus rapidement que le

reste du génome (Ma et al., 2012; Tesson et al., 2013). Ces variations du taux de

mutation mettent en avant l’importance de comprendre quelles forces évolutives

l’impactent et le font varier aux échelles inter et intra génomiques. Ces types de

résultats sont en partie obtenus par une étude directe du taux de mutation, via les

expériences d’accumulation de mutations (EAM). C’est cette approche qui est

utilisée dans ce travail de thèse sur les cinq espèces modèles.

  15  

4. Les expériences d’accumulation de mutations 1. Les premières expériences de Terumi Mukai

Les premières estimations du taux de mutation datent des années 1960 avec

les expériences d’accumulation de mutations (EAM) de Terumi Mukai (Keightley and

Eyre-Walker, 1999; Mukai, 1964) sur la drosophile, bien que les premières

expériences portant sur les mutations ont été développées une cinquantaine

d’années plus tôt par Muller (Crow and Abrahamson, 1997; Muller, 1927). A cette

époque, l’estimation du taux de mutation ne se fait pas par séquençage, en raison

de l’absence des technologies modernes, mais par l’estimation du taux de mutation

délétères (Ud) à partir de données de fitness. Le principe des expériences

d’accumulation de mutations est de maintenir des lignées filles issues d’une lignée

mère pendant un certain nombre de générations et de comparer les lignées filles en

fin d’expérience avec le type ancestral (Figure 2). Durant les expériences

d’accumulation de mutations, une série de goulots d’étranglements est nécessaire

pour maintenir une taille efficace (Ne) la plus faible possible dans les lignées. La

taille efficace d’une population, notion introduite par Sewall Wright en 1931 (Wright,

1931), est la part de la population qui participe à la reproduction, ou la taille

théorique qu’aurait la population dans un cas idéal (c’est à dire une population avec

reproduction aléatoire, la panmixie) qui aurait la même diversité que la population

réelle. Plus la taille efficace de la population est grande, plus la sélection est

efficace. Inversement, plus la taille efficace est faible plus la dérive génétique sera

forte. Réduire la taille efficace dans les lignées permet donc d’éliminer au maximum

la sélection naturelle et d’estimer le taux de mutation avant sélection. Nous avons

donc accès à la totalité des mutations (exception faite des mutations létales),

définissant le taux de mutations spontanées (Drake et al., 1998). C’est pour cette

raison qu’une étude de la diversité existante dans une population ou une espèce est

insuffisante pour estimer le taux de mutations spontanées car seule la diversité

après sélection est mesurée. Dans le cas de la drosophile, en raison de la diploïdie

et de la reproduction sexuée, la lignée mère est généralement consanguine

homozygote avant de commencer l’expérience (Keightley et al., 2014a, 2014b,

2009).

"'!

Figure 2. Schéma d’une expérience d’accumulation de mutations. Les lignées sont maintenues avec

une succession de goulots d’étranglements. En fin d’expérience, une comparaison de fitness ou une

comparaison génomique permet d’étudier l’effet des mutations et leurs distributions dans le génome.

De cette façon, des variations de fitness dues à la recombinaison de plusieurs

allèles lors de la méiose sont évitées. Les locus portant tous le même allèle,

l’hypothèse est faite que seules les mutations créent une variation de fitness.

Avec les données de fitness, estimées par le succès de reproduction (nombre

d’œufs et nombre d’éclosions), Mukai développe une méthode statistique et calcule

les paramètres de mutation:

!! ! !" ! !!! ! !!!!!!!! !"#!!!!!!" ! !!! ! !!!!!!! ! !! ! !!!

Où a est l’effet de la mutation, !V le changement de variance de la donnée de

fitness par génération et !M le changement moyen de fitness par génération.

!V et !M peuvent être estimés directement par régression sur les données de

fitness mesurées pendant l’expérience. L’augmentation de la variance de la valeur

de fitness résulte de l’impact des mutations qui vont faire changer la fitness dans le

cas de mutations avantageuses ou délétères. Mukai estime Ud=0.34 mutations

délétères par génome par génération comme première estimation d’un taux de

mutation délétère chez un organisme et E(a)=0.027 comme baisse moyenne de

fitness par génération. Ce taux de mutation est le taux de mutation minimal, car il ne

prend en compte que les mutations délétères (seule la baisse de fitness est prise en

N Lignées Type ancestral

Contrôle Type ancestral

Mutation

  17  

compte pour les calculs des paramètres de mutations). De plus, il estime le taux de

mutation létal à 0.006 mutations par génération.

Suite à la méthode de Mukai, une autre méthode, par maximum likelihood

(Fry et al., 1999; Keightley, 1994; Keightley and Bataillon, 2000; Keightley and

Caballero, 1997) a été développée. Elle permet notamment d’utiliser des données de

fitness issues d’une EAM comme la méthode de Mukai, mais avec une variance plus

faible.

4.2. L’effet des mutations sur la fitness 1. Les successeurs de Terumi Mukai

La méthode statistique de Mukai est utilisée par différents biologistes pour

estimer Ud chez différents organismes modèles. Une revue a été publiée en 2009

(Halligan and Keightley, 2009). D’une manière générale, il est constaté une baisse

de la fitness chez les lignées mutantes au cours des générations pour toutes les

espèces qui ont été testées, dont quelques exemples sont cités ci-dessous:

- Drosophila melanogaster (Fernández and López-Fanjul, 1996; Fry, 2004,

2001, Fry et al., 1999, 1996; Fry and Heinsohn, 2002; Houle et al., 1992; Huey et al.,

2003; Keightley, 1994; Schrider et al., 2013; Wang et al., 2014);

- Caenorhabditis elegans (Ajie et al., 2005; Baer et al., 2006, 2006; Davies et

al., 1999; Estes et al., 2004; Katju et al., 2014; Vassilieva et al., 2000; Vassilieva and

Lynch, 1999);

- Saccharomyces cerevisiae (Korona, 1999; Wloch et al., 2001; Zeyl and

DeVisser, 2001);

- Daphnia pulex (Deng and Lynch, 1997; Korona, 1999, 1999; Latta et al.,

2013; Schaack et al., 2013);

- Arabidopsis thaliana (Deng and Lynch, 1997; Rutter et al., 2012; Schultz et

al., 1999; Shaw et al., 2000);

  18  

Il existe aussi des organismes un peu moins étudiés par EAMs, mais de plus

en plus de données sont disponibles sur tout l’arbre du vivant; Chlamydomonas

reinhardtii (Morgan et al., 2014), Tetrahymena thermophila (Brito et al., 2010),

Dictyostelium discoideum (Hall et al., 2013), Escherichia coli (Cao et al., 2014;

Kibota and Lynch, 1996).

De ce fait, il est avancé que la majorité des mutations sont délétères, c’est à

dire qu’elles diminuent la capacité de survie. L’impact des mutations délétères dans

une population ou chez un individu est défini comme le poids des mutations

délétères, ou fardeau génétique (Agrawal and Whitlock, 2012; Charlesworth et al.,

1990): c’est la différence de fitness qu’il existe entre la fitness optimale et la fitness

réelle. Les mutations délétères sont normalement supprimées par la sélection

naturelle, mais la dérive peut les maintenir ou les fixer dans une population. L’effet

des mutations délétères sur les populations a largement été exploré (Agrawal and

Whitlock, 2012; Charlesworth and Charlesworth, 1998; Kondrashov, 1995, 1988,

Lande, 1994, 1988; Lynch et al., 1999), de même que l’estimation par des méthodes

statistiques des paramètres mutationnels dans les populations naturelles (Deng et

al., 2002; Deng and Lynch, 1996; Li and Deng, 2005). Une population de petite taille

efficace est plus sensible aux mutations délétères en raison de la faible efficacité de

la sélection naturelle (Eyre-Walker et al., 2002; Higgins and Lynch, 2001; Houle,

1992; Lande, 1998; Lynch et al., 1995; Lynch and Gabriel, 1990; Willi et al., 2006).

Si la sélection est trop faible, elle ne permet pas une purge efficace des mutations

délétères. Cela peut avoir un impact sur les espèces menacées avec de faibles

tailles de population: la dérive et les mutations délétères peuvent accentuer la perte

de diversité et de viabilité d’une population.

Cependant, le taux de mutation « optimal » résulte d’un compromis entre le

coût des mutations délétères et le bénéfice de mutations avantageuses (Wielgoss et

al., 2013). La taille efficace d’une population joue donc un rôle essentiel dans la

force de sélection et la capacité adaptative de cette population (Gossmann et al.,

2012). Ainsi, la probabilité de fixation d’une mutation dans une population va

dépendre de l’intensité de la dérive et de la sélection, et de l’effet de cette mutation

sur la survie (neutre, avantageux ou délétère).

  19  

4.2.2. Paysage adaptatif et distribution de l’effet des mutations

Comme nous venons de voir, la majorité des mutations semble être délétère,

mais une partie est neutre ou avantageuse (Hall et al., 2008; Joseph and Hall,

2004). La distribution de fitness des mutations vient en partie du niveau de fitness

d’un génome dans un environnement donné. En faisant l’hypothèse qu’il existe un

niveau de fitness maximal possible dans un environnement, la proportion de

mutations délétères augmente si la fitness du génome se rapproche du maximum.

L’ensemble des fitness possibles se définit comme le paysage adaptatif (Orr, 2005;

Petren, 2013), une notion introduite par Sewall Wright et Fisher (Mousseau and Roff,

1987; Edwards, 2000; Zhang, 2012). Il existe de nombreuses théories sur les

modèles de paysages adaptatifs possibles, en particulier le « single-peak » (Wright,

1932), le « rugged » ou vallée (Martin and Wainwright, 2013; Steinberg and

Ostermeier, 2016) ou le « holey » (Gavrilets, 1997).

Le « single-peak », le plus simple, est un pic de fitness avec un maximum

possible (Figure 3). Dans ce cas, la fitness du génome, en fonction des mutations et

de l’épigénétique (Kaity et al., 2008), va se déplacer sur le pic de fitness entre le

maximum et le minimum. Plus la fitness du génome est proche du maximum, plus

les mutations auront de fortes probabilités d’être délétères et, inversement, un

génome avec un niveau de fitness bas va compter plus de mutations avantageuses

(Tenaillon et al., 2016). Enfin, si la fitness du génome est trop basse, il peut

simplement être éliminé par la sélection.

Le second modèle est le modèle « holey » (Gavrilets, 1997), où la fitness

maximale est définie comme le plancher du paysage adaptatif. Les mutations

avantageuses ne font que maintenir le génome à ce niveau. Ce plancher est marqué

par des puits de fitness, dans lesquelles le génome « tombe » en cas de mutations

délétères.

  20  

Enfin, le modèle le plus souvent accepté, et qui a déjà été mis en évidence

chez les bactéries (Nahum et al., 2015) ou des espèces comme un téléostéen du

genre Cyprinodon (Martin and Wainwright, 2013), est le « rugged ». Dans ce cas, il

existe de nombreux pics de fitness avec des vallées ou des plateaux sur lesquels le

génome va se déplacer. De plus, une vallée entre des pics de fitness peut entrainer

une différenciation de deux populations, d’où l’importance de cette hypothèse en

évolution. Avec ce modèle, une population avec une faible taille efficace peut

atteindre un pic de fitness plus élevé qu’une population avec une taille efficace plus

grande (Rozen et al., 2008). A cause de l’efficacité de la sélection, une grande

population atteindra rapidement le sommet de fitness le plus proche. En revanche,

une population avec une petite taille efficace pourrait atteindre un pic de fitness plus

élevé, car la dérive génétique déplace la population dans le paysage de fitness.

Dans tous les cas, quel que soit le model admis, ce sont les mutations qui

vont principalement augmenter ou diminuer la fitness du génome sur le paysage

adaptatif et permettre l’accession à une fitness supérieure dans le cas de mutations

avantageuses. Par ailleurs, le paysage adaptatif est spécifiquement défini pour un

génotype et un environnement. La position d’un génome est donc le résultat de

l’interaction génotype-environnement et du contexte génétique. On a donc une

variation du paysage adaptatif suite à une variation environnementale (Matuszewski

et al., 2014) ou le long d’un gradient environnemental (Laughlin and Messier, 2015),

avec un compromis d’adaptation (Elena and Lenski, 2003) entre les environnements

(Figure 4).

Au delà des mutations avantageuses ou délétères, les mutations neutres sont

tout aussi importantes en raison de la variation de la distribution de la fitness des

mutations. Les mutations avantageuses peuvent voir leurs impacts augmentés ou

diminués, et les mutations neutres dans un cas peuvent avoir un effet dans d’autres

conditions. Le changement de distribution de fitness des mutations neutres met en

avant l’importance de la variation existante comme base d’adaptation immédiate à

un changement environnemental (Barrett and Schluter, 2008; Hermisson and

Pennings, 2005). On parle de la « standing genetic variability ».

#"!

Figure 3. Représentation du « fitness landscape ». La fitness du génotype (en bleu) va bouger et

changer en fonction de l’effet des mutations qui vont apparaître. Plus la fitness du génotype est

proche du maximum, plus les mutations auront de probabilité d’être délétères. De même une variation

environnementale peut entrainer un déplacement du génotype sur le paysage de fitness. La

difference entre la position du génotype et le maximum de fitness est definie comme le poids des

mutations délétères.

Figure 4. Changement de fitness d’un genotype entre environnements. La variation de l’effet des

mutations et de la variabilité entre envrironnements. La figure est reprise de Santiago et Richards,

2003 (Elena and Lenski, 2003). Le genotype 1 est specialisé dans l’environnement A mais peu

adapté au B, inversement pour le génotype 2, alors que le génotype 3 est généraliste.

Mutation - neutre - avantageuse - délétère

Fitness du génome

Position du génome

Fitness

!"#$%&% !"#$%'%

()"$%*%

()"$%+%

()"$%,%

  22  

4.2.3. Interaction génotype-environnement

1. Les changements d’effet des mutations

Différentes études sur des lignées mutantes issues d’expériences

d’accumulation de mutations ont tenté d’explorer les effets d’un changement

environnemental sur la distribution de fitness des mutations en comparant les fitness

d’une même lignée, notamment chez la drosophile (Fry et al., 1996, p. 19996; Fry

and Heinsohn, 2002; Kondrashov and Houle, 1994; Korona, 1999), le nématode

Caenorhabditis elegans (Baer et al., 2006), ou la plante Arabidopsis thaliana (Rutter

et al., 2012). Comme nous l’avons vu dans le paragraphe précédent sur le paysage

adaptatif, nous nous attendons à des changements de fitness selon les conditions.

En laboratoire, différentes variables facilement contrôlables peuvent être testées; on

peut citer le cas de la disponibilité en ressource (Chang and Shaw, 2003) et de la

luminosité (Kavanaugh and Shaw, 2005) chez Arabidopsis thaliana. De ces études,

nous pouvons estimer les paramètres de mutations comme pour les EMAs et les

comparer pour émettre des hypothèses sur les implications biologiques des

mutations, définies au nombre de trois (Martin and Lenormand, 2006).

Premièrement, un changement de U (nombre de mutations par génome par

génération) traduit une différence d’effet des mutations, avec des mutations qui ont

un effet détectable dans une condition mais neutre (ou non détectable suivant le

caractère de fitness considéré) dans une autre. On peut par exemple penser à des

changements d’expression de gènes entre deux conditions.

Deuxièmement, une variation de a (effet moyen d’une mutation par

génération) indique un changement de l’intensité de la sélection car les effets d’une

mutation varient. Or, plus l’effet de la mutation est fort, plus la sélection pourra influer

sur la fréquence de cette mutation dans une population : on attend une plus forte

contre sélection d’une mutation délétère qui a un plus fort impact sur la fitness.

Enfin, si CV varie (c’est à dire la variation de l’effet des mutations), on s’attend

à avoir un effet du stress sur les mutations. Ainsi, si une population est adaptée à

une condition et est proche du maximum de fitness, l’effet des mutations sera le plus

souvent délétère. Mais en cas de stress, la population n’est plus à son optimum de

fitness, ce qui fera varier l’effet des nouvelles mutations.

  23  

4.2.3. Interaction génotype-environnement

2. Le stress et les hyper mutateurs

En cas de stress, il est traditionnellement admis que les mutations délétères

ont un impact plus fort sur la fitness (Elena and de Visser, 2003). C’est notamment le

cas dans une étude pourtant sur l’impact du stress chez des lignées issues

d’expériences d’accumulation de mutations chez Chlamydomonas reinhardtii

(Kraemer et al., 2015). Cependant, il est à noter que cette observation n’est pas

systématique et différents articles tendent à montrer que le stress n’a pas d’effet sur

l’ampleur de l’impact des mutations délétères (Andrew et al., 2015; Kishony and

Leibler, 2003). L'impact du stress sur les effets des mutations peut être caractérisé

de trois façons (Elena et de Visser, 2003): tout d'abord, la mutation peut être

délétère sans conditions, avec une augmentation de l'effet délétère avec le stress;

Ensuite, la mutation peut être conditionnellement neutre, c’est à dire neutre dans

certaines conditions et délétère dans d'autres; Enfin, la mutation peut être

conditionnellement bénéfique: avantageuse dans certaines conditions, mais délétère

ou neutre dans d'autres.

En cas de stress, chez les bactéries, il a été mis en évidence la présence

d’allèles mutateurs qui vont avoir un impact sur le taux de mutation en l’augmentant

significativement (Couce et al., 2013; Taddei et al., 1997). Ce type de mécanismes

est avantageux dans un environnement défavorable. Les nouvelles mutations vont

apparaître plus fréquemment, ce qui augmente la probabilité des mutations

avantageuses et donc l’adaptation (Giraud et al., 2001; Sniegowski et al., 1997;

Tenaillon et al., 1999). Il n’y a pas d’allèles mutateurs connus chez les eucaryotes,

mais il semble que chez la drosophile, les individus moins adaptés à un nouvel

environnement ont un taux de mutation plus élevé que les autres (Sharp and

Agrawal, 2012). Cette observation est également faite chez la plante A. thaliana

(Jiang et al., 2014) ou chez la levure (Shor et al., 2013). Cette augmentation est

toutefois moins significative que dans le cas des hyper-mutateurs bactériens.

  24  

5. Les estimations directes du taux de mutation 1. Les variations inter génomiques du taux de mutation

1. La taille du génome

De nos jours, les nouvelles générations de séquenceurs permettent d’estimer

directement le taux de mutation en comparant les génomes de début et de fin d’EAM

(voir le Tableau 1 pour les estimations actuelles). Une base de données en ligne est

également disponible (Wei et al., 2014). Ces estimations ont permis de formuler

différentes hypothèses sur les facteurs biologiques et écologiques qui agissent sur

l’évolution du taux de mutation.

Parmi les premiers articles, Drake propose en 1991, à partir de données sur

des organismes unicellulaires, un nombre de mutations constant par génome

(Drake, 1991; Drake et al., 1998). Cette constante serait de U=0.0033 mutations par

génome par réplication chez les microorganismes. Il s’agit plutôt de formuler que le

taux de mutation U varie moins par rapport au niveau de variation des taux de

mutation µ et des tailles des génomes. De ce fait, le taux de mutation diminue avec

l’augmentation de la taille du génome pour garder le nombre de mutations U par

génome constant à chaque réplication (Figure 5). Dans le cas d’un taux de mutation

qui ne diminue pas avec l’augmentation de la taille du génome, nous obtenons un

nombre de mutations par génome croissant. Cela augmente la probabilité

d’apparition de mutations délétères à chaque réplication, ce qui peut compromettre

la survie. Cette relation ne semble toutefois pas concerner les eucaryotes, où le taux

de mutation augmente avec la taille du génome (Smeds et al., 2016; Sung et al.,

2012a).

  25  

Tableau 1. Les taux de mutations spontanées estimés par des expériences d'accumulation de

mutations. Dans ce tableau, seules les estimations de taux de mutation par séquençage du génome

entier sont spécifiées. G est la taille du génome en Mb, µ est le taux de mutation par nucléotide par

génome par génération et U est le nombre de mutations par génome par génération. Dans ce tableau

n’apparaissent pas les mesures de taux de mutation obtenues avec des lignées artificiellement

mutantes (suppression d’un mécanisme de réparation de l’ADN) ou issues d’un pédigrées, comme

chez l’homme ou la souris (ces données sont disponibles dans le chapitre 3, tableau S10).

Espèces G µ U Références

Arabidopsis thaliana Col-0 157.0 7.00E-09 1.0990 (Ossowski et al., 2010)

Caenorhabditis elegans N2 100.3 2.50E-09 0.2508 (Denver et al., 2009)

Caenorhabditis elegans N2 100.3 3.10E-09 0.3109 (Denver et al., 2009)

Caenorhabditis elegans N2 100.3 1.33E-09 0.1334 (Denver et al., 2012)

Caenorhabditis elegans PB306 100.3 1.62E-09 0.1625 (Denver et al., 2012)

Caenorhabditis briggsae PB800 108.4 1.44E-09 0.1561 (Denver et al., 2012)

Caenorhabditis briggsae HK104 108.4 1.23E-09 0.1333 (Denver et al., 2012)

Pristionchus pacificus PS312 133.1 2.0E-09 0.2663 (Weller et al., 2014)

Drosophila melanogaster Madrid 122.0 3.50E-09 0.4270 (Keightley et al., 2009)

Drosophila melanogaster Florida 122.0 5.49E-09 0.6698 (Schrider et al., 2013)

Drosophila melanogaster Florida 122.0 2.80E-09 0.3416 (Keightley et al., 2014a)

Heliconius melpomene 273.8 2.90E-09 0.7940 (Keightley et al., 2014b)

Chlamydomonas reinhardtii CC-2937 112 2.08E-10 0.0233 (Ness et al., 2012)

Chlamydomonas reinhardtii CC-124 112 6.76E-11 0.0076 (Sung et al., 2012a)

Chlamydomonas reinhardtii 112 9.63E-10 0.1079 (Ness et al., 2015b)

Paramecium tetraurelia d4-2 72.1 1.94E-11 0.0014 (Sung et al., 2012b)

Saccharomyces cerevisiae FY10 12.3 3.30E-10 0.0041 (Lynch et al., 2008)

Saccharomyces cerevisiae 12.3 1.67E-10 0.0021 (Zhu et al., 2014)

Schizoaccharomyces pombe ED668 12.6 2.00E-10 0.0025 (Farlow et al., 2015)

Schizoaccharomyces pombe 12.6 1.70E-10 0.0021 (Behringer and Hall, 2015)

Dictyostelium discoideum AX4 34.2 2.90E-11 0.0010 (Saxer et al., 2012)

Burkholderia cenocepacia HI2424 7.7 1.33E-10 0.0010 (Dillon et al., 2015)

Escherichia coli 3k 4.6 1.88E-10 0.0009 (Lee et al., 2012)

Escherichia coli 6k 4.6 2.45E-10 0.0011 (Lee et al., 2012)

Mesoplasma florum L1 0.8 9.78E-09 0.0078 (Sung et al., 2012a)

Mycobacterium tuberculosis H37Rv 4.4 2.58E-10 0.0011 (Ford et al., 2011)

Salmonella typhimurium LT2 4.8 7.00E-10 0.0034 (Lind and Andersson, 2008)

Bacillus subtilis 4.2 3.28E-10 0.0014 (Sung et al., 2015)

Pseudomonas aeruginosa 6.6 7.92E-11 0.0005 (Dettman et al., 2016)

Deinococcus radiodurans BBA816 3.2 4.99E-10 0.0016 (Long et al., 2015a)

Mycobacterium smegmatis 7.0 5.27E-10 0.0036 (Kucukyildirim et al., 2016)

#'!

Figure 5. Relation entre le taux de mutation et la taille du génome. Figure reprise de Sung, 2012

(Sung et al., 2012a). On observe une diminution du taux de mutation avec une augmentation de la

taille du génome chez les microorganismes. Cela se traduit par des apparitions peu fréquentes des

mutations délétères dans les plus grands génomes.

5.1.2. La taille efficace (Ne)

Un autre facteur essentiel est la taille efficace qui va conditionner l’intensité

de sélection à laquelle sera soumis le taux de mutation (Charlesworth, 2009; Lanfear

et al., 2014), avec la notion de barrière de dérive (Martincorena and Luscombe,

2013; Sung et al., 2012a). Selon Lynch, le taux de mutation est plus faible chez les

microorganismes en raison de leur grande taille efficace de population qui permet

une sélection efficace (Lynch, 2010a). Le taux de mutation pourrait cependant être

attendu plus petit chez les organismes multicellulaires en raison des dommages

somatiques liés aux mutations délétères (Lynch, 2008), en particulier les cancers

(Cowin et al., 2010; Knudson, 2000). Chez les organismes pluricellulaires, le taux de

Taille du génome (Mb)

!

10-11

10-10

10-9

10-8

10-7

10-6

10-3 10-2 10-1 10 101 102

virus

archées

eucaryotes

bacteries

#(!

mutation varie en fonction des tissus (Lynch, 2010a), et le taux de mutation dans la

lignée germinale est inférieur aux taux de mutation des cellules somatiques (Lynch

and Hagner, 2015), limitant la transmission de mutations délétères au générations

suivantes. Le coût des mutations délétères va pousser vers la sélection d’un taux de

mutation faible, avec un taux de mutation théorique défini comme optimal (Figure 6).

Mais ce taux de mutation optimal n’est jamais atteint en raison de la dérive

génétique. Il existe donc une limite, dite la « barrière de dérive », qui empêche

d’atteindre un taux de mutation optimal par la sélection, qui est un compromis entre

l’adaptation, le coût des mutations délétères sur la fitness et le coût de réplication

(Martincorena and Luscombe, 2013). Pour conclure, le taux de mutation réel est le

plus proche du taux de mutation optimal chez les organismes à grande taille efficace

(comme les microorganismes), que celui des organismes à taille efficace de

population plus faible, comme les métazoaires (Figure 7).

Figure 6. La barrière de dérive et le coût de la réplication. Figure reprise de Martincorena et

Luscombe, 2013 (Martincorena and Luscombe, 2013). La dérive impose une limite à la sélection du

taux de mutation, qui ne peut atteindre le taux de mutation optimal, défini comme le compromis entre

le coût des mutations délétères et le coût de la fidélité de réplication. Les espèces avec une grande

taille efficace sont plus susceptibles de se rapprocher du taux de mutation optimal.

Coû

t de

fitne

ss Taux de

mutation optimal Coût des mutations délétères

Taux de mutation !

Coût de réplication

Limite de

dérive

Taux de mutation observé

#)!

Figure 7. Relation entre taille efficace et taux de mutations. Figure reprise de Ness, 2012 (Ness et al.,

2012). La taille efficace de la population définit l’efficacité de la sélection, et donc la capacité à

atteindre le taux de mutation le plus bas possible pour limiter l’apparition des mutations délétères.

5.1.3. Le temps de génération

Le temps de génération étant variable en fonction des caractéristiques

biologiques ou écologiques des espèces, le nombre de mutations qui apparaissent

par unité de temps varie également. Des études ont tenté de comprendre l’influence

du temps de génération sur le taux de mutation (Laird et al., 1969), notamment chez

les vertébrés (Martin and Palumbi, 1993; Mooers and Harvey, 1994). D’une manière

générale, il est observé une diminution du taux de mutation avec l’augmentation du

temps de génération (Tableau 2). Des études plus récentes sur les mollusques

(Thomas et al., 2010) ou les bactéries (Weller and Wu, 2015) tendent à confirmer

cette hypothèse. Cela signifie une plus forte capacité à créer de nouvelles mutations

et donc à s’adapter pour les espèces à temps de génération court.

Taille efficace

104 105 106 107 108 10-10

10-9

10-8

10-7 M. domesticus

H. sapiens

C. elegans

A. thaliana

P. falciparum

N. crassa

C. reinhardtii

S. serevisiae

D. melanogaster

!

  29  

Tableau 2. Corrélation entre le temps de génération et le taux de mutation. Données de Martin et

Palumbi (Martin and Palumbi, 1993). On observe une diminution du taux de mutation avec une

augmentation du temps de génération et une baisse du taux métabolique.

Espèces Substitutions par site par

milliard d'années

Taux

métabolique

(O2/kg/h)

Temps de

génération (jours)

Douroucouli 2.1 450 880

Singe araignée 1.9 415 1 700

Macaque 1.8 430 1 095

Gibbon 1.7 370 3 410

Orang-outang 1.2 230 4 290

Gorille 1.2 200 3 438

Chimpanzé 1.2 220 3 190

Humain 1.1 210 6 200

5.1.4. Le taux métabolique et la température

En plus du temps de génération vu précédemment, Martin et ses

collaborateurs montrent une augmentation du taux de mutation avec une

augmentation du taux métabolique mesurée par la respiration (Martin and Palumbi,

1993). Cette augmentation est en général expliquée par la plus importante

production d’espèces réactives d’oxygène (ROS) qui induisent un stress oxydatif

(Baer et al., 2007). Les ROS, s’ils sont produits en trop grand nombre par

l’organisme, peuvent provoquer des mutations, en particulier par l’oxydation de la

guanine (Foster et al., 2015) ou la déamination de la cytosine (Cooke et al., 2003;

Dizdaroglu, 1992; Hurst and Williams, 2000).

Au delà du taux métabolique, la température pourrait également influer sur le

taux de mutation (Lewis et al., 2016; Wolfenden, 2014). Selon Wolfenden, les

sources hydrothermales auraient pu être un accélérateur pour l’évolution en raison

de la forte température qui augmente la vitesse des réactions enzymatiques, comme

l’hydrolyse des peptides, et l’instabilité de l’ADN. Ainsi, les réactions chimiques

provoquant des changements irréversibles auraient été plus fréquentes, notamment

  30  

les déaminations hydrolytiques des cytosines et adénines qui deviennent des

uraciles et xanthines (Wolfenden, 2014).

En lien avec les deux points précédents, il existe une théorie dite « metabolic

theory of ecology », qui propose une accélération de l’évolution moléculaire avec la

température. Cela se traduit par plus de spéciations et divergences en régions

tropicales, chez plusieurs taxons, dont les plantes, les amphibiens ou les

mammifères (Gillman et al., 2010; Mittelbach et al., 2007; Rolland et al., 2014;

Wright et al., 2010).

5.2. Les variations intra génomiques du taux de mutation 1. Le sens de la transcription et de la réplication

Une étude sur Bacillus subtilis (Paul et al., 2013) suggère une hétérogénéité

du taux de mutation en fonction du sens de la réplication et de la transcription sur le

brin d’ADN. Une augmentation du taux de mutation est observée dans les zones

dites de «conflit réplication-transcription». Le taux de mutation est plus élevé dans

les gènes orientés inversement au sens de réplication, ce qui signifie une variation

du taux d’évolution entre gènes. Ce «conflit réplication-transcription» a également

été mis en évidence par d’autres études portant sur des lignées issues

d’expériences d’accumulations de mutations (Schroeder et al., 2016). Le taux de

mutation est également plus fort dans certaines zones, appelés « points chauds de

mutations ». Chez les bactéries, notamment Escherichia coli, ces points chauds ont

été localisés au niveau des points de blocage ou collision entre les fourches de

réplication des deux brins matrices et non matrices (Foster et al., 2013). De même,

la réplication est plus ou moins fidèle selon l’orientation des brins sens et anti-sens,

ce qui a également une influence sur le taux de mutation (Fijalkowska et al., 1998).

  31  

5.2.2. Le temps de réplication

Au-delà du sens de la réplication, le temps de réplication induit un taux de

mutation plus fort en fin de réplication, phénomène bien connu chez les mammifères

(Chen et al., 2010; Stamatoyannopoulos et al., 2009). C’est à dire que plus le temps

de réplication est long, plus le taux de mutation peut être élevé en fin de réplication.

Les deux hypothèses avancées pour expliquer ce phénomène sont la diminution du

stock de nucléotides disponibles et la perte d’efficacité des mécanismes de

réparation de l’ADN (MisMatch Repair ou MMR). Les MMR permettent de réduire

l’apparition des mutations au cours de la réplication (Fukui and Fukui, 2010; Jiricny,

2006; Kunkel and Erie, 2015; Li, 2008). Nous savons, par des expériences

d’accumulation de mutations avec des lignées artificiellement déficientes en MMR

(Denver et al., 2005; Jiricny, 2006; Lang et al., 2013; Lee et al., 2012; Long et al.,

2015b; Sung et al., 2015), que ces mécanismes de réparation réduisent d’environ un

facteur 100 le taux de mutation et peuvent changer le sens et la distribution des

mutations en fonction de leur activation. Ce biais mutationnel en fin de réplication

existe aussi chez les bactéries (Hudson et al., 2002) et chez la levure (Lujan et al.,

2014). Le type et le taux d’erreur lors de la réplication peuvent également dépendre

du type d’ADN polymérase. En effet, les différentes ADN polymérases n’ont pas les

mêmes niveaux de fidélité, induisant plus ou moins d’erreurs (Hestand et al., 2016;

Kunkel and Bebenek, 2000). Chez les eucaryotes, il existe par exemple de

nombreuses polymérases avec des fonctions et capacités enzymatiques différentes

(Hubscher et al., 2002).

  32  

5.2.3. Les régions codantes et le niveau d'expression

Une troisième raison aux variations intra génomiques vient de la différence du

taux de mutation entre les régions codantes et non codantes du génome, et le

niveau d’expression. Le taux de mutation semble en effet plus faible dans les gènes

fortement exprimés (Eyre-Walker and Bulmer, 1995; Martincorena et al., 2012). Les

expériences d’accumulation de mutations ont permis de le confirmer, notamment

chez la levure (Zhu et al., 2014). Deux explications peuvent être avancées pour

l’expliquer. Les MMR, qui peuvent être plus efficaces en région codante (Foster et

al., 2015), et les transcription-coupled repairs (TCR), capables de réparation dans

les régions fortement exprimées (Hanawalt and Spivak, 2008).

Cependant différentes étude faites chez Escherichia coli (Beletskii and

Bhagwat, 1996; Chen and Zhang, 2013; Klapacz and Bhagwat, 2002) contredisent

ces résultats et montrent que les gènes fortement exprimés mutent plus rapidement

que les autres. L’une des hypothèses avancées est le lien entre le taux de

transcription et la mutabilité de la région transcrite: le processus de transcription peut

perturber la réplication (Kim and Jinks-Robertson, 2012), comme vu dans le

paragraphe traitant du sens de la réplication et de la transcription.

5.2.4. La composition en GC

Enfin, la composition en GC a une influence sur le taux de mutation, par le biais de

la proportion transversions/transitions et la proportion des mutations A-T vers G-C

ou inversement. Hershberg et Petrov ont montré un biais mutationnel chez les

bactéries (Hershberg and Petrov, 2010), avec une proportion plus importante de

mutations depuis les nucléotides G-C vers A-T par rapport aux autres types de

substitutions. Les expériences d’accumulation de mutations montrent généralement

aussi un biais de mutation de G-C vers A-T, chez Caenorhabditis elegans (Denver et

al., 2009), Arabidopsis thaliana (Ossowski et al., 2010), Escherichia coli (Lee et al.,

2012), Salmonella typhimurium (Lind and Andersson, 2008), par exemple. Cette

observation n’est cependant pas systématique chez les bactéries, avec deux contre-

exemples (Dillon et al., 2015; Long et al., 2015a), voir le Tableau 3. Certains types

  33  

de mutations fréquentes comme la déamination de la cytosine (Coulondre et al.,

1978; Fryxell and Zuckerkandl, 2000) et l’oxydation de la guanine sont connus pour

induire des mutations de G-C vers A-T (Cooke et al., 2003; Dizdaroglu, 1992). Ce

biais mutationnel est bien connu chez les mammifères, où les sites CpG, c’est à dire

les dinucléotides CG, mutent plus rapidement que le reste du génome (Hodgkinson

and Eyre-Walker, 2011). Le taux de mutation des sites CpG est ~10 fois plus

important que pour les autres sites. De ce fait, les dinucléotides CpG ne sont

présents qu’a 20% de leur fréquence attendue dans le génome humain (Lander et

al., 2001). Cependant, cette relation n’est pas aussi simple, car il existe aussi chez

les mammifères des régions dite « CpG islands », très riches en GC (Bird, 1986). Or,

dans ces régions d’environ 1kb, le taux de mutation est inferieurs à celui des CpGs

situés ailleurs dans le génome (Cohen et al., 2011). Cela s’expliquerait par la

stabilité de la méthylation des cytosines, influencer par la richesse des nucléotides

adjacents en GC (Elango et al., 2008).

Face à cela, nous pouvons nous attendre à observer une baisse de la teneur

en GC dans certains génomes au cours des générations. Or, chez les bactéries,

certains génomes sont très riches en GC (proche de 70%). Cela s’explique en partie

par la sélection pour des codons optimaux plus riches en GC (Hildebrand et al.,

2010). En effet, même des mutations synonymes peuvent avoir un impact sur la

fitness, comme démontré précédemment (Glémin, 2010) en raison du biais d’usage

du code (Ikemura, 1981). Le biais d’usage du code se traduit par l’utilisation

préférentielle de certains codons par rapport à d’autres, notamment en fonction de la

quantité de séquences qui codent pour l’ARN de transfert associé à ces codons.

La conversion génique biaisée peut aussi expliquer une augmentation de la

teneur en GC d’un génome (Chen et al., 2007; Duret and Galtier, 2009; Galtier et al.,

2001; Glémin et al., 2015; Mugal et al., 2013). Il s’agit d’un biais de réparation des

mésappariements, généralement lors de la recombinaison, qui conduit à

enrichissement en GC du génome. Ce phénomène semble aussi présent chez les

bactéries (Lassalle et al., 2015), qui recombinent moins que les eucaryotes étudiés

généralement pour la conversion génique biaisée.

  34  

De plus, des variations dans l’orientation des mutations ont également été

observées entre le génome nucléaire et le génome des organelles chez

Chlamydomonas reinhardtii (Ness et al., 2015a). Chez Chlamydomonas reinhardtii,

la composition en GC des organelles (47%) est plus faible que celle du génome

nucléaire (63%), ce qui peut expliquer en partie cette différence.

Pour prédire le nombre de mutations en fonction de la composition du

génome, il est utile de calculer le GC% à l’équilibre (Sueoka, 1962), c’est à dire la

teneur en GC du génome pour laquelle il y a autant de mutations de type G-C vers

A-T que A-T vers G-C. Sachant que les mutations sont biaisées de G-C vers A-T, le

taux de mutation est en général plus fort pour les nucléotides G et C que pour A et

T. Le GCeq se calcule avec les équations suivantes :

𝑅!=(GC→AT)𝐺𝐶!

, 𝑅!=(AT→GC)𝐴𝑇!

, GCeq =  𝑅!

𝑅! + 𝑅!  

avec GC→AT le nombre de mutations de type G-C vers A-T et 𝐺𝐶! le nombre de G et

C dans le génome.

Tableau 3. Le biais de GC vers AT, dans la dernière colonne du tableau, est le rapport du taux de

mutation de GC vers AT sur celui de AT vers GC. Les données sont reprises de Dillon et

collaborateurs en 2015 (Dillon et al., 2015). Espèce (%GC) A/T->T/A G/C->C/G A/T->G/C G/C->A/T Biais vers AT

B. cenocepacia (67) 2.67 2.38 12.23 9.95 0.81

E. coli (51) 2.8 2.88 15.38 18.79 1.22

M. florum (27) 15.67 185.36 62.68 1000.97 15.97

H. sapiens (45) 129 295 581 1219 2.1

D. melanogaster (42) 98.06 74.52 149.14 643.95 4.32

S. cerevisiae (38) 3.03 7.82 12.43 27.55 2.22

A. thaliana (36) 43.56 123.63 165.52 1035.38 6.26

C. elegans (35) 17.5 16.89 24.19 101.32 4.19

  35  

6. Nouveaux modèles biologiques 1. L’importance écologique du phytoplancton

Le phytoplancton est composé de la partie photosynthétique du plancton,

présente à l’échelle mondiale dans tous les écosystèmes aquatiques (de Vargas et

al., 2015). Ce n’est cependant pas un terme qui désigne un groupe monophylétique,

et ne constitue donc pas un groupe naturel d’organismes au sens évolutif. Il inclut

des organismes issus de différents règnes, parmi les eucaryotes et les bactéries,

notamment les cyanobactéries. Le phytoplancton eucaryote est très diversifié et se

retrouve dans tous les règnes excepté les unicontes (qui comprennent entre autres

les fungis et les métazoaires). La production primaire du phytoplancton constitue

environ la moitié de la production terrestre (Field et al., 1998) et la base de la plupart

des écosystèmes océaniques (Li, 1994; Worden et al., 2004; Jardillier et al., 2010).

Le phytoplancton est donc essentiel pour les transferts trophiques, et joue

également un rôle fondamental dans les cycles biogéochimiques de la planète

(Worden et al., 2015). Par exemple, les diatomées sont responsables d’environ 40%

de la production primaire océanique (Boyd and Newton, 1995) et jouent un rôle clé

dans les cycles biogéochimiques, comme l’export de carbone (Boyd and Newton,

1999; Buesseler, 1998).  

Dans le cadre de ce travail de thèse, nous nous intéressons aux

Chlorophytae (Friedl and Rybalka, 2012; Leliaert et al., 2012; Lewis and McCourt,

2004), ou «algues vertes», qui regroupent 4 300 espèces dans le règne eucaryote

de la lignée verte (archaeplastidae ou plantae). La photosynthèse est apparue dans

la lignée verte avec la première endosymbiose par transfert du chloroplaste d’une

cyanobactérie il y a environ 1.6 milliard d’années dans une cellule eucaryote (Yoon

et al., 2004). Parmi les chlorophytes, il existe une importante diversité de forme de

vie (De Clerck et al., 2012): des espèces unicellulaires, pluricellulaires, d’eaux

douces, marines ou saumâtres, des espèces coloniales ou non, et des espèces

symbiotiques.

  36  

6.2. Présentation des espèces 1. Choix des modèles biologiques

L’objectif du travail de doctorat est d’acquérir une meilleure compréhension

des processus évolutifs et adaptatifs du pico-phytoplancton eucaryote. Il faut

souligner l’importance des progrès que de telles expérimentations permettent

aujourd’hui dans les recherches menées par la communauté scientifique sur

l’évolution. Cette thèse apporte une importante contribution à la littérature existante

sur les expériences d’accumulation de mutations et permet d’évaluer le potentiel

adaptatif d’un groupe écologique majeur.

Pour cela, nous avons choisi cinq espèces d’algues vertes (Figure 9):

Ostreococcus tauri RCC4221 (Blanc-Mathieu et al., 2014; Derelle et al., 2006),

Ostreococcus mediterraneus RCC2590 (Subirana et al., 2013), Bathycoccus

prasinos RCC1105 (Moreau et al., 2012), Micromonas pusilla RCC299 (Worden et

al., 2009) et Picochlorum sp. RCC4223. Toutes appartiennent à la classe des

Mamiellophyceae (Marin and Melkonian, 2010), sauf le genre Picochlorum qui

appartient à la classe des Trebouxiophyceae (Henley et al., 2004); voir l’arbre

phylogénétique, Figure 8. Les fiches détaillées des souches sont disponibles en

Annexes. Cinq raisons nous ont orienté vers ces choix:

Premièrement, la culture de toutes ces espèces est bien connue en

laboratoire, dans du milieu L1 (voir la composition du L1 en annexe) à 20 °C, avec

un cycle jour-nuit de 8h-16h. Les cultures sont clonales, mais pas axéniques, c’est-

à-dire qu’elles contiennent des bactéries. La maîtrise de la culture est une étape

essentielle pour la mise en place d’expériences et de protocoles avec ces espèces.

Pour les expériences, toutes les souches proviennent de la Roscoff Culture

Collection (http://roscoff-culture-collection.org/), une banque de microorganismes

basée en France et disponible pour la recherche.

  37  

Deuxièmement, ces espèces sont devenues des modèles d’étude avec une

importante bibliographie qui nous donne accès à différentes informations biologiques

ou écologiques. C’est surtout le cas des Mamiellophyceae, avec quelques exemples

relatés dans la littérature (Abby et al., 2014; Blanc-Mathieu et al., 2014, 2013; Demir-

Hilton et al., 2011; Grimsley et al., 2010; Jancek et al., 2008; Palenik et al., 2007;

Piganeau et al., 2011b; Rodríguez et al., 2005; Šlapeta et al., 2006; Sullivan et al.,

2015).

Troisièmement, en lien avec l’argument précédent, le génome de ces

espèces a été entièrement séquencé, ce qui est essentiel pour une étude du taux de

mutation. Les génomes et données associées sont disponibles sur deux sites,

ORCAE (Sterck et al., 2012) pour l’annotation et Picoplaza (Vandepoele et al., 2013)

pour l’analyse comparative des génomes.   Ce n’est cependant pas le cas pour

Picochlorum RCC4223, dont l’assemblage et l’annotation du génome font partie du

travail de thèse.

Quatrièmement, elles possèdent une large diversité génétique et génomique:

un petit génome haploïde de 13 à 21 Mb (Tableau 4), avec des variations en GC qui

vont de 46 à 63%. Ces différences génomiques nous intéressent précisément dans

le cadre des EAMs pour tester les différentes hypothèses exposées en seconde

partie de cette introduction.

Tableau 4. Diversité génomique des espèces utilisées pour les expériences d’accumulation de

mutations. La diversité génétique de nos modèles, notamment la composition en GC et la taille du

génome, nous intéressent pour tester leurs rôles dans la variation du taux de mutation.

Espèces RCC Génome (Mb) %GC Gènes Génome codant (%)

Ostreococcus tauri 4221 12.5 56 8 116 81.21

Ostreococcus mediterraneus 2590 13.5 69 7 492 84.25

Bathycoccus prasinos 1105 15.1 48 7 847 83.09

Micromonas pusilla 299 21.0 63 10 286 81.85

Picochlorum sp. 4223 13.7 46 8 755 79.45

  38  

Enfin, les algues vertes d’une manière générale font l’objet de recherches

pour leur potentiel biotechnologique (Becker, 2007; Brennan and Owende, 2010;

Chisti, 2007; Mata et al., 2010). La possibilité d’exploiter les lipides des algues,

notamment pour la recherche de biocarburant (Brennan and Owende, 2010; Hannon

et al., 2010), a poussé de nombreux chercheurs à optimiser les protocoles de

production ou d’extraction des lipides chez certaines espèces, notamment chez les

Trebouxiophyceae (Dassey and Theegala, 2013; Garzon-Sanabria et al., 2012;

Gerken et al., 2013; S.-J. Park et al., 2012; Tran et al., 2014; Yang et al., 2014; Zhu

and Dunford, 2013). Une étude récente a également mis en évidence une potentielle

application médicale (Black et al., 2014) du genre Nannochloris. Brièvement, les

Nannochloris eukaryotum (ou Picochlorum eukaryotum) pénètrent spontanément

dans des cellules humaines de l’épithélium pigmentaire de la rétine. Les algues qui

entrent sont viables et la photosynthèse est active, avec division cellulaire. Ces

cellules de la rétine jouent un rôle crucial dans la formation du réseau vasculaire de

la rétine en régulant l’expression de la production de facteurs de croissance

vasculaire, qui est fonction de la concentration en dioxygène. Plusieurs pathologies

oculaires sont liées à des problèmes de régulation de ces facteurs de croissance.

La production de dioxygène via la photosynthèse par les Nannochloris entrées dans

les cellules de la rétine semble donc, pour les auteurs, une piste à explorer.

La connaissance du taux de mutation est particulièrement importante ici, en

raison de son utilité pour les recherches d’évolution expérimentale qui peuvent être

utilisé pour sélectionner des lignées d’intérêts. C’est la raison pour laquelle un

chapitre sera consacré à cette question, en se focalisant sur l’espèce Picochlorum

RCC4223.

$*!

Figure 8. Arbre phylogénétique des Chlorophyta, repris de Marin et Melkonian (Marin and Melkonian,

2010), réalisé à partir des séquences qui codent l’ARNr 18S. Les Mamiellophyceae constituent un

groupe basal ayant divergé de façon précoce alors que les Trebouxiophyceae sont plus dérivés.

Picochlorum RCC4223

Picochlorum oklahomensis

Chlorella vulgaris

Dunaliella salina

Chlamydomonas reinhardtii

Oltmannsiellopsis viridis

Acrosiphonia sp.

Tetraselmis striata

Nephroselmis astigmatica

Nephroselmis rotunda

Micromonas pusilla

Ostreococcus tauri

Pyramimonas disomata

Pyramimonas olivacea

Coleochaete nitellarum (groupe externe)

Prasinoderma coloniale

Picocystis salinarum

Monomastix minuta

Bathycoccus prasinos

Crustomastix stigmata

Ulvophycea

Chlorophycea

Trebouxiophycea

Nephroselmidophycea

Mamiellophycea

Pyramimonadales

Acrosiphonia

%+!

Figure 9. Photographies en microscopie électronique des espèces utilisées pour les expériences

d’accumulation de mutations. A. Bathycoccus prasinos (Yau et al., 2015). B. Micromonas pusilla

(Yau et al., 2015). C. Ostreococcus sp (Yau et al., 2015). D. Picochlorum sp (photo de Claire Hemon).

6.2.2. Les Mamiellophyceae

Les Mamiellophyceae constituent une part de ce que qui est défini comme le

pico-phytoplancton eucaryote (Massana, 2011). Ils sont ubiquistes et ont été isolées

en mer Méditerranée, et dans les océans Atlantique et Pacifique (de Vargas et al.,

2015; Demir-Hilton et al., 2011). Ce groupe comprend notamment les plus petits

eucaryotes libres connus, avec une taille de l’ordre du micromètre, dont le plus

étudié est Ostreococcus tauri, qui fut découvert dans l’étang de Thau (France) en

1994 (Courties et al., 1994). Ils ont une organisation cellulaire très simple, avec

seulement une mitochondrie et un chloroplaste, et sont caractérisés par une

absence de paroi cellulaire.

Les quatre espèces de Mamiellophyceae étudiées appartiennent à l’ordre des

Mamiellales, dont la première divergence est datée de 65 millions d’années, et

correspond à la divergence du genre Micromonas à la fin du crétacé ("lapeta et al.,

2006). Enfin, il faut noter une très grande diversité au sein de la classe des

Mamiellophyceae (Piganeau et al., 2011a). Malgré la proximité phylogénétique des

différentes espèces, il est à noter qu’au sein même des espèces Ostreococcus tauri

et O. mediterraneus par exemple, 14 et 6 souches génétiquement distinctes ont été

mises en évidence.

100 nm

1.44 µm 50 nm

!" #" $" %"

%"!

Les différentes espèces de Mamiellales connues possèdent des

chromosomes particuliers, appelés «outlier chromosomes», qui ont une composition

en GC inferieure au reste du génome, avec de nombreuses régions répétées. En

tout, O. tauri possède 20 chromosomes, O. mediterraneus et B. prasinos 19, M.

pusilla 17. Le caryotype de ces quatre espèces est présenté sur la Figure 10.

Figure 10. Migration par PFGE de l’ADN complet des 4 espèces de Mamiellophyceae. B. prasinos

possède 19 chromosomes, O. tauri 20, O. mediterraneus 19 et M. pusilla 17. Les marqueurs de taille

sont le phage Lambda (premier puits à gauche), et la levure (dernier puits à droite).

6.2.3. Les Trebouxiophyceae 1. Présentation générale

La classe des Trebouxiophyceae a évolué plus récemment que celle des

Mamiellophyceae dans l’arbre des Chlorophyta, et possède aussi des genres bien

connus en biologie, comme Chlorella. Il existe également des génomes séquencés

chez les Trebouxiophyceae (Blanc et al., 2012, 2010; Gao et al., 2014; Pombert et

al., 2014). Celui qui se rapproche le plus de notre souche Picochlorum RCC4223 est

la souche Picochlorum SE3 (Foflonker et al., 2016, 2015), avec un génome de 13.5

Y !

Ot Om Bp

Mp

250

450 555

680

815

1 900

915

1 640

1 100

945

!"#$%&'%

(&!%

)""%

$"*%'*'#$%

Taille en Mb

Taille en Mb

  42  

Mb et un GC de 46% (Foflonker et al., 2015). Différentes stratégies de divisons

cellulaires sont connues (Yamamoto et al., 2007): la fission (Picochlorum bacillaris),

le bourgeonnement (Nannochloris coccoides) et l’autosporulation (N. eucaryotum, N.

atomus).

An sein des Trebouxiophyceae, deux genres nous intéressent: Nannochloris

et Picochlorum, auxquels appartient la souche RCC4223. La phylogénie n’est pas

encore totalement établie (Henley et al., 2004; Yamamoto et al., 2007, 2003, 2001),

et des changements de noms entre les deux genres ont eu lieu pour différentes

espèces ou souches. Ainsi, il existe des synonymes, d’où une possible confusion.

D’après les connaissances actuelles, les espèces du genre Picochlorum sont

caractérisées par une halotolérance importante (Foflonker et al., 2015; Henley et al.,

2002; von Alvensleben et al., 2013), jusqu’à 90 g.L-1.

6.2.3. Les Trebouxiophyceae 2. Les transferts horizontaux de gènes

Le genre Picochlorum peut permettre de répondre en partie à une troisième

question concernant l’évolution et la diversification du phytoplancton eucaryote:

Quelle est la part des transferts horizontaux de gènes (« Horizontal Gene

Transfert », HGTs) dans la diversification du phytoplancton?

En effet, des HGTs ont été mis en évidence chez plusieurs espèces

eucaryotes appartenant aux Chlorophyta (Picochlorum SE3 (Foflonker et al., 2015),

B. prasinos (Moreau et al., 2012), Chloromonas brevispina (Raymond, 2014) et

Chlorella variabilis (Blanc et al., 2010)) ainsi que chez des algues rouges

(Rhodobionta) (Galdieria phlegrea par exemple (Qiu et al., 2013)). Ces transferts de

gènes permettent l’acquisition de nouveaux gènes et nouvelles fonctions qui

augmentent la diversité et les capacités adaptatives. Les HGTs sont bien connus et

fréquents chez les bactéries et les archées (Vos et al., 2015), et chez les eucaryotes

(Schönknecht et al., 2014). Il a été proposé que les eucaryotes capables de survivre

à des environnements extrêmes auraient conservés plus de gènes d’origine

  43  

bactérienne acquis par transferts horizontal, comme pour Galdieria sulphuraria

(Schönknecht et al., 2013). L’étude d’un autre génome de Picochlorum, halotolérant

et themotolérant, pourrait donc fournir de nouvelles données sur l’hypothèse des

HGTs vers les Planta.

Pour les différentes raisons évoquées plus haut (HGTs et potentiels

biotechnologiques), il nous a semblé important d’inclure Picochlorum RCC4223 dans

nos études sur le taux de mutation chez les algues vertes. C’est pourquoi, en plus

des expériences d’accumulation de mutations et des résultats associés, une partie

du travail de thèse consiste dans l’assemblage et l’annotation de ce nouveau

génome.

   

  44  

                                                                                             

  45  

7. Les objectifs de thèse Quels sont les impacts des nouvelles mutations sur la fitness du pico-phytoplancton eucaryote (Chlorophyta)?

Pour répondre à cette question, nous avons effectué des EAMs sur les quatre

espèces de Mamiellophyceae présentées précédemment, en suivant l’évolution de

la fitness au cours du temps. La fitness est estimée par le nombre de divisions

cellulaires par jour, depuis le T0 au Tfinal. Au total, cette étude de fitness portera sur 7

lignées de M. pusilla, 8 de B. prasinos, 23 d’O. mediterraneus et 19 d’O. tauri. A cela

s’ajoute, en fin d’expérience, des tests de fitness dans différentes conditions de

salinité et en condition de stress (présence d’herbicides). L’objectif est d’observer ou

non des changements de fitness entre environnements, qui seraient le résultat de

changements d’effet des mutations.

Quel est le taux de mutations spontanés des algues vertes (Chlorophytes) et quels sont les facteurs qui l’influencent?

Les lignées utilisées pour estimer le taux de mutation sont issues d’EAMs

identiques au protocole utiliser pour répondre à la première question exposée ci-

dessus. Les mutations sont un évènement rare, ce qui pose deux contraintes

expérimentales: il faut suffisamment de lignées et suffisamment de générations pour

pouvoir observer des mutations en fin d’expérience. 40 lignées par espèce ont été

maintenues le plus longtemps possible pour obtenir le plus de générations

indépendantes possibles dans nos conditions expérimentales. Le génome de ces

lignées est séquencé par Illumina (162 en tout), et un travail bioinformatique nous

permet d’estimer directement le taux de mutation et leurs répartitions dans le

génome. Deux questions sous jacentes se posent, celles de la variabilité inter

génomique et intra génomique du taux de mutation.

  46  

Quel est le rôle des HGTs dans la diversification des algues vertes (Chlorophytes)?

Enfin, la possibilité d’étudier un nouveau génome (celui de Picochlorum

RCC4223) permet d’explorer d’autres mécanismes d’adaptation. Les HGTs ont été

proposés chez les algues vertes comme un mécanisme de diversité. Ce nouveau

génome confirmera ou pas cette hypothèse en mettant en évidence des transferts

horizontaux de gènes vers Picochlorum. Les HGTs candidats chez Picochlorum SE3

vont être recherchés dans le nouveau génome de RCC4223. De plus, une partie

expérimentale et une partie de génomique comparative vont permettre de

caractériser la nouvelle souche.

Quelles sont les implications du taux de mutation pour la domestication des algues vertes ?

Le taux de mutation de Picochlorum RCC4223 est estimé de la même façon

que pour les Mamiellophyceae. Par contre, l’expérience ne compte que 12 lignées et

le type ancestral. Ce taux de mutation donne l’opportunité de discuter du taux de

mutation d’une espèce d’algue verte qui présente des intérêts pour les

biotechnologies. La connaissance de son taux de mutation peut donc être un

paramètre à prendre en compte dans le choix des espèces.

  47  

CHAPITRE 2:

L’EFFET DES MUTATIONS SUR LA

FITNESS

  48  

                                                                                   

  49  

Quels sont les impacts des nouvelles mutations sur la fitness du pico-phytoplancton eucaryote (Chlorophyta)?

Pour tenter de comprendre l’impact des mutations sur la fitness chez les

algues vertes, nous avons effectué des EAMs sur 40 lignées de chaque espèce de

Mamiellophyceae. Cette étude est la première du genre chez les Mamiellophyceae,

qui n’ont jamais fait l’objet d’EAMs. Selon les espèces, les lignées ont été

maintenues de 204 à 378 jours, avec une série de goulots d’étranglements à une

cellule tous les 14 jours. Contrairement à la plupart des microorganismes ayant déjà

fait l’objet d’EAMs, les cultures ne sont pas maintenues en milieu solide, mais

liquide. Pour cette raison, nous avons utilisé la cytométrie en flux pour suivre la

croissance des lignées et des contrôles. Toutes les lignées sont issues d’un clone

T0, et maintenues avec une taille efficace réduite au maximum pour les lignées, et

100 fois plus grande pour le contrôle. Le contrôle, avec une sélection efficace,

maintient la fitness du type ancestral au niveau optimal.

La fitness est estimée par le nombre de divisions cellulaires par jour. En

raison des pertes de lignées remplacées par les survivantes en cours d’expérience,

nous ne considérons que les lignées totalement indépendantes pour les analyses

statistiques. Au suivi de la fitness s’ajoutent deux tests pour explorer l’interaction

génotype-environnement sur l’effet des mutations. Pour cela, la fitness des lignées

est mesurée dans différentes conditions: une variation de salinité sur un gradient de

5 à 65 g.l-1, et deux conditions en présence d’herbicides. Les espèces choisies ont

une large tolérance aux changements de salinité: nous avons voulu voir la réponse

des lignées mutantes à ces changements. Les milieux avec herbicides permettent

d’étudier la réponse au stress.

Cette étude montre une baisse de fitness chez O. tauri, en accord avec la

littérature sur le sujet (Halligan and Keightley, 2009). Nous mettons aussi en avant

l’importance de l’interaction GxE dans l’adaptation. En effet, certaines lignées

montrent des variations significatives de fitness (augmentation ou diminution) dans

les conditions de tests GxE qui n’ont pas été détectées pendent l’EAM. Par ailleurs,

nous discutons des possibles problèmes expérimentaux, notamment la forte perte

de lignées pour certaines espèces, en particulier B. prasinos et M. pusilla.

Le matériel supplémentaire de ce chapitre est disponible page 137 à 142.

  50  

                                                                                                 

INVESTIGATION

Fitness Effects of Spontaneous Mutations inPicoeukaryotic Marine Green AlgaeMarc Krasovec,*,1 Adam Eyre-Walker,§ Nigel Grimsley,* Christophe Salmeron,† David Pecqueur,†

Gwenael Piganeau,*,1 and Sophie Sanchez-Ferandin** Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie Intégrative des Organismes Marins (BIOM), ObservatoireOcéanologique, F-66650 Banyuls/Mer, France †Sorbonne Universités, UPMC Univ Paris 06, CNRS, ObservatoireOcéanologique de Banyuls (OOB) , F-66650 Banyuls/Mer, France and §School of Life Sciences, University of Sussex,Brighton BN1 9QG, United Kingdom

ABSTRACT Estimates of the fitness effects of spontaneous mutations are important for understanding theadaptive potential of species. Here, we present the results of mutation accumulation experiments over 265–512 sequential generations in four species of marine unicellular green algae, Ostreococcus tauri RCC4221,Ostreococcus mediterraneus RCC2590, Micromonas pusilla RCC299, and Bathycoccus prasinos RCC1105.Cell division rates, taken as a proxy for fitness, systematically decline over the course of the experiment inO.tauri, but not in the three other species where the MA experiments were carried out over a smaller numberof generations. However, evidence of mutation accumulation in 24 MA lines arises when they are exposedto stressful conditions, such as changes in osmolarity or exposure to herbicides. The selection coefficients,estimated from the number of cell divisions/day, varies significantly between the different environmentalconditions tested in MA lines, providing evidence for advantageous and deleterious effects of spontaneousmutations. This suggests a common environmental dependence of the fitness effects of mutations andallows the minimum mutation/genome/generation rates to be inferred at 0.0037 in these species.

KEYWORDS

spontaneousmutation

mutationaccumulation

fitness effectsmarine pico-phytoplankton

single cellcultures

Mutations are the main drivers of genetic diversity that enable speciesto adapt by natural selection. Estimating the spontaneousmutation rateand the fitness effects of mutations is, thus, essential for a betterunderstanding of the evolution and the adaptive potential of species(Wright 1932; Kondrashov 1988). A proportion of new mutations aredeleterious (Charlesworth and Charlesworth 1998; Keightley andLynch 2003; Lynch et al. 1999), and some of the strongest evidencefor this comes frommutation accumulation (MA) experiments, pioneeredby Mukai in Drosophila melanogaster (Mukai 1964). The accumula-tion of mutations can be measured experimentally by monitoring thegrowth, or other fitness traits, of independent lines starting from one

genotype for a given number of generations (see Halligan andKeightley 2009 for a review). Serial bottlenecks make natural selectionineffective in the face of genetic drift and permit deleterious muta-tions to segregate and become fixed in MA lines. Since Mukai’s firstexperiments in Drosophila, many MA experiments have been per-formed in different organisms: Arabidospis thaliana (Shaw et al. 2000),Caenorhabditis elegans (Ajie et al. 2005; Katju et al. 2014; Vassilieva et al.2000; Vassilieva and Lynch 1999), Daphnia pulex (Deng et al. 2002;Deng and Lynch 1997; Schaack et al. 2013), Dictyostelium discoideum(Hall et al. 2013), D. melanogaster (Fernández and López-Fanjul 1996;Fry 2004, 2001; Fry et al. 1999; Keightley 1994; Schrider et al. 2013),Saccharomyces cerevisiae (Wloch et al. 2001; Zeyl and DeVisser 2001),and Tetrahymena thermophila (Long et al. 2013). Generally, these ex-periments show a decrease of fitness in the MA lines as the experimentprogresses, consistent with a substantial proportion of spontaneousmutations being deleterious.

MA experiments also enable the relationship between the fitnesseffects of mutations and the environment to be explored. Knowledgeabout genotype–environment (GxE) interactions is essential to under-stand the adaptation process, because fitness effects of mutations maychange with time and spatial scales. InD. melanogaster (Fry et al. 1996;Kondrashov and Houle 1994), C. elegans (Baer et al. 2006) or S. cer-evisiae (Korona 1999), the fitness effects of spontaneous mutations

Copyright © 2016 Krasovec et al.doi: 10.1534/g3.116.029769Manuscript received March 29, 2016; accepted for publication May 5, 2016;published Early Online May 10, 2016.This is an open-access article distributed under the terms of the CreativeCommons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproductionin any medium, provided the original work is properly cited.Supplemental material is available online at www.g3journal.org/lookup/suppl/doi:10.1534/g3.116.029769/-/DC11Corresponding authors: Pierre and Marie Curie University (UPMC), 1 Avenue deFontaulé, 66650 Banyuls-sur-Mer, France. E-mails: krasovec@obs-banyuls.fr;gwenael.piganeau@obs-banyuls.fr

Volume 6 | July 2016 | 2063

change with environmental conditions. However, this interaction is notsystematic; in the case ofA. thaliana, one experiment showed a positiveGxE interaction in fitness effects of mutations (Rutter et al. 2012),whereas other studies did not (Chang and Shaw 2003; Kavanaughand Shaw 2005). The nature of the change in mutational effect withenvironmental conditions allows us to infer three biological implica-tions (Martin and Lenormand 2006): (i) a change in the genomicmutation rate U can be interpreted as changes in the expression ofmutated genes, (ii) an increase of the fitness variance suggests a varia-tion in the fitness effects of mutation between environments (iii), achange in the average fitness measuredmight be explained by increasedselection strength in harsh conditions.

In harsh environments, the effects of deleterious mutations areexpected to increase, because of the biological and ecological pressureinduced by stress. However, this view is disputed by experimental evidencein Escherichia coli (Kishony and Leibler 2003) and C. elegans (Andrewet al. 2015). In general, the interaction between stress and fitness effects ofmutationsmay be categorized as follows (Elena and deVisser 2003): first,unconditionally deleterious, with the magnitude of the stress increasingthe deleterious effect; second, conditionally neutral, i.e., neutral in someconditions and deleterious in others; third, conditionally beneficial, i.e.,advantageous in some conditions but deleterious in others.

While most MA experiments have been performed in model or-ganisms, no results are available inmarine phytoplanktonic eukaryotes.Here, we report MA experiments in four haploid marine green algae(Chlorophyta): Ostreococcus tauri RCC4221 (Blanc-Mathieu et al.2014), Ostreococcus mediterraneus RCC2590 (Subirana et al. 2013),Micromonas pusilla RCC299 (Worden et al. 2009), and Bathycoccusprasinos RCC1105 (Moreau et al. 2012). All species belong to theMamiellales order (class Mamiellophyceae, Marin and Melkonian2010), and are widespread members of the marine phytoplankton(De Vargas et al. 2015) that sustain the marine ecosystem in coastalareas (Worden et al. 2004). These green algae contain the smallestknown free-living eukaryotes (Courties et al. 1994), defined as thepico-phytoplankton (see Massana 2011 for a review). They have asimple cell organization, with only one chloroplast and one mitochon-drion, and a small genome of 13–21 Mb.

MATERIALS AND METHODS

Biological modelsWe performed MA experiments on four haploid marine green algae(Chlorophyta): O. tauri RCC4221, O. mediterraneus RCC2590, M.pusilla RCC299, and B. prasinos RCC1105. All cultures are availablefrom the Roscoff Culture Collection (http://roscoff-culture-collection.org/). The identity of each strain was confirmed by 18S rDNA sequenc-ing and PFGEmigration (Schwartz and Cantor 1984) at the start of theexperiment. All species were kept in L1 liquid medium (salinity of35 g/L) with a light:dark (LD) cycle of 8:16 (8 hr light 16 hr dark) in24-well plates, at 20�, except for B. prasinos RCC1105, for which thecycle was 12:12 LD.

MA experimentsEach experiment was started with one single cell, which divided toproduce the ancestral population, fromwhich single cells were sampledtogenerate independent lines byonecell inoculation (Figure1). For eachspecies, we inoculated 40MA lines, kept in 24-well microtiter plates. Asa control, the ancestral population was cultured in the same conditions,but with an inoculation of 100 cells, to maintain a larger effectivepopulation size. We kept one microplate of controls, i.e., 24 controlreplicates.

Classically, inMA experiments of unicellular organisms, a colony ofcells is transferred to a fresh agar plate at each bottleneck to allow theseparation of the cells and the random sampling of a new cell. However,this is not possible in these species as they do not grow on the surface ofgelledmedia, and only grow slowlywithin gelledmedium, in contrast toS. cerevisiae, D. discoideum or Chlamydomonas reinhardtii (Hall et al.2013; Morgan et al. 2014; Wloch et al. 2001). Nevertheless, they areeasily cultured in liquid medium in the laboratory. Therefore, we de-veloped an experimental protocol combining flow cytometry, whichhas the advantage of counting individual cells while verifying cell sizeand fluorescence, and transfer of single cells in liquid media. Bottle-necks of MA lines to one cell were performed every 14 d. However,since the number of sampled cells follows a Poisson distribution, theprobability of line loss by sampling one single cell is 0.37. Indeed, incontrast with agar plate protocols, a colony cannot be observed in liquidmedium, and the cell densities were never large enough to be seen asgreen. Thus, we measured the number of cells in our wells and calcu-lated the volume needed to extract 10 cells, from which we sampled sixfor the next new six wells with fresh media. Thus, we maintained sixreplicates per line at each bottleneck.

If we assume that cells are uniformly distributed through themedium, the number of sampled cells, N, is Poisson distributed:

P�N; �N

� ¼ e2�N �NN

N!(1)

We inoculated those cells into a volume V from which we drewaliquots such that we ultimately discarded a proportion q of thesample. For a particular sample, the probability that all N cells arediscarded is simply qN. Thus, the overall probability that we discard allcells and hence lose a line is:

G ¼XNN¼0

P�N; �N

�qN (2)

If we wanted to include pipetting error, we could model this byassuming that the volume sampled differs from that intended by afactor a which is g distributed with a mean of 1 and a shape param-eter of b. Now equation 1 becomes:

P�N; �N;b

� ¼ZN

a¼0

e2a�Νða�NÞNN!

Dða;bÞda (3)

This is actually a negative binomial:

P�N; �N;b

� ¼ 1N!GðbÞ

�NN�1b

�b��Nþb

�2N2bGðNþbÞ (4)

So the probability of observing k or more line losses over t transfers isgiven by multiplying G from equation (2) by k and t.

One fifth of themicrotiter plate’s volumewas used for Cell counting,using a FACSCanto II flow cytometer (Becton Dickinson, FranklinLakes, NJ) equipped with an air-cooled laser providing 15 mW at488 nm with the standard filter set-up. Becton Dickinson TrucountTM

beads were used to calculate the abundance of the cells as described byPecqueur et al. (2011). A total of 20ml of mixed fluorescent beads 1mmin diameter (Molecular Probes Inc., Eugene, OR) were added as aninternal standard to 300 ml of the diluted sample (20th dilution). Theflow rate of the cytometer was set to high (acquisition time: 1 min).Eukaryotic pico-phytoplankton cells were detected and analyzed usingnatural chlorophyll fluorescence (chlorophyll a FL3 670 nm LP). The

2064 | M. Krasovec et al.

flow cytometry data were analyzed using BD FACSDiva (BectonDickinson).

In total, the experiments involved 27 bottlenecks over 378 d forO. tauri, 21 bottlenecks over 294 d forO. mediterraneus, 21 bottlenecksover 302 d forM. pusilla, and 16 bottlenecks over 224 d for B. prasinos(Table 1).

Estimation of fitnessWe estimated the fitness of lines from the number of divisions/day, G,calculated over a period of 14 d using the equation:

G ¼ e½lnðNt=1Þ=t� (5)

Nt is the final number of cells just before the bottleneck and t = 14 thenumber of days between two bottlenecks (t = 14). G is the number ofgenerations/day. To compareG between differentMA lines over time,the relative fitness, Gr (Gr = GMA/Gcontrol), was computed. The effec-tive population size of MA lines and control line populations at eachbottleneck was estimated as the harmonic mean of the population sizebetween t = 1 to t = 14 days. Following Chevin (2011), the fitnesseffects of mutations in the MA lines at the end of the experiment weremeasured by estimating the selection coefficient scaled by the gener-ation time, ST.

ST ¼ lnðGMAÞ2 lnðGcontrolÞlnðGcontrolÞ

ln2 (6)

Fitness assays in stressful conditionsUpon completion of the MA experiments in O. mediterraneus, M.pusilla, and B. prasinos, we used MA lines that had survived from thefirst to the last generations in each species for further investigations in

stressful conditions: nineMA lines ofO. mediterraneus, sevenMA linesof M. pusilla, and eight MA lines of B. prasinos. For O. mediterraneus,24 MA lines reached the end of the experiment, of which nine werechosen randomly for practicality.

Before starting fitness assays, we transferredMA lines in L1mediumflasks and let them grow for 2 wk to have enough cells to inoculatecultures. Fitness assays were performed in 48-well microtiter plates,with a starting population of�50,000 cells/well. For herbicide tolerancetests, we used Diuron at 10 mg/L and Irgarol 1051 at 1 mg/L (Sanchez-Ferandin et al. 2013). We tested salinities of 5, 20, 35, 50, and 65 g/Lusing L1 medium supplements (Guillard and Hargraves 1993). Thenumber of biological replicates was three for each MA line and fourfor each control. Cell concentrations were obtained by flow cytometry7 d after plate inoculation and STwas estimated as specified above. Thiscorresponds to a total of 52 wells measures for M. pusilla, 58 for B.prasinos, and 64 for O. mediterraneus. In O. tauri, the MA experimentwas completed 6 months before the start of the fitness assays understressful conditions, so fitness assays could not be performed for thisspecies.

Statistical analysisFirst, to investigate the relationship between fitness,G, and the numberof sequential generations, we used data from those lines that survivedthroughout the experiment: 21 lines for O. tauri, 24 for O. mediterra-neus, eight for B. prasinos, and seven for M. pusilla. We performed anANOVA on the control data to test whether G changed significantlybetween bottleneck times. The change in fitness of MA lines as a func-tion of time was thereafter analyzed by dividing the growth rate in theMA lines by the growth rate in the control, Gr, to remove the variationin the experimental set-up through time. For each line, the relationshipbetween the relative fitness (Gr) and the number of generations wastested using Pearson’s correlation.

Figure 1 Mutation accumulation (MA) experiments in pico-algae. Flow cytometer measurements were performed every 14 d to make one cellbottlenecks for each line. The ancestral culture of each species came from one single cell, inoculated in a well to grow enough cells to start theexperiment. The ancestral culture was maintained with higher effective population size in the control lines (inoculation of 100 cells) and MA linesby reinoculating one single cell, in six replicates per line, in 24-well microtiter plates.

Volume 6 July 2016 | Effects of Mutations in Algae | 2065

Second, for fitness assays in stressful conditions, ST was calculatedin all conditions using GMA and Gcontrol at each condition as explainedabove. We used a pairwise Student’s test to detect changes betweenMA lines and control. The p-value was corrected for multiple testingusing the Bonferroni-Holm method (Holm 1979), as implementedin R. Because MA lines could have fixed more than one mutationduring MA experiments, the selection coefficient is estimated for apotential set of mutations, including their possible epistatic effectson fitness.

To check that the environmental assays were indeed stressful for ourcultures,Gcontrol of the 24 controls at the end of theMA experiment wascompared to Gcontrol of the four controls in each of the environmentalconditions. A significant decrease of G in an environmental conditionconfirmed its stressful effect.

Finally, the salinity of 35 g/L is the standard salinity of culture. Weperformed a Fisher-Snedecor test to detect changes in variance betweenthe standard salinity and the other salinities.

Statistical analyses were performed with R (version 3.1.1) (R CoreTeam 2014).

Data availabilitySupplemental Material, Table S1, Table S2, Table S3, and Table S4contain fitness data of each MA line during the experiments. TableS5, Table S6, and Table S7 contain fitness data for fitness assays inherbicides and salinity gradient conditions. Control data during MAexperiments are provided in Table S8, Table S9, Table S10, andTable S11.

RESULTS

MA experimentsThe average effective population sizes across the experiment were sixcells for O. mediterraneus and M. pusilla and eight cells in B. prasinosand O. tauri (Table 1). The effective population size in the control,which was started with an initial cell number of 100, was estimatedto be 600 forM. pusilla, 650 forO. mediterraneus, and 700 for the othertwo species. Between each bottleneck, depending on species and lines,the lines divided 10–20 times, corresponding to 512 independent se-quential generations/line forO. tauri, 272 forO. mediterraneus, 265 forB. prasinos, and 272 for M. pusilla, on average (Table 1).

Fitness effects of mutations during the MA experimentWemeasured the fitness of ourMA lines as the number of cell divisionsthat occurred between two bottlenecks. There was no increase ordecrease in the growth rate of the control lines with generation time,but there was a significant variation between bottleneck times(ANOVA, p-value , 0.001) for all species. The fitness values ofMA lines were thus divided by the mean fitness estimation of thecontrol, Gcontrol, to yield relative fitness values, Gr; this was done to

eliminate any changes in fitness due to uncontrolled variation in theexperimental set-up.

The average Gr of O. tauriMA lines per bottleneck event decreasessignificantly with time (Pearson correlation test, r = 20.49, p-value =0.047). Also, four independent MA lines of the 21 had an individu-ally significant decrease of Gr (Pearson correlation test; r = 20.54,p-value = 0.026; r = 20.51, p-value = 0.035; r = 20.56, p-value =0.018; and r = 20.55, p-value = 0.022) (Table S4).

In O. mediterraneus, Gr significantly increased in one line (Pearsoncorrelation test, r = 0.52, p-value, 0.05). This line is the only one witha significant increase in fitness. No significant increase or decrease ofwithin-species fitness variation of Gr was detected forM. pusilla (TableS1), B. prasinos (Table S2), and O. mediterraneus (Table S3).We alsoinvestigated whether the number of lines lost varied over the course ofthe experiments: the data are consistent with a constant line loss overthe course of the experiments in all four species. However, the observednumber of lines lost was higher than expected by chance for a coeffi-cient of variation in sampling error equal or smaller to 5% (Table 2) inall species.

Fitness effects in stressful conditions

Herbicide stress: Both herbicides significantly decreased fitness in thecontrol lines in all tested species when compared to those culturedwithout herbicide (Wilcoxon test, p-value , 0.001); the herbicides re-duced growth rate by 52% and 74% for B. prasinos, 40% and 42% forM.pusilla, and 52% and 48% for O. mediterraneus, in Irgarol 1051 andDiuron media, respectively. In some cases, the variance significantlyincreased in MA lines (Fisher-Snedecor test, p-value , 0.05 in Irgarol1051 for O. mediterraneus and M. pusilla; p-value , 0.001 for B.prasinos with the two herbicides). A change of variance is as expectedin stressful conditions, because of the revelation of mutation effects.

For each species, the selection coefficients, ST, are shown in Figure 2.In contrast with the MA experimental conditions, some MA linesshowed significantly lower or higherfitnesses with a significant negativeor positive selection coefficient. In addition, ST changed between thetwo conditions for some identical MA lines.

In all, one MA line had a significantly positive selection coefficient,while two MA lines had a significantly negative selection coefficient inthe two conditions.

In summary, out of 24 tested lines, 12 lines (50%) had a significantlynegative ST in at least one herbicide, whereas five lines (21%) had asignificantly positive ST.

Osmolarity stress: MA and control lines were exposed to lower(salinities of 5 and 20 g/L) and higher (salinities of 50 and 65 g/L) levelsof salinity than the seawater of their natural environment (35 g/L).Below, we define an environment as stressful if the controls grow moreslowly in this environment than in standard conditions, the magni-tude of stress being estimated by the growth rate reduction. Both high

n Table 1 Summary of mutation accumulation experiments for four species

Species Number of Lines Average Number of Generations Per Line Ne T0–Tf (d)

O. tauri RCC4221 21 512 8 378O. mediterraneus RCC2590 24 272 6 294M. pusilla RCC299 7 272 6 302B. prasinos RCC1105 8 265 8 224

The number of lines is the number of surviving independent lines since the start of the experiment (T0) to the end (Tf).Ne is the average of effective population size betweeneach bottleneck. The last column is the total duration of the experiment. The probability of line loss was estimated using equation (2) in theMaterials and Methods section,N = 10, and q = 0.4. Expected number of line losses (Lexp) is estimated for each species as a function of the coefficient of variation in sampling cells (Table 2).

2066 | M. Krasovec et al.

and low salinities are stressful for B. prasinos. In contrast, the controllines of bothM. pusilla and O. mediterraneus grew faster in the slightlylower salinity treatment (20 g/L), andO. mediterraneus also grew fasterin the lowest salinity treatment (5 g/L) than in the standard conditions(35 g/L), suggesting that lower salinity is not necessarily stressful.A change in the selection coefficient of MA lines is thus not necessarilya consequence of a stress, but just due to benign changes of an envi-ronmental parameter.

Stress may be expected to increase the fitness variance. To test this,we compared the variance of ST in each condition with the standardconditions (35 g/L). The variance of the fitness of MA lines was signif-icantly higher for O. mediterraneus in the higher salinity, the moststressful condition (p-value , 0.01). This was also the case for B.prasinos in the two higher and lower salinities (p-value , 0.001) andat 20 g/L (p-value, 0.05). In contrast, we did not detect any significantchange of the variance in the fitness of M. pusilla MA lines betweentested conditions.

The three species showed contrasting patterns in terms of thedirection of selection coefficient variation, estimated from the numberof cell divisions/day (Figure 3). In O. mediterraneus, ST was systemat-ically negative for theMA lines. In particular, the decrease of STwas themost significant in the highest salinity, which was the most stressful. B.prasinos andM. pusillaweremuchmore variable. In B. prasinos, almostall MA lines had a significantly higher fitness than the control understressful conditions, whereas in M. pusilla approximately half of thelines with significantly different fitness to the control had higher fitness,and half had lower fitness. Strikingly, the MA lines in B. prasinos withhigher fitness under low salinity also had higher fitness in highersalinity.

In conclusion, all 24 MA lines investigated had a significant loweror higher selection coefficient than the control lines in at least onecondition, in accordance with the accumulation of spontaneous muta-tions in each MA line and a variation in the effects of spontaneousmutations in different environments.

DISCUSSION

No fitness decrease in three out of four species: nomutations or mutations with no fitness effects?Except forO. tauri, mostMA lines did not show any evidence of fitnessdecrease during the experiment. This is despite running the experimentwith a low average effective population size of around eight individuals,at maximum, over 265–272 generations. Several factors might explainthe absence of fitness decrease in most MA lines.

First, it could be due to a very low mutation rate. The low mutationrate could be a result of large effective population sizes in these species,that enable selection for lowermutation rate, limiting the appearance of

deleterious mutations (Lynch 2010; Sung et al. 2012). Nevertheless, itis possible to estimate a minimum mutation rate, assuming that asignificant fitness difference between the controls and the MA linesmight be the result of at least one mutation. Since each of the MAlines has a significant fitness difference with the control in at leastone condition, this corresponds to nine mutations for O. mediterra-neus, seven for M. pusilla, and eight for B. prasinos. Depending onthe number of generations and the genome size, the minimum mu-tation rate is thus 2.72210 mutations/site/generation for O. mediter-raneus (i.e., 0.0037 mutations/genome/generation), 1.75210 for M.pusilla (i.e., 0.0037 mutations/genome/generation), and 2.52210 forB. prasinos (i.e., 0.0038 mutations/genome/generation). These esti-mates are consistent with estimates in other unicellular organisms,like C. reinhardtii (Ness et al. 2012) with 2.08210 mutations/site/generation, or S. cerevisiae with 3.30210 mutations/site/generation(Lynch et al. 2008), Schizosaccharomyces pombe with 2.00210

mutations/site/generation (Farlow et al. 2015), Burkholderia ceno-cepacia with 1.33210 mutations/site/generation (Dillon et al. 2015),or E. coli with 2.45210 mutations/site/generation (Lee et al. 2012).Thus, fitness assays suggest that the minimum mutation rates ofour strains are not lower than those in other species and are close tothe constant mutation rate proposed by Drake (Drake 1991), that isU = 0.0033 in microorganisms.

Second, our measure of fitness may not be well suited to detect theeffect of mutations. In a MA experiment in D. discoideum, Hall andcoworkers followed eight fitness traits, and showed that two of themdidnot decrease (Hall et al. 2013).Wemeasured fitness as the rate at whichthe population increased over the 2 wk period between two bottlenecks.Most of the species tend to divide once a day, in rhythm with thenatural LD cycle, and so this is probably a robust character, particularlyunder the benign lab conditions. Likewise, cell death may not occurvery often under laboratory conditions. However, the fact that all MAlines show significant fitness differences with the control lines understressful conditions suggests that at least some mutations with fitnesseffects have occurred. Indeed, the fitness effects of mutations changeacross environments. Previous mutation experiments in Caenorhabditis(Baer et al. 2006) andD.melanogaster (Fry et al. 1996; Fry andHeinsohn2002) suggest thatmutational parameters change, as expected because ofGxE interactions.

Third, although all of these species are usually haploid, some linesmay have become diploid during the experiment, which may havemasked the effects of some deleterious mutations. However, we wouldexpect an increase of cell size with ploidy change, but this was notobserved by flow cytometry.

Finally, the duration of the experimentmay not have been sufficientto detect the effects of deleterious mutations. A decrease of fitness was

n Table 2 Statistical probabilities of line loss

CV pO. tauri O. mediterraneus B. prasinos M. pusilla

Lexp P(L $ Lobs) Lexp P(L $ Lobs) Lexp P(L $ Lobs) Lexp P(L $ Lobs)

0 0.0025 2.7 0 2.1 0 2.4 0 1.7 00.05 0.0026 2.8 0 2.2 0 2.5 0 1.8 00.4 0.0150 16.2 0.09 12.6 0 14.4 0 10.2 00.5 0.0260 28.1 0.89 21.8 0.5 25.0 0.0000 17.7 0.0033

Statistical probabilities of line loss, with p the probability of line loss at each bottleneck, Lexp the expected number of line losses for each experiment, and Lobs thenumber of observed line losses. Probability of observing Lobs or more line losses, as a function of the number of lines, the number of bottlenecks, t (16, 21, and27 bottlenecks depending on species), and the coefficient of variation of the sampling error (g distribution with average 1 and Coefficient of Variation CV). As anexample, for O. tauri, the probability of obtaining the observed line loss, Lobs, over the number of bottlenecks performed, with a CV of 0.04, is 0.09 [P(L $ Lobs)], theexpected line loss, Lexp, being 2.8.

Volume 6 July 2016 | Effects of Mutations in Algae | 2067

observed in O. tauri, which was allowed to accumulate mutationsover a longer period than the other three species (512 generations ascompared to the 272 and 265 in the other species). Indeed, recentMA experimental studies in C. reinhardtii (Morgan et al. 2014) andD. discoideum (Hall et al. 2013) reported a decrease in fitness withsimilar effective population sizes and higher numbers of sequentialgenerations (Ne = 6.5 during �1000 generations, and Ne = 7.5 dur-ing �994 generations, respectively). However, increasing the num-ber of sequential generations beyond 200 was not possible: inB. prasinos and M. pusilla, the MA experiments had to be stoppedas a consequence of the high line loss at each bottleneck. The num-ber of lines lost was leading to a stagnation of the total number ofindependent generations in the experiments. Line loss occurred ateach bottleneck from the start of the experiment and there was notrend (increase or decrease) in the number of lines lost with time.There are three possible explanations for line loss.

First, it could be due to sampling error, since single cell transfercannot be checked by eye or light microscopy due to small cell size.The probability of sampling one single cell from a volume follows aPoisson distribution and the probability of sampling no cell is thus0.37. To overcome this high rate of loss, our experimental procedurewas to sample a volume of culture predicted by flow cytometry tocontain 10 cells and divide this into six wells of a culture plate (seeMaterials and Methods). The probability of line loss is thus smallerthan 1022 in all experiments (Table 2). Coefficients of variationbetween 0.4–0.5 are needed to account for the observed line loss.However, since cytometry counts and pipetting errors are below 1%,it is highly unlikely that the sampling procedure is responsible forthe observed level of line loss.

Second, line loss may be the consequence of lethal mutations orstrong selection imposed by the experiment. If the experiment wasassociated with selection, we would expect the growth rates from thecontrol cultures, reinoculated at the same time with 100 cells, toincrease over the course of the experiment. There is no evidence forthis in any experiment. On the other hand, if lethal mutations areresponsible for the line loss, the rate of lethal mutations per gener-ation can be estimated by the proportion of lost lines divided by thenumber of generations and is 0.025 and 0.019 per genome pergeneration in B. prasinos and M. pusilla, respectively. Comparedto the known spontaneous mutation rates in other microorganisms(Drake 1991) and the estimations above, these lethal mutation rates

would be five to sevenfold higher than the spontaneous mutationrates reported above. This corresponds to lethal mutation rates thatare too high to be viably supported by a population.

A third hypothesis is that line loss is not the consequence of celldeath but the consequence of the absence of cell division. In labconditions, living cells usually engage in cell division at the end of theday, after light exposure, provided nutrients are available. Withoutbottleneck to one single cell, line loss in culture maintenance isexceptional. However, if cell division is triggered by an environmen-tal factor produced by the culture, it may be halted as a consequenceof the reinoculation step of one single cell. Consistent with this hy-pothesis, we observed that lost lines were transferred from signifi-cantly smaller volumes; from 2 ml on average, while maintained lineshave been transferred from 4 ml, on average, for M. pusilla and B.prasinos (Student’s test, p-values , 0.001 and , 0.01, respectively).The difference in line loss rates between species could thus be theconsequence of a difference in dependence of cell division to anenvironmental factor, lost during the reinoculation step. This envi-ronmental factor may be a metabolite produced by the culture, e.g., aphytohormone (Bartel 1997; Piotrowska-Niczyporuk and Bajguz2014). This high level of line loss reveals a knowledge gap on theinduction of cell division in nonmodel microorganisms and reducesthe amount of data available for fitness estimates. However, it doesnot alter the growth rate estimates of the maintained lines or theestimations of mutations per generation.

Increase or decrease of fitness understressful conditionsChanges in environmental conditions clearly enable the detection ofsubstantial variation in fitness between MA lines. This is as expectedif the fitness effect of mutation changed between environments. Thevariance between the MA lines is greater than the variance between thecontrol lines, suggesting that some mutations, not detected in MAstandard conditions, have been fixed in our MA lines. The significantvariation in fitness of some MA lines may be the result of severalnonmutually exclusive factors.

First, stressful conditions might exacerbate already existingfitness differences (Kondrashov and Houle 1994), so the MA linesmay have accumulated more slightly deleterious mutations thanthe control lines because they have smaller Ne, but the overalldifference in fitness between the MA and control lines is not

Figure 2 Selection coefficients, ST, inmedia containing Irgarol 1051 or Diu-ron herbicides. Empty circles with anumber: MA lines with significant STdifferences (Student’s test, p-value ,0.01). Left to right in the two graphs:B. prasinos in orange (eight MA lines),M. pusilla in blue (seven MA lines),and O. mediterraneus in green (nineMA lines). The ST of controls are pre-sented as white plots on the left of theMA lines. MA, mutation accumulation.

2068 | M. Krasovec et al.

detectable under the standard MA conditions. However, such dif-ferences in fitness might be detectable in a stressful environmentbecause the selection intensity changes (Martin and Lenormand2006). A change in selection intensity might come about through achange in the environment (Fry and Heinsohn 2002; Rutter et al.2012), or a change in the effect of an allele, for example by achange in gene expression. In another green algae, C. reinhardtii,Kraemer and coworkers also highlight the effects of stress on theamplification of deleterious mutations and their impact on fitness(Kraemer et al. 2015).

Second, the fixation of mutations, particularly slightly dele-terious mutations, is faster in the MA lines because they havesmaller Ne. As a consequence, these slightly deleterious muta-tions, which could become advantageous in a novel environ-ment, can accumulate in the MA lines but not in the controls.They may thereby increase the fitness in some of these MA lines.In addition, both the control and MA lines have accumulatedmutations that are neutral under the original conditions butdeleterious under the stressful conditions, causing the fall offitness among MA lines.

ConclusionWe investigated the accumulation of mutations in four marine greenpicoalgae. Despite a modest number of sequential generationsper MA line, we found evidence for a variation in fitness effectsof spontaneous mutations from benign to stressful environments.This allowed us to estimate a minimum per genome mutation rateof 0.0037.

ACKNOWLEDGMENTSWe acknowledge Hervé Moreau, Sheree Yau, and the Genomics ofPhytoplankton lab for support and stimulating discussions. We alsothank three anonymous referees for their constructive comments ona previous version of this manuscript. We are grateful to SebastienPeuchet, Aurelien De Jode, Claire Hemon, and Elodie Desgranges fortechnical assistance with the mutation accumulation experimentsfrom 2011–2013, and to the Agence Nationale de la Recherche(ANR) for supporting them (PICOVIR, DECOVIR, TARA-GIRUS;BLAN07- 1_200218, ANR-12-BSV7-0009, ANR-09-PCS-GENM-218). This work was funded by grant ANRJCJC-SVSE6-2013-0005to G.P. and S.S.F.

Figure 3 Selection coefficients in five salinity con-ditions. Empty circles with number are MA lines withsignificant differences to controls (Student’s test,p-value , 0.01). (A) O. mediterraneus in green, nineMA lines. (B) M. pusilla in blue, seven MA lines. (C)B. prasinos in orange, eight MA lines. The ST ofcontrols are presented as white plots on the left ofthe MA lines. MA, mutation accumulation.

Volume 6 July 2016 | Effects of Mutations in Algae | 2069

LITERATURE CITEDAjie, B. C., S. Estes, M. Lynch, and P. C. Phillips, 2005 Behavioral degra-

dation under mutation accumulation in Caenorhabditis elegans. Genetics170: 655–660.

Andrew, J. R., M. M. Dossey, V. O. Garza, M. Keller-Pearson, C. F. Baer et al.,2015 Abiotic stress does not magnify the deleterious effects of sponta-neous mutations. Heredity 115: 503–508.

Baer, C. F., N. Phillips, D. Ostrow, A. Avalos, D. Blanton et al.,2006 Cumulative effects of spontaneous mutations for fitness in Cae-norhabditis: role of genotype, environment and stress. Genetics 174:1387–1395.

Bartel, B., 1997 Auxin biosynthesis. Annu. Rev. Plant Physiol. Plant Mol.Biol. 48: 51–66.

Blanc-Mathieu, R., B. Verhelst, E. Derelle, S. Rombauts, F.-Y. Bouget et al.,2014 An improved genome of the model marine alga Ostreococcus tauriunfolds by assessing Illumina de novo assemblies. BMC Genomics 15:1103.

Chang, S.-M., and R. G. Shaw, 2003 The contribution of spontaneousmutation to variation in environmental response in Arabidopsis thaliana:responses to nutrients. Evolution 57: 984–994.

Charlesworth, B., and D. Charlesworth, 1998 Some evolutionary conse-quences of deleterious mutations. Genetica 102–103: 3–19.

Chevin, L.-M., 2011 On measuring selection in experimental evolution.Biol. Lett. 7: 210–213.

Courties, C., A. Vaquer, M. Troussellier, J. Lautier, M. J. Chrétiennot-Dinetet al., 1994 Smallest eukaryotic organism. Nature 370: 255.

Deng, H.-W., G. Gao, and J.-L. Li, 2002 Estimation of deleterious genomicmutation parameters in natural populations by accounting for variablemutation effects across loci. Genetics 162: 1487–1500.

Deng, H. W., and M. Lynch, 1997 Inbreeding depression and inferreddeleterious-mutation parameters in Daphnia. Genetics 147: 147–155.

De Vargas, C., S. Audic, N. Henry, J. Decelle, F. Mahé et al., 2015 Oceanplankton. Eukaryotic plankton diversity in the sunlit ocean. Science 348:1261605.

Dillon, M. M., W. Sung, M. Lynch, and V. S. Cooper, 2015 The rate andmolecular spectrum of spontaneous mutations in the GC-rich multi-chromosome genome of Burkholderia cenocepacia. Genetics 200: 935–946.

Drake, J. W., 1991 A constant rate of spontaneous mutation in DNA-basedmicrobes. Proc. Natl. Acad. Sci. USA 88: 7160–7164.

Elena, S. F., and J. A. G. de Visser, 2003 Environmental stress and theeffects of mutation. J. Biol. 2: 12.

Farlow, A., H. Long, S. Arnoux, W. Sung, T.G. Doak et al., 2015 TheSpontaneous mutation rate in the fission yeast Schizosaccharomycespombe. Genetics 201: 737–744.

Fernández, J., and C. López-Fanjul, 1996 Spontaneous mutational variancesand covariances for fitness-related traits in Drosophila melanogaster.Genetics 143: 829–837.

Fry, J. D., 2001 Rapid mutational declines of viability in Drosophila. Genet.Res. 77: 53–60.

Fry, J. D., 2004 On the rate and linearity of viability declines in Drosophilamutation-accumulation experiments: genomic mutation rates and syn-ergistic epistasis revisited. Genetics 166: 797–806.

Fry, J. D., and S. L. Heinsohn, 2002 Environment dependence of mutationalparameters for viability in Drosophila melanogaster. Genetics 161: 1155–1167.

Fry, J. D., S. L. Heinsohn, and T. F. C. Mackay, 1996 The contribution ofnew mutations to genotype-environment interaction for fitness in Dro-sophila melanogaster. Evolution 50: 2316–2327.

Fry, J. D., P. D. Keightley, S. L. Heinsohn, and S. V. Nuzhdin,1999 New estimates of the rates and effects of mildly deleteriousmutation in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 96:574–579.

Guillard, R. R. L., and P. E. Hargraves, 1993 Stichochrysis immobilis is adiatom, not a chrysophyte. Phycologia 32: 234–236.

Hall, D.W., S. Fox, J.J. Kuzdzal-Fick, J.E. Strassmann, and D.C. Queller,2013 The rate and effects of spontaneous mutation on fitness traits in

the social amoeba, Dictyostelium discoideum. G3 (Bethesda) 3: 1115–1127.

Halligan, D. L., and P. D. Keightley, 2009 Spontaneous mutation accumu-lation studies in evolutionary genetics. Annu. Rev. Ecol. Evol. Syst. 40:151–172.

Holm, S., 1979 A simple sequentially rejective multiple test procedure.Scand. J. Stat. 6: 65–70.

Katju, V., L.B. Packard, L. Bu, P.D. Keightley, and U. Bergthorsson,2014 Fitness decline in spontaneous mutation accumulation lines ofCaenorhabditis elegans with varying effective population sizes. Evolution69: 104–116.

Kavanaugh, C. M., and R. G. Shaw, 2005 The contribution of spontaneousmutation to variation in environmental responses of Arabidopsis thali-ana: responses to light. Evolution 59: 266–275.

Keightley, P. D., 1994 The distribution of mutation effects on viability inDrosophila melanogaster. Genetics 138: 1315–1322.

Keightley, P.D., and M. Lynch, 2003 Toward a realistic model of mutationsaffecting fitness. Evolution 57: 683–685.

Kishony, R., and S. Leibler, 2003 Environmental stresses can alleviate theaverage deleterious effect of mutations. J. Biol. 2: 14.

Kondrashov, A. S., 1988 Deleterious mutations and the evolution of sexualreproduction. Nature 336: 435–440.

Kondrashov, A. S., and D. Houle, 1994 Genotype-environment interactionsand the estimation of the genomic mutation rate in Drosophila mela-nogaster. Proc. Biol. Sci. 258: 221–227.

Korona, R., 1999 Genetic load of the yeast Saccharomyces cerevisiae underdiverse environmental conditions. Evolution 53: 1966–1971.

Kraemer, S. A., A. D. Morgan, R. W. Ness, P. D. Keightley, and N. Colegrave,2015 Fitness effects of new mutations in Chlamydomonas reinhardtiiacross two stress gradients. J. Evol. Biol. 29(3): 583–593.

Lee, H., E. Popodi, H. Tang, and P. L. Foster, 2012 Rate and molecularspectrum of spontaneous mutations in the bacterium Escherichia coli asdetermined by whole-genome sequencing. Proc. Natl. Acad. Sci. USA109: E2774–E2783.

Long, H. A., T. Paixão, R. B. R. Azevedo, and R. A. Zufall,2013 Accumulation of spontaneous mutations in the ciliate Tetrahy-mena thermophila. Genetics 195: 527–540.

Lynch, M., 2010 Evolution of the mutation rate. Trends Genet. 26: 345–352.Lynch, M., J. Blanchard, D. Houle, T. Kibota, S. Schultz et al.,

1999 Perspective: spontaneous deleterious mutation. Evolution 53: 645–663.

Lynch, M., W. Sung, K. Morris, N. Coffey, C. R. Landry et al., 2008 Agenome-wide view of the spectrum of spontaneous mutations in yeast.Proc. Natl. Acad. Sci. USA 105: 9272–9277.

Marin, B., and M. Melkonian, 2010 Molecular phylogeny and classificationof the Mamiellophyceae class. nov. (Chlorophyta) based on sequencecomparisons of the nuclear- and plastid-encoded rRNA operons. Protist161: 304–336.

Martin, G., and T. Lenormand, 2006 The fitness effect of mutations acrossenvironments: a survey in light of fitness landscape models. Evolution 60:2413–2427.

Massana, R., 2011 Eukaryotic picoplankton in surface oceans. Annu. Rev.Microbiol. 65: 91–110.

Moreau, H., B. Verhelst, A. Couloux, E. Derelle, S. Rombauts et al.,2012 Gene functionalities and genome structure in Bathycoccus prasi-nos reflect cellular specializations at the base of the green lineage. GenomeBiol. 13: R74.

Morgan, A. D., R. W. Ness, P. D. Keightley, and N. Colegrave,2014 Spontaneous mutation accumulation in multiple strains ofthe green alga, Chlamydomonas reinhardtii. Evolution 68: 2589–2602.

Mukai, T., 1964 The genetic structure of natural populations of Drosophilamelanogaster. I. Spontaneous mutation rate of polygenes controlling vi-ability. Genetics 50: 1–19.

Ness, R. W., A. D. Morgan, N. Colegrave, and P. D. Keightley,2012 Estimate of the spontaneous mutation rate in Chlamydomonasreinhardtii. Genetics 192: 1447–1454.

2070 | M. Krasovec et al.

Pecqueur, D., F. Vidussi, E. Fouilland, E. L. Floc’h, S. Mas et al.,2011 Dynamics of microbial planktonic food web components during ariver flash flood in a Mediterranean coastal lagoon. Hydrobiologia 673:13–27.

Piotrowska-Niczyporuk, A., and A. Bajguz, 2014 The effect of natural andsynthetic auxins on the growth, metabolite content and antioxidant re-sponse of green alga Chlorella vulgaris (Trebouxiophyceae). Plant GrowthRegul. 73: 57–66.

R Core Team, 2014 R: A Language and Environment for Statistical Com-puting, R Foundation for Statistical Computing, Vienna, Austria.

Rutter, M. T., A. Roles, J. K. Conner, R. G. Shaw, F. H. Shaw et al.,2012 Fitness of Arabidopsis thaliana mutation accumulation lineswhose spontaneous mutations are known. Evolution 66: 2335–2339.

Sanchez-Ferandin, S., F. Leroy, F.-Y. Bouget, and F. Joux, 2013 A new,sensitive marine microalgal recombinant biosensor using luminescencemonitoring for toxicity testing of antifouling biocides. Appl. Environ.Microbiol. 79: 631–638.

Schaack, S., D. E. Allen, L. C. Latta, K. K. Morgan, and M. Lynch, 2013 Theeffect of spontaneous mutations on competitive ability. J. Evol. Biol. 26:451–456.

Schrider, D. R., D. Houle, M. Lynch, and M. W. Hahn, 2013 Rates andgenomic consequences of spontaneous mutational events in Drosophilamelanogaster. Genetics 194: 937–954.

Schwartz, D. C., and C. R. Cantor, 1984 Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37: 67–75.

Shaw, R. G., D. L. Byers, and E. Darmo, 2000 Spontaneous mutationaleffects on reproductive traits of Arabidopsis thaliana. Genetics 155: 369–378.

Subirana, L., B. Péquin, S. Michely, M. L. Escande, J. Meilland et al.,2013 Morphology, genome plasticity, and phylogeny in the genus Os-treococcus reveal a cryptic Sspecies, O. mediterraneus sp. nov. (Mamiel-lales, Mamiellophyceae). Protist 164: 643–659.

Sung, W., M. S. Ackerman, S. F. Miller, T. G. Doak, and M. Lynch,2012 Drift-barrier hypothesis and mutation-rate evolution. Proc. Natl.Acad. Sci. USA 109: 18488–18492.

Vassilieva, L. L., and M. Lynch, 1999 The rate of spontaneous mutation forlife-history traits in Caenorhabditis elegans. Genetics 151: 119–129.

Vassilieva, L. L., A. M. Hook, and M. Lynch, 2000 The fitness effects ofspontaneous mutations in Caenorhabditis elegans. Evolution 54: 1234–1246.

Wloch, D. M., K. Szafraniec, R. H. Borts, and R. Korona, 2001 Directestimate of the mutation rate and the distribution of fitness effects in theyeast Saccharomyces cerevisiae. Genetics 159: 441–452.

Worden, A. Z., J. K. Nolan, and B. Palenik, 2004 Assessing the dynamicsand ecology of marine picophytoplankton: the importance of the eu-karyotic component. Limnol. Oceanogr. 49: 168–179.

Worden, A. Z., J. H. Lee, T. Mock, P. Rouzé, M. P. Simmons et al.,2009 Green evolution and dynamic adaptations revealed by genomes ofthe marine picoeukaryotes Micromonas. Science 324: 268–272.

Wright, S., 1932 The roles of mutation, inbreeding, crossbreeding, andselection in evolution. Proc. Sixth Int. Congr. Genet. 1: 356–366.

Zeyl, C., and J. A. DeVisser, 2001 Estimates of the rate and distribution offitness effects of spontaneous mutation in Saccharomyces cerevisiae. Ge-netics 157: 53–61.

Communicating editor: S. I. Wright

Volume 6 July 2016 | Effects of Mutations in Algae | 2071

  61  

CHAPITRE 3:

LE TAUX DE MUTATION CHEZ LES

MAMIELLOPHYCEAE

  62  

                                                               

  63  

Quel est le taux de mutations spontanées des algues vertes (Chlorophytes) et comment varie-t-il ?

Les lignées mutantes issues des EAMs ont accumulé de ~80 à ~500

générations indépendantes. Ce chapitre traite des données génomiques de ces

lignées, dont 153 ont été séquencées par Illumina MiSeq et HiSeq, ainsi que les 4

types ancestraux.

Il n’est question ici que des Mamiellophycea, le taux de mutation de

Picochlorum RCC4223 étant abordé dans le chapitre 5. L’intégralité des données fut

traitée avec le même pipeline informatique. En résumé, les génomes sont alignés

sur le génome de référence disponible avec BWA (Li and Durbin, 2010); les fichiers

de sortie sont traités avec Samtools (Li et al., 2009); les mutations sont identifiées

avec GATK (DePristo et al., 2011).

Une importante variation du taux de mutation est mise en évidence et

discutée. Les régions non codantes et peu exprimées mutent plus que les autres

régions du génome. Cela peut s’expliquer par des mécanismes de réparation liés à

la transcription, appelés transcription-coupled repair (TCR).

Les taux de mutation obtenus sont mis en relation avec ceux de la littérature

existante sur les EAMs et les études de pédigrées (humain et souris). Nous

discutons du rôle de la taille du génome et de la distance entre le GC% réel et celui

à l’équilibre dans les variations inter espèces du taux de mutation. En effet, un biais

de mutation est observé, avec une plus forte fréquence de mutation de GC vers AT

qu’inversement. Cette augmentation du taux de mutation pour les nucléotides G et C

induit un plus fort taux de mutation pour les génomes éloignés de leurs équilibres en

GC.

En résumé, cette étude met en avant différents facteurs de variations intra et

inter génomiques et tente d’apporter des réponses quand à l’évolution du taux de

mutation chez les eucaryotes.

Le matériel supplémentaire de ce chapitre est disponible page 143 à 155.

   

  64  

                                                                                               

  65  

The rate of spontaneous mutation rates in pico-algae and implications for mutation rate variation

Krasovec Marc*, Eyre-Walker Adam‡, Sanchez-Ferandin Sophie*, Piganeau

Gwenael*.

* Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie Intégrative des

Organismes Marins (BIOM), Observatoire Océanologique, F-66650, Banyuls/Mer,

France

‡ School of Life Sciences, University of Sussex, Brighton BN1 9QG, United Kingdom

Keywords: Spontaneous mutation rate, Mutation accumulation, Effective population

size, GC content, Phytoplankton. Corresponding authors: krasovec@obs-banyuls.fr

ABSTRACT Mutation, the ultimate source of genetic variation, has been studied by generations

of evolutionary biologists. Genome wide spontaneous mutation rates have been

estimated by mutation accumulation experiments in many model species. Here, we

report mutation rate estimations in four marine green algal species Bathycoccus

prasinos, Ostreococcus tauri, Ostreococcus mediterraneus and Micromonas pusilla.

There is a twofold variation of spontaneous mutation rate between species from

µ=4.4 x 10-10 mutations per nucleotide per generation to 9.8 x 10-10. Within genomes,

there is a threefold increase in the mutation rate in lowly transcribed regions,

consistent with transcription-coupled DNA repair. The mutation rate variation

between species can be explained by genome size, consistent with a lower fidelity of

replication in larger genomes. Additionally, we provide evidence that departure from

equilibrium GC content impacts the mutation rate, accounting for up to a 70%

increase of the mutation rate in some eukaryotic species.

  66  

INTRODUCTION Mutations are responsible for the genetic variability within organisms (Wright,

1932), which permit adaptation by natural selection. Thus, estimation of the mutation

rate (µ) is important for a better understanding of evolution and adaptability.

Estimating the mutation rate was difficult until recently, because mutations are rare

events, so methods either relied on reporter constructs, for example the reversion to

antibiotic resistance, or phylogenetic methods which required knowledge of

divergence times and assumptions of neutrality. However, new sequencing

technologies have allowed the estimation of the mutation rate from either offspring-

parent trios, in humans (Abecasis et al., 2010; Conrad et al., 2011) and mice

(Adewoye et al., 2015; Uchimura et al., 2015), or mutation accumulation (MA)

experiments (Halligan and Keightley, 2009; Lynch et al., 2008) in organisms such as

Drosophila melanogaster (Haag-Liautard et al., 2007; Keightley et al., 2014a, 2009),

Arabidopsis thaliana (Ossowski et al., 2010), Caenorhabditis elegans (Denver et al.,

2012, 2009, 2004), unicellular eucaryotes such as Saccharomyces cerevisiae (Lang

and Murray, 2008; Lynch et al., 2008; Wloch et al., 2001; Zhu et al., 2014) and

bacteria such as Escherichia coli (Lee et al., 2012) and Salmonella typhimurium

(Lind and Andersson, 2008). The mutation rate varies considerably across the tree of

life from 1.94 x 10-11 in the ciliate Paramecium tetraurelia (Sung et al., 2012b) to 9.78

x 10-9 in the bacteria Mesoplasma florum (Sung et al., 2012a).

The variation of mutation rate between species appears to be correlated to

two factors – genome size (Drake, 1991; Drake et al., 1998), and in particular the

size of the protein coding component of the genome (Lynch, 2010a), and effective

population size (Lynch, 2010a; Sung et al., 2012a). Both of these correlations may

arise because of the limitations that genetic drift imposes on selection to minimize

the mutation rate (Sung et al., 2012a). In asexual species, selection will favour an

intermediate mutation rate, which generates sufficient advantageous mutations,

whilst not generating too many deleterious mutations. In contrast, in sexual species,

selection always acts to minimize the mutation rate because a modifier of the

mutation rate only stays linked the mutations it causes for a short period of time and

deleterious mutations are more prevalent than advantageous mutations, increasing

the genetic load (Agrawal and Whitlock, 2012).

  67  

However, genetic drift ultimately limits the degree to which the mutation rate

can be reduced (Martincorena and Luscombe, 2013), because the strength of

selection acting on a modifier is equal to γ*U*s, where, γ is the proportional decrease

in the mutation rate, U is the genomic rate of mutation and s is the average strength

of selection against deleterious mutations. If γ*U*s<1/Ne then selection will be

ineffective against the modifier and the mutation rate cannot be reduced further.

Hence we expect the per site rate of mutation to depend upon the effective

population size (Charlesworth, 2009; Lanfear et al., 2014) – species with larger Ne

should have lower mutation rates – and genome size – the more selected sites there

are the lower the mutation rate should be. These predictions appear to be largely

upheld (Lynch, 2010a).

It has also been observed that there is variation in the mutation rate within a

genome at a number of different scales, from differences between chromosomes, to

variation between regions on a chromosome and variation between adjacent sites

(Hodgkinson and Eyre-Walker, 2011; Schrider et al., 2011). As an example, the Y-

chromosome in humans and chimps mutates faster than the other chromosomes

(Ebersberger et al., 2002). It is also known known that mitochondria has a higher

mutation rate than nuclear genome in Caenorhabditis elegans (Denver et al., 2009,

2000), Homo sapiens (Rebolledo-Jaramillo et al., 2014) and Drosophila

melanogaster (Haag-Liautard et al., 2008; Keightley et al., 2009). Within

chromosomes, it has been shown that nucleotide context affects the mutability of a

site in Chlamydomonas reinhardtii (Ness et al., 2015b), Bacillus subtilis (Sung et al.,

2015) and humans (Aggarwala and Voight, 2016; Gojobori et al., 1982). In

mammals, the most conspicuous effect is the high mutability of CpG dinucleotides

resulting from cytosine deamination (Coulondre et al., 1978; Fryxell and

Zuckerkandl, 2000), which leads to an 80% reduction in the frequency of the CpG

dinucelotide in the human genome (Lander et al., 2001).

Gene expression also affects the rate of mutation and its effect is

controversial. First, the mutation rate seemed lower in highly expressed genes

(Martincorena et al., 2012). However, analysis on MA lines in Escherichia coli

highlighted that the mutation rate increases with gene expression (Chen and Zhang,

2013). The last findings is congruent with observations in Saccharomyces cerevisiae

  68  

and humans (C. Park et al., 2012; Polak and Arndt, 2008). This phenomenon,

resulting from an alteration of DNA sequence associated with transcription process,

is known as transcription-associated mutagenesis (Kim and Jinks-Robertson, 2012).

In this study, we provide the first estimates of the spontaneous mutation rate

in 4 species of haploid green algae (Chlorophyta, Mamiellophyceae (Marin and

Melkonian, 2010)): Ostreococcus tauri RCC4221 (Blanc-Mathieu et al., 2014), O.

mediterraneus RCC2590 (Subirana et al., 2013), Micromonas pusilla RCC299

(Worden et al., 2009) and Bathycoccus prasinos RCC1105 (Moreau et al., 2012),

with compact genomes containing 83% to 84% coding sequences. Green algae

constitute one of the most important photosynthetic group on Earth, with an

ubiquitous repartition in global ocean (de Vargas et al., 2015), and play a

fundamental role in foodweb and biogeochimical cycles (Worden et al., 2015). These

green algae span a large evolutionary divergence as revealed by a high proportion of

species-specific genes, and high amino-acid divergence between orthologous genes

(Jancek et al., 2008; Šlapeta et al., 2006). Their genome size ranges from 13 Mb to

21 Mb and their average GC content from 48 to 63 %.

Combined with spontaneous mutation rates from previous studies, these new

data enable the exploration of the role of genome size, transcription rates and GC

content on mutation rate variation.

MATERIAL AND METHODS MA experiments

Mutation accumulation experiments were performed on four haploid marine

green algae (Chlorophyta): Ostreococcus tauri RCC4221, O. mediterraneus

RCC2590, Micromonas pusilla RCC299 and Bathycoccus prasinos RCC1105. All

strains are maintained in the Roscoff Culture Collection (RCC), in France

(http://roscoff-culture-collection.org/). MA lines were started from a clonal population

and maintained in L1 liquid medium in 24 wells of a microtiter plate, with a one-cell

bottleneck every 14 days (Krasovec et al., 2016). Serial bottlenecks allowed to

largely removes the influence of natural selection (the average effective population

size, estimated with the harmonic mean of cell number, varied between 6 and 9

across the four species, Table S1).

  69  

Cell concentrations of MA lines were measured by flow cytometry using a

FACSCanto II flow cytometer (Becton Dickinson, Franklin Lakes, NJ, U.S.A.),

relative to their natural chlorophyll fluorescence (FL3 acquisition at 670 nm) and size

scatter (SSC) acquisitions. Depending of cell concentration, the volume

corresponding to one cell was inoculated into a new well plate with new media (we

always assumed N0=1 to estimated the effective population size). The number of

generations per day, G, was estimated as follows:

𝐺 = 𝑒[!"  (!"! )/!]

where Nt is the cells number in the well at bottleneck time, and t = 14 days. MA

experiments were performed over a period of 224 to 378 days depending on the

species and MA lines accumulated between 80 and 500 independent generations

(Table S1).

Sequencing DNA of ancestral types and MA lines were extracted as described previously

(Winnepenninckx et al., 1993) and sequenced with Illumina technology. All library

preparations and sequencing were performed by GATC biotech® (Konstanz,

Germany). Two different sequencing technologies were used: MiSeq for O.tauri and

O. mediterraneus, and HiSeq for B. prasinos and M. pusilla. Reads from ancestral

types and MA lines were aligned to the reference genomes using BWA (Li and

Durbin, 2010) (M. pusilla:   GCA_000151265.1; O. tauri:   GCF_000214015.2; B.

prasinos: ; O. mediterraneus in preparation) and SAMtools (Li et al., 2009) were

used to obtained bam and mpileup files. The four ancestral types and 150 MA lines

were sequenced: 40 for O. tauri, 37 for O. mediterraneus, 37 for M. pusilla and 36 for

B. prasinos.

Mutation identifications Mutations were called from mpileup files (Li et al., 2009) using GATK

(DePristo et al., 2011). The final mutation candidates were filtered to remove low

mapping quality regions (<50), low coverage regions (<5 reads), and shared

mutations between all MA lines. The number of callable sites per genome above

these thresholds was computed to estimate the per base pair mutation rate (97 to

99% of the genomes was callable (Table S2)). All mutation candidates were

  70  

compared to the ancestral type to discard spurious candidates that result from

discrepancies between the reference genome and the ancestral strain at the start of

the MA experiment (e.g. 9 substitutions in O. tauri RCC4221 occurred between 2001

and 2009 (Blanc-Mathieu et al., 2014)). Sanger re-sequencing of 22 random

mutation candidates were found to be correct (true positive rate = 100%). Whether

the mutation was non-synonymous, synonymous, intronic or intergenic was

extracted with snpEff (Cingolani et al., 2012). This calling method has been used for

base substitution and indels mutations.

Mutation rate at equilibrium GC content Let R1 be equal to the rate of mutation from GC to AT, R2 from AT to GC, R3

the rate of mutation between A and T, and R4 be the rate between G and C

𝑅!= (NN→NN)!!!

(1)

NNn is the number of GC or AT sites in the genome; NN→NN is the number of

mutations from GC→AT or GC→AT; Then it is straightforward to show that the GC-

content at mutational equilibrium (Sueoka, 1962)

𝐺𝐶!" =  !!

!!!!! (2)

Assuming that R1, R2, R3 and R4 are constant, the expected mutation rate at

equilibrium is

µμeq  =  GCeq  *  (R1  +  R3)  +  (1-­‐GCeq)  *  (R2  +  R4) (3)  

Mutation spectrum tests To investigate the effects of context we extracted the 10bp either side of each

mutated site and used binomial tests to investigate whether a particular trinucleotide,

either NXN or NNX, where X is the mutated site, has a significantly higher or lower

mutation rate. We also ran a logistic regression to test whether the GC content

surrounding the site affected whether the site had a mutation or not.

To investigate whether gene expression affected the rate of mutation we used

STAR (Dobin et al., 2013) to compute the coverage of the genome by RNAseq data,

available from the ORCAE web site (Sterck et al., 2012), for B. prasinos (RNAseq

data from Moreau and co-workers (Moreau et al., 2012)) and O. tauri (RNAseq data

from Blanc-Mathieu and co-workers (Blanc-Mathieu et al., 2014)).Statistical analyses

were performed with R (version 3.1.1) (R Development Core Team, 2011).

  71  

RESULTS Mutation rates within Mamiellophyceae

We have performed an MA experiment in four species of algae. All together,

we found 238 single nucleotide mutations and 48 indels, summarized in Table 1.

Mutation types are provided in Tables S3 to S8. The numbers of synonymous and

non-synonymous mutations are as expected if mutations are randomly distributed

across sites for all species (Table 2), consistent with a lack of selection on non-

synonymous spontaneous mutations along the MA experiments. We thus assume

that the rates and patterns of mutation are not affected by selection.

The base substitution mutation rate (µbs) and the insertions-deletions mutation

rate (µID) per nucleotide per generation were estimated on callable sites, which

represented 97 to 99% of the genome (Table S2). The total mutation rate, µtot, is the

sum of µbs and µID. Mutation rates varied (not significantly, Kruskal-Wallis test) over

two-fold from 4.4 x 10-10 mutations per site per generation in B. prasinos to 9.8 x 10-

10 in M. pusilla.

Table 1. Summary of spontaneous mutation rates in four Mamiellophyceae species. BS is the number

of base-substitution mutations, Ins the number of insertions and Del the number of deletions. G is the

genome size in Mb and µ the mutation rate per nucleotide per genome per generation. TotGen is the

total number of generations accumulated per species.

Species TotGen G (Mb) BS Ins Del µbs -10 µID -10 µtot -10

O. tauri 17 250 12.46 91 5 8 4.19 0.60 4.79

O. mediterraneus 8 380 13.34 54 3 8 4.92 1.00 5.92

B. prasinos 4 145 14.96 22 5 5 3.02 1.37 4.39

M. pusilla 4994 20.99 71 2 12 8.15 1.61 9.76

Non-random mutation events in the genome:

It has been reported that the rate of mutation at a site varies between

nucleotides, and that some trinucleotides are more mutable than others, both in

eukaryotes (Ness et al., 2015b) and bacteria (Sung et al., 2015). However, we did

not detect any influence of adjacent nucleotides or GC content upon the mutation

rate in our data. The analysis of the distribution of mutations across these four

species reveals significant deviations from a uniform distribution of mutations along

the genome.

  72  

First, mutation events tend to cluster within adjacent nucleotides: of our 238

base substitution mutations across all species, 37 occurred adjacent to one another.

These clustered mutations probably represent single mutational events since each

multiple mutation is found within a single strain. No mutations were found in the

mitochondria or chloroplast genomes of these species; this is perhaps not surprising

since both genomes are small relative to the nuclear genome and both have lower

nucleotide diversity than the nuclear genome suggesting that they might have lower

mutation rates, consistent with patterns seen in higher plants (Smith, 2015).

Second, there is an excess of mutations in non-coding (Chi-Square, P-

value<0.01) and lowly expressed sequences (Wilcoxon test, P-value<0.001) as

opposed to coding regions (Table S9). The mutation rate varies by three fold (Table

2), in opposition to which is observed both in humans and yeast (C. Park et al.,

2012).

Third, there are significantly more deletions than insertions (Binomial test, P-

value<0.05) if we combine the data from all species. A deletion bias has been

reported in species among the three domain of life (Kuo and Ochman, 2009), and

may have contributed to the compact genomes of Mamiellophyceae species. Most

indels appeared in non-coding regions, and from the 20 indels occurring in coding

regions, there are 14 frame shifts, 2 codon insertions and 4 codon deletions.

Last, mutations are overrepresented at the first and last 1000 bp of

chromosomes (Binomial test, P-value < 0.001). However, despite the hypervariable

telomeric regions described above, there are no significant differences in the

mutation rate between chromosomes (Chi-Squared test, ns).

Table 2. Mutation rate variation between coding and non-coding sequences. The bias of mutation

toward non-coding sequences is significant, with P-value<0.01 (Chi-squared test). Syn and non-syn

are the synonymous and non-synonymous point mutations.

Species

% genome

non-coding

: coding

µ x 10-10

coding

regions

µ x 10-10

non-coding

regions

N mutations

syn : non-syn

O. tauri 18.4 : 81.6 3.9 8.9 19 : 42

O. mediterraneus 15.6 : 84.4 5.0 11.7 9 : 34

B. prasinos 16.9 : 83.1 3.4 14.7 5 : 10

M. pusilla 18.1 : 81.9 8.15 16.1 15 : 41

($!

The direction of base-substitution mutations The mutational spectrum of the Mamiellophyceae is biased towards GC to AT

mutations (significant for O. tauri and M. pusilla; Binomial test, P-value<0.01 and P-

value<0.05, respectively) (Figure 1 and S1). The equilibrium GC content, GCeq, is

substantially lower than the current GC content (GCeq = 36.8% and GCobs = 59.0%

for O. tauri, 43.5% and 56.0% for O. mediterraneus, 46.2% and 63.8 for M. pusilla

and 36.8% and 48.0 for B. prasinos), which suggests that other forces are acting to

maintain the GC content above its mutational equilibrium. It can be noticed that two

chromosomes are defined as outlier chromosomes in Mamiellophyceae because

they have a lower GC content than the other chromosomes, and are closer to the

GCeq. These chromosomes have a GC% of 51.3% in M. pusilla, 49.9% in O.

mediterraneus, 54.3% in O. tauri and 41.9% in B. prasinos.

Figure 1. The GC to AT and AT to GC mutations in the four species. GC to AT bias is significant in

O.tauri and M. pusilla (Binomial test, P-value = 4-7 and 0.02, respectively).

Inter-genomic variation in the mutation rate in eukaryotes Several ecological and biological factors have been proposed to explain the

variation in the mutation rate between species, such as genome size and effective

population size. We compiled the available estimates of the spontaneous mutation

rate from whole genome sequencing in wild-type strains (Table S10), adding the new

mutation rate estimates from this study.

1 2 3 4 5 6 7 8

020

4060

60

GC!AT AT!GC GC!AT AT!GC O. tauri O. mediterraneus B. prasinos M. pusilla

0

20

30

60

*

GC!AT AT!GC GC!AT AT!GC

16

30

18

8

3

37

19

***

(%!

Following Sung and co-workers, we performed a meta analysis to investigate

the effective population size effect on the mutation rate (Sung et al., 2012a). Using

Ne estimates provided in Table S10, we observe a significant decrease of the

mutation rate with the effective population size with all species (n=17, Pearson

correlation P-value<0.001, "=-0.71) (Figure 2). There is a negative correlation between genome size (G) and mutation rates

in bacteria (n=8, Pearson correlation, P-value=0.001, "=-0.95) and a positive

correlation between G and # in eukaryotes, where the mutation rate increases with

genome size (n=18, Pearson correlation, P-value=0.001, "=0.69, Figure 3A). These

results are consistent with a previous meta analysis by Lynch and Sung et al.

(Lynch, 2010a; Sung et al., 2012a), where it was suggested that the proportion of

coding regions, rather than genome size was the relevant parameter. The increase

of U with genome size in eukaryotes reveals an increase of the number of mutations

per genome at each division (n=18, Pearson correlation, P-value=0.0001, "=0.92,

Figure 3C). Note that there are two! outlier species in eukaryotes, Dictyostelium

discoideum and Paramecium tetraurelia (Figure 3). Exclude these two species would

provide more significant results. Additionally, the relation between genome size and

mutation rate is also observed using the size of the protein coding genome,

excluding the two outliers species (n=16, Pearson correlation, P-value=0.0001,

"=0.84, Figure 3B).

Figure 2. Correlation of the base substitution mutation rate and the effective population size (n=17,

Pearson correlation P-value<0.001, "=-0.71).

4 5 6 7 8 9

-11

-10

-9-8

-7

Log_Ne

Log_

µ

Bacteria Unicellular Eukaryotes Mamiellophyceae Metazoans Arabidopsis

Log1

0 of

nuc

leot

ide

mut

atio

n ra

te (µ

)

Log10 of effective population size (Ne)

4.0 5.0 6.0 7.0 8.0 9.0

(&!

Figure 3. Correlation of the base

substitution mutation rate, µ, in log10

scale. Raw data come from Table S10.

Blue regressions are done without the 2

outliers, Dictyostelium discoideum and

Paramecium tetraurelia. A. Mutation rates

as a function of the genome size G (n=18

eukaryotes, Pearson correlation, P-

value=0.001, "=0.69; n=16 eukaryotes,

Pearson correlation, P-value<0.0001,

"=0.89; n=8 bacteria, Pearson correlation,

P-value<0.0003, "=-0.95). B. Mutation

rates as a function of effective genome

size, estimated as the coding genome

size, Ge (n=16 eukaryotes, Pearson

correlation, P-value<0.0001, "=0.84). C.

Mutation rate per genome as a function of

genome size (n=18 eukaryotes, Pearson

correlation, P-value<0.0001, "=0.92).

0.0 0.5 1.0 1.5

-11.

0-1

0.0

-9.0

-8.5

-8.0

-7.5

Log_Ge

Log_

µ

!"

0.0 1.0 2.0 3.0

Log1

0 of

gen

omic

mut

atio

n ra

te (U

)

-3

-2

-1

0

1

Log10 of genome size (Mb)

!"#$%&'()Pt Dd

Log10 of effective genome size (Mb)

0.0 0.5 1.0 1.5 2.0

#"

$"

!"#$%&'()Pt Dd

Log10 of genome size (Mb)

0.0 1.0 2.0 3.0

-11.

0

-10.

0

-9.

0

-8.

0

Lo

g10

of n

ucle

otid

e m

utat

ion

rate

(µ)

$"

!"#$%&'()Pt Pt Pt Dd

0 1 2 3

-11.

0-1

0.0

-9.0

-8.5

-8.0

-7.5

Log_G

Log_

µ

!"

0 1 2 3

-3-2

-10

1

Log_G

Log_

U

-11.

0

-10.

0

-9.

0

-8.

0

Lo

g10

of n

ucle

otid

e m

utat

ion

rate

(µ)

('!

One striking feature of the mutation spectrum in Mamiellophyceae is the high

GC->AT mutation bias and the large gap between the observed genomic GC content

and the equilibrium GC content predicted from the pattern of mutation (Table S11).

Departures from the equilibrium GC-content affect the mutation rate; if the mutation

rate is biased towards AT and the observed GC content is above the equilibrium

value, then the mutation rate is elevated relative to its value at the equilibrium GC

content (Figure 3A). If we calculate the mutation rate at the equilibrium GC-content

we find that the observed mutation rate can be up to 2.5-fold higher than expected at

equilibrium. The ratio of the observed and the equilibrium mutation rates is highly

correlated to the ratio of the observed and equilibrium GC content (Pearson, P-value

= 2 x 10e-16, " = 0.99, Figure 4B). The correlation between the observed mutation

rate and GCr is also positive (Pearson correlation, P-value = 0.01, " = 0.51) (Figure

4A). GC->AT bias, estimated as R1/R2, is positively correlated to the nucleotide

mutation rate, excluding Mesoplasma florum and Paramecium tetraurelia (Pearson

correlation, P-value=0.002, #=0.61), Figure S3.

Figure 4. Correlation between mutation rate and gap from GC equilibrium. Pt is Paramecium

tetraurelia and Mp is Mesoplasma florum. A. Observed base-substitution mutation rates as function of

relative gap from GCeq. (Pearson, P-value = 0.01, " = 0.51, excluding Pt). B. Correlation between

relative increase of observed mutation rate from equilibrium mutation rate and relative gap from

GCeq, Pearson, P-value = 2 x 10e-16, " = 0.99.

µ obs

/µeq

GCr (GC/GCeq) GCr (GC/GCeq)

Pt

1 2 3 4

1.0

1.5

2.0

2.5

tab$Rgc

tab$

Rµ

!" #"Bacteria Unicellular Eukaryotes Mamiellophyceae Metazoans Arabidopsis

Mp

1.0 2.0 3.0 4.0

1.0

1.

5

2.0

2.

5

µ obs

/µeq

Pt

µ obs

µ eq

!"

Mp

1 2 3 4

-11

-10

-9-8

-7

tab$Rgc

Log_

µ

-11.

0

-10.

0

-9.0

-8.0

-

7.0

Log1

0 of

nuc

leot

ide

mut

atio

n ra

te (µ

)

1.0 2.0 3.0 4.0

  77  

To test the effect of effective population size, Ne, effective genome size, Ge,

genome size, G and distance to equilibrium GC content, GCr, on the spontaneous

mutation rate, we performed stepwise selection of these predictor variables using the

stepAIC function from R version 3.1.1 (R CoreTeam 2014). Data set was n=11

eukaryotes, excluding the outlier Paramecium tetraurelia. The final fit model included

two parameters, G and GCr (AIC=-28.8). In conclusion, spontaneous mutation rates

in eukaryotes increase with genome size G and with distance to equilibrium GC

content, GCr. In this dataset, the effective population size effect may be cancelled by

the genome size effect as Ne and G are negatively correlated (Pearson correlation,

P-value = 0.004, ρ = -0.64).

DISCUSSION

We have performed mutation accumulation experiments in 4 species of pico-

phytoplankton followed by whole genome sequencing. In total we have observed

238-point mutations and 48 indels. These have allowed us to study various aspects

of the mutation rate. The genome coverage of each mutation accumulation lines is

98% and mutation rates vary from µ=4.4 x 10-10 to 9.8 x 10-10 mutations per

nucleotide per generation.

Within genome variation of mutation rate

We observed a two to three fold difference in the mutation rate of coding and

non-coding regions in our dataset. There are several possible explanations for this

observation.

First, this could simply reflect selection against spontaneous mutations in

coding regions. The MA experiment was designed such that all but the most strongly

deleterious mutations would accumulate. However, strongly deleterious mutations

will lead to line loss, which is something we observed (Krasovec et al., 2016). In

coding regions, approximately one third of nucleotide positions are synonymous and

are thus expected to have little consequence on fitness. If selection occurred during

the MA experiments, mutations in coding regions should be biased towards

synonymous mutations. There is no excess of synonymous mutations in any of the

MA experiments (Chi-squared test, NS), consistent with a lack of selection during the

experiment.

  78  

Second, the lower mutation rate in coding regions could reflect a difference in

the efficiency of mismatch repair (MMR) between coding and non-coding regions

(Kunkel and Erie, 2015). The MMR efficiency may be optimized in coding region of

the genome (Foster et al., 2015; Lee et al., 2012). In E. coli, MA experiment using

wild type and MMR deficient lines show that the bias between coding and non-

coding sequence disappears in MMR deficient lines (Foster et al., 2015).

Third, the higher mutation rate in non-coding regions could come from

transcription-coupled DNA repairs (TCR) (Hanawalt and Spivak, 2008). This system

allows the repair of lesions in the DNA that are encountered during transcription and

hence is more likely in the regions of the genome that are expressed. In

Mamiellophyceae, genes coding for TCRs have been identified (gene family

HOMO03P001591 from the picoplaza database) (Vandepoele et al., 2013).

In conclusion, mutation rates in Mamiellophyceae do not occur randomly

along the genome, and we report one of the largest differences in the mutation rate

between coding and non-coding sequences in eukaryotes. The difference in the

mutation rate between coding and non-coding may affect mutation rate estimates in

some other species. In our data we were able to call de novo mutations in 98.5% of

the genome, but this fraction is much smaller in some other studies such A. thaliana

(Ossowski et al., 2010) (78%), C. reinhardtii (Ness et al., 2015b, 2012) (75%) and

Heliconius melpomene (Keightley et al., 2014b) (46%). In some of these studies

there is a bias towards coding regions, which will decrease the estimated mutation

rate if there are differences between coding and non-coding regions as we have

reported here.

Inter-specific mutation rate variation The genomic mutation rate varies by about two-fold amongst the four species

of Mamiellophyceae investigated here. Including these in an analysis of all mutation

rate estimates confirms the negative correlation between the mutation rate and

effective population size, the positive correlation between genome size (G and Ge)

and the mutation rate in eukaryotes (Smeds et al., 2016). There are a number of

potential explanations for why the mutation rate might be positively correlated to

genome size. (i) Larger genomes are more costly to replicate and this might lead to a

  79  

trade-off in fidelity. (ii) As we have shown the mutation rate is higher in non-coding

sequences and larger genomes have a higher proportion of non-coding DNA: i.e

~80% of the genome is coding in Mamiellophyceae, ~20% to ~50% in D.

melanogaster, C. elegans or A. thaliana and less than 2% in H. sapiens and mice;

(iii) it could be due to the negative correlation between genome size and effective

population size. To investigate this last explanation we ran a multiple regression of

the log mutation rate against the log genome size and log effective population size.

The best model only keeps the genome size, which is more relevant than the

effective population size (AIC=-26.1 for G and -24.8 for G and Ne).

In addition to genome size, the departure from the equilibrium GC base

composition is responsible for a substantial part of mutation rate variation between

species, as a consequence of the increase of the mutation rate with an increase of

the relative GC content from equilibrium. The mutation rate expected at equilibrium

GC composition is lower than the observed mutation rate measured especially in

Arabidopsis thaliana (Ossowski et al., 2010) and Mesoplasma florum (Sung et al.,

2012a). Most species have a higher GC content than expected from the GC->AT

and AT->GC mutation rates at the equilibrium and this gap is responsible of an

increase of the mutation rate. The forces that increase the GC content of the

genome thus contribute to an increase in the spontaneous mutation rate in the

majority of species studied by MA experiment (Table S10). Two mechanisms could

be responsible for an increase in GC content above the equilibrium value; selection

and biased gene conversion.

(i) Selection can act on protein coding sequences, synonymous codon use and gene

regulatory sequences, in a manner which is expected to lead to less biased base

composition than the mutational spectrum would cause.

(ii) Biased gene conversion, a byproduct of recombination, has been identified in

many organisms from bacteria (Lassalle et al., 2015) and yeast (Harrison and

Charlesworth, 2011; Lesecque et al., 2013) to humans (Duret and Arndt, 2008; Duret

and Galtier, 2009). There is indirect evidence of recombination in O. tauri (Grimsley

et al., 2010), so that GC biased gene conversion may be involved in GC content of

Mamiellophyceae.

  80  

CONCLUSION Our analysis of DNM in Mamiellophyceae species has shown that the

spontaneous mutation rate is ~3-fold higher in non-coding than coding regions.

In Eukaryotes, mutation rates increase with effective genome size and the

distance from the GC content equilibrium, providing support that processes

increasing the GC content may influence the spontaneous mutation rate. Because of

this, we propose that the distance a genome is from the GC equilibrium is an

important parameter in determining the mutation rate.

ACKNOWLEDGEMENTS We are grateful to Claire Hemon, Elodie Desgranges and Christophe

Salmeron for technical assistance with the mutation accumulation experiments from

2012 to 2015 and to the Genomics of Phytoplankton lab for support and stimulating

discussions. We acknowledge the O. mediterraneus genome consortium for access

to the complete genome data and the GenoToul Bioinformatics platform from

Toulouse, France, for bioinformatics analysis support and GenoToul cluster

availability.  This work was funded by ANRJCJC-SVSE6-2013-0005 to GP and SSF.

  81  

CHAPITRE 4:

LES TRANSFERTS HORIZONTAUX DE

GENES : LE CAS DE PICOCHLORUM

RCC4223

 

  82  

                                                                                           

  83  

Quelle est la part des HGTs dans la diversification des algues vertes (Chlorophytes)?

En plus des mutations, différents processus créent aussi de la diversité

génétique. L’un de ces processus est le transfert horizontal de gènes. Des transferts

horizontaux de gènes ont été proposés chez plusieurs espèces de Chlorophycées, y

compris une espèce de Picochlorum SE3.

Pour cette raison, un nouveau génome de référence d’une nouvelle souche

de Picochlorum, la Picochlorum RCC4223, est étudié pour tester cette hypothèse.

Le génome fut construit à partir de données issues de séquençages PacBio

RS II et Illumina MiSeq 2000. Différents assembleurs ont été utilisés jusqu'à obtenir

un génome de qualité satisfaisante: HGAP (Chin et al., 2013), ABySS (Simpson et

al., 2009), SGA (Simpson and Durbin, 2012), SSPACE (Boetzer et al., 2011) et

Geneious (Kearse et al., 2012). L’annotation à été faite à partir des bases de

données ORCAE (Sterck et al., 2012) et PicoPLAZA (Vandepoele et al., 2013).

27 candidats pour des HGTs sont proposés, et une analyse de génomique

comparative permet d’identifier des familles de gènes surreprésentées chez cette

nouvelle souche par rapport aux autres génomes d’algues vertes connus: plusieurs

retro-transcriptases, une famille de polykétide synthase, une endonucléase et une

hélicase.

En parallèle de ces études génomiques, une caractérisation phénotypique

confirme l’halotolérance déjà observée chez le genre Picochlorum , alliée à une forte

thermotolérance chez RCC4223. De plus, l’étude d’un méta-génome obtenu sur 4

sites d’échantillonnage en mer Méditerranée confirme la présence de séquences

18S appartenant à Picochlorum RCC4223 dans le milieu marin.

Enfin, ce génome constitue une nouvelle ressource pour la communauté

scientifique en générale.

 Le matériel supplémentaire de ce chapitre est disponible page 156 à 158.

 

  84  

                                                                                           

  85  

Genomic insights into a thermotolerant and halotolerant Trebouxiophyceae: Picochlorum costavermella RCC4223

Marc Krasovec*, Sophie Sanchez-ferandin*, Stephane Rombauts#, Nigel Grimsley*,

Sheree Yau*, Claire Hemon*, Hugo Lebredonchel*, Emmelien Vancaester#, Hervé

Moreau*, Klaas Vandepoele#, Gwenaël Piganeau*

*Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie Intégrative des

Organismes Marins (BIOM), ObservatoireOcéanologique, F-66650 Banyuls/Mer,

France

#Department of Plant Systems Biology (VIB) and Department of Plant Biotechnology

and Bioinformatics (Ghent University), Technologiepark 927, 9052, Ghent, Belgium

Keywords: Picochlorum, Green algae biotechnology, Horizontal gene transfers.

Corresponding authors: krasovec@obs-banyuls.fr

ABSTRACT Picochlorum species regroup halotolerant green algae, both studied for their

high tolerance to extreme environments and for their high potential for

biotechnologies. Here, we investigate the new genome of the strain Picochlorum

RCC4223, isolated from an estuary connected to the Mediteranean Sea. The

genome is 13.7 Mb length and contains 9315 genes, its GC content is 46 GC%. The

average gene length is 1155 bp, shorter as compared to other green algae, and the

genome contains 19 extended gene families. This study confirms the presence of

horizontal gene transfers (HGT) from bacteria in the genome of Picochlorum. Last,

18S sequences 100% identical with RCC4223 were present in four meta-genomes

from Mediterranean Sea samples, consistent with a marine habitat of the strain

RCC4223.

  86  

INTRODUCTION In aquatic and ocean ecosystems, photosynthetic planktonic microorganisms

are taxonomically very diverse, with representative in five of the six super-groups of

the eukaryotic tree of life (Not et al., 2012) and produce an important part of primary

production on Earth (Field et al., 1998; Worden et al., 2004). Chlorophyta (green

algae) are ubiquitous members of phytoplanktonic communities (de Vargas et al.,

2015) and are descendants of the first endosymbiosis, when an unicellular

heterotrophic eukaryote captured a cyanobacteria that evolved into the chloroplast,

1.6 billion years ago (Yoon et al., 2004).

Among Chlorophyta, the Trebouxiophycae is a monophyletic green algae

class proposed by Friedl in 1995 (Friedl, 1995), which contained the representative

genus Chlorella. The Trebouxiophyceae includes phenotypically very diverse

organisms; flagellates, coccoids, colonies and multicellular organisms (De Clerck et

al., 2012), photosynthetic symbiosis with other eukaryotes (Blanc et al., 2010) and

diverse cell division strategies (Yamamoto et al., 2007, 2003). Phylogenetic analysis

place the Trebouxiophycae as a recent group in Chlorophyta evolution (Friedl and

Rybalka, 2012; Leliaert et al., 2012). The lack of morphological discriminating features in the coccoid unicellular

Trebouxiophyceae (e.g Chlorella, Picochlorum, Nannochloris) led to a conundrum on

species description in many genera that has been partially solved by the

generalization of molecular techniques. The same have sometimes been described

as Nannochloris or Picochlorum genus and a distinction was proposed to clarify their

phylogeny (Henley et al., 2004). It was suggested that Picochlorum alga regroup

marine or saline autosporic taxa, supported by 18S rDNA phylogeny, including

Picochlorum RCC4223, Picochlorum SE3 (Foflonker et al., 2015) and Picochlorum

oklahomensis (Henley et al., 2004), while Nannochloris regroup freshwater algae.

They are characterized by a genome size estimated from 13 Mb to 50 Mb

(Yamamoto et al., 2001) according to species, a thick cell wall and halotolerance

(Foflonker et al., 2016, 2015; Henley et al., 2002).

The domestication of new algal species by evolutionary biology appeared to

be one of possible solutions to the challenge imposed by the shortage of natural

resources (Carroll et al., 2014). Biotechnological potential of green algae is the field

of intense investigation. Several biotechnological applications have been proposed

for Picochlorum algae as a consequence of their suitable lipid and protein content for

  87  

aquaculture (Becker, 2007; Chen et al., 2012), biofuel production (de la Vega et al.,

2011; S.-J. Park et al., 2012; Tran et al., 2014; Zhu and Dunford, 2013) or

bioremediation (von Alvensleben et al., 2013). Interestingly, a recent study suggests

that microalgae from the Picochlorum genus may form symbiosis with human cell

cultures. Black and co-workers (Black et al., 2014) provided evidence that a

spontaneous symbiosis between Picochlorum eukaryotum and retinal humans cells

in culture can be maintained in culture. This suggests that this alga is good model to

study the onset of photosymbiosis.

In this study, we provide the complete genome of Picochlorum RCC4223, a

resource for the investigation of metabolic pathways and genome evolution

mechanisms in Trebouxiophyceae.

MATERIALS AND METHODS

Strain characterisation Picochlorum RCC4223 strain was isolated from the estuary of the river La

Massane (June 2011, France). Water sample was spread on petri dish containing L1

(Guillard and Hargraves, 1993) agar medium. One colony was successively isolated,

cloned and kept in L1 seawater medium flask. We sequenced the complete 18S

rDNA sequence and obtained the karyotype by PFGE, following the protocol

described by Yamamoto (Yamamoto et al., 2001).

Phylogenetic position of Picochlorum RCC4223 was assessed with four

methods with 18S rDNA sequence: maximum likelihood, neighbor joining, maximum

parsimony and bayesian inference.

Phenotypic traits

Picochlorum species are characterized by large range of extremotolerence.

To explore phenotypic traits of Picochlorum RCC4223, fitness tests in two conditions

were performed.

First, halotolerant capacity was tested using fresh water 3N-BBM medium and

salinity gradient (10 to 70 g.L-1 from L1 medium with adjustment of salinity). Algae

were put in 48 well plates, with 5 samples per salinity and 5 controls in standard L1

medium. Plates were maintained one week at 20 °C with 12-12 h light-dark cycle.

  88  

Second, culture were maintained in the same condition as the halotolerant

test, but only in L1 medium and in two temperature conditions: 20°C and 35°C.

To compare with other green algae, the model species Ostreococcus tauri

(Blanc-Mathieu et al., 2014; Courties et al., 1994) was exposed to the same

conditions. Flow cytometer (Becton Dickinson, Franklin Lakes, NJ, U.S.A.) gave us

the cells concentration to estimate the growth rate using below equation:

𝐺 = 𝑒[!"  (!"!!)/!]

with N0 = 5000, Nt the final cell number and t = 7. G is defined as the number of cell

divisions per day.

Picochlorum RCC4223 was isolated from the estuary of a river. As

consequence, it is unsure whether its habitat is mainly freshwater or marine. We

sampled two marine stations (SOLA marine station, 47 27’136 N 03 32’360 E; MOLA

marine station, 42°27‘205 N 03°32’565 E; Mediterranean Sea, France) and two

lagoon stations in Leucate lagoon (Mediterranean Sea, France).

Two hypervariable regions of the 18S rDNA sequence were amplified: the V4

(380 nt length) and the V9 (94 nt length) regions by PCR in eight samples from the

SOLA marine station, 14 samples from the MOLA marine station and 30 samples

from the Leucate lagoon. Sequencing was done by Illumina HiSeq (GATC biotech®,

Konstanz, Germany) and analysed using mothur (Schloss et al., 2009).

Sequencing and genome assembly DNA was extracted using the CTAB protocol modified from Winnepenninckx

and co-workers (Winnepenninckx et al., 1993) and RNA using the Direct-zol™ RNA

MiniPrep Kit from Zymo Research®. Two technologies have been used for whole

genome sequencing.

First, sequencing was done with the SMRT® Technology PacBio RS II by

GATC biotech® (Konstanz, Germany). The genome was assembled by GATC

biotech® (Konstanz, Germany), with InView™ De novo Genome 2.0. HGAP

assembler. Second sequencing was done using MiSeq technology (GATC biotech®,

Konstanz, Germany). Miseq reads were assembled with ABySS (Simpson et al.,

2009).

  89  

To improve the PacBio HGAP assembly, we removed ABySS contigs smaller

than 1kb length and bacterial contigs from ABySS and HGAP assembly. ABySS

contigs were then aligned to PacBio contigs to build scaffolds using Geneious.

MiSeq reads mapping to the HGAP scaffolds were done with two different assembly

software; SSPACE (Boetzer et al., 2011) and SGA (Simpson and Durbin, 2012).

Parameters and options tested are presented in the supplementary material.

Genome annotations The RNA libraries were constructed by GATC biotech® (Konstanz, Germany)

and sequenced by Illumina HiSeq. Annotation was done using ORCAE (Sterck et al.,

2012) and Picoplaza (Vandepoele et al., 2013) databases. Twenty height HGTs

candidates were proposed by Foflonker and co-workers in Picochlorum SE3

(Foflonker et al., 2015). HGTs candidates were search among the RCC4223

genome using blastp. Seven of the 28 candidates were found.

Additionally, new HGT candidates were identified by searching best blastp

hits against non Chlorophyta genes using the approach used previously in

Bathycoccus (Moreau et al., 2012). Twenty-four candidate genes were thus retrieved

with best blast hit on bacterial genes.

Extended gene families have been explored with Picoplaza platform, by

comparing genes from 38 eukaryotes species (including Metazoa, Funfi,

Chlorophyta, Embryophyta, Rhodophyta, Haptobionta and Stramenopile).

RESULTS

Strain characterisation: The phylogenetic position of Picochlorum costavermella (Figure 1A) inferred

from the 18S rDNA sequence is closely related the other Picochlorum genome

sequenced (Figure 1A), Picochlorum SE3 from Foflonker and co-workers (Foflonker

et al., 2015). Transmission electron photography reveals a small cell of 1 to 2 µm

size, with a simple organisation and a thick cell wall ~50 nm (Figure 1C). The

karyotype is provided in Figure 2, and suggests that the genome is composed of 13

chromosomes from ~95 to ~1 800 kb.

*+!

Phenotypic tests reveal a high tolerance to salinity variations (Figure 1B): the

strain has the faster growth rate in salinities from 20 to 35 g.L-1, and is able to grow

in all salinity concentrations tested. Growth is lower in fresh water and starts to

decrease after a salinity of 40 g.L-1. However, the salinity gradient used here

confirms that the strain may develop in a wide range of salinities. The temperature

assay indicates a similar tolerance to a wide range of temperature. Indeed,

Picochlorum RCC4223 is able to grow at 35 °C (Figure 1D), whereas Ostreococcus

tauri cultures do not survive when exposed to this temperature.

Figure 1. (A) Phylogenetic tree summarizing the position of Picochlorum RCC4223 in green

Chlorophyta, using 18S rDNA sequence. (B) Fitness measures of Picochlorum RCC4223 in salinity

gradient from fresh water to 70 g/L. The proxy for fitness is the number of cell division per day. For

each point, there were 3 replicates started with 5 000 cells. (C) Picochlorum RCC4223 transmission

electron micrograph. Note the thick cell wall. Cell size is about 1 to 2 µm, close to the smallest known

eukaryotes. (D) Fitness measures in high temperature (35°C) compared to standard culture

conditions (20°C). O. tauri grows faster is standard condition, but do not survive at 35°C, contrary to

Picochlorum RCC4223.

0 10 20 30 40 50 60 70

1.6

1.8

2.0

2.2

2.4

2.6

y

moy

1.8

2.0

2.2

2.4 C

ell d

ivis

ion

per d

ay

2.6

6 8 10 12 14

1.8

2.0

2.2

2.4

2.6

2.8

m1

m

68

1012

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8m

1

m

1.6

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

2.0 2.5 3.0 3.5 4.0 4.5 5.0

1.9

2.0

2.1

2.2

2.3

2.4

all

mm

1.9

2.0

2.1

2.2

Cel

l div

isio

n pe

r day

2.3

1.9

6 8 10 12 14

1.8

2.0

2.2

2.4

2.6

2.8

m1

m

68

1012

141.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

2.0 2.5 3.0 3.5 4.0 4.5 5.0

1.9

2.0

2.1

2.2

2.3

2.4

all

mm

20°C 35°C

6 8 10 12 14

1.82.0

2.22.4

2.62.8

m1

m

0

68

10

12

14

1.8 2.0 2.2 2.4 2.6 2.8

m1

m

2.0 2.5 3.0 3.5 4.0 4.5 5.0

1.9

2.0

2.1

2.2

2.3

2.4

all

mm

N0 = 100 000 L1 medium

fw 10 20 30 40 50 60 70

100 nm

1.44 µm 50 nm

Picochlorum Picochlorum

O. tauri

20°C 35°C

C

ell d

ivis

ions

per

day

Cel

l div

isio

ns p

er d

ay

N0 = 5 000 n = 3 fw = fresh water

1.8

2.0

2.2

2.4

2.6

1.6

Salinity

1.9

2.0

2.1

2.3

2.4

0

A B

C D

A RCC 4223

Picochlorum sp SE3

Chlorella variabilis NC64A

Coccomyxa C169

Chlamydomonas reinhardtii

Volvox carteri nagariensis

Micromonas pusilla RCC299

Ostreococcus meditarraneus RCC2590

Ostreococcus lucimarinus RCC2590

Ostreococcus tauri RCC745

Coleochaete pulvinata (outgroup)

100

98

100

100

100

100

100

98

0.01

*"!

Mothur analysis from the two marine stations and the lagoon confirms marine

distribution of RCC4223. Two OTU reference sequences had 100% sequence

identity with V4 and V9 sequences in the three stations. However, RCC4223 V4

region is 100% identical to Picochlorum RCC2935, RCC897, RCC142, RCC140,

RCC14 and RCC4223 V9 region is 100% identical to Picochlorum sp. Azis1. Despite

the 100% identical sequences found in environmental samples, it is thus not possible

to conclude about the presence of this RCC4223 strain. However, it clearly appears

that Picochlorum genus is present both in costal station (SOLA) and offshore station

(MOLA). Associated with a higher growth rate in saline water, RCC4223 seems to be

better adapted to the marine environment, athough it has been isolated in estuary.

Figure 2. PFGE migration of Picochlorum RCC4223 in the left and yeast ladder in the right. 13

chromosomes are identified, with size from 95 to 1 800 Mb. Ch_n N (Sx); Ch_n is the chromosome

number, N is the chromosome size in Mb estimated, (Sx) is the possible contig number associated to

the chromosome (see contig sizes in Table S4). PFGE migration provided a genome size of ~14.1

Mb.

Pico Yladder

!"#$

"""$

%&#$$

'!"$

&("$

($)##$

)("$

($%!#$

($(##$

)!"$

*+,(- $)"$./001/0'2$

*+,(0 $%##$./&3/)3/(02$

*+,(( $&##$./"2$

$*+,( $($&##$./(2$*+,01-1!$$$$$$$($"##$4$-$./-2$

*+,"1% $($-##$4$0$

*+,'3& $($###3)"#$./!2$

*+,) $)-#$*+,(# $&"#$

Mb

  92  

Genome assembly PacBio sequencing generate 266 217 reads, with mean read length of 6 215

bp and mean coverage of 69.94x. HGAP assembly built 361 contigs and total length

was 21 260 393 bp. Maximum and minimum contig lengths were 965 kb and 2.3 kb

length, with N50=244 Mb. After removal of bacterial contigs, 147 HGAP contigs were

conserved: total length was reduced to 14 233 452 bp with an average 46% GC

content. The statistical results of raw HGAP assembly and assembly report from

GATC biotech® (Konstanz, Germany) are provided in Table S1 and supplementary

materials. Illumina MiSeq sequencing generated 2.3 millions reads of 300 pb,

mapped in 94.63% of the HGAP genome. The best results obtained from ABySS

using Illumina reads are presented in Table S2. The ABySS genome was composed

by 19 896 contigs with N50=11 212 bp. After removal of bacterial contigs and small

contigs below 1 kb, 2 503 were kept and mapped on HGAP with Geneious, SGA

(Table S3) and SSPACE. Final assembly was composed by 40 scaffolds of 10.5 kb

to 1 794 kb, with N50=691 kb, GC content of 46% and total length of 13.74 Mb.

These values are similar to those obtained from the Picochlorum SE3 genome, that

is 13.5 Mb length and 46.1% of GC. Mitochondrial sequence corresponds to one

contig of 42.9 kb and 41% GC, and the chloroplast sequence corresponds to one

contig of 78.2 kb and 31.9% GC. Final assembly is presented in Table S4 and possible correspondences of scaffold sizes and chromosomes are presented in

Figure 2.

Genome annotations

9 315 genes composed the genome of Picochlorum RCC4223 with 2 738

genes smaller than 500 bp and 879 genes smaller than 200 pb (see lengths of Open

Read Frame (ORF) in Figure 3).

The RCC4223 genome reveals a high number of extended gene families.

These extensions are the results of tandem gene duplications. First, genes families

involved in variety of transposons and transposable elements are extended in the

genome of RCC4223 compared to SE3: (i) the reverse transcriptase

HOM03P000019 (53 vs 17; number of copies in SE3 and RCC4223, respectively)

and HOM03P007658 (10 vs 1), and (ii) the transposase HOM03P005338 (15 vs 2)

and MULE transposase domain HOM03P007225 (10 vs 2).

  93  

Second, the polyketide synthase HOM03P000145 (23 vs 6), which is

implicated in the fatty acid chain formation and polyketide secondary metabolites

production. With 23 copies, this genome contains the most abundant gene repertoire

of polyketide synthases as compared to other green algae. Polyketides are known in

bacteria, plants and fungi, and may be involved in the synthesis of antibiotics,

chemotherapeutic compounds or toxins (Carreras et al., 1997; Hopwood, 1997). In

plants, two molecules are particularly studied, stilbene and chalcone,, both

implicated in phytoalexins synthesis (Schröder and Schröder, 1990).

Third, the DEE superfamily endonuclease (HOM03P005481 and

HOM03P005432, 12 vs 5 and 11 vs 2). DDE family are responsible of coordination

of metal ions for catalysis.

Fourth, DNA helicase Pif1 HOM03P000255 (21 vs 4), involved in DNA repair

and genome stability in telomeres in yeast (Pinter et al., 2008) and human (Mateyak

and Zakian, 2006).

Last, Zinc finger SWIM-type HOM03P007225 (10 vs 2), which is involved in

different biological functions (Laity et al., 2001).

Of the 28 HGT candidates from the strain SE3 (Foflonker et al., 2015), 7 were

found in the RCC4223 genome (09g03890, 03g06310, 08g00570, 10g04270,

15g01560, 15g01560, 17g01380).

In addition, 27 new HGT candidates were identified: 01g04510, 01g02120,

01g05920, 01g07290, 01g09100, 01g10000, 02g01220, 03g02930, 03g03660,

04g02340, 05g00790, 06g02940, 07g01620, 08g03650, 09g00220, 09g01800,

10g00960, 12g02430, 13g00040, 14g01620, 16g00230, 18g00250, 20g00540,

20g00570, 21g00070, 21g00420).

*%!

Figure 3. Open Read Frame (ORF) lengths comparison between Picochlorum species.

Figure 4. Gene family extensions between Picochlorum SE3 and Picochlorum RCC4223.

Histogram of pico

pico

Freq

uenc

y

0 1000 2000 3000 4000 5000

020

040

060

0

Histogram of batash

batash

Frequenc

y

0 1000 2000 3000 4000 5000

050

100150

200250

Picochlorum RCC4223 Picochlorum SE3

Freq

uenc

y

Gene length (bp)

Pic

ochl

orum

RC

C42

23!

Picochlorum SE3 !10 20 30 40 50

10

50

40

30

20

Number of gene families per position

1-2 3-8 9-25 26-75 76-400 400+

  95  

DISCUSSION Origin of RCC4223

Picochlorum species are commonly found in marine and saline ecosystems

(see Picochlorum strains at http://roscoff-culture-collection.org). The presence of

Picochlorum RCC4223 species in marine stations and its higher fitness in saline

water justify its affiliation to the Picochlorum genus. The new genome of RCC4223

strain provides (i) a new tool to better study extremophile green algae, (ii) and to

explore metabolic pathways in these algae.

HGTs candidates It has been proposed that horizontal gene transfers from Bacteria to Plantae

including green algae, such as Bathycoccus prasinos RCC1105 (Moreau et al.,

2012), Picochlorum SE3 (Foflonker et al., 2015), Chlorella variabilis (Blanc et al.,

2010) and the red algae Galdiera phlegrea (Qiu et al., 2013) are more extended than

previously thought, and are not limited to the transfer of genes from the chloroplast

to the nucleus. HGTs are a fundamental mechanism of adaptation in Bacteria and

Archaea (Vos et al., 2015), by enabling the acquisition of new genes involved in

metabolic pathways, resistance to a stress or other biological interests.

These cross kingdom gene transfers are rare in eukaryotes, but there is

evidence that HGT conferred survival capability to extremophile eukaryotes

(Schönknecht et al., 2013). However, none of the HGT candidates we identified in

Picochlorum RCC4223 can be directly linked to thermotolerance or halotolerance of

Picochlorum.

Some HGT candidates are present in both RCC4223 and SE3, meaning that

these genes have been acquired earlier by their common ancestor. The presence of

species-specific genes HGTs candidates indicates that more recent transfers

occurred, and thus actively and regularly participate to genome evolution and

adaptation of these species.

  96  

Extended gene families Genes belonging to an over-represented family are disposed at adjacent

sites, suggesting an origin by tandem duplication.

In the case of the polyketide synthase family HOM03P000145, genes from

02g08770 to 02g08840 and from 16g00230 to 16g00280 are disposed in tandem,

with shorter gene length as commonly known in this gene family. Adjacent genes

have very low levels of amino-acid identity (~35%), pointing to a very ancient origin

by duplication.

The zinc finger SWIM-type HOM03P00722 is composed by 3 genes of ~2300

bp and ~95% of amino acid identity. There are also two times 3 short adjacent

genes, whose concatenated sequences have ~95% amino acid identity with the

previous genes of 2300 bp length.

The principle mechanism of gene family extension we observed could be the

division of existing genes that may first appear by duplication, and that are later

shortened by internal stop codons by mutations. This does not necessarily mean

functional loss, and RNA data suggests that all these genes are expressed.

CONCLUSION This study provided a new resource for the study of green algae by bringing a

new Picochlorum genome, from the halotolerant and thermotolerant strain RCC4223.

The genome of Picochlorum RCC4223 is characterized by a high number of genes

compare to other green algae with similar genome size, in part explain by the

extension of several gene families with short ORFs. In addition, we support the

hypothesis of horizontal gene transfers from bacteria to algae. Last, given the

interest of Picochlorum species for biotechnologies, this new genome is an

opportunity to explore deeply their potential.

ACKNOWLEDGEMENTS We are grateful to the Genomics of Phytoplankton lab for support and

stimulating discussions and the GenoToul Bioinformatics platform from Toulouse,

France, for bioinformatics analysis support and GenoToul cluster availability.   This

work was funded by ANRJCJC-SVSE6-2013-0005 to GP and SSF.

  97  

CHAPITRE 5:

IMPACT DU TAUX DE MUTATION POUR

LES BIOTECHNOLOGIES

       

  98  

                                                                                           

  99  

Quels sont les impacts du taux de mutation sur la domestication des algues vertes ?

Les espèces du genre Picochlorum sont étudiées pour différentes

applications biotechnologiques. Pour cette raison, mais aussi pour élargir les

connaissances sur le taux de mutation, une EAM a été réalisée avec l’espèce

Picochlorum RCC4223.

12 lignées ont été suivies pendant environ 150 générations par lignées sur

199 jours. Contrairement aux expériences avec les Mamiellophyceae, il n’y a pas de

témoin pour mieux suivre l’évolution de la fitness des lignées au cours du temps. La

méthode pour l’identification des mutations est identique à celle exposer dans le

chapitre 3, et le génome de référence est présenté dans le chapitre 4.

En résumé, il est observée une baisse de fitness au cours du temps chez les

lignées en raison des mutations délétères (cependant il n’y a pas de normalisation

par un control comme dans le chapitre 2). Le taux de mutation par génome est plus

élevé que chez les Mamiellophyceae et la majorité des eucaryotes unicellulaires. Il

n’y a que 21 mutations, ce qui est trop peu pour obtenir des résultats statistiques

solides sur la distribution des mutations dans le génome, comme se fut le cas chez

les espèces de Mamiellophyceae.

Cette étude met l’accent sur la variabilité du taux de mutation, y compris entre

espèces proches, et surtout sur l’utilisation du taux de mutations spontanées pour

l’évolution expérimentale et la domestication des algues vertes. En effet, les algues

vertes sont maintenant l’un des groupes le plus représenté parmi les estimations des

taux de mutations spontanées. Cette connaissance peut être prise en compte dans

le choix d’une espèce pour l’élaboration d’un protocole.

         

  100  

                                                                                           

  101  

Spontaneous mutation rate of the Chlorophyta Picochlorum RCC4223

Krasovec Marc*, Piganeau Gwenael*, Sanchez-Ferandin Sophie*.

* Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie Intégrative des

Organismes Marins (BIOM), Observatoire Océanologique, F-66650 Banyuls/Mer,

France

Keywords: Mutation rate, Mutation accumulation, Green algae biotechnology,

Picochlorum.

Corresponding authors: krasovec@obs-banyuls.fr

ABSTRACT Mutation rate is a crucial parameter to understand evolution and adaptive capacity of

species, because mutations are at the origin of variability on which selection acts.

Spontaneous mutations may be an alternative to mutagenesis for microalgal

domestication purposes. To investigate the potential of spontaneous mutations to

generate genetic variation, we performed a mutation accumulation experiment using

the species Picochlorum RCC4223, a green alga with important biotechnological

potential. A decrease of fitness during experiment due to deleterious mutations is

observed. The spontaneous mutation rate is 10.12 x 10-9 mutations per nucleotide

per genome per generation, one of the highest estimates in unicellular eukaryotes.

  102  

INTRODUCTION Natural selection allows species to adapt from standing genetic variation,

powered by mutations which constitute the ultimate source of diversity (Wright 1932).

Quantifying the rate of mutations and their effects are thus of primary importance to

better understand evolution. Mutation accumulation (MA) experiments allows to

access to the spontaneous mutation rate (Halligan and Keightley, 2009) thanks to

the development of high-throughput sequencing technologies (see Wei and co-

workers for a database (Wei et al., 2014)). The principle is to maintain MA lines from

an ancestral type with serial bottlenecks to remove selection and fix deleterious

spontaneous mutations. Current estimations of mutation rates range from 1 x 10-9

mutations per nucleotide per generation in metazoans, such as Drosophila

melanogaster (Keightley et al., 2014a, 2009; Schrider et al., 2013), Caenorhabditis

elegans (Denver et al., 2012, 2009) or Heliconius melpomene (Keightley et al.,

2014b), and in order of 1 x 10-10 in microorganisms, such as Saccharomyces

cerevisiae (Lang and Murray, 2008; Lynch et al., 2008; Zhu et al., 2014),

Schizoaccharomyces pombe (Behringer and Hall, 2015; Farlow et al., 2015) and

Escherichia coli (Lee et al., 2012).

The mutation rate is expected to be low so that the mutational load due to

deleterious mutations is limited (Agrawal and Whitlock, 2012). As a consequence,

selection pushes to decrease the mutation rate. Effective population size is therefore

a key parameter because it defines the intensity of selection and drift, which are

inversely related (Charlesworth, 2009). Microorganisms, with high effective

population size, like green algae, are expected to reach a low mutation rate (Lynch,

2010a; Sung et al., 2012a). Inversely, high genetic drift imposes a drift barrier which

prevents the natural selection to reach the optimal mutation rate (Martincorena and

Luscombe, 2013).

In eukaryotes, the mutation rate is positively correlated to the genome size

(Smeds et al., 2016) (Krasovec et al., 2016, in preparation), which varies by 100-fold

from a few Mb to a few Gb. This variation causes an increase of replication cost that

leads to decrease the replication fidelity.

  103  

Although the knowledge about mutation rate variation between species is

improving, intra-species variation is also commonly observed in MA experiments

(Behringer and Hall, 2016). These variations are thus independent from genome size

and effective population size. In bacteria, mutation rate can increase by 100-fold

because of mutator alleles (Sniegowski et al., 1997; Taddei et al., 1997; Tenaillon et

al., 1999). This boosts the chance to observe the appearance of mutations (including

mutations advantageous). In eukaryotes, stress can induce an increase of the

mutation rate (Jiang et al., 2014), but not as strongly as in bacteria.  

In green algae, MA studies are available in a wide range of species. These

MA experiments were conducted to estimate either the fitness effects of mutations

(Kraemer et al., 2015; Krasovec et al., 2016; Morgan et al., 2014) or the

spontaneous mutation rate: Chlamydomonas reinhardtii (Ness et al., 2015b, 2012;

Sung et al., 2012a) and four Mamiellophyceae species (Krasovec et al., 2016, in

preparation). This knowledge is relevant for biotechnological applications of green

algae, like the biofuels production (Brennan and Owende, 2010; Chisti, 2007; Mata

et al., 2010) and proteins for health food or cosmetics   (Becker, 2007). All natural

populations harbour standing genetic variability (Barrett and Schluter, 2008) which

enables adaptation to environmental changes and pressures. Thus, domestication of

traits of interest could be obtained from the standing genetic diversity. Alternatively,

adaptation may also occur from new mutations so that the estimation of spontaneous

mutations rates is also paramount to investigate the possible rate of domestication of

green algae.

In this study, we performed a mutation accumulation experiment in

Picochlorum RCC4223, a green algae species belonging to Chlorophyta in the

Trebouxiophyceae family (Henley et al., 2004). It has a small haploid genome of

~13.5 Mb with 79.5% of coding sequences and 46% GC content (Krasovec et al., in

prep). Strains from the Picochlorum genera are versatile alga for large scale

culturing, capable of growing in a wide range of salinities and temperatures

(Foflonker et al., 2016, 2015). They also constitute interesting models in different

fields, such as medicine (Black et al., 2014), biofuels (Wang et al., 2016) and in

aquaculture as dietary complement given its high content in proteins (Chen et al.,

2012).

  104  

MATERIAL AND METHODS MA experiment: The Picochlorum RCC4223 culture has been isolated from an estuary of the

river La Massane (France) in our lab and has been deposited at the Roscoff Culture

Collection (http://roscoff-culture-collection.org/, France). 12 MA lines were kept from

a clonal ancestral population in 24 well plates, at 20°C with life cycle of 16h-8h dark-

light. MA lines were inoculated by one single cell and maintained by serial one-cell

bottlenecks every 14 days. At bottleneck time, cell concentration was measured with

a FACSCanto II flow cytometer (Becton Dickinson, Franklin Lakes, NJ, U.S.A.) using

natural chlorophyll fluorescence (670 nm used FL3 data) and SSC acquisitions.

Effective population size, Ne, was estimated with the harmonic mean of cell number

between bottlenecks and the number of generations was provided by the following

equation:

Nt is the total number of cells measured by flow cytometer and t the time between

two bottlenecks, i.e 14. Lines were maintained during 199 days and suffered a serial

of 14 bottlenecks. G is also used as a proxy of fitness to estimate the effects of

mutations over time, from T0 to Tf, with a linear model.

Sequencing and mutations identification

We extracted DNA using CTAB protocol for Illumina MiSeq sequencing,

performed by GATC biotech® (Konstanz, Germany). 12 MA lines and the ancestral

type were sequenced. To identify mutations, we used the same method described by

Krasovec and co-workers (Krasovec et al., 2016, in preparation); MiSeq reads were

aligned to the reference genome with BWA (Li and Durbin, 2010), bam files were

treated with SAMtools (Li et al., 2009) and mutations were identified with GATK

(DePristo et al., 2011). Afterwards, final vcf files and mutations candidates were

obtained after following filtered steps: removal of low mapping quality sites (<40), low

covered sites (<5) and candidates shared by two MA lines. SnpEff (Cingolani et al.,

2012) permitted to identify synonymous, non-synonymous, intronic and intergenic

mutation types using the annotation available in ORCAE web site (Sterck et al.,

2012). This mutation calling pipeline was used for base-substitution and insertions-

deletions (indels).

G = e ln Nt /1( )/t!" #$

  105  

Mutation spectrum

Pearson's chi-squared test was used to test the distribution of observed

mutations and expected distribution. Expected distribution H0 was defined assuming

that mutations appear randomly and independently in the genome.

We compared the distribution of mutations between coding and non coding

regions; the level of expression of mutated sites using STAR (Dobin et al., 2013); the

synonymous and non-synonymous base-substitution mutations; the direction of

mutations from each nucleotide to others and the nucleotide context (between 2 and

10 nucleotides) around mutated sites.

GC bias and GCeq were estimated from the following equations (Sueoka, 1962):

𝑅!=(GC→AT)𝐺𝐶!

, 𝑅!=(AT→GC)𝐴𝑇!

, 𝐺𝐶𝑒𝑞 =  𝑅!

𝑅! + 𝑅!, 𝛥𝐺𝐶 = 𝐺𝐶 −  𝐺𝐶𝑒𝑞

GCn and ATn are the total GC and AT; GC→AT and AT→GC are the number of

nucleotide changes; GCeq is the GC at the equilibrium, meaning the GC content

where the number of mutations from GC to AT and AT to GC is equal.

RESULTS Picochlorum mutation rate

The experiment lasted 199 days, corresponding to an average of 133

generations per MA line with an effective population size of Ne ~6. About ~  97% of

the genome was usable for mutation identifications (Table 1). MA lines accumulated

21 mutations: 19 base-substitutions (Figure 1) and 2 insertion-deletions (indels)

(Table 2). 19 of these mutations were validated by PCR. Despite MA the fact that

lines were maintained for a similar number of generations, there is a strong

heterogeneity in the mutations distribution between lines (Table 1). Considering all

MA lines, µbs is 9.19 x 10-10 base-substitution mutations per nucleotide, and µID is

9.64-11 indels per nucleotide. Total mutation rate µ is 1.012 x 10- 9 mutations per

nucleotide per generation. It corresponds to Ubs = 0.0119 base-substitution mutations

per genome and UID = 0.0013 indels per genome per generation. No mutation was

found the mitochondria and the chloroplast genomes.

"+'!

The fitness of the MA lines significantly decreased during the experiment

(linear model, " = -0.36, P-value = 1.7 x 10-6), suggesting that some spontaneous

mutations are deleterious. Nevertheless, no fitness measurement of control line with

high effective population size is available to normalize MA lines fitness data (Chevin,

2011; Krasovec et al., 2016). Although the fitness decrease is expected as a

consequence of deleterious mutations, it can’t be exclude that the fitness variation in

MA lines could arise from the experimental set-up

We propose to estimate the arrival of new mutations in a Picochlorum

RCC4223 culture, started from modest an inoculation of N0=10 cells and maintained

for 30 days, assuming U=0.0132 mutations per genome per cell division and one cell

division per day. According to these simple assumptions, this will lead to a culture of

230 cells (~5.4 x 109 cells) corresponding to 230 cell divisions. This culture would thus

contain ~3.57 x 107 mutant cells (3.54 x 10-7 cells with one mutations, 23.4 x 104

cells with 2 mutations, 1543 cells with 3 mutations and 10 cells with four mutations).

Mutation distribution Mutations appearing in non-coding region were higher than expected by

chance but this is not statistically significant. The proportion of synonymous and non-

synonymous mutations was as expected under neutral evolution (Table 2),

consistent with the lack of selection against non-synonymous mutations.

Figure 1. Number of base-substitution mutations observed in MA lines of Picochlorum RCC4223. 19

base-substitutions mutations were detected, and 17 confirmed by PCR.

G!A C!T T!C A!G C!G G!C G!T C!A T!G A!T A!C T!A G C C GG C G C G C

1 2 3 4 5 6 7 8 9 10 11 12

24

68

10

1

2

3

0

Transitions Transversions

  107  

Table 1. Distribution of the mutations. BS and ID are the base-substitution and insertion-deletion

mutations. G* corresponds to the genome percentage usable for mutations identification.

MA lines G* (%) BS ID Generations

1 97.2 1 0 143

2 97.1 2 0 148

3 97.2 0 0 120

4 97.1 1 0 125

5 97.1 0 0 123

6 97.3 6 0 128

7 97.7 1 0 90

8 96.9 1 0 134

9 97.2 0 0 145

10 97.2 5 1 156

11 98.1 1 0 130

12 97.2 0 1 153

Table 2. The distribution of the mutations in the genome, with the predicted effects from SnpEFF.

Contig Position Reference Mutation Effect

1 1412265 A G Synonymous coding

2 1558965 T A Non synonymous coding

3 1431057 G A Intergenic

3 1438974 C T Synonymous coding

4 388329 G T Intergenic

4 532113 C A Non synonymous coding

4 632871 A G Non synonymous coding

4 726437 T A Non synonymous coding

4 934361 C A Intergenic

6 671466 G A Non synonymous coding

10 496542 C G Non synonymous coding

10 615708 A T Intergenic

12 132864 T C Intergenic

12 160261 C T Synonymous coding

12 545145 T C Intergenic

13 215260 G A Non synonymous coding

13 240891 G C Non synonymous coding

13 475120 C G Intergenic

41 2537 A C Non synonymous coding

27 93213 TG T Frame shift

13 8595 T TTA Frame shift

  108  

R1 (GC->AT mutation rate) and R2 (AT->GC mutation rate) are respectively

equal to 4.12 x 10-10 and 9.61 x 10-10 mutations per nucleotide per generation. We

obtained a GCeq of 30%, while the observed GC content is 46%. The base

substitution mutation increases by 8.8% as consequence of GC distance from

equilibrium, meaning it has a moderate influence on the high mutation rate in

Picochlorum. No influence of the nucleotide context was observed in the distribution

of the mutations.

Mutation rate variation

The Chlorophyta constitute one of the most represented phylogenetic group in

spontaneous mutation rate estimates by MA experiments. In addition to Picochlorum,  

four mutation rates from Mamiellophyceae (Krasovec et al., in preparation) and

several mutation rates from multiple strains from Chlamydomonas reinhardtii (Ness

et al., 2015b, 2012; Sung et al., 2012a) are available (Table 3).

In C. reinharditii, the mutation rate varies by ~40 fold, like observed with all

unicellular eukaryotes. In Mamiellophyceae, µ is ~6.2 x 10-10(±2.5-10); Considering

the other eukaryotes with multiple mutation rate estimates, µ is ~39.3-10(±14.0-10) in

Drosophila melanogaster (Keightley et al., 2014a, 2009; Schrider et al., 2013) and

~21.4-10(±8.1-10) in Caenorhabditis elegans (Denver et al., 2012, 2009). It

corresponds to ~35% intra specific variation of µ. This part of mutation rate variability

is thus independent from species characters such as genome size or effective

population size. This suggests that a mutation rate estimated in a strain or species

may not be extrapolated to phylogenetically closely related species. This implies that

there is no or low phylogenetic constraint on the mutation rate. The mutation rate

observed in RCC4223 is thus not necessarily representative of the Picochlorum

genus mutation rate.

  109  

Table 3. Available direct spontaneous mutation rate estimations by mutation accumulation

experiments in Chlorophyta, taking into account base-substitutions and indels.

Species G G*% µ -10 U References

C. reinhardtii CC-2937 105 59.0 3.23 0.0362 (Ness et al., 2012)

C. reinhardtii CC-124 121 - 0.676 0.0076 (Sung et al., 2012a)

C. reinhardtii C-1952 104 71.5 4.05 0.0454 (Ness et al., 2015b)

C. reinhardtii CC-2931 104 69.7 15.6 0.1747 (Ness et al., 2015b)

C. reinhardtii CC-1373 104 75.8 28.1 0.3147 (Ness et al., 2015b)

C. reinhardtii CC-2342 104 69.2 11.1 0.1243 (Ness et al., 2015b)

O. tauri RCC4221 13.0 97.5 4.79 0.0062 Krasovec et al., 2016

O. mediterraneus RCC2590 13.5 97.2 5.92 0.0081 Krasovec et al., 2016

M.s pusilla RCC299 21.0 99.6 9.76 0.0205 Krasovec et al., 2016

B. prasinos RCC1105 15.0 99.5 4.39 0.0066 Krasovec et al., 2016

Picochlorum sp RCC4223 14.3 97.0 10.12 0.0132 This study

DISCUSSION High mutation rate

The mutation rate of Picochlorum RCC4223 is one of the highest

spontaneous mutation rates estimated from a microorganism. In unicellular

eukaryotes, higher mutation rate has been reported in three strains of C. reinhardtii

(Ness et al., 2015b).

First, a high mutation rate can be a consequence of low adaptation to lab

conditions. Picochlorum RCC4223 was isolated from brackish water, and we

performed the MA experiment just one year after its isolation, while it was kept in L1

medium. In eukaryotes, the mutation rate can increase in genome with a low fitness

quality or stressful conditions, such as in A. thaliana (Jiang et al., 2014) and D.

melanogaster (Sharp and Agrawal, 2012). This increases the chance of beneficial

mutation appearance. Although a higher mutation rate is a pledge of fast arrival of

new mutations, it also increases deleterious mutation events. Effectively, in

accordance with the literature, the fitness of the MA lines decreases during the

experiment as expected if mutations are deleterious (Ajie et al., 2005; Fry, 2001; Hall

  110  

et al., 2013; Keightley, 1994; Shaw et al., 2000). However, the large effective

population size in microorganisms allows effective selection against this higher pool

of deleterious mutations, and therefore limits the genetic load (Agrawal and Whitlock,

2012; Lynch and Gabriel, 1990) due to this high mutation rate. Species with a high

effective population size could support a higher mutation rate if necessary for a given

time period, without undergoing too heavily deleterious mutation effects.

Second, the mutation rate variation between MA lines can come from the

stochastic production of DNA repair proteins, reported in Escherichia coli (Uphoff et

al., 2016). This bias could be responsible of an increase of mutation rate in some MA

lines, increasing the global mutation rate from the whole experiment.

Biotechnological potential of Picochlorum RCC4223 Spontaneous mutation rate is determinant to estimate the number of mutants

in a culture of microalgae. In Picochlorum RCC4223, calculation suggests that the

number of mutants generated spontaneously is sufficient for effective and fast

experimental evolution, provided efficient selection procedure to isolate mutants with

relevant trait. For example, single cells with larger sizes or higher lipids content can

be sorted by flow cytometry using fluorescent dyes such as Nile red and BODIPY

505/515 (Rumin et al., 2015). Mutation and selection are of primary importance for

species domestication, as biotechnologies and use of new species are reported as a

possible solution to global challenges (Carroll et al., 2014).

In Picochlorum RCC4223, we expect to quickly reach a genotype of interest

with high effective population size and strong selection. Despite a decrease of fitness

due to deleterious mutations in MA condition, the adaptation potential of Picochlorum

is not impacted. First, high selection due to high effective population size removes

deleterious mutations. Second, mutation effects are environment dependent and a

deleterious mutation in one condition is not necessarily deleterious in other

(Krasovec et al., 2016).

  111  

The chance to a obtain desirable genotype may be increased by

mutagenesis. In green algae, different protocols have been tested and permit to

obtain cells of interest (Cazzaniga et al., 2014; Ota et al., 2013; Vonlanthen et al.,

2015). However, the mutagen factors also increase the deleterious mutation rate,

and thus the mutation load. Algal populations have so to be carefully exposed to a

mutagen in order to not compromise their survival capacity. In the case of Ultraviolet

irradiation, the survival rate reaches just 10% (Cazzaniga et al., 2014). The use of

mutagens chemicals could be avoided for Picochlorum RCC4223 in culture

condition, providing that the mutation rate and the effective population size are high.

It has recently been shown that experimental evolution with high effective population

size induces an increase of the growth rate over generations without the use of

mutagens in Chlamydomonas reinhardtii (Perrineau et al., 2014).

To conclude, knowledge about green algae mutation rates allows an

estimation of the numbers of mutations appearing in the culture, and may be

considered as a criterion for species selection for domestication purposes.

CONCLUSION This study provided the first direct spontaneous mutation rate estimate in a

Picochlorum species. The mutation rate of RCC4223 appears to be sensibly higher

that mutation rate commonly found in unicellular eukaryotes, including other green

algae, with the exception of a few strains of C. reinhardtii. This high mutation rates

strengthens Picochlorum species as a promising alga in biotechnological

researches.

  112  

  113  

CHAPITRE 6:

DISCUSSION GENERALE ET

CONCLUSION

       

  114  

                                                                                           

  115  

1. Les variations de fitness indépendantes des mutations 1. La plasticité phénotypique

Les résultats obtenus à partir des données de fitness sur les lignées

mutantes (chapitre 2) indiquent que l’effet des mutations chez le phytoplancton

eucaryote peut être très important. Les lignées n’ont accumulé en moyenne que 2 ou

3 mutations chacune (Tableaux A1 à A3, page 159 à 161). Or elles ont des fitness

significativement différentes, inférieures ou supérieures au contrôle selon les

lignées. Il apparaît donc que quelques mutations induisent une variation de fitness

détectable. En effet, certaines mutations pourraient avoir un fort impact sur la

capacité de survie, notamment dans le cas d’une mutation qui introduit un codon

stop dans une protéine, ou qui réduit l’efficacité d’un facteur de transcription

responsable de la régulation d’une voie métabolique.

Les données de séquençage nous donnent l’opportunité de corréler certaines

mutations avec des données de fitness. Malgré cela, les données disponibles ne

permettent pas de comprendre la relation entre une mutation et un effet mesuré. Par

exemple, la lignées 3 d’O. mediterraneus pousse significativement plus vite dans le

milieu avec Irgarol et moins vite dans le milieu avec le Diuron. Cette lignée a fixé

trois mutations, deux substitutions non synonymes et une délétion avec un décalage

du cadre de lecture (Tableaux A2 et A3). Les gènes impactés sont identifiés (une

glycoside hydrolase, une triphosphate hydrolase et un domaine MYB), mais il n’est

pas possible de conclure sur l’impact réel de l’une des mutations sur la différence de

fitness observée.

Il existe cependant un point qui relativise l’importance du rôle des mutations

dans la variation de fitness observée: deux lignées n’ont pas fixé de mutation et

montrent pourtant un changement significatif de fitness (la lignées 7 d’O. tauri

montre une baisse significative de sa fitness au cours de l’EAM (Tableau A1), et la

lignées 5 de B. prasinos a une fitness plus élevée dans les milieux avec herbicides).

La forte couverture de séquençage sur la presque totalité du génome réduit la

probabilité qu’une mutation soit apparue sans avoir été identifiée.

  116  

Bien que cela ne concerne que 2 lignées sur la totalité dont la fitness a été

étudiée, ces résultats mettent en avant l’importance de facteurs non mutationnelles

qui peuvent être impliqués dans la variation de la fitness.

Cette différence de fitness peut venir de variations dans la transcription et la

méthylation de gènes (Jones, 2012), ou d’une forte plasticité comme proposé par

Collins et ses collaborateurs chez différentes espèces d’algues vertes (Collins et al.,

2014; Schaum et al., 2015; Schaum and Collins, 2014; Scheinin et al., 2015). La

plasticité est définie comme la capacité pour un même génotype de produire

plusieurs phénotypes en réponse à des variations environnementales. Il est montré

que dans un environnement fluctuant, la moitié de cette réponse peut être apportée

par la plasticité. Si tel est le cas, il est délicat d’affirmer que les changements de

fitness sont issus des mutations (même dans le cas où des mutations ont été

identifiées). Le changement de fitness serait alors lié aussi bien aux mutations qu’à

la plasticité phénotypique. Pourtant, les différences de fitness sont bien observées,

qu’elles soient d’origine mutationnelle ou non. C’est plutôt le rôle précis des

mutations qui est délicat à déterminer dans cette étude sur la fitness.

Par ailleurs, de nombreuses études sur les variations de fitness chez des

lignées issues d’EAMs avaient été réalisées avant que l’accès aux données de

séquençage ne soit aussi facile qu’aujourd’hui (Halligan and Keightley, 2009). Un

changement de fitness était alors interprété comme la conséquence de l’apparition

d’une mutation. A partir de là, la moyenne et la variance du caractère de fitness

permettaient de calculer les paramètres mutationnels. De ce fait, il est possible que

lors de ces études, le rôle des mutations sur la fitness ait parfois été surestimé en

raison de l’absence de données de séquençage.

  117  

1. 2. Les bactéries présentes dans les cultures d’O tauri

Les EAMs ont permis d’aborder d’autres questions que celles relatives aux

mutations, notamment sur la communauté bactérienne qui pourrait être associée aux

cultures de Mamiellophyceae. Des cas d’interactions entre bactéries et unicellulaires

eucaryotes phytoplanctoniques sont connus (Cole, 1982), comme chez les

diatomées (Bacillariophyceae) (Schäfer et al., 2002). Par exemple, certaines

bactéries peuvent produire des vitamines qui stimulent la croissance du

phytoplancton (Croft et al., 2005).

Aucune culture totalement axénique (c’est à dire sans bactéries) de

Mamiellophyceae n’a pour l’instant été obtenue dans notre laboratoire. Même avec

différentes méthodes (centrifugation, antibiotiques), des bactéries restent présentes

dans la culture. S’il n’est pas possible ou difficile d’obtenir des cultures axéniques, il

est raisonnable de penser que c’est parce que certaines bactéries favorisent ou

stimulent la croissance de la culture.

Si tel est le cas, une diminution de fitness observée ou une perte de lignée

pourraient s’expliquer par l’absence de la bactérie associée à la culture d’algue.

Dans le cas des EAMs, les lignées ont pu être inoculées, de façon stochastique,

avec ou sans bactéries lors des goulots d’étranglement.

Concernant les lignées d’O. tauri ayant survécu à l’ensemble de l’EAM, une

certaine communauté de bactéries devrait être retrouvée en fin d’expérience dans

les cultures si celle-ci. Aussi, on peut supposer que cette communauté bactérienne

aura été inoculée à chaque goulot d’étranglement avec O. tauri. est indispensable

pour favoriser la croissance de la microalgue.

Pour tester cette hypothèse, nous avons étalé sur boite de Pétri 16 milieux de

culture de 16 lignées d’O. tauri et identifié les colonies bactériennes par séquençage

du marqueur ADNr 16S. Les résultats de cette étude sont présenté dans un article

accepté dans la revue Frontiers in Microbiology (Lupette et al., 2016, in press, voir

annexes page 173). Le genre bactérien le plus représenté est Marinobacter, déjà

retrouvé dans des cultures de Dinobiontes ou Haptobiontes (Alavi et al., 2001; Amin

et al., 2009; Hold et al., 2001). Les Marinobacter sont connues pour produire des

  118  

sidérophores, un chélateur du fer utilisé par le phytoplancton (Martinez et al., 2003,

2000; Vraspir and Butler, 2009), et des vitamines B12 (cobalamine). Il n’est

cependant pas possible de conclure à ce stade de l’étude sur une éventuelle

association symbiotique entre les bactéries identifiées et O. tauri. Pour cela, d’autres

expériences doivent être menées sur des cultures axéniques pour tester les effets

de la présence/absence bactérienne, et cela dans différents milieux de culture. Si

cette relation est confirmée, les pertes de lignées observées lors des EAMs

pourraient peut-être s’expliquer en partie par l’absence de bactéries au moment du

goulot d’étranglement.

1.3. Le rôle des variations structurelles sur le phénotype

Au-delà des mutations étudiées dans les chapitres précédents (les

substitutions et les insertions-délétions), il existe des variations structurelles du

caryotype avec d’importantes conséquences phénotypiques. Les différentes

souches d’une même espèce de Mamiellophycae sont en partie différenciées par

leurs caryotypes, qui présentent des variations au niveau de la taille des

chromosomes dit « outliers » (Subirana et al., 2013). Il s’agit de chromosomes avec

une composition en GC inferieure au reste du génome, et de nombreuses régions

répétées. Il y a 1 ou 2 chromosomes dit « outliers » par génome suivant les espèces,

sur le total des chromosomes (de 17 à 20 suivant l’espèce) qui composent le

caryotype.

Par ailleurs, les Mamiellophycea sont infectés par des prasinovirus

spécifiques (Yau et al., 2015), comme c’est le cas pour le virus modèle d’O. tauri,

OtV5 (Derelle et al., 2008). En laboratoire, l’infection d’une culture d’algue par le

virus induit une très forte mortalité (on parle de lyse de la culture), mais qui n’est pas

totale car il existe une partie de la population d’algues qui est résistante au virus. Les

variations dans la taille des chromosomes « outliers » semblent être en partie

responsables de l’acquisition de cette résistance chez O. tauri (Yau et al., en

révision).

  119  

Pour ces raisons, une migration par PFGE (Schwartz and Cantor, 1984) sur

l’ensemble des lignées d’O. mediterraneus, M. pusilla et B. prasinos a été réalisée

pour détecter ou non un changement de caryotype au cours des EAMs.

Parallèlement, nous avons testé la sensibilité des lignées d’O. mediterraneus

RCC2590 au virus d’O. mediterraneus, dit OmV0 (Yau et al., 2015).

Il est ressorti de ces deux tests que quatre lignées d’O. mediterraneus n’ont

pas le même caryotype que le type ancestral. Toutes les autres lignées, y compris

chez les autres espèces, n’ont pas changé de caryotype. Le résultat obtenu par

PFGE est présenté sur la Figure 3, avec une variation de la taille du chromosome

11. Aussi, les 4 lignées avec un caryotype modifié étaient sensibles au virus, alors

que toutes les autres et la souche témoin étaient résistantes au virus. Ce n’est

cependant qu’une corrélation, et les mécanismes moléculaires qui peuvent lier ces

deux observations ne sont pas connus.

Par ailleurs, nous ne savons pas si ces cellules constituent une sous-

population au sein de la souche O. mediterraneus RCC2590, caractérisée par une

variation au niveau du chromosome 11, ou si ces variations sont issues du

processus d’accumulation de mutations. Dans la seconde hypothèse, l’estimation du

taux de mutation caryotypique d’O. mediterraneus RCC2590 donne Uc=0.00046

mutations par génome par génération.

Pour tester cela, une expérience est réalisée avec différents clones de la

souche O. mediterraneus RCC2590 isolés par cytométrie en flux. Chaque clone est

mis en présence du virus OmV0. Dans le cas d’une lyse, le caryotype est vérifié par

PFGE. Suivant le résultat, il est possible d’estimer la part de la population de la

souche RCC2590 qui présente cette variation chromosomique, certainement

corrélée avec la résistance au virus OmV0. D’après cette expérience, il apparaît qu’il

y a bien une sous-population, environ 7% des cellules, qui présente cette

particularité caryotypique.

Le séquençage par la technologie PACBIO d’une lignée de chaque caryotype

a permis d’obtenir une meilleure précision dans l’assemblage de ce chromosome,

notamment par la mise en évidence d’une région répétée de 60kb dans la lignée

"#+!

résistante. Ces résultats sont inclus dans un manuscrit portant sur l’analyse du

génome d’O. mediterraneus RCC2590 (Yau et al., en préparation).

Figure 1. Migration PFGE des lignées issues de l’EAM d’O. mediterraneus.. Les numéros d’O.

mediterraneus en blanc sont des lignées identiques au type ancestral, et en en rouge apparaissent

les numéros des lignées qui présentent une variation de caryotype et une sensibilité au virus OmV0.

Les rectangles jaunes indiquent les variations de caryotype observées chez les lignées.

2. Les limites à l’estimation du taux de mutation

Différentes facteurs jouent un rôle dans la détermination du taux de mutation

et dans ses variations (Figure 2). Le taux de mutation est un compromis entre ces

facteurs, que sont la taille du génome et le coût de la réplication, la force de

sélection et de la dérive, ou encore le poids des mutations délétères entre autres.

Les hypothèses qui prédisent l’impact de chacun de ces facteurs sur le taux de

450

555

610

1 900

680

815

375

295

225

945

485

194

48.5

727.5

!"""""#""""$""""""%""""""&"""""""'"""""(""""")""""""*"

!" #"!"# !$#%&'("&))*+&,-#

$%" $%"

"#"!

mutation sont en partie issues des résultats des EAMs. Il est donc nécessaire de

discuter des biais éventuels qui existes avec ce type d’approche expérimentale.

Figure 2. Présentation des différents facteurs qui influencent le taux de mutation.

Premièrement, ces expériences sont réalisées en majorité sur des

organismes connus et maintenus depuis des années en laboratoire. Ces conditions

sont donc devenues des conditions optimales, auxquelles les modèles biologiques

utilisés ont pu s’adapter et dans lesquelles, à part pour certaines expériences

données, ils ne sont pas soumis à la compétition interspécifique, à un

environnement variable ou encore à une forte sélection (après un certain temps

d’adaptation au laboratoire). Prenons le cas des algues vertes dans le cadre des

EAMs chez les Mamiellophyceae: les cultures sont clonales (pas de compétition

avec une autre espèce), adaptées aux conditions du laboratoire (avec un cycle de

vie parfaitement constant depuis des années: lumière et température), dans un

milieu riche jamais limitant (pas de compétition pour la ressource) et sans prédation.

Bien qu’il n’y ait pas d’hyper-mutateurs connus chez les eucaryotes, le taux de

mutation peut varier en cas de stress (Jiang et al., 2014; Sharp and Agrawal, 2012).

Dans la nature, nous pouvons supposer que les espèces ne sont jamais soumises à

des conditions de laboratoire.

!

Mutations délétères MMR et TCR

Dérive Coût de la réplication Taille du génome

Selection Fidélité de le Polymerase

Distance au GC

équilibre

Mutations adaptatives

Coût de la réparation

Mutagènes extérieurs

  122  

En raison de ces arguments, il est raisonnable de s’interroger sur la

représentativité de ce type d’expérience par rapport au taux de mutation réel dans la

nature. Dans ce cas, davantage d’EAMs réalisées en conditions de stress pourraient

permettre de plus se rapprocher du taux de mutation réel dans la nature. Cela a été

fait avec Caenorhabditis elegans pour la température (Matsuba et al., 2013), mais il

serait intéressant de réaliser ce type d’expérience en condition de stress avec

d’autres espèces. Le taux de mutation peut donc aussi varier en fonction des

conditions expérimentales, expliquant une partie de la variation observée entre les

expériences sur un même organisme. Un article se focalise sur cette question

(Behringer and Hall, 2016), en étudiant les résultats d’EAMs indépendantes chez D.

melanogaster, A. thaliana, C. reinhardtii, C. elegans, S. pombe et S. cerevisiae. Il

apparaît un taux de mutation différent mais un spectre mutationnel statistiquement

identique (c’est à dire que les mêmes biais sont observés, par exemple le biais de

mutations de GC vers AT) chez S. pombe, C. elegans et D. melanogaster

(Behringer and Hall, 2015; Farlow et al., 2015).

Deuxièmement, le nombre de taux de mutation disponibles au niveau de

génomes complets sur des souches « sauvages » avec un nombre relativement

élevé de lignées est faible et non représentatif de l’arbre eucaryote. Il existe des taux

de mutation disponibles par EAMs pour cinq métazoaires et deux levures (tous des

Unikonta), sept Archeplastida (six algues vertes et Arabidopsis thaliana),

Dictyostelium discoideum, Paramecium tetraurelia et neuf bactéries. De plus, la

couverture des grands génomes est souvent inferieure à 80% (78% pour

Arabidopsis thaliana (Ossowski et al., 2010), 46% pour Heliconius (Keightley et al.,

2014b)). D’une manière générale, le taux de mutation n’est pas uniforme, et cela à

toutes les échelles, d’où l’importance d’une couverture la plus grande possible pour

estimer un taux de mutation à l’échelle d’un génome.

  123  

3. Perspectives pour les EAMs Les EAMs ont eu un rôle majeur pour permettre une meilleure compréhension

des mutations et de leurs effets. Ce travail de thèse est une contribution à ce sujet,

et expose les premiers protocoles utilisant la technique de la cytométrie en flux pour

réaliser des EAMs avec des espèces de pico-phytoplancton qui ne se développent

pas sur boite. Ce dernier point est important car les microorganismes ayant fait

l’objet de recherches par EAMs sont des organismes qui peuvent se développer sur

boite de Pétri, c’est-à-dire en milieu solide. C’est un confort expérimental par rapport

au milieu liquide, mais le nombre d’espèces candidates est limité.

Les nouveaux séquenceurs favorisent les nouvelles études portant sur les

taux de mutation, et il y a une augmentation du nombre de taux de mutation

disponibles par EAM. Néanmoins, des taxons majeurs ne sont pas représentés,

notamment les Straménopiles, les Dinobiontes, les Haptobiontes, les Excavates, les

Rhizarias ou encore l’intégralité des Archées (on parle ici de taux de mutation à

l’échelle d’un génome complet). Il est donc nécessaire d’explorer d’autres modèles

biologiques que ceux connus depuis des années en laboratoire.

Seule une amélioration significative du nombre d’espèces, en explorant

l’intégralité de l’arbre du vivant, apportera des éléments complémentaires sur les

facteurs biologiques et écologiques qui influencent le taux de mutation et ces

variations.

En effet, les conclusions sur les facteurs influençant les variations du taux de

mutation ont été tirées à partir de données obtenues chez les Archeplastida et les

Opistochontes. Les taux de mutation de Paramecium tetraurelia (Sung et al., 2012b)

et Dictyostellium discoideum (Saxer et al., 2012), éloignées de ces deux règnes

eucaryotes, sont justement des « points aberrants » (outliers) concernant, par

exemple, le rôle de la taille du génome.

  124  

Pour ces raisons, à la suite de ce travail de thèse, une sixième EAM a été

lancée sur une espèce modèle, Phaeodactylum tricornutum RCC2967

(Straménopiles,   Bacillariophycea, détails en Annexes), une diatomée dont le

génome est disponible et annoté (Bowler et al., 2008). Son génome fait 27.5 Mb

avec un GC de 48.8%. Dans le cas où l’expérience aboutirait (c’est à dire

conservation d’un nombre suffisants de lignées pour obtenir 8000 générations

indépendantes), ce serait le premier taux de mutation directement estimé sur une

espèce de Straménopiles. L’objectif est d’étendre les connaissances actuelles sur

les taux de mutation à d’autres modèles biologiques.

Le protocole de cette expérience est identique à celui décrit dans le chapitre

2, avec un suivi de 42 lignées qui seront séquencées au bout de ~200 générations

par lignée. Il existe d’autres espèces candidates intéressantes, mais il faut pour cela

un génome publié de bonne qualité, annoté et d’une espèce pour laquelle la

manipulation est la moins complexe possible. On peut par exemple citer

l’Haptobionte modèle Emiliania huxlei, même s’il y a des complications dans

l’assemblage du génome (Read et al., 2013).

Enfin, une dernière expérience est en projet pour étudier l’effet de la

température et du stress chez Picochlorum RCC4223. Cette souche est capable de

se développer jusqu’à 35°C. Une expérience en milieu standard à 20°C et une autre

à 30°C permettront de comparer les deux conditions. Une variation du taux de

mutation peut refléter un effet de la température ou du stress. 20 lignées dans

chaque condition seront suivies pendant 150 générations.

  125  

4. Conclusion générale

En conclusion, ce travail de thèse a permis l’estimation de 5 nouveaux taux de

mutations spontanées et fournit un nouveau génome d’algue verte assemblé et

annoté. Le nombre d’espèces ayant fait l’objet d’une estimation directe du taux de

mutation par EAMs était de 12 en début de thèse (septembre 2013), puis 25 en fin

de thèse (septembre 2016) en comptant les 5 algues vertes issues de ce travail. Ces

résultats ont permis de répondre en partie à la question de l’origine des variations du

taux de mutation à l’intérieur d’un génome et entre espèces.

Une méta-analyse confirme le rôle de la taille efficace et de la taille du génome

dans l’évolution du taux de mutation. Aussi, nous mettons en évidence l’impact de la

distance relative de la composition en GC du génome par rapport à l’équilibre dans

l’augmentation du taux de mutation.

D’une manière générale, cette contribution participe à résoudre la problématique

globale du rôle des mutations en évolution, et met en avant le rôle des expériences

d’accumulation de mutations dans les avancées faites par les biologistes sur les

questions qui entourent les mutations et l’adaptation.

Pour conclure, il est essentiel de développer des approches d’accumulation de

mutations sur un spectre plus large d’espèces. L’effet des mutations sur la fitness

est de mieux en mieux connu, de même que les spectres mutationnels chez les

modèles classiques en biologie. Il est crucial de s’orienter vers les nouveaux

modèles pour non seulement réévaluer les hypothèses existantes, mais aussi en

développer de nouvelles qui n’auraient peut-être pas émergé avec les

connaissances issues des modèles classiques.

       

  126  

                                                                                         

  127  

ANNEXES

                         

  128  

                                                               

                   

         

 Page 1 of 3  

 

L1  Medium  

Guillard  and  Hargraves  (1993)  -­‐  please  see  note  at  the  bottom  of  this  page  

This  enriched  seawater  medium  is  based  upon  f/2  medium  (Guillard  and  Ryther  1962)  but  has  additional  trace  metals.  It  is  a  general  purpose  marine  medium  for  growing  coastal  algae.  

To  prepare,  begin  with  950  mL  of  filtered  natural  seawater.  Add  the  quantity  of  each  component  as  indicated  below,  and  then  bring  the  final  volume  to  1  liter  using  filtered  natural  seawater.  The  trace  element  solution  and  vitamin  solutions  are  given  below.  Autoclave.  Final  pH  should  be  8.0  to  8.2.  

Component   Stock  Solution   Quantity   Molar  Concentration  in  Final  Medium  

NaNO3   75.00  g  L-­‐1  dH2O   1  mL   8.82  x  10-­‐4  M  NaH2PO4·  H2O   5.00  g  L-­‐1  dH2O   1  mL   3.62  x  10-­‐5  M  Na2SiO3  ·  9  H2O   30.00  g  L-­‐1  dH2O   1  mL   1.06  x  10-­‐4  M  trace  element  solution   (see  recipe  below)   1  mL   -­‐-­‐-­‐  vitamin  solution   (see  recipe  below)   0.5mL   -­‐-­‐-­‐  

L1  Trace  Element  Solution  

To  950  mL  dH2O  add  the  following  components  and  bring  final  volume  to  1  liter  with  dH2O.  Autoclave.  

   

 

 Page 2 of 3  

 

Component   Stock  Solution   Quantity   Molar  Concentration  in  Final  Medium  

Na2EDTA  ·  2H2O   -­‐-­‐-­‐   4.36  g   1.17  x  10-­‐5  M  FeCl3  ·  6H2O   -­‐-­‐-­‐   3.15  g   1.17  x  10-­‐5  M  MnCl2·4  H2O   178.10  g  L-­‐1  dH2O   1  mL   9.09  x  10-­‐7  M  ZnSO4  ·  7H2O   23.00  g  L-­‐1  dH2O   1  mL   8.00  x  10-­‐8  M  CoCl2  ·  6H2O   11.90  g  L-­‐1  dH2O   1  mL   5.00  x  10-­‐8  M  CuSO4  ·  5H2O   2.50  g  L-­‐1  dH2O   1  mL   1.00  x  10-­‐8  M  Na2MoO4  ·  2H2O   19.9  g  L-­‐1  dH2O   1  mL   8.22  x  10-­‐8  M  H2SeO3   1.29  g  L-­‐1  dH2O   1  mL   1.00  x  10-­‐8  M  NiSO4  ·  6H2O   2.63  g  L-­‐1  dH2O   1  mL   1.00  x  10-­‐8  M  Na3VO4   1.84  g  L-­‐1  dH2O   1  mL   1.00  x  10-­‐8  M  K2CrO4   1.94  g  L-­‐1  dH2O   1  mL   1.00  x  10-­‐8  M  

f/2  Vitamin  Solution  

(Guillard  and  Ryther  1962,  Guillard  1975)  

First,  prepare  primary  stock  solutions.  To  prepare  final  vitamin  solution,  begin  with  950  mL  of  dH2O,  dissolve  the  thiamine,  add  the  amounts  of  the  primary  stocks  as  indicated  in  the  quantity  column  below,  and  bring  final  volume  to  1  liter  with  dH2O.  At  the  NCMA  we  autoclave  to  sterilize.  Store  in  refrigerator  or  freezer.  

Component   Primary  Stock  Solution  

Quantity   Molar  Concentration  in  Final  Medium  

thiamine  ·  HCl  (vit.  B1)   -­‐-­‐-­‐   200  mg   2.96  x  10-­‐7  M  biotin  (vit.  H)   0.1g  L-­‐1  dH2O   10  mL   2.05  x  10-­‐9  M  cyanocobalamin  (vit.  B12)   1.0  g  L-­‐1dH2O   1  mL   3.69  x  10-­‐10  M  

   

ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION

Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org

RCC 4221Ostreococcus

tauri

STATUSStatus: DistributedCryopreserved:

IDENTITYClass: MamiellophyceaeOrder: MamiellalesEcotype:Strain name: BCC145000Other names: La Reine (from BCC1000, RCC745)

ORIGINOcean origin: Mediterranean SeaRegion of origin: Thau lagoonCountry of origin: FranceCruise:Isolation station:Isolation depth: 0 mGPS position: +42° 24', +3° 36'Isolation Date: 3/5/1995 00:00:00Isolator: Courties

CULTURESize: 1.0 µmCell shape: CoccoidCell assemblage:Growth medium: L1Growth light: 100 µEinGrowth temperature: 20.0°CRemarks: Clonal cultures obtained from RCC745. Replaces RCC745

RCC 4221

STATUSStatus: DistributedCryopreserved:

IDENTITYClass:Order:Ecotype:Strain name:Other names:

ORIGINOcean origin:Region of origin:Country of origin:Cruise:Isolation station:Isolation depth:GPS position: n/aIsolation Date:Isolator:

CULTURESize:Cell shape:Cell assemblage:Growth medium:Growth light:Growth temperature:Remarks:

ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION

Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org

RCC 2590Ostreococcusmediterraneus

STATUSStatus: DistributedCryopreserved:

IDENTITYClass: MamiellophyceaeOrder: MamiellalesEcotype: clade DStrain name: P_4-03_1Other names: BCC 102000

ORIGINOcean origin: Mediterranean SeaRegion of origin: Gulf of LionCountry of origin: FranceCruise:Isolation station:Isolation depth: 1 mGPS position: +43° 24', +3° 36'Isolation Date: 23/3/2009 00:00:00Isolator: Stephanie Michely

CULTURESize: 1.0 µmCell shape: coccoidCell assemblage:Growth medium: KGrowth light: 100 µEinGrowth temperature: 20.0°CRemarks:

RCC 2590

STATUSStatus: DistributedCryopreserved:

IDENTITYClass:Order:Ecotype:Strain name:Other names:

ORIGINOcean origin:Region of origin:Country of origin:Cruise:Isolation station:Isolation depth:GPS position: n/aIsolation Date:Isolator:

CULTURESize:Cell shape:Cell assemblage:Growth medium:Growth light:Growth temperature:Remarks:

ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION

Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org

RCC 1105Bathycoccus

prasinos

STATUSStatus: DistributedCryopreserved:

IDENTITYClass: MamiellophyceaeOrder: MamiellalesEcotype:Strain name: BBan7Other names: BCC4000

ORIGINOcean origin: Mediterranean SeaRegion of origin: Gulf of LionCountry of origin: FranceCruise:Isolation station: Banyuls Bay, SOLAIsolation depth: 0 mGPS position: +42° 27', +3° 32'Isolation Date: 1/1/2006 00:00:00Isolator: N.Grimsley

CULTURESize:Cell shape:Cell assemblage:Growth medium: KGrowth light: 100 µEinGrowth temperature: 20.0°CRemarks: The strain deposited at RCC appears to be Ostreococcus. We do not know when the contaminationoccured. The Banyuls lab has recloned the culture from a cryopreserved aliquot (RCC4222) that can be ordered.

ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION

Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org

RCC 299Micromonas

pusilla

STATUSStatus: DistributedCryopreserved:

IDENTITYClass: MamiellophyceaeOrder: MamiellalesEcotype: clade AStrain name: NOUM17Other names: NOUM97017, NIES-2672

ORIGINOcean origin: Pacific OceanRegion of origin: Equatorial PacificCountry of origin:Cruise: EbeneIsolation station:Isolation depth: 0 mGPS position: -22° 20', +166° 20'Isolation Date: 10/2/1998 00:00:00Isolator: Boulben S.

CULTURESize: 2.0 µmCell shape: flagellateCell assemblage:Growth medium: KGrowth light: 100 µEinGrowth temperature: 20.0°CRemarks: The clonal version of this strain is RCC 827. We recommend that you RCC 827 rather than RCC 299.

ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION

Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org

RCC 4223Picochlorum

sp

STATUSStatus: DistributedCryopreserved:

IDENTITYClass: TrebouxiophyceaeOrder: ChlorellalesEcotype:Strain name: BCC143000Other names: 10M2F12

ORIGINOcean origin: Mediterranean SeaRegion of origin: Gulf of LionCountry of origin: FranceCruise:Isolation station:Isolation depth: 0 mGPS position: +42° 32', +2° 59'Isolation Date: 11/8/2011 00:00:00Isolator: Subirana

CULTURESize: 1.0 µmCell shape: coccoidCell assemblage:Growth medium: L1Growth light: 100 µEinGrowth temperature: 20.0°CRemarks:

Genome sequence is currently done in the Banyuls Lab.

RCC 4223

STATUSStatus: DistributedCryopreserved:

IDENTITYClass:Order:Ecotype:Strain name:Other names:

ORIGINOcean origin:Region of origin:Country of origin:Cruise:Isolation station:Isolation depth:GPS position: n/aIsolation Date:Isolator:

CULTURESize:Cell shape:Cell assemblage:Growth medium:Growth light:Growth temperature:Remarks:

ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION

Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org

RCC 2967Phaeodactylum

tricornutum

STATUSStatus: DistributedCryopreserved:

IDENTITYClass: BacillariophyceaeOrder: NaviculalesEcotype:Strain name: Pt1_8.6Other names: CCAP 1055/1, Pt Gen,COUGH, CCMP632

ORIGINOcean origin: Atlantic OceanRegion of origin: BlackpoolCountry of origin: UKCruise:Isolation station:Isolation depth: 0 mGPS position: +54° 0', -4° 0'Isolation Date:Isolator:

CULTURESize: 10.0 µmCell shape: fusiformCell assemblage:Growth medium: F/2Growth light: 100 µEinGrowth temperature: 20.0°CRemarks:

Strain has been fully described in De Martino et al (2007) J Phycol 43: 992-109. Its genome has been sequencedin Bowler, C., Allen, A.E., Badger, J.H., Grimwood, J., Jabbari, K., Kuo, A., Maheswari, U. et al. 2008. ThePhaeodactylum genome reveals the evolutionary history of diatom genomes. Nature. 456:239-44.

  137  

CHAPITRE 2          Table S1. Normalized Gr from Micromonas pusilla MA lines that survived since the beginning to the end of the mutation accumulation experiment, at each

bottleneck, from 14 to 302 days. Gtot is the total number of generations of the MA line, and p-value the result of linear correlation test to detect an increase or

a decrease of fitness using normalised data. We could not normalize the MA growth rates for days 70 and 98 because the control lines did not grow, but

bottlenecks have been performed.

Line 14 28 42 56 84 112 126 140 154 168 182 196 210 224 245 260 274 288 302 Gtot P-value

1 0.90 1.26 1.02 1.16 1.25 1.33 1.01 1.08 1.05 0.95 1.14 1.07 0.99 1.01 1.19 1.01 1.02 1.00 0.96 275 NS 2 1.00 1.09 1.21 0.97 1.46 1.4 1.02 1.04 1.08 1.12 0.98 1.01 0.93 1.13 1.15 0.92 1.00 1.05 1.15 277 NS 3 1.08 1.13 1.01 0.92 1.23 1.34 0.99 1.1 1.04 1.35 0.95 1.08 0.98 1.00 1.10 1.10 1.09 1.00 1.21 284 NS 4 0.88 1.27 1.01 0.96 1.25 1.53 0.97 1.17 0.95 1.24 1.00 1.13 0.75 1.2 1.01 1.01 0.95 0.80 0.99 261 NS 5 0.94 1.02 1.14 0.90 1.24 1.21 1.14 0.86 0.94 0.96 0.83 1.15 0.81 1.18 0.99 0.87 1.01 0.93 1.13 247 NS 6 0.96 1.09 1.14 1.00 1.25 1.46 1.02 1.10 0.91 1.32 1.01 1.17 0.98 1.12 1.21 0.95 1.01 0.94 1.21 280 NS 7 0.91 1.28 1.04 1.12 1.38 1.33 1.02 1.16 0.99 1.34 0.90 1.08 0.97 1.06 1.22 1.09 0.95 0.91 1.22 285 NS

               

  138  

Table S2. Normalized Gr from Ostreococcus mediterraneus MA lines that survived since the beginning to the end of the mutation accumulation experiment,

from 14 to 294 days. Gtot is the total number of generations of the MA line, and p-value the result of linear correlation test to detect an increase or a decrease

of fitness using normalised data.

Line 14 28 42 56 70 84 98 112 126 140 154 168 182 196 210 224 238 252 266 280 294 Gtot P-value 1 1.12 0.98 1.07 1.01 1.07 0.98 1.06 1.13 1.04 1.04 0.91 1.04 1.12 1.00 0.95 0.89 1.11 1.00 1.05 1.03 0.98 287 NS 2 1.12 1.12 1.09 1.06 0.98 1.06 0.99 1.10 0.87 1.01 1.00 1.00 1.06 1.04 0.96 0.92 1.07 0.96 0.98 0.97 0.96 280 NS 3 0.99 0.96 0.99 0.98 0.85 1.12 0.89 0.95 0.91 0.95 0.88 0.98 1.12 0.89 0.90 1.03 0.91 0.97 1.10 0.94 0.95 252 NS 4 0.95 1.07 0.95 1.13 1.06 1.00 0.97 1.02 0.99 1.04 0.95 1.10 1.12 0.88 1.03 0.98 1.02 1.06 1.16 1.00 1.12 288 NS 5 0.90 0.93 1.06 0.85 1.22 0.91 1.00 0.90 0.97 1.12 1.05 1.04 1.09 1.01 0.99 1.05 1.01 0.97 1.03 0.93 0.86 268 NS 6 0.93 0.99 0.98 0.91 1.02 0.95 1.15 0.93 0.86 0.98 1.12 1.02 1.04 1.01 0.97 1.09 0.96 1.11 1.02 0.99 0.95 271 NS 7 1.05 0.95 1.04 0.91 0.97 0.94 1.07 1.13 0.87 0.99 0.98 1.00 1.07 0.93 0.97 0.97 1.06 1.15 0.94 0.97 1.00 271 NS 8 0.90 0.96 0.84 0.92 0.91 0.86 1.05 0.98 1.03 0.98 1.07 1.11 0.96 1.23 0.97 1.14 0.93 0.93 1.01 1.03 1.15 271 increase* 9 1.05 0.94 0.97 1.09 0.98 1.14 0.96 0.92 1.09 1.03 0.99 0.91 1.09 0.95 0.99 1.05 1.11 0.97 1.06 1.00 0.96 278 NS 10 1.00 1.10 1.03 0.92 1.06 0.98 0.96 1.01 0.91 1.07 0.94 0.91 1.02 1.03 0.98 0.91 0.99 0.92 0.92 1.06 0.92 262 NS 11 0.93 1.04 0.93 1.06 1.08 0.97 1.00 1.10 1.07 0.93 1.02 1.06 0.85 1.18 0.98 0.96 0.88 1.10 0.90 0.93 1.01 270 NS 12 0.95 0.99 1.01 0.99 1.03 0.98 0.93 1.01 0.95 1.08 0.89 1.03 0.97 1.01 0.92 1.03 1.00 0.92 1.02 0.86 0.99 260 NS 13 1.03 0.96 1.09 0.97 0.89 1.13 0.89 1.07 0.93 1.02 0.84 0.99 1.05 0.95 1.11 0.95 1.05 1.02 0.95 0.93 1.04 267 NS 14 1.10 0.96 1.02 0.92 1.11 0.91 0.93 1.20 0.89 0.96 1.08 1.00 0.98 0.95 1.08 0.97 1.02 1.15 1.00 1.06 0.94 277 NS 15 0.94 0.92 0.92 1.01 0.95 1.01 1.03 0.89 1.00 0.97 0.90 1.04 1.04 0.90 1.10 0.86 1.11 0.87 0.90 1.13 1.02 259 NS 16 1.00 0.88 0.99 0.99 0.86 1.02 1.15 0.94 0.91 1.16 0.88 1.00 0.95 1.09 1.08 1.11 0.96 1.15 0.94 1.14 0.94 276 NS 17 0.93 0.98 0.94 1.12 0.92 0.97 1.06 0.88 1.08 0.97 1.08 1.09 1.02 1.02 1.03 1.09 1.11 1.00 1.03 1.14 0.96 284 NS 18 0.97 1.00 0.92 1.17 0.97 0.94 0.97 0.98 0.93 1.01 1.02 0.89 1.14 0.84 1.02 0.95 0.95 1.00 0.93 1.05 0.99 262 NS 19 1.03 1.04 0.99 1.02 1.00 1.07 1.03 1.04 1.02 0.97 0.98 1.05 0.98 0.96 1.03 0.98 0.97 0.96 1.05 1.06 1.13 281 NS 20 0.94 1.02 1.03 0.92 1.16 1.04 1.05 0.96 1.13 0.98 1.10 1.05 0.95 1.18 0.93 1.23 0.98 1.12 1.08 0.96 1.04 295 NS 21 0.99 1.00 0.86 1.09 0.92 1.02 0.91 0.93 1.23 0.95 0.91 1.02 0.88 1.06 0.93 1.09 0.88 0.89 1.05 1.04 1.07 264 NS 22 0.95 1.09 1.01 0.96 1.04 1.08 0.94 1.02 0.96 1.00 1.05 1.06 0.88 1.01 0.95 1.02 0.87 1.14 0.90 1.11 1.04 273 NS 23 0.94 1.08 1.12 1.06 1.06 0.95 0.95 0.86 1.00 0.94 1.11 1.00 1.09 0.92 1.07 0.95 1.01 0.92 1.06 0.94 1.11 275 NS 24 1.04 1.04 1.01 1.01 1.08 0.91 0.91 0.91 1.20 0.92 0.98 0.97 0.96 0.95 1.05 0.94 1.01 0.99 1.07 1.01 0.96 269 NS

  139  

   Table S3. Normalized Gr from Bathycoccus prasinos MA lines that survived since the beginning to the end of the mutation accumulation experiment, at each

bottleneck, from 14 to 224 days. Gtot is the total number of generations of the MA line, and p-value the result of linear correlation test to detect an increase or

a decrease of fitness using normalised data.

Lines 14 28 42 56 70 84 98 112 126 140 154 168 182 196 210 224 Gtot P-value

1 0.95 1.25 1.05 1.10 0.97 1.00 1.06 1.07 1.45 0.96 0.89 1.06 1.16 1.00 1.15 1.06 258 NS 2 1.08 1.30 0.95 1.13 1.11 1.18 1.02 1.11 1.38 0.92 0.91 1.02 1.18 0.91 1.20 1.11 269 NS 3 1.03 1.25 0.85 1.17 1.22 1.05 1.19 1.02 1.56 0.93 0.90 0.91 1.14 1.17 1.07 0.91 264 NS 4 1.04 1.12 1.04 0.97 1.01 1.15 1.02 0.79 1.26 0.98 1.05 1.04 1.19 1.15 1.14 0.92 251 NS 5 1.09 1.03 1.13 1.18 1.23 1.35 1.04 0.96 1.41 0.85 1.02 0.93 1.09 0.99 0.89 1.05 262 NS 6 1.04 1.19 0.98 1.18 1.21 1.00 1.06 0.97 1.40 1.02 0.90 0.87 1.20 1.02 1.06 1.06 259 NS 7 1.13 1.12 1.28 1.10 1.12 0.95 1.23 1.13 1.40 0.92 1.05 1.19 1.30 1.22 1.39 0.96 296 NS 8 1.02 1.13 1.10 1.00 1.24 1.12 1.14 1.14 1.34 0.95 1.14 0.80 1.24 1.05 1.04 0.86 263 NS

                       

  140  

Table S4. Normalized Gr from Ostreococcus tauri MA lines that survived since the beginning to the end of the mutation accumulation experiment, at each

bottleneck, from 140 to 378 days. Gtot is the total number of generations of the MA line, and p-value the result of linear correlation test to detect an increase or

a decrease of fitness using normalised data. For O. tauri, however, there were two exceptions in bottleneck time: one at 11 days, and one after 18 days (Ne=

9.5 for this data point).

Lines 140 151 165 179 192 224 238 252 266 280 294 308 322 336 350 364 378 Gtot P-value 1 1.16 1.12 1.42 1.13 1.21 1.28 1.21 1.20 1.29 1.31 1.13 1.15 1.01 1.03 1.31 1.12 1.10 519 NS 2 1.19 1.26 1.34 1.12 1.27 1.19 1.24 1.21 1.36 1.26 1.15 1.07 1.03 1.17 1.29 1.12 1.16 526 NS 3 1.10 1.39 1.23 1.23 1.16 1.24 1.07 1.15 1.33 1.21 1.10 1.11 0.93 1.11 1.35 1.11 1.21 515 NS 4 1.16 1.21 1.18 1.26 1.20 1.23 1.05 1.23 1.23 1.23 1.17 0.99 1.09 1.09 1.33 1.05 1.08 492 NS 5 1.23 1.31 1.18 1.16 1.14 1.2 1.07 1.23 1.34 1.21 1.18 1.11 1.05 1.07 1.28 1.12 1.08 503 NS 6 1.08 1.31 1.22 1.19 1.21 1.21 1.09 1.26 1.19 1.23 1.27 1.07 1.01 1.08 1.21 1.10 1.13 514 NS 7 1.18 1.6 1.31 1.24 1.17 1.24 1.14 1.18 1.37 1.23 1.21 1.05 1.02 1.12 1.22 1.21 1.06 521 decrease* 8 1.14 1.35 1.29 1.26 1.27 1.34 1.00 1.29 1.3 1.18 1.15 0.95 1.00 1.10 1.23 1.13 1.1 517 decrease* 9 1.22 1.29 1.22 1.29 1.20 1.25 1.07 1.13 1.2 1.26 1.18 1.17 1.02 1.12 1.14 1.21 1.04 509 NS 10 1.09 1.42 1.22 1.15 1.19 1.24 1.25 1.07 1.23 1.34 1.09 1.07 0.93 1.23 1.25 1.19 1.1 526 NS 11 1.18 1.33 1.24 1.16 1.18 1.18 1.16 1.19 1.18 1.32 1.14 1.18 0.99 1.21 1.27 1.2 1.14 525 NS 12 1.19 1.17 1.21 1.18 1.11 1.16 1.16 1.14 1.18 1.33 1.02 1.14 0.87 1.13 1.15 1.23 1.12 498 NS 13 1.19 1.30 1.18 1.12 1.16 1.23 1.13 1.28 1.27 1.25 1.12 1.01 1.04 1.11 1.09 1.23 1.17 511 NS 14 1.11 1.40 1.14 1.22 1.26 1.34 1.16 1.14 1.18 1.36 1.20 1.02 0.99 1.26 1.09 1.18 1.30 526 NS 15 1.08 1.27 1.19 1.22 1.22 1.21 1.16 1.12 1.28 1.3 1.03 0.97 0.98 1.19 1.08 1.26 1.24 498 NS 16 1.19 1.30 1.17 1.27 1.25 1.24 1.08 1.17 1.28 1.16 1.10 0.97 1.00 1.14 1.13 1.28 1.20 520 NS 17 1.18 1.3 1.17 1.25 1.26 1.31 1.11 1.20 1.30 1.12 1.21 1.03 0.95 1.16 1.07 1.33 1.14 511 NS 18 1.18 1.64 1.4 1.24 1.18 1.2 1.22 1.17 1.32 1.12 1.09 1.09 1.03 1.14 1.19 1.20 1.16 521 decrease* 19 1.12 1.28 1.34 1.3 1.24 1.3 1.13 1.23 1.30 1.23 0.99 1.00 1.05 1.15 1.16 1.12 1.14 507 decrease* 20 1.05 1.23 1.40 1.22 1.27 1.21 1.07 1.17 1.35 1.20 1.07 1.01 1.03 1.16 1.15 1.17 1.09 505 NS 21 1.03 1.30 1.31 1.16 1.23 1.27 1.14 1.21 1.16 1.17 1.08 1.03 1.05 1.22 1.00 1.28 1.17 500 NS

 

  141  

 Table S5. Average of G of MA lines and control of Micromonas pusilla for each environmental test. P-value column indicates the result of the pairwise test to

compare MA lines fitness with the control (NS p-value non significant, * p-value significant at 5%, ** p-value significant at 1%, *** p-value significant at 0.1%).

Line 1 2 3 4 5 Control Irgarol 1 µg.L-1 0.98 0.97 0.52*** 0.78*** 0.37*** 1.08 Diuron 10 µg.L-1 1.08 0.96** 0.93** 1.06 0.89*** 1.05 Salinity 5 g.L-1 0.98 0.80 1.01 0.95 1.03 0.83 Salinity 20 g.L-1 1.64** 1.52*** 1.69** 1.55*** 1.73 1.80 Salinity 35 g.L-1 1.66 1.54** 1.72 1.60 1.79** 1.65 Salinity 55 g.L-1 1.51** 1.46** 1.64** 1.49** 1.66** 1.35 Salinity 65 g.L-1 1.24*** 1.05*** 1.26*** 1.10*** 1.23*** 0.84  

Table S6. Average of G of MA lines and control of Bathycoccus prasinos for each environmental test. P-value column indicates the result of the pairwise test

to compare MA lines fitness with the control (NS p-value non significant, * p-value significant at 5%, ** p-value significant at 1%, *** p-value significant at

0.1%).

Line 1 2 3 4 5 6 7 8 Control Irgarol 1 µg.L-1 1.00 0.74*** 1.00 0.88 1.67*** 0.74*** 1.04 1.46*** 0.97 Diuron 10 µg.L-1 0.60 0.52 0.55 0.68 1.08*** 0.47 0.57 0.65 0.52 Salinity 5 g.L-1 1.42*** 1.41*** 1.25*** 0.82 1.13** 1.48*** 1.51*** 0.69 0.72 Salinity 20 g.L-1 2.22** 2.33** 2.15** 1.70** 2.30** 2.36** 2.32** 2.20** 1.93 Salinity 35 g.L-1 2.05 2.03 1.99 1.86** 2.05 2.14 2.08 2.21 2.23 Salinity 55 g.L-1 1.72 1.76 1.56 1.56 1.62 1.70 1.79 1.57 1.88 Salinity 65 g.L-1 1.04** 1.08** 0.81 0.84 0.98 1.14** 1.10** 0.64 0.86

  142  

Table S7. Average of G of MA lines and control of Ostreococcus mediterraneus for each environmental test. P-value column indicates the result of the

pairwise test to compare MA lines fitness with the control, (NS p-value non significant, * p-value significant at 5%, ** p-value significant at 1%, *** p-value

significant at 0.1%).

Line 1 2 3 4 5 6 7 8 9 Control Irgarol 1 µg.L-1 1.07*** 1.06*** 1.04*** 0.86 0.95 0.78** 0.67*** 0.82 0.73*** 0.89

Diuron 10 µg.L-1 0.87** 0.98 0.92 0.9 0.93 0.91 0.95 0.88** 0.88** 0.96 Salinity 5 g.L-1 1.87 1.83 1.88 1.93 1.90 1.68*** 1.60*** 1.93 1.66*** 1.86

Salinity 20 g.L-1 1.97 2.07 2.08 2.10 2.04 1.79* 1.75* 2.11 2.00 2.00 Salinity 35 g.L-1 1.86 1.80 1.94 1.93 1.71 1.63** 1.65** 1.90 1.82 1.81 Salinity 55 g.L-1 1.34 1.28 1.62 1.46 1.59 1.21 1.54 1.29 1.36 1.49 Salinity 65 g.L-1 0.73*** 0.68*** 0.63*** 0.59*** 1.14 1.14 1.23 0.73*** 0.91*** 1.13

               

  143  

CHAPITRE 3

Table S1. Summary of mutation accumulation experiments. Ne is the average of effective population

size during the experiment (estimated using harmonic mean of cell number), and the total line is the

total sequenced lines at the end of the MA experiment. Total generation is the total of independent

generations obtained with all sequenced MA lines. T0 to Tf is the duration of the mutation

accumulation experiment since the inoculation of the MA lines to the DNA extraction. Gen. is

generation

Species Total

line Total gen

Mean gen per

MA line Ne T0 to Tf (days)

O. tauri RCC4221 40 17 250 431 8.5 378

O. mediterraneus RCC2590 37 8 379 235 7 294

M. pusilla RCC299 37 4 145 112 6 299

B. prasinos RCC1105 36 4994 139 8.5 224

Table S2. The part of the genome usable (G*) for mutations calling. G*min is the minimum and G*max

the maximum genome size.

Species G (Mb) G*average (%) G*min (%) G*max (%)

O. tauri RCC4221 13.03 12.60 (97.5) 11.82 (91.54) 12.84 (99.45)

O. mediterraneus RCC2590 13.48 13.10 (97.2) 12.28 (91.10) 13.35 (99.08)

B. prasinos RCC1105 15.07 15.02 (99.6) 14.66 (97.23) 15.03 (99.73)

M. pusilla RCC299 21.11 21.01 (99.5) 20.55 (97.36) 21.07 (99.79)

Table S3. Base-substitution mutations in O. tauri.

Chromosome Position Reference Mutation Effect

1 281349 T C Synonym coding

1 462543 T A -

1 462544 A T -

1 536352 G A -

1 688195 A G -

1 762227 A G Non synonym coding

1 764912 G A -

1 934994 C T Synonym coding

2 202377 C A Non synonym coding

2 744253 G A Synonym coding

2 759388 C T Non synonym coding

  144  

2 817108 C T Non synonym coding

2 820022 C A Non synonym coding

2 868393 G A Synonym coding

2 1070559 A G Non synonym coding

3 41080 C T Synonym coding

3 127716 G A Non synonym coding

3 210680 A G -

3 353325 C T Non synonym coding

3 379647 C T Non synonym coding

3 779548 T C Synonym coding

3 971494 C T Non synonym coding

4 117 C A -

4 366731 C T Synonym coding

4 524836 G A Non synonym coding

4 735752 C T Non synonym coding

5 5699 C T Non synonym coding

5 405535 G A Synonym coding

5 498490 T G Non synonym coding

5 600053 T A -

5 600056 G A -

5 658543 G A Non synonym coding

5 668815 C T Non synonym coding

6 12972 C T Non synonym coding

6 18960 C T -

6 46323 T G Non synonym coding

6 162319 T C Non synonym coding

6 334481 G C -

6 661927 C T -

6 716579 C T Non synonym coding

7 475871 A G Non synonym coding

7 612454 C T Synonym coding

7 702913 A C Non synonym coding

7 744212 G A Non synonym coding

8 66027 G A -

8 185592 G C -

9 31962 G A Non synonym coding

9 126121 C T Synonym coding

9 393218 C T Non synonym coding

9 398617 C T Synonym coding

9 514297 C T Non synonym coding

  145  

9 643568 A G Non synonym coding

10 108529 G A Non synonym coding

10 510428 C T Non synonym coding

10 562914 G A Synonym coding

10 587147 G A -

11 222249 A G -

11 446073 T C Synonym coding

11 452825 C A Non synonym coding

11 472590 G A Stop gained

11 474928 A G -

12 94 A G -

12 419488 C A Non synonym coding

12 460233 T G -

13 145936 G A Synonym coding

13 365169 C T Non synonym coding

13 496008 C T Non synonym coding

14 75583 G A Intron

14 210547 G A Non synonym coding

14 231150 G T -

14 257724 C A Non synonym coding

14 374547 G C Synonym coding

14 495621 G A Synonym coding

14 500741 C T Non synonym coding

15 165137 C T Non synonym coding

15 177872 G T Non synonym coding

15 352817 A G Synonym coding

16 460708 C T Synonym coding

16 325515 G T Synonym coding

16 521001 C T Non synonym coding

17 35411 T G Non synonym coding

17 410925 C T -

17 410926 G A -

17 410927 A G -

17 410928 C G -

18 122316 A G -

18 252024 T G -

18 345570 T G -

18 345641 G A -

20 49667 C T Non synonym coding

2 165267 T G -

  146  

Table S4. Base-substitution mutations in O. mediterraneus.

Chromosome Position Reference Mutation Effect 1 240410 T C Synonym coding 1 281668 A T Non synonym coding 1 384332 T C - 1 500961 T G - 1 504598 G A - 1 960787 G T Non synonym coding 2 783209 C A Synonym coding 3 168617 T G Non synonym coding 3 194253 A T Non synonym coding 4 4863 A G Non synonym coding 4 250707 T C - 4 271238 A G - 4 271242 G T - 4 271243 A G - 4 271249 A C - 4 271258 C T - 4 271264 G T - 5 204024 G A Non synonym coding 5 237455 G A Non synonym coding 5 369175 C T Non synonym coding 5 561353 C A Non synonym coding 6 167738 C T Non synonym coding 6 365873 C T Synonym coding 6 638629 C A Non synonym coding 7 136735 A C Non synonym coding 7 298488 C T Non synonym coding 8 59263 G A Non synonym coding 8 106639 G A Non synonym coding 8 165454 G A Synonym coding 8 246199 T C Non synonym coding 8 285631 G A Synonym coding 8 390757 T A Non synonym coding 8 425236 T G Non synonym coding 8 437922 G C Non synonym coding 8 699362 G A Synonym coding 9 552630 G T Non synonym coding 9 701807 A C Non synonym coding 9 717500 C A - 9 737678 G T Non synonym coding

10 165842 G A Non synonym coding 13 107450 T C Non synonym coding 13 162729 C T Synonym coding 13 586916 T C Non synonym coding

  147  

14 60175 T A Non synonym coding 14 60217 G A Non synonym coding 14 98081 A C Non synonym coding 15 112247 C A Start gained 16 222414 C T Synonym coding 16 297544 C T Synonym coding 17 368001 G T Non synonym coding 17 422490 C T - 18 272777 A G Non synonym coding 18 299852 A G Non synonym coding 19 81732 C G Non synonym coding

Table S5. Base-substitution mutations in B. prasinos.

Chromosome Position Reference Mutation Effect

1 42082 C A Non synonym coding

1 79489 C T Synonym coding

1 418914 T G Non synonym coding

1 1305044 G C Synonym coding

11 525583 C T Non synonym coding

12 50 T A -

12 122406 T C -

13 208600 T A Non synonym coding

17 72 G C -

18 999 C A Non synonym coding

18 235306 T G -

19 69819 A T -

19 145968 A T -

2 556426 G C Non synonym coding

4 135852 C T Synonym coding

4 531741 C G Non synonym coding

5 87328 C T Non synonym coding

5 145129 A T Intron

5 602981 C G Synonym coding

5 797176 A T Non synonym coding

8 574299 C A Non synonym coding

9 93038 C T Synonym coding

  148  

Table S6. Base-substitution mutations in M. pusilla.

Chromosome Position Reference Mutation Effect

1 101651 G T -

1 319728 T A -

1 319729 C A -

1 356850 G C Non synonym coding

1 868786 A G -

1 907594 A G -

1 989553 G A Non synonym coding

1 1166944 A G -

1 1311961 A G Non synonym coding

1 1328941 C T -

1 1480609 A C -

1 1531771 T C -

1 1771291 T C -

2 296 C T -

2 197240 G C Non synonym coding

2 318653 C G Non synonym coding

2 318654 A C Non synonym coding

2 318655 G C Non synonym coding

2 371001 G T Non synonym coding

2 629587 T G Non synonym coding

2 1231590 G A Synonym coding

2 1439488 C T Non synonym coding

2 1898300 G T Synonym coding

2 1898302 A C Non synonym coding

2 1898303 C A Non synonym coding

2 1898304 T A Non synonym coding

2 1898305 T C Synonym coding

3 1370371 C G Non synonym coding

3 1375097 G A Non synonym coding

3 1708043 C T Non synonym coding

4 3470 C A Synonym coding

4 334275 G A Synonym coding

4 571514 G A Non synonym coding

4 1224092 G A Synonym coding

5 486431 C A Synonym coding

5 508099 G C Synonym coding

5 556716 C G Non synonym coding

5 896616 C T -

  149  

5 1108981 G A Non synonym coding

6 1235633 G A Non synonym coding

7 570664 G T Non synonym coding

7 570665 A C Synonym coding

7 570666 G T Non synonym coding

7 672236 G A -

7 746112 G C Synonym coding

8 93285 G T Non synonym coding

8 273349 C T Non synonym coding

8 284318 G T Non synonym coding

8 303063 G A Synonym coding

8 310233 T A Non synonym coding

8 310234 G C Non synonym coding

8 1077655 G T Non synonym coding

9 1126769 A T Synonym coding

11 173723 G A -

11 430804 C T Non synonym coding

11 899300 A G Non synonym coding

11 899309 G A Non synonym coding

12 323466 T C Non synonym coding

12 797741 C T Synonym coding

12 823088 T G Non synonym coding

13 688257 C G Synonym coding

14 346000 G T Synonym coding

14 346390 G C Synonym coding

14 761603 G A Non synonym coding

15 146889 A T Non synonym coding

15 146890 T G Non synonym coding

15 320895 A G Synonym coding

15 408470 A C -

15 410306 C T Non synonym coding

15 504682 G T Non synonym coding

16 329517 C T Non synonym coding

  150  

Table S7. Insertions in the four species. Chromosome Position Reference Mutation Effect

Bathycoccus prasinos

2 102 A AC -

9 521140 A AAG -

13 570953 T TGCC Codons insertion

14 272 A ACC -

18 523 A AC -

Micromonas pusilla

1 319727 A AC -

2 378439 C CCG Frame shift

Ostreococcus tauri

4 76071 C CG -

10 455685 T TCGTCGG Codons insertion

15 109437 C CG -

17 226384 C CG -

20 153964 G GA -

Ostreococcus mediterraneus

1 384327 G ATT -

8 729406 C CA Frame shift

12 432782 C CTACTG -

Table S8. Deletions in the four species. Chromosome Position Reference Mutation Effect

Bathycoccus prasinos      

1 164711 AGGCGAGCAGTG A -

1 164726 AATTCAATTTCAATA A -

5 622569 GA G Frame shift

5 963834 AAATATCTATTG A -

14 329038 TG T -

Micromonas pusilla      

1 1787228 TTATTCCTTCGAAGCTTACGTACG T -

1 1924354 CA C Frame shift

1 319750 GTACCTTCGAAGGTATAA G -

3 214 CT C -

5 140463 CGCGAGACCTCG C Frame shift

6 1235612 AGGAGGAGGAGGGGGAGGAGGG A Codons

deletion

8 310219 CGATCTGCGTCCGGTG C Codons

deletion

10 1045182 GCGC G -

10 1160336 TCA T -

11 899291 ACAGACGGCACAGCTGGCG A Codons

deletion

14 474 AACCCTTCGT A -

  151  

16 287228 AACTCGAGTTGACAAGACC A -

Ostreococcus tauri      

1 601169 GA G -

6 46321 CT C Frame shift

8 273361 AAC A Frame shift

8 72783 GACACCCGCGTGTACGGGACCGCGACCC G -

11 222762 GA G Frame shift

12 403601 CGCGAGACCGGCGCACATCGCCGTCGTCGCCACCGTCGGAAACT C Frame shift

13 135 CA C -

17 87 CT C -

Ostreococcus mediterraneus      

6 284415 CG C Frame shift

7 156017 GT G -

7 1775 TGTTGCC T -

8 350046 CGTT C Codons

deletion

9 185017 CACGGCGACGACGAACGATGGCG C Frame shift

12 567140 TCG T Frame shift

12 328305 GT G -

13 112767 ATCTATCGTCGCGACGGCGGTCGTCTCTATG A Codons

deletion

Table S9: RNAseq coverage of exons and other sequences, in mutated and no mutated sites in B.

prasinos and O. tauri.

Species Sequence

types

N mutations Mutated site

coverages

Non-mutated

site coverages

P. value

Wilcoxon test

Bathycoccus prasinos Non-exons 13 247 646 0.0004

Exons 19 505 667 0.123

Ostreococcus tauri Non-exons 38 26 149 3.45-7

Exons 64 127 126 0.382

"&#!

Figure S1. The distribution of the base-substitution mutations. GC to AT bias in observed in the four

species, and is significant in O.tauri and M. pusilla.

1 2 3 4 5 6 7 8 9 10 11 12

510

2030

1 2 3 4 5 6 7 8 9 10 11 12

510

2030

1 2 3 4 5 6 7 8 9 10 11 12

510

2030

1 2 3 4 5 6 7 8 9 10 11 12

510

2030

G!A C!T T!C A!G C!G G!C G!T C!A T!G A!T A!C T!A

22

29

8 12

3 1 1 1

3 3 6

0 0 0 0

5 1

3 3 2 2

2

2 4

O. tauri

B. prasinos

O. mediterraneus

M. pusilla

13 10 10

4 4 7 7

4 3 3 2 5

10 9 6 6 5 4 3 1 1 2 2

Transversions Transitions

5

GC to AT > AT to GC (Binomial test,P-value=0.0001)

GC to AT > AT to GC (Binomial test,NS)

GC to AT > AT to GC (Binomial test,P-value=0.02)

GC to AT > AT to GC (Binomial test,NS)

  153  

Table S10. Spontaneous base-substitution mutation rates estimated by mutation accumulation

experiments in Bacteria and Eukaryotes. G is the genome size in Mb, µ is the mutation rate per

nucleotide and U is the number of mutations per genome per generation. The data from Ness in 2015

is the average of 6 strains. Effective population size come from Lynch supplementary material (Lynch,

2010a), excepted for Mus musculus (Phifer-Rixey et al., 2012), Heliconius melpomene (Keightley et

al., 2014b), Ficedula albicollis (Backström et al., 2013), Arabidopsis thaliana (Cao et al., 2011),

Caenorhabditis elegans (Cutter, 2006 ), Caenorhabditis briggsae (Cutter et al., 2006), Drosophila

melanogaster (Shapiro et al., 2007) and O. tauri (Blanc-Mathieu et al., in preparation). Ge is the

estimation of protein length sequences provided in ensembl.org website database.

Species G Ge µ U Ne References

Homo sapiens 3300.0 24.4 1.29E-08 38.5500 2.00E+04 (Lynch, 2010b)

Mus musculus 2700.0 24.3 5.40E-09 14.5800 2.00E+05 (Uchimura et al., 2015)

Ficedula albicollis 1100 26.1 4.60E-09 5.0600 4.50E+05 (Smeds et al., 2016)

Arabidopsis thaliana 134.4 45.0 7.00E-09 1.0990 2.50E+05 (Ossowski et al., 2010)

Caenorhabditis elegans 100.3 27.2 1.48E-09 0.1479 8.00E+04 (Denver et al., 2012)

Caenorhabditis briggsae 108.4 26.2 1.34E-09 0.1447 6.00E+04 (Denver et al.. 2012)

Pristionchus pacificus 133.1 25.3 2.00E-9 0.2663 - (Weller et al., 2014)

Drosophila melanogaster 148.0 21.2 5.49E-09 0.6698 1.15E+06 (Schrider et al., 2013)

Heliconius melpomene 273.8 17.9 2.90E-09 0.7940 2.00E+06 (Keightley et al., 2014b)

Ostreococcus tauri 13.0 10.6 4.19E-10 0.0054 9.60E+06 This study

Ostreococcus mediterraneus 13.5 11.4 4.92E-10 0.0065 - This study

Bathycoccus prasinos 15.1 12.5 3.07E-10 0.0046 - This study

Micromonas pusilla 21.1 17.3 8.15E-10 0.0172 - This study

Chlamydomonas reinhardtii 112.0 19.7 9.63E-10 0.1079 3.10E+07 (Ness et al., 2015b)

Saccharomyces cerevisiae 12.3 8.8 1.67E-10 0.0021 6.20E+06 (Zhu et al., 2014)

Schizoaccharomyces pombe 12.6 7.1 2.00E-10 0.0025 2.60E+06 (Farlow et al., 2015)

Paramecium tetraurelia 72.1 53.9 1.94E-11 0.0014 1.20E+08 (Sung et al., 2012b)

Dictyostelium discoideum 34.2 21.1 2.90E-11 0.0010 - (Saxer et al., 2012)

Bacillus subtilis 4.2 3.6 3.28E-10 0.0014 6.30E+07 (Sung et al., 2015)

Escherichia coli 4.6 4.1 2.20E-10 0.0010 1.80E+08 (Lee et al., 2012)

Mesoplasma florum 0.8 0.7 9.78E-09 0.0078 1.10E+06 (Sung et al., 2012a)

Burkholderia cenocepacia 7.7 6.8 1.33E-10 0.0010 - (Dillon et al., 2015)

Pseudomonas aeruginosa 6.6 6.0 7.92E-11 0.0005 2.00E+07 (Dettman et al., 2016)

Salmonella typhimurium 4.8 4.3 7.00E-10 0.0034 - (Lind and Andersson, 2008)

Mycobacterium tuberculosis 4.4 4.0 2.58E-10 0.0011 - (Ford et al., 2011)

Deinococcus radiodurans 3.2 2.9 4.99E-10 0.0016 - (Long et al., 2015a)

  154  

Table S11. Effect of GC gap from equilibrium in base substitution mutation rate. R1, R2, R3 and R3

were used to calculate the GCeq and the mutation rate at equilibrium µeq. The ratio µ/µeq permits to

estimate the elevation of the mutation rate due to the GC gap, i.e in O.tauri the mutation rate

increases by 11.8%.

Species µ GC GCeq GCr GC>AT relative

to AT>GC µ/µeq References

Homo sapiens 1.29E-08 0.420 0.323 1.301 2.098 1.081 (Lynch, 2010b)

Mus musculus 5.40E-09 0.424 0.207 2.051 3.842 1.295 (Uchimura et al., 2015)

Ficedula albicollis 4.60E-09 0.443 0.311 1.426 2.219 1.116 (Smeds et al., 2016)

Arabidopsis thaliana 7.00E-09 0.367 0.138 2.663 6.255 1.640 (Ossowski et al.. 2010)

Caenorhabditis elegans 1.48E-09 0.354 0.193 1.837 4.189 1.225 (Denver et al.. 2012)

Caenorhabditis briggsae 1.34E-09 0.377 0.211 1.784 3.732 1.227 (Denver et al.. 2012)

Pristionchus pacificus 2.00E-09 0.427 0.157 2.711 5.350 1.381 (Weller et al., 2014)

Drosophila melanogaster 5.49E-09 0.419 0.188 2.228 4.318 1.324 (Schrider et al., 2013)

Heliconius melpomene 2.90E-09 0.331 0.248 1.335 3.032 1.044 (Keightley et al., 2014b)

Ostreococcus tauri 4.19E-10 0.590 0.365 1.615 1.737 1.118 This study

Ostreococcus mediterraneus 3.73E-10 0.560 0.433 1.293 1.310 1.017 This study

Bathycoccus prasinos 3.07E-10 0.480 0.366 1.312 1.733 1.029 This study

Micromonas pusilla 8.15E-10 0.638 0.462 1.382 1.166 1.030 This study

Chlamydomonas reinhardtii 9.63E-10 0.619 0.259 2.392 2.864 1.428 (Ness et al., 2015)

Saccharomyces cerevisiae 1.67E-10 0.384 0.311 1.235 2.216 1.067 (Zhu et al., 2014)

Schizoaccharomyces pombe 2.00E-10 0.360 0.264 1.364 2.790 1.122 (Farlow et al., 2015)

Paramecium tetraurelia 1.94E-11 0.279 0.072 3.884 12.921 1.543 (Sung et al., 2012b)

Bacillus subtilis 3.28E-10 0.437 0.443 0.986 1.256 0.999 (Sung et al., 2015)

Escherichia coli 2.20E-10 0.506 0.450 1.124 1.222 1.010 (Lee et al., 2012)

Mesoplasma florum 9.78E-09 0.270 0.059 4.582 15.970 2.628 (Sung et al., 2012a)

Burkholderia cenocepacia 1.33E-10 0.669 0.551 1.213 0.814 0.978 (Dillon et al., 2015)

Pseudomonas aeruginosa 7.92E-11 0.662 0.396 1.671 1.524 1.083 (Dettman et al., 2016)

Salmonella typhimurium 7.00E-10 0.521 0.559 0.932 0.788 1.008 (Lind and Andersson, 2008)

Mycobacterium tuberculosis 2.58E-10 0.656 0.276 2.376 2.622 1.512 (Ford et al., 2011)

Deinococcus radiodurans 4.99E-10 0.668 0.643 1.039 0.555 0.983 (Long et al., 2015)

"&&!

Figure S2. Correlation between the strength of the GC bias (R1/R2) and the nucleotide mutation rate.

Mp is Mesoplasma florum and Pt is Paramecium tetraurelia. (n=23 excluding Pt and Mp, Pearson

correlation, P-value=0.002, "=0.61).

Figure S3. Mutational context of base-substitution mutations. Mutations occur at the last position of

the trinucleotides. This figure takes count of all mutations of the four species add together. Despite

some trinucleotides mutated more frequently as expected by chance, no significant bias is detected.

0 5 10 15

-11

-10

-9-8

-7

tab$R1R2

Log_

µ

Bacteria Unicellular Eukaryotes Mamiellophyceae Metazoans Arabidopsis

R1 (GC to AT) / R2 (AT to GC)

Mp

Pt

-11.

0

-10.

0

-9.0

-8.0

-

7.0

Log1

0 of

nuc

leot

ide

mut

atio

n ra

te (µ

)

0.0 5.0 10.0 15.0

24

68

1012

14

A T G C T

24

68

1012

14

G

24

68

1012

14

C

24

68

1012

14

A T C G A T G C A T G C A T G C A T G C

A T C G A T G C A T G C A T G C A T G C

A T C G A T G C A T G C A T G C A T G C

A T C G A T G C A T G C A T G C A T G C

Nucleotides context of mutations

Mutated site

  156  

CHAPITRE 4

Table S1. Draw statistical results from Pacbio RS II sequencing and polished step.

Job Metric Value

Polished Contigs 361

N50 Contig Length 244 124

Sum of Contig Lengths 21 260 393

Adapter Dimers (0-10bp) 0.02%

Short Inserts (11-100bp) 0.01%

Number of Bases 1 654 575 141

Number of Reads 266 217

N50 Read Length 10 870

Mean Read Length 6 215

Mean Read Score 0.85

Mapped Reads 237 383

Mapped Read Length of Insert 1 971

Average Reference Length 446,159

Average Reference Bases Called 100.0%

Average Reference Consensus Concordance 99.98%

Average Reference Coverage 69.94

Polymerase Read Quality 0.852

Table S2. Statistical best results from ABySS assembly with MiSeq reads (K=80 and n=10).

n n:200 n:N50 min N80 N50 N20 max sum

Unitigs 20 806 15 924 1 042 200 2 411 10 108 25 033 99 228 41.55e6

Contigs 19 925 15 327 902 200 2 534 11 210 29 270 189 496 41.62e6

Scaffolds 19 896 15 298 889 200 2 536 11 212 29 270 483 331 41.62e6

                 

  157  

Table S3. SGA results with MiSeq reads mappings in HGAP assembly.

Classified 140 vertices as unique (13.96 Mbp)

Classified 6 vertices as repeat (0.12 Mbp)

Classified 59 vertices as spurious (0.70 Mbp)

Constructed 81 scaffolds from 81 contigs

Total bases: 13.26Mbp

Max scaffold: 964 334 bp

N50 scaffold: 436 237 bp

Mean scaffold: 163 701 bp

Table S4. Total final genome assembly with the 64 contigs. The contig indicated Mt is the

mitochondria and the contig indicated Cl is the chloroplast.

Contig Size (kb) GC%

1 1793.9 46.4

2 1666.5 46.5

3 1505.7 46.4

4 965.3 46.4

5 764.1 46.5

6 691.2 46.4

10 664,0 46.6

7 651.1 46.3

8 588.1 46.6

12 578.9 46.5

9 564.2 46.6

13 475.2 46.9

14 361.5 47.1

16 349.9 47.9

11 349.1 46.3

15 260.0 46.7

18 227.8 46.9

17 225,0 47.5

29 186.6 43.5

19 178.3 46.3

22 94.6 46.4

27 93.3 47.3

20-Cl 78.2 31.9

30 75.5 40.1

92 47.9 36.9

  158  

101 45.8 36,0

21-Mt 42.9 41.0

24 40.2 51.7

103 39.2 44.9

104 39.1 34.9

111 37.8 35.5

105 37.5 36.4

128 35.0 34.9

114 33.3 44.7

117 28.2 35.1

23 28.1 44.6

130 27.2 35.8

39 27.0 39.8

25 24.7 47.7

40 23.7 38,0

132 21.9 35.1

165 20.6 35.7

41 20.1 60.8

151 19.0 34.6

28 18.2 47.9

26 16.6 44.7

190 16.5 34.7

138 15.2 35.2

42 14.9 45.0

174 14.2 30.9

169 13.7 34.8

43 13.5 57.3

31 12.8 45.9

44 12.7 61.0

180 12.7 40.9

195 12.7 37.1

181 12.3 34.3

208 12.1 37.3

45 11.9 62.7

202 11.5 36.0

199 11.0 35.7

32 10.7 54.6

206 10.7 35.7

46 10.5 46.0

  159  

CHAPITRE 6 Tableau A1. Mutations des lignées d’O. tauri qui montrent une baisse significative de fitness au cours

de l’expérience d’accumulation de mutations. Dans le cas de mutations inter-géniques, il est indiqué

les deux gènes adjacents.

Lignée Chromosome Position Effet de fitness Gene Annotation

12 3 210680 Inter génique Ostta03g01200

Ostta03g01210

Spermidine

spermine synthases family TPMT

family

12 5 5699 Non synonyme Ostta05g00040 FAD-dependent pyridine nucleotide

disulphide oxidoreductase

12 6 18960 Inter génique Ostta06g00060

Ostta06g00070

Helicase, C-terminal

NA

12 7 612454 Synonyme Ostta07g03740 transducin family protein

12 8 66027 Inter génique Ostta08g00400

ostta08g00410

Zinc finger, CCHC-type

Translation initiation factor 3 subunit D

35 3 353325 Non synonyme Ostta03g02180 Conserved oligomeric Golgi complex

35 10 510428 Non synonyme Ostta10g03080 Zinc finger, C2H2

36 1 688195 Inter génique Ostta01g04240

Ostta01g04250

NA

Methylase domain

36 11 452825 Non synonyme Ostta11g02480 Filamin/ABP280 repeat-like

36 13 365169 Non synonyme Ostta13g02140 tRNA/rRNA methyltransferase

Tableau A2. Délétions et insertions identifiées chez les lignées utilisées pour les essais de fitness.

Lignée Effet de fitness Gene Annotation

Micromonas pusilla        2 Inter génique Mipur14g00010 Polyribonucleotide nucleotidyltransferase

4 Inter génique Mipur01g07370 NA Mipur01g07380 Zinc finger, RING-type

4 Frame shift Mipur02g01650 SKI-interacting protein

5 Inter génique Mipur01g01440 Translation elongation factor Mipur01g01450 Small nuclear RNA activating complex

5 Inter génique Mipur01g01440 Translation elongation factor Mipur01g01450 Small nuclear RNA activating complex

Bathycoccus prasinos        4 insertion de codons Bathy13g02570 General substrate transporter

7 Inter génique Bathy05g04970 General substrate transporter Bathy05g04980 Dynein heavy chain

7 Inter génique Bathy18g00010 TonB-dependent receptor Bathy18g00020 ATP-binding cassette superfamily

Ostreococcus mediterraneus        3 Frame shift Ostme06g01720 Glycoside hydrolase catalytic domain

6 Inter génique Ostme12g03410 NA

  160  

Tableau A3. Substitutions identifiées chez les lignées utilisées pour les essais de fitness.

Lignée Effet de fitness Gene Annotation

Micromonas pusilla    

1 Inter génique Mipur01g06170 Tetratricopeptide-like helical

Mipur01g06160 NA

1 Inter génique Mipur02g00010 Protein binding

NA

1 Inter génique Mipur11g01020 Intracellular protein transport

Mipur11g01030 NA

2 Inter génique Mipur01g03700 Ribosomal protein L21

Mipur01g03710 Heme binding,Cytochrome b5,Fatty acid desaturase

4 Inter génique Mipur01g04900 Protein kinase,ransferase activity

Mipur01g04910 ATPase

4 Synonyme Mipur07g02835 Clusterin-associated protein-1

4 Non synonyme Mipur07g02835 Clusterin-associated protein-1

4 Non synonyme Mipur07g02835 Clusterin-associated protein-1

4 Non synonyme Mipur11g02270 Membrane,transferase activity

Transferring phosphorus-containing groups

4 Non synonyme Mipur15g02150 sulfotransferase activity

5 Inter génique Mipur01g01440 Translation elongation factor,Nucleic acid-binding

Mipur01g01450 Small nuclear RNA activating complex

5 Inter génique Mipur01g01440 Translation elongation factor,Nucleic acid-binding

Mipur01g01450 Small nuclear RNA activating complex

5 Non synonyme Mipur01g04180 SKI-interacting protein

5 Inter génique Mipur15g02130 Multidrug efflux transporter AcrB

Mipur15g02140 Methyltransferase FkbM

1-3 Non synonyme Mipur02g01500 Pectin lyase fold

1-3 Non synonyme Mipur02g01500 Immunoglobulin E-set

1-3 Non synonyme Mipur02g01500 Parallel beta-helix repeat

1-3 Non synonyme Mipur05g02350 Protein kinase, catalytic domain,transferase activity

Transferring phosphorus-containing groups

Bathycoccus prasinos  

1 Inter génique Bathy18g01200 RNA polymerase

Bathy18g01210 NA

2 Synonyme Bathy01g00480 Esterase, SGNH hydrolase-type, lipase

2 Inter génique Bathy12g00620 D-galacturonic acid reductase

3 Synonyme Bathy01g00250 NA

3 Inter génique Bathy05g00830 GTP cyclohydrolase II

Bathy05g00840 NA

3 Synonyme Bathy05g03350 ATP-dependent Clp protease proteolytic subunit

4 Non synonyme Bathy05g04130 DNA-binding

6 Non synonyme Bathy01g02250 NA

6 Non synonyme Bathy13g00710 ATP-dependent metalloprotease FtsH

7 Inter génique Bathy19g00710 NA

8 Inter génique Bathy12g00610 NA

Bathy12g00620 NA

  161  

Ostreococcus mediterraneus   1 Gain d’un start Ostme09g04340 NA

1 Non synonyme Ostme13g00630 Cation/H+ exchanger

2 Non synonyme Ostme05g02160 Cleavage/polyadenylation specificity factor

A subunit, C-terminal

3 Non synonyme Ostme05g01170 Myb domain, plants

3 Non synonyme Ostme05g01310 P-loop containing nucleoside triphosphate hydrolase

4 Non synonyme Ostme05g03160 P-loop containing nucleoside triphosphate hydrolase

5 Non synonyme Ostme07g00860 Steroid receptor RNA activator-protein

coat protein complex II, Sec31

5 Inter génique Ostme17g02510 Putative 5-3 exonuclease

Ostme17g02520 NA

7 Non synonyme Ostme01g01630 COMM domain

7 Non synonyme Ostme08g01390 Exonuclease, phage-type/RecB

8 Non synonyme Ostme09g04240 P-loop containing nucleoside triphosphate hydrolase

8 Non synonyme Ostme09g04420 Regulator of K+ conductance

9 Non synonyme Ostme01g05620 Acetyl-coenzyme A transporter 1

9 Synonyme Ostme13g01030 RNA recognition motif domain, eukaryote

 

     

Results

2.0

0.5 Salinity (g/l)

Cell division per day (G)

O . mediterraneus

Cell division per day (G)

Diuron 10 µg/l

Irgarol 1 µg/l

1.0 1.2 1.4 1.6 1.8 2.0

0.0

0.5

1.0

1.5

2.0

a

tab[

1, 2

]

1.0 1.2 1.4 1.6 1.8 2.0

0.0

0.5

1.0

1.5

2.0

a

tab[

3, 2

]

1.5

1.0

0

0.5

B. prasinos M. pusilla

1.5

1.0

5 20 35 50 65 5 20 50 65 1 2 3 4 5 6

0.5

1.0

1.5

2.0

2.5

a

tab[

11, 2

]

35 35

Lines with significant difference in fitness Controls (ancestral line) Lines MA experiment condition

Lines with significant

Controls (ancestral line) Lines

difference in fitness Controls (ancestral line)

O . mediterraneus

!!!!! !!!!!

10 µg/l

!!!!! !!!!!!!!!!

1.0 1.2 1.4 1.6 1.8 2.0

0.0

0.5

1.0

1.5

2.0

a

tab[

5, 2

]

!!!!!!!!!!

Salinity tests: - MA lines were less fit in stressful environment - ancestral type was never outcompeted by MA lines

Herbicide tests: - MA lines were equally, less or more fit depending on species

Marc Krasovec1, Gwenael Piganeau1, Adam Eyre-Walker2 ,Nigel Grimsley1, David Pecqueur3, Christophe Salmeron3, Elodie Desgranges1, Claire Hemon1, Sophie Sanchez-Ferandin1

1 Oceanological Observatory of Banyuls, UMR 7232, Banyuls-sur-mer, 66650, France 2 University of Sussex, Evolution Behaviour and Environment, United Kingdom

3 Oceanological Observatory of Banyuls, UMS 2348, Banyuls-sur-mer, 66650, France

What are the fitness effects of spontaneous mutations in picophytoplankton?

Biological models: Our picophytoplankton models (Ostreococcus mediterraneus, Micromonas pusilla and Bathycoccus prasinos) belong to the Mamiellophyceae class (Chlorophyta). They are the smallest free-living eukaryotes (1 !m) described to date(3). They possess a simple cellular organization with one mitochondrion, one chloroplast and a 13 to 20 Mbp haploid nuclear genome. The spontaneous mutation rate is the lower limit of the rate of adaptation and paramount for understanding the consequences of rapid environmental changes on these species.

Context: Mutations are the main source of diversity upon which natural selection can act(1). The study of mutation rates and their effects on fitness is fundamental to our understanding of evolution rates.

Mutation accumulation (MA) experiments(2) aim to estimate the effects of spontaneous mutations on fitness. We followed the evolution of fitness, measured as the growth rate between bottlenecks, in 40 to 60 lines (MA lines) from 3 strains passaged through serial bottlenecks during 200 to 400 days.

Number of MA lines assayed for fitness effects in stressful conditions

Species Number of lines Total number of generations

O. mediterraneus 9 300 M. pusilla 7 250 B. prasinos 8 250

Mutation Ancestral line n mutant

lines

T0 = one cell per well Cell count by

flow cytometer

How can we estimate the fitness effects of spontaneous mutations in eukaryotic picophytoplankton?

How does the fitness effects of mutations change in stressful environments? -! Salinity tests (5 to 65 g/l)

-! Herbicide tests (irgarol and diuron)

One cell bottleneck each 14 days

Conclusion: Taking the cell division per day as a proxy for fitness, the fitness of MA lines show little or no differences compared with ancestral line. In stressful environments, the difference fitness between MA lines was more striking, particularly for M. pusilla. We found evidence for changes in fitness effects of mutations in B. prasinos exposed to herbicides: where some MA lines outcompete the ancestral line. This study shows the importance of genotype/environment interactions to understand species adaptation. 1 Wright, S., 1932. The roles of mutation, inbreeding, crossbreeding, and selection in evolution. Proc. Sixth Int. Congr. Genet. 1, 356–366.

2 Halligan, D.L., Keightley, P.D., 2009. Spontaneous Mutation Accumulation Studies in Evolutionary Genetics.Annu. Rev. Ecol. Evol. Syst. 40, 151–172. 3 Courties, C., Vaquer, A., Troussellier, M., Lautier, J., Chrétiennot-Dinet, M.J., Neveux, J., Machado, C., Claustre, H., 1994. Smallest eukaryotic organism. Nature 370, 255–255. Funding: CNRS, UPMC Complexité du vivant and ANR SVSE6-0004 PHYTNESS

krasovec@obs-banyuls.fr

Summary of MA experiment results

!"#$%#&' ()*+,',%-#&' ()*+,'-./0#1')2'3#-#1+4)-&' 56+-3#'%-'7*-#&&'!!"#!$%&'(%))*+%,-! "#! $!###! %&!'&()*+,*-!./++)0*1/-2!

!!.#!/,-'00*! "#! 3!###! %&!'&()*+,*-!./++)0*1/-2!

!!1#!/)*-'+2-! 4#! 3!###! %&!'&()*+,*-!./++)0*1/-2!

There was no evidence for a variation in fitness in MA lines along the course of the experiment.

56!"#!$%&'(%))*+%,-7!86!.'3)2$2+*-!9(:7!;6!1*(453233,-!9(:!

A B C

!!

Salinity (g/l)

Salinity (g/l) 0.

00.

51.

01.

52.

02.

53.

0

0.5

1

1.5

0 M

ean

fitne

ss re

lativ

e to

th

e co

ntro

l 5 20 35 50 65

6 7 9

6 7

7 6

1 2 3 4 8

9

Results obtained from O. mediterraneus salinity stress

=> high variation in fitness between MA lines, strikingly, 5 MA lines outcompete control

M. pusilla B. prasinos

O. mediterraneus

Marc Krasovec1, Adam Eyre-Walker2 ,Nigel Grimsley1, David Pecqueur1, Christophe Salmeron1, Elodie Desgranges1, Claire Hemon1, Gwenael Piganeau1, Sophie Sanchez-Ferandin1

1 Oceanological Observatory of Banyuls, UMR 7232, Banyuls-sur-mer, 66650, France 2 University of Sussex, Evolution Behaviour and Environment, United Kingdom

What are the fitness effects of spontaneous mutations in picophytoplankton?

Biological models: Our picophytoplankton models (Ostreococcus mediterraneus, Micromonas pusilla and Bathycoccus prasinos) belong to the Mamiellophyceae family (Chlorophyta). They contain the smallest free-living eukaryotes (1 !m) described to date(3) and possess a simple cellular organization with one mitochondrion, one chloroplast and a 13 to 21 Mbp haploid nuclear genome. The spontaneous mutation rate sets the lower limit of the rate of adaptation and is crucial to understand the consequences of rapid environmental changes on these species.

Context: Mutations are the main source of diversity upon which natural selection can act(1). The study of mutation rates and their effects on fitness is fundamental to our understanding of evolution and adaptation rates.

Mutation accumulation (MA) experiments(2) allow the estimation of the fitness effects of spontaneous mutations. MA lines from 3 strains were subcultured through serial bottlenecks during 200 to 400 days to allow the segregation of spontaneous deleterious mutations. The growth rate between bottlenecks was taken as a proxy for fitness.

Mutation Ancestral line n mutant

lines

T0 = one cell per well

Cell count by flow cytometer

How can we estimate the fitness effects of spontaneous mutations in eukaryotic picophytoplankton?

Do the fitness effects of mutations change in stressful environments? -! Salinity tests (5 to 65 g/l)

-! Algicide tests (irgarol and diuron)

One cell bottleneck each 14 days

Conclusion: Taking the cell division per day as a proxy for fitness, the fitness of MA lines shows little differences compared with the control line. However fitness effects of mutations are revealed in stressful conditions. Considering that each significant fitness difference between the control and the MA lines might be result of at least one mutation, the minimum mutation rate is thus 2.72-10 mutations per nucleotide per generation for O. mediterraneus, 1.75-10 for M. pusilla and 2.52-10 for B. prasinos. This study also pinpoints the importance of genotype-environment interactions to understand species adaptation.

1 Wright, S., 1932. The roles of mutation, inbreeding, crossbreeding, and selection in evolution. Proc. Sixth Int. Congr. Genet. 1, 356–366. 2 Halligan, D.L., Keightley, P.D., 2009. Spontaneous Mutation Accumulation Studies in Evolutionary Genetics.Annu. Rev. Ecol. Evol. Syst. 40, 151–172. 3 Courties, C., Vaquer, A., Troussellier, M., Lautier, J., Chrétiennot-Dinet, M.J., Neveux, J., Machado, C., Claustre, H., 1994. Smallest eukaryotic organism. Nature 370, 255–255. Funding: CNRS, UPMC Complexité du vivant and ANR SVSE6-0004 PHYTNESS

krasovec@obs-banyuls.fr

=> There is little evidence for variation in fitness in MA lines along the course of the experiment : 5 MA lines decrease, 1 increase.

"#!!"#$%&'(%))*+%,-$!%#!.'/)0$0+*-!&'($!)#!1*(23/0//,-#&'(!

A B C

Species Number of lines

Average generations Ne T0 to Tf (days)

O. tauri RCC4221 21 512 8 378 O. mediterraneus RCC2590 24 272 6 294 M. pusilla RCC299 7 272 6 302 B. prasinos RCC1105 8 265 8 224

What are the fitness effects of spontaneous mutations in standard subculturing conditions?

=> MA lines are less fit than control culture when osmolarity changes : salinity stress reveals fitness effects of spontaneous mutations

Algicide stress

0.0

0.5

1.0

1.5

2.0

2.5

Diuron (10 µg.L-1 )

0.5

1

1.5

0

2 6

5

8

6 9 7

1 2 3

Irgarol (1 µg.L-1 )

Mea

n fit

ness

rela

tive

to t

he c

ontr

ol 5

2 3 5

3 5

4

3 4 7

0.5

1

1.5

0

mediterraneus

M. pusilla

B. prasinos

O. mediterraneus

5

2 3 5

3 4 7

0.0

0.5

1.0

1.5

2.0

2.5

2.0 2.0

!"#$%&'(")*+,)"-(./*"0*!12'"#%&)3'")4*!"#$%&'&''(" #)($*+&/*&*.&/,*/'$52!"#$%&'()$&*+,$-.%/01',$2%#/'3/454$461'74%* !%8$)91',$4*':4$9"8/*1'';"<.%/';$&*./=+>/4$&6%&1'

?6$#'7@4/+A$)B/4'$&6'CD/&$E)'F%G$&/$0!12%"6,),'(.*#"/('(")A%-.%&'70B$4@"-/9

>4"#'F%G$&/$0'!"#$H1'IJKK,"6%L%/6'L4"#'M"-'!"#$H1'IJKI

7*/(-#%,*.,%%

8&-#%()6*%".&'(")*&)5*.$%'(9&'(")*/',#/*

!"%2-":#1(/-/*.&%%()6*&)5*9&%(5&'(")*#:".,5$:,

8'&'(/'(./ M"&+"0-)%/49 N0-)%/49

%MO'M"&9@&"&@#"09 9/G4/G$-%&G 9%-/9' PK1QRR PPS

&MO'M"&9@&"&@#"09 9%-/9' Q1PJJ1TIJ IU1IRJ

πMO'M"&9@&"&@#"09 &0*)/"-%6/ 6%8/49%-@ JHJJQ JHJJP

%;O';@&"&@#"09 9/G4/G$-%&G 9%-/9' SJ1JRK QKU

&;O';@&"&@#"09 9%-/9' I1KSJ1QUJ KP1KQJ

π;O';@&"&@#"09 &0*)/"-%6/ 6%8/49%-@ JHJJR JHJJR

%QO'Q+L")6'9/G4/G$-%&G 9%-/9' PK1TPS ISR

&QO'Q+L")6'9%-/9' K1QIK1IIS R1VPI

πQO'Q+L")6'&0*)/"-%6/ 6%8/49%-@ JHJJR JHJJVK

%WO'W&-/4G/&%* 9/G4/G$-%&G 9%-/9' PK1IJP SUU

&WO'W&-/4G/&%* 9%-/9' K1KRV1IQJ IV1KTS

πWO'W&-/4G/&%* &0*)/"-%6/ 6%8/49%-@ JHJJT JHJJS

%WO'W&-4"&%* 9/G4/G$-%&G 9%-/9' Q1RIR IQ

&WO'W&-4"&%* 9%-/9' IIP1RPU RSI

πWO'W&-4"&%* &0*)/"-%6/ 6%8/49%-@ JHJJVS JHJJU

9-4$%& X4/$69'Y2KJUZ

X4/$69H&-+K C/&"#/'*"8'Y[\KJ]Z'Y^Z

X;MF9'Y_CZ XW&6/)9'Y_CZ

!``QIIK QK RP TRHJ J J!``KKJR KVR TQU TQHT QPRSU KVSV!``KKKJ VT PKQ TQHS QIURR KUUS!``KKKI KVT UUT TQHV QPUKV KVSQ!``KKKQ SK KTK TQHI PRKVT KQRS!``KKKS UP IUP TQHQ QVSJJ KTKJ!``KKKU UQ ISP TQHS QVSJI KTJV!``KKKV KRJ RQU TSHJ QPUKS KVSI!``KKKR KRQ TUS TQHT QITPS KUPI!``KKIP KVR TKR TSHQ QIVJR KUTJ!``KSSR UP IQS TQHS QKJTU KSUI!``KSST PK KSS TQHQ QTTSQ IJKJ!``KSUK KRR RSR TSHI QPSIQ KVSJ

>4"#'C4%#9)/@ !"#$H1'IJKJ1'

IJJ'9$#<)/9'"&'U'9%-/9'%&'IJJU

KI'*)"&$)'9-4$%&9'"L''()"#*+,

a"-$)'bM?'9/c0/&*%&G'</4L"4#/6'$-'-./'d"%&-'C/&"#/'W&9-%-0-/'09%&G'W))0#%&$'C?'WW

&0*)/%'Y&Z1'*.)"4"<)$9-'Y*Z1'#%-"*."&64%"&'Y#Z1'C")G%'5"6%/9'YGZ1'-./'7&6"<)$9#%*'!/-%*0)0#'Y/4Z1'$&6'G4$&0)/9'YG4ZH';*$)/'bar = 200 &#>4"#'d/&9/&'!"#$(1'IJJV

,/-."69 e$4%$&-9 F")@#"4<.%9#9 ;MF9 WMb7f;

_C KUV1QKV KIS1ITJ KIJ1QSR Q1RPI

3` KVK1VTQ KQK1QRT KPI1JSR T1QPK

C7MN + KJQ1UTS KJI1UTT K1TTU

`.4"#"9"#/ F"9%-%"&9 X';-4$%&9 X'5< ;$&G/4'9/c0/&*/6 aM aF >M >F ;/&9%-%8%-@ ;</*%L%*%-@IJ VU1KSR'-"'VU1UVS KI UJJQ SRJI KTR I I TT^ TTHT^IJ UT1IJJ'-"'UT1RJJ KK SSSS SSKS QJ J J KJJ^ KJJ^IJ KJS1VSJ'-"'KJU1QSJ T SKRS SKSQ PK J J KJJ^ KJJ^IJ KJR1VSJ'-"'KJT1QSJ P KIIT KIKP KS J K KJJ^ TTHT^

W))0#%&$'F$%4/6'7&6'!/$69'L"4'KP'.$<)"%6'*)"&$)'9-4$%&9'"L''()"#*+,

;MF'$&6'9."4-'W&6/)9 f$4G/'Y[KJJ'5<Z'W&6/)9

,$<<%&G'$G$%&9-'-./'4/L/4/&*/'G/&"#/'9/c0/&*/'Y!``QIIKZ

(A?+,7, `!?`

9$#-"")9#<%)/0<

C?a:

W&6/)9 4/$)%G&/4

_&%L%

/6'C

/&"-

@</4

Y_CZ

3$<)

"-@<

/'`$

))/4'

Y3`Z

;&:(&)'/*0(%':&'(")4!/c0%4/'*"8/4$G/O['KJ]g'I'-%#/9'$8/4$G/'</4'9-4$%&e$4%$&-9'90<<"4-'5@''['RJ^'4/$69,$<<%&G'c0$)%-@'['PJ'

b0<)%*$-/9'4/#"8/6'$&6'4/$6'-4%##/6'Y>$-9_&%c $&6'a4%##"#$-%*Z

`$9/9'"L'<$4-%$)'#$<<%&G

W&9/4-%"&'6/-/*-%"&

W&9/4-%"&'$99/#5)@

b/)/-%"&'6/-/*-%"&

e$)%6$-%"&'5@';$&G/4'9/c0/&*%&G'"L'F`!'<4"60*-'"L'B/@'4/G%"&9

'-"+!././/*- "#*+,)%9'$'$)(.,%%$%&:*,$3&:2"'(.*6:,,)*&%6&, "L'-./'*)$99'<&-(,%%"#12.,&,=,$#%/))"<.@*/$/'%9'$'*)$99'5/)"&G%&G'-"'-./'<.@)0#'>1%":"#12'&=?))''()"#*+, 9-4$%&9'*0)-%8$-/6'%&'-./')$5'$4/'1&#%"(5='()"#*+, .$9'$'/(-#%,*?*$-*%&:6,*.,%%*#$6/'"L'$'9%&G)/'*.)"4"<)$9- $&6'#%-"*."&64%"&H

'()"#*+, .$9'$'?@*<A*6,)"-,*#$6/'"L'BC*.1:"-"/"-,/*$&6'<$*B/6'D%-.'DCCC*#:,5(.',5*6,),/HB*"$'%(,:/*.1:"-"/"-,/*<4/9/&-'$')"D/4'C`'*"&-/&-'-.$-'-./'"-./4'YST^Z1'$-@<%*$)'G/&/9'$&6'*"&-$%&'VV^'"L'$))'[QJJ'-4$&9<"9$5)/'/)/#/&-9H

<&-(,%%"#12.,&/'$4/'G4"0<'-"G/-./4'5$9/6'"&'-"%,.$%&:*.:(',:(&H'b/9<%-/'9.$4%&G'$'),&:%2*(5,)'(.&%*?D8:EF7*/,G$,).,1''()"#*+, $&6''()$*/,0#+,1*-)<4"-/"#/9'$4/'"&)@'VJ^'%6/&-%*$)1'$'6%LL/4/&*/'*"#<$4$5)/'-"'.0#$&'$&6'*.%*B/&'6/9<%-/'-./9/'9</*%/9'.$8/'$'.%G./4'6%8/4G/&*/'%&'-./%4'KR;4bM?'9/c0/&*/H

H1&'*(/*'1,*%,9,%*"0*/'&)5()6*6,)"-(.*9&:(&'(")*()*&*?D8:EF7*5,0(),5*/#,.(,/*I

>"-#&:(/")*&.:"//*.&%%()6*-,'1"5/

b/*$@'"L')%&B$G/'6%9/c0%)%54%0#

<&-(,%%"#12.,&,KR;4bM?'-4//

8,G$,).()6*/'&'(/'(./*#,:*/':&()

?))'<")@#"4<.%9#9 (%$))/)%* ;MF9'"&)@

?L-/4'L%)-4$-%"&'"L'$'D$-/4'9$#<)/1'.%")&%*/':&()/*$4/'/9-$5)%9./6'L"4'5"--)/9'.$45"4%&G'$'G4//&'*")"4'*.$4$*-/4%9-%*'"L',$#%/))$)/9H'a./'9</*%/9'%9'-./&'6/L%&/6'5$9/6'"&'-./'?D8:EF7*9/c0/&*/

A%)6'9-4$%&9!/L/4/&*/

J$'%(,:/*1&9,*$#*'"*KDC*3A*L.1BM*&)5*NB3A*L.1?OM*)")P."9,:,5*:,6(")/

f"D'C`

A%)6'9-4$%&9!/L/4/&*/

f"D'C`

;-$&6$46'*.4"#"9"#/9O'KJ'<4/6%*-/6'$&6'*"&L%4#/6')$4G/'6/)/-%"&9'YJHS'-"'KQ'B5Z

b%9-$&*/'YB5Z

f%&B

$G/'

6%9/

c0%)%

54%0

#'Y4

IZ N59/48/672</*-/6'YL"4'$'<$&#%*-%*<"<0)$-%"&Z

7*%&:6,*()5,% #"%2-":#1(/-/*()*'1,*.1%":"#%&/'*&)5*('/*!>Q*9&%(5&'(")

8'&'(/'(./*")*'1,*)$.%,&:*&)5*":6&),%%&: 6,)"-,/ 8'&'(/'(./*&.:"//*/(',/

'()"#*+,)&0*)/"-%6/'6%8/49%-@'2-( "-./4'/0B$4@"-/9

['KJ]g KJ]\'J]

`"8/4$G/

H1"%,*6,)"-,*0,&'$:,/*&)5*#"%2-":#1(/-/*

R(61*"..$::,).,*"0*&5S&.,)'*8F!/

f"D')/8/)'"L'<")@#"4<.%9#'"&'TQ^'"L'-./'G/&"#/'#$B/9'*4@<-%*'9</*%/9'0&)%B/)@

,%&%#0#'L4/c0/&*@'"L'9/20$)'4/<4"60*-%"&'K'#/%"9%9'/8/4@'KJ1JJJ'#%-"9%9'%&''()"#*+,

3%G.'8$4%$-%"&'"L')/8/)'"L'G/&/-%*9'$&6'9-40*-04$)'<")@#"4<.%9#9'5/-D//&'"0-)%/49'$&6'&"4#$)'*.4"#"9"#/9

f$4G/'%&9/4-%"&'YgZ'$&6'6/)/-%"&'Y[Z'<")@#"4<.%9#9Y4/6O'F`!'*"&L%4#/61'G4/@O'F`!'6"'&"-'$G4//1'5)$*BO'&"-'F`!'*./*B/6Z

>").%$/(")C`'*"&-/&- YG4//&'\'UJ^1'5)0/'\'SJ'^Z

F"<0)$-%"&'9*$)/6'4/*"#5%&$-%"&'4$-/'Y</4'B5Z'%&L/44/6'5@'f6.$-OF%hF9'4$-%"'Y*)/$4\')"D1'6$4B'5)0/\'.%G.ZM0*)/"-%6/'6%8/49%-@'YF%Z

�F/48$9%8/'#0)-%+&0*)/"-%6/'#0-$-%"&'/8/&-9

/2</*-/6

"59/48/6

F"<0)$-%"&'9*$)/6'4/*"#5%&$-%"&'4$-/'

W&'."09/'9*4%<-'YC7MNZ

H1&'*T,*"A/,:9,5

>:2#'(.*/#,.(,/*."-#%,U*I !"#$%&'(")*I

F./&"-@<%*'8$4%$-%"&

F")@#"4<.%9#

;-4$%&'9</*%L%*'G/&/9

!/*"#5%&$-%"&

J$'%(,:*.1:"-"/"-,/

8'&)5&:5*.1:"-"/"-,/

®®®

®

H1&'*'"*,U#,.'*I>:2#'(.*/#,.(,/*."-#%,U*I !"#$%&'(")*I

F./&"-@<%*'8$4%$-%"&

F")@#"4<.%9#

;-4$%&'9</*%L%*'G/&/9

!/*"#5%&$-%"&

®®®

®

3%G.'M/f"D'FMhF;;B/D/6';>;

;&%(5&'(") Y5$9/6'"&'Q'.%G.)@'<")@#"4<.%*'4/G%"&9Z

+,)"-, >1%":"#%&/' <('".1")5:(& F$.%,&:M0#5/4'"L'9%-/9 VR'B5 QQ'B5 KKHI',5;@&"&@#"09';MF KKT SS QV TKVF%';@&"&@#"09 JHJJS JHJJP JHJK!/*"#5%&$-%"& i/9 M" i/9

Stable Production of a Lytic Prasinovirus by its Picoalgal Host,Ostreococcus mediterraneus

Sheree Yau1, Marc Krasovec1, Nigel Grimsley1, Evelyne Derelle1, Sophie Sanchez-Ferrandin1, Stephane Rombauts2, Klaas Vandepoele2, Gwenael Piganeau1

1Integrative Biology of Marine Organisms (BIOM)-CNRS UMR7232 - Observatoire Océanologique de Banyuls, FRANCE2Department of Plant Systems Biology, VIB, Ghent, BELGIUM. Correspondence: sheree.yau@obs-banyuls.fr

BackgroundGlobally distributed marine algae of the genus Ostreococcus are among the smallest known free-living eukaryotes (<1 micron diameter) [1]. Ostreococcus genomes possess a "Small Outlier Chromosome" (SOC), so named because it has a lower GC content than the rest of the genome and shares little sequence homology with other species [2]. All Ostreococcus species are infected by prasinoviruses, large DNA viruses thus far all known to be strictly lytic. Surprising, a prasinovirus genome, termed OmV0, was assembled with the genome of the recently described species, O. mediterraneus RCC2590 [3].The culture showed no sign of infection in standard batch culture conditions since its isolationand cloning in 2008.

[1] Courties et al. (1994) Smallest eukaryotic organism. Nature. 370:255.[2] Moreau et al. (2012) Gene funtionalities and genome structure in Bathycoccus prasinos reflect cellular specializations at the base of the green lineage. Genome Biology. 13: R74.[3] Subirana et al. (2013) Morphology, genome plasticity and phylogeny in the genus Ostreococcus reveal a cryptic species, O. mediterraneus sp. nov. (Mamiellales, Mamiellophyceae). Protist. 164: 643–659.[4] Thyrhaug et al. (2003) Stable coexistence in marine algal host–virus systems. Mar. Ecol. Prog. Ser. 254:27-35.

Methods

Results

ReferencesConclusions and Perspectives

Fig 7. Hybridisation of SOC-specific probes to thePFGE gel of "wild type" OmV0-producing RCC2590and the OmV0-susceptible MA3, MA23, and MA24 lines shows a decrease in SOC size. MAlines that were not lysed by OmV0 showed nochange in SOC size as assessed by PFGE (not shown) suggesting a strong correlation betweendeletion in the SOC with susceptibility to lysis byOmV0. The estimated SOC sizes vary between OmV0-susceptible MA lines confirming the deletions occurred independently.

MA3

infected non-infected

Ancestor line

MA24MA23infected non-infected

infected non-infected infected non-infected

Fig 6. Three independnent MA culture lines (MA3, MA23, MA24) of 24 (40 total lines) visibly lysed upon addition of OmV0 producedby the "wild type" O. mediterraneus RCC2590 indicating OmV0 is capable of lytic reproduction. Neither the Ancestor line, nor the otherindependent MA lines were lysed by OmV0.

A) Pulse-field Gel Electrophoresis (PFGE) and hybridisation * Chromosomes were separated by PFGE. * Radiolabelled probes specific to OmV0 and the host genes were hybridised to the chromosomes in the gel.

B) Fig 2. Test for production of OmV0 virions

"wild type" RCC2590

Centrifuge 8,000 g20 mins

Filter <0.8 micron

cell-free filtrate

PCR for major capsid protein

gene

Infection of MAlines D) Determination of genomic changes

in MA lines by single molecule PACBIO sequencing

C) Mutation Accumulation (MA) Experiment and infection of MA lines* A virus-free clone was obtained by limiting dilution that was used as the ancestor to the MA experiment (Fig 3.)* Culture medium filtrate from the RCC2590 "wild-type" strain was added to the MA lines and lysis observed

Fig 3. Mutation Accumulation Experiment Design

* O. mediterraneus stably produces an infectious lytic prasinovirus, OmV0.* Spontaneous mutation leading to susceptibility to OmV0 lysis occurs in ~12% of independent MA lines. * Coexistence of OmV0 and O. mediterraneus in culture is linked to the presence of a genomic region located on the SOC. * The OmV0-O. mediterraneus system is, as far as we know, the first report of this type of virus-host interaction to be isolated directly from the environment. A similar phenomenon is observed in diverse marine algal host-virus systems in culture [4], whose significance in the environment is yet to be explored.

200

Fig 1. Electronmicrograph of O. mediterraneus0.5 micron

1

2

3

4

OmV0 is not integrated into the O. mediterraneus RCC2590 genome

RCC2590

Fig 4. Hybridisation of OmV0 and 18S rRNA specific probes to the PFGE-separated chromosomes of "wild type" O. mediterraneusRCC2590 culture.The 18S rRNA probe hybridised to the chromosomal band corresponding to the size predicted from the assembled genome.Both OmV0 probes, unique to two separate genomic regions, hybridised to the same physicallocation on the gel corresponding to the predicted size of the complete linear OmV0 genome (200 kb).

Mutant O. mediterraneus lines are lysed by OmV0produced by the parent strain, RCC2590

Mutant OmV0-susceptibleO. mediterraneus lines have decreasedSOC size

A 58 kb region is deleted in the SOC of mutant line MA3

(24 independent)

O. mediterraneus RCC2590 culture medium filtrate contains OmV0

2 31M Fig 5. PCR amplification of the OmV0 major capsid protein gene in the culture medium filtrate.M) 1 Kb molecular ladder1) No DNA template control2) Genomic DNA preparation3) Culture medium filtrate

5RCC2590 SOC: 644 kb

MA3 - SOC: 590 kb

58 kb

Fig 8. Alignment of theSOC from O. mediterraneusRCC2590 to the SOCof the MA3 line shows a 58 kb deletion at one end of the MA3 SOC. This deleted region contains primarily repeated sequences found elsewhere in the genomebut also at least 6 unique ORFs of unknown function.

AIM: Determine how OmV0 reproduces and the genetic basis for its stable coexistence with its host.

!"#$"%"&'"()*&)+,,)-."+&%)-/)'0")1,-2"3)'0")#*.-"45+$6-7.)1$""&)+,1+")8%*9"):);)<=>)/$-=)'0")?+=*",,-#06."+").,+%%)+$")"%%"&7+,)+.'-$%)-/)#,+&5'-&*.).-==4&*7"%)-/)'0")?"(*'"$$+&"+&)@"+A)B0")!"#$%&'&''(")1"&4%)C+%)-$*1*&+,,6)("%.$*2"()/$-=)+)%'$+*&)(*%.-D"E$"()*&)'0")B0+4),+1--&);F)6"+$%)+1-3)!"#$%&''&'(")#*($+3)5&-C&))+%)'0")%=+,,"%')"45+$6-7.)/$""E,*D*&1).",,)8FAG)<=>)'-)(+'")8H>A))

@-#0*")@+&.0"9EI"$+&(*&3)?+$.)J$+%-D".3)KC"&+",)L*1+&"+4)

!"#"$"%&"'(E!8H>)M-4$7"%)M3)N+O4"$)P3)B$-4%%",,*"$)?3)Q+47"$)R3)M0$S7"&&-'ET*&"')?R3)U"D"4V)R3)?+.0+(-)M3)M,+4%'$")WA)HXXYA)@=+,,"%')"45+$6-7.)-$1+&*%=A)U+'4$")Z[F\;]]A)E!8;>)^,+&.E?+'0*"4)!A3)@+&.0"9EI"$+&(*&)@A3)_6$"E`+,5"$)PA)+&()L*1+&"+4)KA3);FHZA)a$1+&",,"%)b&0"$*'+&.")*&)'0")K$""&)Q*&"+1"\)b&%*10'%)I$-=)!"#$%&'&''(")#*($+A)K"&-=")^*-,A)_D-,A3)]8G>\H]FZEHHA)E8Z>)Tc-4+&*)_AE^A3)M0$*%7")RA3)@+&.0"9EI"$+&(*&)@A3)@+&.0"9)IA3)^-41"')IAEdA3)M-$",,-4)IA3);FHHA)P)"45+$6-7.)QaNE0*%7(*&")5*&+%")$"14,+'"%).*$.+(*+&).,-.5)/4&.7-&)*&)'0")#*.-+,1+)!"#$%&'&''("A)B0")L,+&')R-4$&+,3)e]8Y>\][GE]GGA))E8Y>)@+&.0"9EI"$+&(*&)@A3)Q"$-6)IA3)^-41"')IEd)+&()R-4V)IA3);FHZA)P)U"C3)@"&%*7D")?+$*&")?*.$-+,1+,)!".-=2*&+&')^*-%"&%-$)4%*&1)Q4=*&"%."&.")?-&*'-$*&1)/-$)'0")B-V*.*'6)B"%7&1)-/)P&7/-4,*&1)^*-.*("%A)P##,*"()_&D*$-&="&'+,)?*.$-2*-,-163)[X\eZHEeZGA)

L06'-#,+&5'-&)%#".*"%)/$-=)?+=*",,+,"%)-$("$)+')'0").$-%%$-+(%)-/)1"&"7.%3)".-,-163)"V#"$*="&'+,)2*-,-16))

+&()2*-*&/-$=+7.%\)'0")LWdBU_@@)#$-c".'A)

)

f?!)[;Z;)^*-,-1*")b&'S1$+7D")("%)a$1+&*%="%)?+$*&%),-.!/0)

)

KS&-=*O4")_D-,47D")"')_&D*$-&&"="&'+,")(4)L06'-#,+&.'-&)

,123!4560))

a2%"$D+'-*$")a.S+&-,-1*O4"3)eee]F)^+&64,%E%4$E="$)

))

B0")LWdBU_@@)#$-c".')+*=%)'-)g,,)=+c-$)1+#%)*&)-4$)2+%*.)4&("$%'+&(*&1)-/)'0")#$-."%%"%)4&("$,6*&1)1"&-=")"D-,47-&)*&)'0"%")=*.$-+,1+")26)+)=4'+7-&)+..4=4,+7-&)8?P>)+##$-+.0A))

)*("+,"$-."%/(-&)YF)*&("#"&(+&')%'$+*&%)8%'+$7&1)/$-=)-&").",,>)0"12"%&-%3)-/)+,,)(+410'"$)%'$+*&%)+h"$)'0-4%+&(%)-/)1"&"$+7-&%)4-5-%#5$.67&')+##$-+.0)'-)"%7=+'")'0")=4'+7-&)$+'")26)$"#,*.+E)7-&)"$$-$3)<)i)=4'+7-&)$+'")#"$)&4.,"-7(")#"$).",,)(*D*%*-&)

2+%*.)4&("$%'+&(*&1)-/)'0")#$-."%%"%)4&("$,6*&1)1"&-=")"D-,47-&) @*=#,").",,4,+$)-$1+&*9+7-&)C*'0)-&")=*'-.0-&($*+)+&()-&").0,-$-#,+%')+&()+)HZ)?2#)0+#,-*()&4.,"+$)1"&-="A)@4.."%%/4,,6)4%"()'-)1+*&)5&-C,"(1")*&'-)/4&(+="&'+,).",,4,+$)#$-."%%"%)%4.0)+%)-$1+&",,+$)*&0"$*'+&."))8;>3)).",,)(*D*%*-&3).*$.+(*+&).,-.5)8Z>3),*#*()+&()%'+$.0)%6&'0"%*%A))

L06%*-,-1*.+,)"V#"$*="&'+7-&%)C*,,)"&+2,")'-)"%7=+'")'0")#0"&-'6#*.)(*D"$%*'6)+&()'0"),*&5)C*'0)1"&"7.)(*D"$%*'6)26)g&(*&1)1"&-=")C*(")+%%-.*+7-&%)2"'C""&)%-=")0+#,-'6#"%)+&()(*%.$"'")#0"&-'6#"%A))

B-).-&.,4("3)"%7=+7-&%)-/)'0")=4'+7-&)$+'"%)-/)'0"%")(*j"$"&')=*.$-+,1+")C*,,)2$*&1)&"C)4&("$%'+&(*&1)'-)'0")=-(")+&()'"=#-)-/)"D-,47-&)-/)'0"%")"&*1=+7.)"45+$6-'"%)'0+')($*D")'0")-."+&k%)".-%6%'"=A))

!"#"$"%&"('/$6-%(

)2/675%(

!(.2/6%/('/$6-%'(

M-&'"V')

P\)!7)8%9+#%$$*:%("l)^\)/+'$&8&:*")%#Al)M\)-*#;<'&''(")%#A)

.:#%$%"=:>)#&):&='%?)*&)+((*7-&)'-)'0"*$)".-,-1*.+,)*=#-$'+&."3)'0"%")=*.$-+,1+").-4,()-j"$)&"C)2*-'".0&-,-1*.+,)#-'"&7+,)+%)#-%%*2,")%-4$."%)-/)2*-/4",%)+&()(*"'+$6)m-="1+EZn),*#*()/--()%4##,"="&'%3)+&()'0"6)0+D")/-%'"$"()%"D"$+,)*&'"$&+7-&+,)*&*7+7D"%)*&)'0")f@)8R-*&')K"&-=")b&*7+7D">3)+&()=-$")$"."&',6)*&)_4$-#")8BP!PEa."+&%>)'-)1+*&)5&-C,"(1")*&'-)'0"*$)(*D"$%*'6)+&()="'+2-,*.)#-'"&7+,A)

M)^)P)

Henderson et al., 2007

"#$%&'()8(/9"(:3$""%(;"6'/:(#5$(,<6%/(=-5<53-'/'((

@*=*,+$)#0"&-'6#*.)%.$""&*&1)0+%)#$"D*-4%,6)2""&)(-&")+')'0"),+2-$+'-$6)26).-=#+$*&1)1$-C'0)$+'"%)4&("$)(*j"$"&')"&D*$-&="&'+,)%'$"%%"%)8Y>)

>%&2=675%(-%((?-@"$"%/(&5%?-75%'(

A/9"$()6.-"<<5,9;&"6"(2'"?(-%(/9-'('/2?;(

Marinobacter dominates the bacterial community of the Ostreococcus tauri phycosphere in culture

Josselin Lupette1,2, Raphaël Lami3, Marc Krasovec2, Nigel H. Grimsley2, Hervé

Moreau2, Gwenael Piganeau2, Sophie Sanchez-Ferandin2* 1 CEA / CNRS / INRA / Université Grenoble Alpes UMR 5168, France, 2UMR 7232 Biologie

Intégrative desOrganismes Marins, BIOM, Observatoire Océanologique, France, 2 Observatoire Océanologique, UMR 7232 Biologie Intégrative des Organismes Marins, BIOM,

France, 3 Observatoire Océanologique, USR3579 Laboratoire de Biodiversité et Biotechnologies

Microbiennes, LBBM, France,

Keywords: Ostreococcus tauri, Marinobacter sp., Picoalgae, Bacteria, interactions,

Phytoplankton

ABSTRACT Microalgal-bacterial interactions are commonly found in marine environments and

are well known in diatom cultures maintained in laboratory. These interactions also

exert strong effects on bacterial and algal diversity in the oceans. Small green

eukaryote algae of the class Mamiellophyceae (Chlorophyta) are ubiquitous and

some species, such as Ostreococcus spp., are particularly important in

Mediterranean coastal lagoons, and are observed as dominant species during

phytoplankton blooms in open sea. Despite this, little is known about the diversity of

bacteria that might facilitate or hinder O. tauri growth. We show, using rDNA 16S

sequences, that the bacterial community found in O. tauri RCC4221 laboratory

cultures is dominated by γ-­‐‑proteobacteria from the Marinobacter genus, regardless

of the growth phase of O. tauri RCC4221, the photoperiod used, or the nutrient

conditions (limited in nitrogen or phosphorous) tested. Several strains of M. algicola

were detected, all closely related to strains found in association with taxonomically

distinct organisms, particularly with dinoflagellates and coccolithophorids. These

sequences were more distantly related to M. adhaerens, M. aquaeoli and bacteria

usually associated to euglenoids. This is the first time, to our knowledge, that distinct

Marinobacter strains have been found to be associated with a green alga in culture.

  175  

LISTES DES FIGURES ET DES TABLEAUX

 

  176  

CHAPITRE 1: INTRODUCTION Figure 1. Processus de mutations. 13 Figure 2. Schéma d’une expérience d’accumulation de mutations. 16 Figure 3. Representation du fitness landscape selon Fisher. 21 Figure 4. Changement de fitness d’un genotype entre environnements. 21 Figure 5. Relation entre le taux de mutation et la taille du génome. 26 Figure 6. La barrière de dérive et le coût de la réplication. 27 Figure 7. Relation entre taille efficace et taux de mutations. 28 Figure 8. Photographies en microscopie électronique des espèces utilisées pour les expériences d’accumulation de mutations. 39 Figure 9. Arbre phylogénétique des Chlorophyta. 40 Figure 10. Migration par PFGE de l’ADN complet des 4 espèces de Mamiellophyceae. 41 Tableau 1. Les taux de mutations spontanées estimés par des expériences d'accumulation de mutations. 25 Tableau 2. Corrélation entre le temps de génération et le taux de mutation. 29 Tableau 3. Le biais de GC vers AT. 34 Tableau 4. Diversité génomique des espèces utilisées pour les expériences d’accumulation de mutations. 37

  177  

CHAPITRE 2: EFFETS DES MUTATIONS SUR LA FITNESS Figure 1. Mutation accumulation (MA) experiments in pico-algae. 53 Figure 2. Selection coefficients, ST, in Irgarol 1051 or Diuron. 56 Figure 3. Selection coefficients in five salinity conditions. 57 Table 1. Summary of mutation accumulation experiments for four species. 54 Table 2. Statistical probabilities of line loss. 55 CHAPITRE 3: LE TAUX DE MUTATION CHEZ LES MAMIELLOPHYCEAE Figure 1. The GC to AT and AT to GC mutations in the four species. 73 Figure 2. Correlation of the base substitution mutation rate and the effective population size. 74 Figure 3. Correlation of the base substitution mutation rate. 75 Figure 4. Correlation between mutation rate and gap from GC equilibrium. 76 Table 1. Summary of spontaneous mutation rates in four Mamiellophyceae species. 71 Table 2. Mutation rate variation between coding and non-coding sequences. 72 CHAPITRE 4: LES TRANSFERTS HORIZONTAUX DE GENES: LE CAS DE PICOCHLORUM RCC4223 Figure 1. Phylogenetic and phenotypic analysis of Picochlorum RCC4223. 90 Figure 2. PFGE migration of Picochlorum RCC4223. 91

  178  

Figure 3. Open Read Frame (ORF) lengths comparison between Picochlorum species. 94 Figure 4. Gene family extensions in Picochlorum RCC4223. 94 CHAPITRE 5: IMPACT DU TAUX DE MUTATION POUR LES BIOTECHNOLOGIES Figure 1. Number of base-substitution mutations observed in MA lines of Picochlorum RCC4223. 106 Table 1. Distribution of the mutations between MA lines. 107 Table 2. The distribution of the mutations in the genome, with the predicted effects from SnpEFF. 107 Table 3. Available direct spontaneous mutation rate estimations in Chlorophyta. 109 CHAPITRE 6: DISCUSSION ET CONCLUSION Figure 1. Migration PFGE chez les lignées issue de l’EAM d’O. mediterraneus. 120 Figure 2. Présentation des différents facteurs qui influencent le taux de mutation. 121

  179  

ANNEXES CHAPITRE 2: EFFETS DES MUTATIONS SUR LA FITNESS Table S1. Normalized Gr from Micromonas pusilla. 137 Table S2. Normalized Gr Ostreococcus mediterraneus. 138 Table S3. Normalized Gr from Bathycoccus prasinos. 139 Table S4. Normalized Gr from Ostreococcus tauri. 140 Table S5. Average of G of MA lines and control of Micromonas pusilla for each environmental test. 141 Table S6. Average of G of MA lines and control of Bathycoccus prasinos for each environmental test. 141 Table S7. Average of G of MA lines and control of Ostreococcus mediterraneus for each environmental test. 142 CHAPITRE 3: LE TAUX DE MUTATION CHEZ LES MAMIELLOPHYCEAE Figure S1. The distribution of the base-substitution mutations. 152 Figure S2. Correlation between the strength of the GC bias (R1/R2) and the nucleotide mutation rate. 155 Figure S3. Mutational context of base-substitution mutations. 155 Table S1. Summary of mutation accumulation experiments. 143 Table S2. The part of the genome usable (G*) for mutations calling. 143 Table S3. Base-substitution mutations in O. tauri. 143 Table S4. Base-substitution mutations in O. mediterraneus. 146

  180  

Table S5. Base-substitution mutations in B. prasinos. 147 Table S6. Base-substitution mutations in M. pusilla. 148 Table S7. Insertions in the four species. 150 Table S8. Deletions in the four species. 150 Table S9: RNAseq coverage of exons and other sequences in mutated and no mutated sites. 151 Table S10. Spontaneous base-substitution mutation rates estimated by mutation accumulation. 153 Table S11. Effect of GC gap from equilibrium in base substitution mutation rate. 154 CHAPITRE 4: LES TRANSFERTS HORIZONTAUX DE GENES: LE CAS DE PICOCHLORUM RCC4223 Table S1. Draw statistical results from Pacbio RS II sequencing and polished step. 156 Table S2. Statistical best results from ABySS assembly. 156 Table S3. SGA results with MiSeq reads mappings in HGAP assembly. 157 Table S4. Total final genome assembly. 157 CHAPITRE 6: DISCUSSION ET CONCLUSION Tableau A1. Mutations des lignées d’O. tauri qui montrent une baisse significative de fitness. 159 Tableau A2. Délétions et insertions identifiées chez les lignées utilisées pour les essais de fitness. 159 Tableau A3. Substitutions identifiées chez les lignées utilisées pour les essais de fitness. 160

  181  

BIBLIOGRAPHIE

 

  182  

Abby, S.S., Touchon, M., De Jode, A., Grimsley, N., Piganeau, G., 2014. Bacteria in

Ostreococcus tauri cultures - friends, foes or hitchhikers? Front. Microbiol. 5,

505.

Abecasis GR, Altshuler D, Auton A, Brooks LD, Durbin RM, 1000 Genomes Project Consortium, 2010. Nature 467(7319): 1061–1073. Adewoye, A.B., Lindsay, S.J., Dubrova, Y.E., Hurles, M.E., 2015. The genome-wide

effects of ionizing radiation on mutation induction in the mammalian germline.

Nat. Commun. 6, 6684.

Aggarwala, V., Voight, B.F., 2016. An expanded sequence context model broadly

explains variability in polymorphism levels across the human genome. Nat.

Genet. 48, 349–355.

Agrawal, A.F., Whitlock, M.C., 2012. Mutation Load: The Fitness of Individuals in

Populations Where Deleterious Alleles Are Abundant. Annu. Rev. Ecol. Evol.

Syst. 43, 115–135.

Ajie, B.C., Estes, S., Lynch, M., Phillips, P.C., 2005. Behavioral Degradation Under

Mutation Accumulation in Caenorhabditis elegans. Genetics 170, 655–660.

Alavi, M., Miller, T., Erlandson, K., Schneider, R., Belas, R., 2001. Bacterial

community associated with Pfiesteria-like dinoflagellate cultures. Environ.

Microbiol. 3, 380–396.

Amin, S.A., Green, D.H., Hart, M.C., Küpper, F.C., Sunda, W.G., Carrano, C.J.,

2009. Photolysis of iron–siderophore chelates promotes bacterial–algal

mutualism. Proc. Natl. Acad. Sci. U. S. A. 106, 17071–17076.

Andrew, J.R., Dossey, M.M., Garza, V.O., Keller-Pearson, M., Baer, C.F., Joyner-

Matos, J., 2015. Abiotic stress does not magnify the deleterious effects of

spontaneous mutations. Heredity.

Backström, N., Sætre, G.-P., Ellegren, H., 2013. Inferring the demographic history of

European Ficedula flycatcher populations. BMC Evol. Biol. 13, 2.

Baer, C.F., Miyamoto, M.M., Denver, D.R., 2007. Mutation rate variation in

multicellular eukaryotes: causes and consequences. Nat. Rev. Genet. 8, 619–

631.

Baer, C.F., Phillips, N., Ostrow, D., Avalos, A., Blanton, D., Boggs, A., Keller, T.,

Levy, L., Mezerhane, E., 2006. Cumulative Effects of Spontaneous Mutations

for Fitness in Caenorhabditis: Role of Genotype, Environment and Stress.

Genetics 174, 1387–1395.

  183  

Barrett, R.D.H., Schluter, D., 2008. Adaptation from standing genetic variation.

Trends Ecol. Evol. 23, 38–44.

Becker, E.W., 2007. Micro-algae as a source of protein. Biotechnol. Adv. 25, 207–

210.

Behringer, M.G., Hall, D.W., 2016. The repeatability of genome-wide mutation rate

and spectrum estimates. Curr. Genet. 1–6.

Behringer, M.G., Hall, D.W., 2015. Genome-Wide Estimates of Mutation Rates and

Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly

Mutagenic Despite the Absence of DNA Methylation. G3

GenesGenomesGenetics 6, 149–160.

Beletskii, A., Bhagwat, A.S., 1996. Transcription-induced mutations: Increase in C to

T mutations in the nontranscribed strand during transcription in

Escherichia  coli. Proc. Natl. Acad. Sci. U. S. A. 93, 13919–13924.

Bird, A.P., 1986. CpG-rich islands and the function of DNA methylation. Nature 321,

209–213.

Black, C.K., Mihai, D.M., Washington, I., 2014. The Photosynthetic Eukaryote

Nannochloris eukaryotum as an Intracellular Machine To Control and Expand

Functionality of Human Cells. Nano Lett. 14, 2720–2725.

Blanc, G., Agarkova, I., Grimwood, J., Kuo, A., Brueggeman, A et al., 2012. The

genome of the polar eukaryotic microalga Coccomyxa subellipsoidea reveals

traits of cold adaptation. Genome Biol. 13, R39.

Blanc, G., Duncan, G., Agarkova, I., Borodovsky, M., Gurnon, J et al., 2010. The

Chlorella variabilis NC64A genome reveals adaptation to photosymbiosis,

coevolution with viruses, and cryptic sex. Plant Cell 22, 2943–2955.

doi:10.1105/tpc.110.076406

Blanc-Mathieu, R., Sanchez-Ferandin, S., Eyre-Walker, A., Piganeau, G., 2013.

Organellar inheritance in the green lineage: insights from Ostreococcus tauri.

Genome Biol. Evol. 5, 1503–1511.

Blanc-Mathieu, R., Verhelst, B., Derelle, E., Rombauts, S., Bouget, F.-Y., Carré, I.,

Château, A., Eyre-Walker, A., Grimsley, N., Moreau, H., Piégu, B., Rivals, E.,

Schackwitz, W., Van de Peer, Y., Piganeau, G., 2014. An improved genome

of the model marine alga Ostreococcus tauri unfolds by assessing Illumina de

novo assemblies. BMC Genomics 15, 1103.

  184  

Boetzer, M., Henkel, C.V., Jansen, H.J., Butler, D., Pirovano, W., 2011. Scaffolding

pre-assembled contigs using SSPACE. Bioinformatics 27, 578–579.

Bousquet, J., Strauss, S.H., Doerksen, A.H., Price, R.A., 1992. Extensive variation in

evolutionary rate of rbcL gene sequences among seed plants. Proc. Natl.

Acad. Sci. U. S. A. 89, 7844–7848.

Bowler, C., Allen, A.E., Badger, J.H., Grimwood, J., Jabbari, K et al., 2008. The

Phaeodactylum genome reveals the evolutionary history of diatom genomes.

Nature 456, 239–244.

Boyd, P., Newton, P., 1995. Evidence of the potential influence of planktonic

community structure on the interannual variability of particulate organic

carbon flux. Deep Sea Res. Part Oceanogr. Res. Pap. 42, 619–639.

Boyd, P.W., Newton, P.P., 1999. Does planktonic community structure determine

downward particulate organic carbon flux in different oceanic provinces?

Deep Sea Res. Part Oceanogr. Res. Pap. 46, 63–91.

Brennan, L., Owende, P., 2010. Biofuels from microalgae-A review of technologies

for production, processing, and extractions of biofuels and co-products.

Renew. Sustain. Energy Rev. 14, 557–577.

Brito, P.H., Guilherme, E., Soares, H., Gordo, I., 2010. Mutation accumulation in

Tetrahymena. BMC Evol. Biol. 10, 354.

Britten, R.J., 1986. Rates of DNA sequence evolution differ between taxonomic

groups. Science 231, 1393–1398.

Bromham, L., 2009. Why do species vary in their rate of molecular evolution? Biol.

Lett. 5, 401–404.

Bromham, L., Penny, D., 2003. The modern molecular clock. Nat. Rev. Genet. 4,

216–224.

Bromham, L., Rambaut, A., Harvey, P.H., 1996. Determinants of rate variation in

mammalian DNA sequence evolution. J. Mol. Evol. 43, 610–621.

Buesseler, K.O., 1998. The decoupling of production and particulate export in the

surface ocean. Glob. Biogeochem. Cycles 12, 297–310.

Cao, H., Butler, K., Hossain, M., Lewis, J.D., 2014. Variation in the fitness effects of

mutations with population density and size in Escherichia coli. PloS One 9,

e105369.

Cao, J., Schneeberger, K., Ossowski, S., Günther, T., Bender, S., Fitz, J., Koenig,

D., Lanz, C., Stegle, O., Lippert, C., Wang, X., Ott, F., Müller, J., Alonso-

  185  

Blanco, C., Borgwardt, K., Schmid, K.J., Weigel, D., 2011. Whole-genome

sequencing of multiple Arabidopsis thaliana populations. Nat. Genet. 43, 956–

963.

Carreras, C.W., Pieper, R., Khosla, C., 1997. The chemistry and biology of fatty acid,

polyketide, and nonribosomal peptide biosynthesis 85–126.

Carroll, S.P., Jørgensen, P.S., Kinnison, M.T., Bergstrom, C.T., Denison, R.F.,

Gluckman, P., Smith, T.B., Strauss, S.Y., Tabashnik, B.E., 2014. Applying

evolutionary biology to address global challenges. Science 346, 1245993.

Cazzaniga, S., Dall’Osto, L., Szaub, J., Scibilia, L., Ballottari, M., Purton, S., Bassi,

R., 2014. Domestication of the green alga Chlorella sorokiniana: reduction of

antenna size improves light-use efficiency in a photobioreactor. Biotechnol.

Biofuels 7, 157.

Chang, S.-M., Shaw, R.G., 2003. The contribution of spontaneous mutation to

variation in environmental response in Arabidopsis thaliana: responses to

nutrients. Evol. Int. J. Org. Evol. 57, 984–994.

Charlesworth, B., 2009. Effective population size and patterns of molecular evolution

and variation. Nat. Rev. Genet. 10, 195–205.

Charlesworth, B., Charlesworth, D., 1998. Some evolutionary consequences of

deleterious mutations. Genetica 102–103, 3–19.

Charlesworth, B., Charlesworth, D., Morgan, M.T., 1990. Genetic loads and

estimates of mutation rates in highly inbred plant populations. Nature 347,

380–382.

Chen, C.-L., Rappailles, A., Duquenne, L., Huvet, M., Guilbaud, G., Farinelli, L.,

Audit, B., d’Aubenton-Carafa, Y., Arneodo, A., Hyrien, O., Thermes, C., 2010.

Impact of replication timing on non-CpG and CpG substitution rates in

mammalian genomes. Genome Res. 20, 447–457.

Chen, J.-M., Cooper, D.N., Chuzhanova, N., Férec, C., Patrinos, G.P., 2007. Gene

conversion: mechanisms, evolution and human disease. Nat. Rev. Genet. 8,

762–775.

Chen, T.-Y., Lin, H.-Y., Lin, C.-C., Lu, C.-K., Chen, Y.-M., 2012. Picochlorum as an

alternative to Nannochloropsis for grouper larval rearing. Aquaculture 338–

341, 82–88.

Chen, X., Zhang, J., 2013. No Gene-Specific Optimization of Mutation Rate in

Escherichia coli. Mol. Biol. Evol. 30, 1559–1562.

  186  

Chevin, L.-M., 2011. On measuring selection in experimental evolution. Biol. Lett. 7,

210–213.

Chin, C.-S., Alexander, D.H., Marks, P., Klammer, A.A., Drake, J., Heiner, C., Clum,

A., Copeland, A., Huddleston, J., Eichler, E.E., Turner, S.W., Korlach, J.,

2013. Nonhybrid, finished microbial genome assemblies from long-read

SMRT sequencing data. Nat. Methods 10, 563–569.

Chisti, Y., 2007. Biodiesel from microalgae. Biotechnol. Adv. 25, 294–306.

Cingolani, P., Platts, A., Wang, L.L., Coon, M., Nguyen, T., Wang, L., Land, S.J., Lu,

X., Ruden, D.M., 2012. A program for annotating and predicting the effects of

single nucleotide polymorphisms, SnpEff. Fly (Austin) 6, 80–92.

Cohen, N.M., Kenigsberg, E., Tanay, A., 2011. Primate CpG Islands Are Maintained

by Heterogeneous Evolutionary Regimes Involving Minimal Selection. Cell

145, 773–786.

Cole, J.J., 1982. Interactions Between Bacteria and Algae in Aquatic Ecosystems.

Annu. Rev. Ecol. Syst. 13, 291–314.

Collins, S., Rost, B., Rynearson, T.A., 2014. Evolutionary potential of marine

phytoplankton under ocean acidification. Evol. Appl. 7, 140–155.

Conrad, DF., Keebler, JE., DePristo, MA., Lindsay, SJ., Zhang, Y et al., 2011. Variation in genome-wide mutation rates within and between human families. Nat Genet. 43(7): 712–714. Consortium, T. 1000 G.P., 2010. A map of human genome variation from population-

scale sequencing. Nature 467, 1061–1073.

Consortium, T.C.S. and A., 2005. Initial sequence of the chimpanzee genome and

comparison with the human genome. Nature 437, 69–87.

Cooke, M.S., Evans, M.D., Dizdaroglu, M., Lunec, J., 2003. Oxidative DNA damage:

mechanisms, mutation, and disease. FASEB J. Off. Publ. Fed. Am. Soc. Exp.

Biol. 17, 1195–1214.

Couce, A., Guelfo, J.R., Blázquez, J., 2013. Mutational spectrum drives the rise of

mutator bacteria. PLoS Genet. 9, e1003167.

Coulondre, C., Miller, J.H., Farabaugh, P.J., Gilbert, W., 1978. Molecular basis of

base substitution hotspots in Escherichia coli. Nature 274, 775–780.

Courties, C., Vaquer, A., Troussellier, M., Lautier, J., Chrétiennot-Dinet, M.J.,

Neveux, J., Machado, C., Claustre, H., 1994. Smallest eukaryotic organism.

Nature 370, 255–255.

  187  

Cowin, P.A., Anglesio, M., Etemadmoghadam, D., Bowtell, D.D.L., 2010. Profiling

the Cancer Genome. Annu. Rev. Genomics Hum. Genet. 11, 133–159.

Croft, M.T., Lawrence, A.D., Raux-Deery, E., Warren, M.J., Smith, A.G., 2005. Algae

acquire vitamin B12 through a symbiotic relationship with bacteria. Nature

438, 90–93.

Crow, J.F., Abrahamson, S., 1997. Seventy Years Ago: Mutation Becomes

Experimental. Genetics 147, 1491–1496.

Cutter, A.D., 2006. Nucleotide polymorphism and linkage disequilibrium in wild

populations of the partial selfer Caenorhabditis elegans. Genetics 172, 171–

184.

Cutter, A.D., Félix, M.-A., Barrière, A., Charlesworth, D., 2006. Patterns of

Nucleotide Polymorphism Distinguish Temperate and Tropical Wild Isolates of

Caenorhabditis briggsae. Genetics 173, 2021–2031.

Dassey, A.J., Theegala, C.S., 2013. Reducing electrocoagulation harvesting costs

for practical microalgal biodiesel production. Environ. Technol. 35, 691–697.

Davies, E.K., Peters, A.D., Keightley, P.D., 1999. High Frequency of Cryptic

Deleterious Mutations in Caenorhabditis elegans. Science 1748.

De Clerck, O., Bogaert, K.A., Leliaert, F., 2012. Diversity and Evolution of Algae:

Primary Endosymbiosis. Adv. Bot. Res. 64, 55–86.

de la Vega, M., Díaz, E., Vila, M., León, R., 2011. Isolation of a new strain of

Picochlorum sp and characterization of its potential biotechnological

applications. Biotechnol. Prog. 27, 1535–1543.

De Vargas, C., Audic, S., Henry, N., Decelle, J., Mahé, F et al., 2015. Ocean

plankton. Eukaryotic plankton diversity in the sunlit ocean. Science 348,

1261605.

Demir-Hilton, E., Sudek, S., Cuvelier, M.L., Gentemann, C.L., Zehr, J.P., Worden,

A.Z., 2011. Global distribution patterns of distinct clades of the photosynthetic

picoeukaryote Ostreococcus. ISME J. 5, 1095–1107.

Deng, H.-W., Gao, G., Li, J.-L., 2002. Estimation of deleterious genomic mutation

parameters in natural populations by accounting for variable mutation effects

across loci. Genetics 162, 1487–1500.

Deng, H.W., Lynch, M., 1997. Inbreeding depression and inferred deleterious-

mutation parameters in Daphnia. Genetics 147, 147–155.

  188  

Deng, H.W., Lynch, M., 1996. Estimation of Deleterious-Mutation Parameters in

Natural Populations. Genetics 144, 349–360.

Denver, D.R., Dolan, P.C., Wilhelm, L.J., Sung, W., Lucas-Lledó, J.I., Howe, D.K.,

Lewis, S.C., Okamoto, K., Thomas, W.K., Lynch, M., Baer, C.F., 2009. A

genome-wide view of Caenorhabditis elegans base-substitution mutation

processes. Proc. Natl. Acad. Sci. U. S. A. 106, 16310–16314.

Denver, D.R., Feinberg, S., Estes, S., Thomas, W.K., Lynch, M., 2005. Mutation

Rates, Spectra and Hotspots in Mismatch Repair-Deficient Caenorhabditis

elegans. Genetics 170, 107–113.

Denver, D.R., Morris, K., Lynch, M., Thomas, W.K., 2004. High mutation rate and

predominance of insertions in the Caenorhabditis elegans nuclear genome.

Nature 430, 679–682.

Denver, D.R., Morris, K., Lynch, M., Vassilieva, L.L., Thomas, W.K., 2000. High

direct estimate of the mutation rate in the mitochondrial genome of

Caenorhabditis elegans. Science 289, 2342–2344.

Denver, D.R., Wilhelm, L.J., Howe, D.K., Gafner, K., Dolan, P.C., Baer, C.F., 2012.

Variation in base-substitution mutation in experimental and natural lineages of

Caenorhabditis nematodes. Genome Biol. Evol. 4, 513–522.

DePristo, M.A., Banks, E., Poplin, R., Garimella, K.V., Maguire, J.R., Hartl, C.,

Philippakis, A.A., del Angel, G., Rivas, M.A., Hanna, M., McKenna, A.,

Fennell, T.J., Kernytsky, A.M., Sivachenko, A.Y., Cibulskis, K., Gabriel, S.B.,

Altshuler, D., Daly, M.J., 2011. A framework for variation discovery and

genotyping using next-generation DNA sequencing data. Nat. Genet. 43,

491–498.

Derelle, E., Ferraz, C., Escande, M.-L., Eychenié, S., Cooke, R., Piganeau, G.,

Desdevises, Y., Bellec, L., Moreau, H., Grimsley, N., 2008. Life-cycle and

genome of OtV5, a large DNA virus of the pelagic marine unicellular green

alga Ostreococcus tauri. PloS One 3, e2250.

Derelle, E., Ferraz, C., Rombauts, S., Rouzé, P., Worden, A.Z et al., 2006. Genome

analysis of the smallest free-living eukaryote Ostreococcus tauri unveils many

unique features. Proc. Natl. Acad. Sci. U. S. A. 103, 11647–11652.

Dettman, J.R., Sztepanacz, J.L., Kassen, R., 2016. The properties of spontaneous

mutations in the opportunistic pathogen Pseudomonas aeruginosa. BMC

Genomics 17.

  189  

Dillon, M.M., Sung, W., Lynch, M., Cooper, V.S., 2015. The Rate and Molecular

Spectrum of Spontaneous Mutations in the GC-Rich Multi-Chromosome

Genome of Burkholderia cenocepacia. Genetics.

Ding, J., McConechy, M.K., Horlings, H.M., Ha, G., Chun Chan, F., Funnell, T.,

Mullaly, S.C., Reimand, J., Bashashati, A., Bader, G.D., Huntsman, D.,

Aparicio, S., Condon, A., Shah, S.P., 2015. Systematic analysis of somatic

mutations impacting gene expression in 12 tumour types. Nat. Commun. 6,

8554.

Dizdaroglu, M., 1992. Oxidative damage to DNA in mammalian chromatin. Mutat.

Res. 275, 331–342.

Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P.,

Chaisson, M., Gingeras, T.R., 2013. STAR: ultrafast universal RNA-seq

aligner. Bioinforma. Oxf. Engl. 29, 15–21.

Drake, J.W., 1991. A constant rate of spontaneous mutation in DNA-based

microbes. Proc. Natl. Acad. Sci. U. S. A. 88, 7160–7164.

Drake, J.W., Charlesworth, B., Charlesworth, D., Crow, J.F., 1998. Rates of

spontaneous mutation. Genetics 148, 1667–1686.

Duret, L., Arndt, P.F., 2008. The Impact of Recombination on Nucleotide

Substitutions in the Human Genome. PLOS Genet 4, e1000071.

Duret, L., Galtier, N., 2009. Biased Gene Conversion and the Evolution of

Mammalian Genomic Landscapes. Annu. Rev. Genomics Hum. Genet. 10,

285–311.

Ebersberger, I., Metzler, D., Schwarz, C., Pääbo, S., 2002. Genomewide

Comparison of DNA Sequences between Humans and Chimpanzees. Am. J.

Hum. Genet. 70, 1490–1497.

Edwards, A.W.F., 2000. The Genetical Theory of Natural Selection. Genetics 154,

1419–1426.

Elango, N., Kim, S.-H., Vigoda, E., Yi, S.V., 2008. Mutations of different molecular

origins exhibit contrasting patterns of regional substitution rate variation. PLoS

Comput. Biol. 4, e1000015.

Elena, S.F., de Visser, J.A.G., 2003. Environmental stress and the effects of

mutation. J. Biol. 2, 12.

Elena, S.F., Lenski, R.E., 2003. Evolution experiments with microorganisms: the

dynamics and genetic bases of adaptation. Nat. Rev. Genet. 4, 457–469.

  190  

Ellegren, H., Galtier, N., 2016. Determinants of genetic diversity. Nat. Rev. Genet.

17, 422–433.

Estes, S., Phillips, P.C., Denver, D.R., Thomas, W.K., Lynch, M., 2004. Mutation

Accumulation in Populations of Varying Size: The Distribution of Mutational

Effects for Fitness Correlates in Caenorhabditis elegans. Genetics 166, 1269–

1279.

Eyre-Walker, A., Bulmer, M., 1995. Synonymous substitution rates in enterobacteria.

Genetics 140, 1407–1412.

Eyre-Walker, A., Keightley, P.D., 2007. The distribution of fitness effects of new

mutations. Nat. Rev. Genet. 8, 610–618.

Eyre-Walker, A., Keightley, P.D., Smith, N.G.C., Gaffney, D., 2002. Quantifying the

Slightly Deleterious Mutation Model of Molecular Evolution. Mol. Biol. Evol.

19, 2142–2149.

Farlow, A., Long, H., Arnoux, S., Sung, W., Doak, T.G., Nordborg, M., Lynch, M.,

2015. The Spontaneous Mutation Rate in the Fission Yeast

Schizosaccharomyces pombe. Genetics genetics.115.177329.

Fernández, J., López-Fanjul, C., 1996. Spontaneous mutational variances and

covariances for fitness-related traits in Drosophila melanogaster. Genetics

143, 829–837.

Field, null, Behrenfeld, null, Randerson, null, Falkowski, null, 1998. Primary

production of the biosphere: integrating terrestrial and oceanic components.

Science 281, 237–240.

Fijalkowska, I.J., Jonczyk, P., Tkaczyk, M.M., Bialoskorska, M., Schaaper, R.M.,

1998. Unequal fidelity of leading strand and lagging strand DNA replication on

the Escherichia coli chromosome. Proc. Natl. Acad. Sci. U. S. A. 95, 10020–

10025.

Foflonker, F., Ananyev, G., Qiu, H., Morrison, A., Palenik, B., Dismukes, G.C.,

Bhattacharya, D., 2016. The unexpected extremophile: Tolerance to

fluctuating salinity in the green alga Picochlorum. Algal Res. 16, 465–472.

Foflonker, F., Price, D.C., Qiu, H., Palenik, B., Wang, S., Bhattacharya, D., 2015.

Genome of the halotolerant green alga Picochlorum sp. reveals strategies for

thriving under fluctuating environmental conditions. Environ. Microbiol. 17,

412–426.

  191  

Ford, C.B., Lin, P.L., Chase, M.R., Shah, R.R., Iartchouk, O., Galagan, J.,

Mohaideen, N., Ioerger, T.R., Sacchettini, J.C., Lipsitch, M., Flynn, J.L.,

Fortune, S.M., 2011. Use of whole genome sequencing to estimate the

mutation rate of Mycobacterium tuberculosis during latent infection. Nat.

Genet. 43, 482–486.

Foster, P.L., Hanson, A.J., Lee, H., Popodi, E.M., Tang, H., 2013. On the mutational

topology of the bacterial genome. G3 Bethesda Md 3, 399–407.

Foster, P.L., Lee, H., Popodi, E., Townes, J.P., Tang, H., 2015. Determinants of

spontaneous mutation in the bacterium Escherichia coli as revealed by whole-

genome sequencing. Proc. Natl. Acad. Sci. U. S. A. 112, E5990-5999.

Friedl, T., 1995. Inferring Taxonomic Positions and Testing Genus Level

Assignments in Coccoid Green Lichen Algae: A Phylogenetic Analysis of 18s

Ribosomal Rna Sequences from Dictyochloropsis Reticulata and from

Members of the Genus Myrmecia (chlorophyta, Trebouxiophyceae Cl. Nov.)1.

J. Phycol. 31, 632–639.

Friedl, T., Rybalka, N., 2012. Systematics of the Green Algae: A Brief Introduction to

the Current Status. Prog. Bot. 73 259.

Fry, J.D., 2004. On the rate and linearity of viability declines in Drosophila mutation-

accumulation experiments: genomic mutation rates and synergistic epistasis

revisited. Genetics 166, 797–806.

Fry, J.D., 2001. Rapid mutational declines of viability in Drosophila. Genet. Res. 77,

53–60.

Fry, J.D., Heinsohn, S.L., 2002. Environment dependence of mutational parameters

for viability in Drosophila melanogaster. Genetics 161, 1155–1167.

Fry, J.D., Heinsohn, S.L., Mackay, T.F.C., 1996. The Contribution of New Mutations

to Genotype-Environment Interaction for Fitness in Drosophila melanogaster.

Evolution 50, 2316–2327.

Fry, J.D., Keightley, P.D., Heinsohn, S.L., Nuzhdin, S.V., 1999. New estimates of the

rates and effects of mildly deleterious mutation in Drosophila melanogaster.

Proc. Natl. Acad. Sci. U. S. A. 96, 574–579.

Fryxell, K.J., Zuckerkandl, E., 2000. Cytosine deamination plays a primary role in the

evolution of mammalian isochores. Mol. Biol. Evol. 17, 1371–1383.

  192  

Fukui, K., Fukui, K., 2010. DNA Mismatch Repair in Eukaryotes and Bacteria, DNA

Mismatch Repair in Eukaryotes and Bacteria. J. Nucleic Acids J. Nucleic

Acids 2010, 2010, e260512.

Galtier, N., Piganeau, G., Mouchiroud, D., Duret, L., 2001. GC-content evolution in

mammalian genomes: the biased gene conversion hypothesis. Genetics 159,

907–911.

Gao, C., Wang, Y., Shen, Y., Yan, D., He, X., Dai, J., Wu, Q., 2014. Oil accumulation

mechanisms of the oleaginous microalga Chlorella protothecoides revealed

through its genome, transcriptomes, and proteomes. BMC Genomics 15, 582.

Gao, Z., Wyman, M.J., Sella, G., Przeworski, M., 2016. Interpreting the Dependence

of Mutation Rates on Age and Time. PLoS Biol. 14, e1002355.

Garzon-Sanabria, A.J., Davis, R.T., Nikolov, Z.L., 2012. Harvesting Nannochloris

oculata by inorganic electrolyte flocculation: effect of initial cell density, ionic

strength, coagulant dosage, and media pH. Bioresour. Technol. 118, 418–

424.

Gavrilets, S., 1997. Evolution and speciation on holey adaptive landscapes. Trends

Ecol. Evol. 12, 307–312.

Gerken, H.G., Donohoe, B., Knoshaug, E.P., 2013. Enzymatic cell wall degradation

of Chlorella vulgaris and other microalgae for biofuels production. Planta 237,

239–253.

Gillman, L.N., Keeling, D.J., Gardner, R.C., Wright, S.D., 2010. Faster evolution of

highly conserved DNA in tropical plants. J. Evol. Biol. 23, 1327–1330.

Giraud, A., Matic, I., Tenaillon, O., Clara, A., Radman, M., Fons, M., Taddei, F.,

2001. Costs and benefits of high mutation rates: adaptive evolution of bacteria

in the mouse gut. Science 291, 2606–2608.

Glémin, S., 2010. Surprising Fitness Consequences of GC-Biased Gene Conversion:

I. Mutation Load and Inbreeding Depression. Genetics 185, 939–959.

Glémin, S., Arndt, P.F., Messer, P.W., Petrov, D., Galtier, N., Duret, L., 2015.

Quantification of GC-biased gene conversion in the human genome. Genome

Res.

Gojobori, T., Li, W.-H., Graur, D., n.d. Patterns of nucleotide substitution in

pseudogenes and functional genes. J. Mol. Evol. 18, 360–369.

  193  

Gossmann, T.I., Keightley, P.D., Eyre-Walker, A., 2012. The Effect of Variation in the

Effective Population Size on the Rate of Adaptive Molecular Evolution in

Eukaryotes. Genome Biol. Evol. 4, 658–667.

Grimsley, N., Péquin, B., Bachy, C., Moreau, H., Piganeau, G., 2010. Cryptic sex in

the smallest eukaryotic marine green alga. Mol. Biol. Evol. 27, 47–54.

Guillard, R.R.L., Hargraves, P.E., 1993. Stichochrysis immobilis is a diatom, not a

chrysophyte. Phycologia 32, 234–236.

Haag-Liautard, C., Coffey, N., Houle, D., Lynch, M., Charlesworth, B., Keightley,

P.D., 2008. Direct estimation of the mitochondrial DNA mutation rate in

Drosophila melanogaster. PLoS Biol. 6, e204.

Haag-Liautard, C., Dorris, M., Maside, X., Macaskill, S., Halligan, D.L., Houle, D.,

Charlesworth, B., Keightley, P.D., 2007. Direct estimation of per nucleotide

and genomic deleterious mutation rates in Drosophila. Nature 445, 82–85.

Haldane, J.B.S., 1949. The Rate of Mutation of Human Genes. Hereditas 35, 267–

273.

Haldane, J.B.S., 1937. The Effect of Variation of Fitness. Am. Nat. 71, 337–349.

Hall, D.W., Fox, S., Kuzdzal-Fick, J.J., Strassmann, J.E., Queller, D.C., 2013. The

Rate and Effects of Spontaneous Mutation on Fitness Traits in the Social

Amoeba, Dictyostelium discoideum. G3 GenesGenomesGenetics 3, 1115–

1127.

Hall, D.W., Mahmoudizad, R., Hurd, A.W., Joseph, S.B., 2008. Spontaneous

mutations in diploid Saccharomyces cerevisiae: another thousand cell

generations. Genet. Res. 90, 229–241.

Halligan, D.L., Keightley, P.D., 2009. Spontaneous Mutation Accumulation Studies in

Evolutionary Genetics. Annu. Rev. Ecol. Evol. Syst. 40, 151–172.

Hanawalt, P.C., Spivak, G., 2008. Transcription-coupled DNA repair: two decades of

progress and surprises. Nat. Rev. Mol. Cell Biol. 9, 958–970.

Hannon, M., Gimpel, J., Tran, M., Rasala, B., Mayfield, S., 2010. Biofuels from

algae: challenges and potential. Biofuels 1, 763–784.

Harrison, R.J., Charlesworth, B., 2011. Biased Gene Conversion Affects Patterns of

Codon Usage and Amino Acid Usage in the Saccharomyces sensu stricto

Group of Yeasts. Mol. Biol. Evol. 28, 117–129.

Henley, W.J., Hironaka, J.L., Guillou, L., Buchheim, M.A., Buchheim, J.A., Fawley,

M.W., Fawley, K.P., 2004. Phylogenetic analysis of the “Nannochloris-like”

  194  

algae and diagnoses of Picochlorum oklahomensis gen. et sp. nov.

(Trebouxiophyceae, Chlorophyta). Phycologia 43, 641–652.

Henley, W.J., Major, K.M., Hironaka, J.L., 2002. Response to Salinity and Heat

Stress in Two Halotolerant Chlorophyte Algae1. J. Phycol. 38, 757–766.

Henry, L., Schwander, T., Crespi, B.J., 2012. Deleterious Mutation Accumulation in

Asexual Timema Stick Insects. Mol. Biol. Evol. 29, 401–408.

Hermisson, J., Pennings, P.S., 2005. Soft Sweeps Molecular Population Genetics of

Adaptation From Standing Genetic Variation. Genetics 169, 2335–2352.

Hershberg, R., Petrov, D.A., 2010. Evidence That Mutation Is Universally Biased

towards AT in Bacteria. PLoS Genet 6, e1001115.

Hestand, M.S., Houdt, J.V., Cristofoli, F., Vermeesch, J.R., 2016. Polymerase

specific error rates and profiles identified by single molecule sequencing.

Mutat. Res. Mol. Mech. Mutagen. 784–785, 39–45.

Higgins, K., Lynch, M., 2001. Metapopulation extinction caused by mutation

accumulation. Proc. Natl. Acad. Sci. U. S. A. 98, 2928–2933.

Hildebrand, F., Meyer, A., Eyre-Walker, A., 2010. Evidence of Selection upon

Genomic GC-Content in Bacteria. PLoS Genet. 6.

Hodgkinson, A., Eyre-Walker, A., 2011. Variation in the mutation rate across

mammalian genomes. Nat. Rev. Genet. 12, 756–766.

Hold, G.L., Smith, E.A., Rappé, M.S., Maas, E.W., Moore, E.R.., Stroempl, C.,

Stephen, J.R., Prosser, J.I., Birkbeck, T.H., Gallacher, S., 2001.

Characterisation of bacterial communities associated with toxic and non-toxic

dinoflagellates: Alexandrium spp. and Scrippsiella trochoidea. FEMS

Microbiol. Ecol. 37, 161–173.

Hopwood, D.A., 1997. Genetic Contributions to Understanding Polyketide

Synthases. Chem. Rev. 97, 2465–2498.

Houle, D., 1992. Comparing Evolvability and Variability of Quantitative Traits.

Genetics 130, 195–204.

Houle, D., Hoffmaster, D.K., Assimacopoulos, S., Charlesworth, B., 1992. The

genomic mutation rate for fitness in Drosophila. Nature 359, 58–60.

Hubscher, U., Maga, G., Spadari, S., 2002. Eukaryotic DNA polymerases. Annu.

Rev. Biochem. 71, 133–163.

Hudson, R.E., Bergthorsson, U., Roth, J.R., Ochman, H., 2002. Effect of

chromosome location on bacterial mutation rates. Mol. Biol. Evol. 19, 85–92.

  195  

Huey, R.B., Gilchrist, G.W., Ward, K., Maves, L., Pepin, D., Houle, D., 2003.

Mutation Accumulation, Performance, Fitness. Integr. Comp. Biol. 43, 387–

395.

Hurst, L.D., Williams, E.J., 2000. Covariation of GC content and the silent site

substitution rate in rodents: implications for methodology and for the evolution

of isochores. Gene 261, 107–114.

Ikemura, T., 1981. Correlation between the abundance of Escherichia coli transfer

RNAs and the occurrence of the respective codons in its protein genes: a

proposal for a synonymous codon choice that is optimal for the E. coli

translational system. J. Mol. Biol. 151, 389–409.

Jancek, S., Gourbière, S., Moreau, H., Piganeau, G., 2008. Clues about the genetic

basis of adaptation emerge from comparing the proteomes of two

Ostreococcus ecotypes (Chlorophyta, Prasinophyceae). Mol. Biol. Evol. 25,

2293–2300.

Jardillier, L., Zubkov, M.V., Pearman, J., Scanlan, D.J., 2010. Significant CO2

fixation by small prymnesiophytes in the subtropical and tropical northeast

Atlantic Ocean. ISME J. 4, 1180–1192.

Jiang, C., Mithani, A., Belfield, E.J., Mott, R., Hurst, L.D., Harberd, N.P., 2014.

Environmentally responsive genome-wide accumulation of de novo

Arabidopsis thaliana mutations and epimutations. Genome Res. 24, 1821–

1829.

Jiricny, J., 2006. The multifaceted mismatch-repair system. Nat. Rev. Mol. Cell Biol.

7, 335–346.

Jones, P.A., 2012. Functions of DNA methylation: islands, start sites, gene bodies

and beyond. Nat. Rev. Genet. 13, 484–492.

Joseph, S.B., Hall, D.W., 2004. Spontaneous Mutations in Diploid Saccharomyces

cerevisiae. Genetics 168, 1817–1825.

Kaity, A., Ashmore, S.E., Drew, R.A., Dulloo, M.E., 2008. Assessment of genetic and

epigenetic changes following cryopreservation in papaya. Plant Cell Rep. 27,

1529–1539.

Katju, V., Packard, L.B., Bu, L., Keightley, P.D., Bergthorsson, U., 2014. Fitness

decline in spontaneous mutation accumulation lines of Caenorhabditis

elegans with varying effective population sizes. Evol. Int. J. Org. Evol.

  196  

Kavanaugh, C.M., Shaw, R.G., 2005. The contribution of spontaneous mutation to

variation in environmental responses of Arabidopsis thaliana: responses to

light. Evol. Int. J. Org. Evol. 59, 266–275.

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S.,

Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B.,

Meintjes, P., Drummond, A., 2012. Geneious Basic: an integrated and

extendable desktop software platform for the organization and analysis of

sequence data. Bioinforma. Oxf. Engl. 28, 1647–1649.

Keightley, P.D., 1994. The Distribution of Mutation Effects on Viability in Drosophila

melanogaster. Genetics 138, 1315–1322.

Keightley, P.D., Bataillon, T.M., 2000. Multigeneration maximum-likelihood analysis

applied to mutation-accumulation experiments in Caenorhabditis elegans.

Genetics 154, 1193–1201.

Keightley, P.D., Caballero, A., 1997. Genomic mutation rates for lifetime reproductive

output and lifespan in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A.

94, 3823–3827.

Keightley, P.D., Eyre-Walker, A., 1999. Terumi Mukai and the Riddle of Deleterious

Mutation Rates. Genetics 153, 515–523.

Keightley, P.D., Ness, R.W., Halligan, D.L., Haddrill, P.R., 2014a. Estimation of the

spontaneous mutation rate per nucleotide site in a Drosophila melanogaster

full-sib family. Genetics 196, 313–320.

Keightley, P.D., Pinharanda, A., Ness, R.W., Simpson, F., Dasmahapatra, K.K.,

Mallet, J., Davey, J.W., Jiggins, C.D., 2014b. Estimation of the spontaneous

mutation rate in Heliconius melpomene. Mol. Biol. Evol.

Keightley, P.D., Trivedi, U., Thomson, M., Oliver, F., Kumar, S., Blaxter, M.L., 2009.

Analysis of the genome sequences of three Drosophila melanogaster

spontaneous mutation accumulation lines. Genome Res. 19, 1195–1201.

Kibota, T.T., Lynch, M., 1996. Estimate of the genomic mutation rate deleterious to

overall fitness in E. coll. Nature 381, 694–696.

Kim, N., Jinks-Robertson, S., 2012. Transcription as a source of genome instability.

Nat. Rev. Genet. 13, 204–214.

Kimura, M., 1991. The neutral theory of molecular evolution: a review of recent

evidence. Idengaku Zasshi 66, 367–386.

  197  

Kimura, M., 1987. Molecular evolutionary clock and the neutral theory. J. Mol. Evol.

26, 24–33.

Kimura, M., 1968. Evolutionary rate at the molecular level. Nature 217, 624–626.

Kishony, R., Leibler, S., 2003. Environmental stresses can alleviate the average

deleterious effect of mutations. J. Biol. 2, 14.

Klapacz, J., Bhagwat, A.S., 2002. Transcription-dependent increase in multiple

classes of base substitution mutations in Escherichia coli. J. Bacteriol. 184,

6866–6872.

Knudson, A.G., 2000. Chasing the Cancer Demon. Annu. Rev. Genet. 34, 1–19.

Kondrashov, A.S., 1995. Contamination of the genome by very slightly deleterious

mutations: why have we not died 100 times over? J. Theor. Biol. 175, 583–

594.

Kondrashov, A.S., 1988. Deleterious mutations and the evolution of sexual

reproduction. Nature 336, 435–440.

Kondrashov, A.S., Houle, D., 1994. Genotype-environment interactions and the

estimation of the genomic mutation rate in Drosophila melanogaster. Proc.

Biol. Sci. 258, 221–227.

Korona, R., 1999. Genetic Load of the Yeast Saccharomyces cerevisiae under

Diverse Environmental Conditions. Evolution 53, 1966–1971.

Kraemer, S.A., Morgan, A.D., Ness, R.W., Keightley, P.D., Colegrave, N., 2015.

Fitness effects of new mutations in Chlamydomonas reinhardtii across two

stress gradients. J. Evol. Biol. n/a-n/a.

Krasovec, M., Eyre-Walker, A., Grimsley, N., Salmeron, C., Pecqueur, D., Piganeau,

G., Sanchez-Ferandin, S., 2016. Fitness Effects of Spontaneous Mutations in

Picoeukaryotic Marine Green Algae. G3 GenesGenomesGenetics 6, 2063–

2071.

Kucukyildirim, S., Long, H., Sung, W., Miller, S.F., Doak, T.G., Lynch, M., 2016. The

Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis,

a Bacterium Naturally Devoid of the Post-replicative Mismatch Repair

Pathway. G3 GenesGenomesGenetics g3.116.030130.

Kunkel, T.A., Bebenek, and K., 2000. DNA Replication Fidelity. Annu. Rev.

Biochem. 69, 497–529.

Kunkel, T.A., Erie, D.A., 2015. Eukaryotic Mismatch Repair in Relation to DNA

Replication. Annu. Rev. Genet. 49, null.

  198  

Kuo, C.-H., Ochman, H., 2009. Deletional Bias across the Three Domains of Life.

Genome Biol. Evol. 1, 145–152.

Laird, C.D., McConaughy, B.L., McCarthy, B.J., 1969. Rate of Fixation of Nucleotide

Substitutions in Evolution. Nature 224, 149–154.

Laity, J.H., Lee, B.M., Wright, P.E., 2001. Zinc finger proteins: new insights into

structural and functional diversity. Curr. Opin. Struct. Biol. 11, 39–46.

Lande, R., 1998. Risk of population extinction from fixation of deleterious and

reverse mutations. Genetica 102–103, 21–27.

Lande, R., 1994. Risk of Population Extinction from Fixation of New Deleterious

Mutations. Evolution 48, 1460–1469.

Lande, R., 1988. Genetics and demography in biological conservation. Science 241,

1455–1460.

Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C et al., 2001. Initial

sequencing and analysis of the human genome. Nature 409, 860–921.

Lanfear, R., Kokko, H., Eyre-Walker, A., 2014. Population size and the rate of

evolution. Trends Ecol. Evol. 29, 33–41.

Lang, G.I., Murray, A.W., 2008. Estimating the per-base-pair mutation rate in the

yeast Saccharomyces cerevisiae. Genetics 178, 67–82.

Lang, G.I., Parsons, L., Gammie, A.E., 2013. Mutation rates, spectra, and genome-

wide distribution of spontaneous mutations in mismatch repair deficient yeast.

G3 Bethesda Md 3, 1453–1465.

Laroche, J., Li, P., Maggia, L., Bousquet, J., 1997. Molecular evolution of

angiosperm mitochondrial introns and exons. Proc. Natl. Acad. Sci. U. S. A.

94, 5722–5727.

Lassalle, F., Périan, S., Bataillon, T., Nesme, X., Duret, L., Daubin, V., 2015. GC-

Content Evolution in Bacterial Genomes: The Biased Gene Conversion

Hypothesis Expands. PLoS Genet 11, e1004941.

Latta, L.C., Morgan, K.K., Weaver, C.S., Allen, D., Schaack, S., Lynch, M., 2013.

Genomic background and generation time influence deleterious mutation

rates in Daphnia. Genetics 193, 539–544.

Laughlin, D.C., Messier, J., 2015. Fitness of multidimensional phenotypes in

dynamic adaptive landscapes. Trends Ecol. Evol. 30, 487–496.

  199  

Lee, H., Popodi, E., Tang, H., Foster, P.L., 2012. Rate and molecular spectrum of

spontaneous mutations in the bacterium Escherichia coli as determined by

whole-genome sequencing. Proc. Natl. Acad. Sci. U. S. A. 109, E2774-2783.

Leliaert, F., Smith, D.R., Moreau, H., Herron, M.D., Verbruggen, H., Delwiche, C.F.,

Clerck, O.D., 2012. Phylogeny and Molecular Evolution of the Green Algae.

Crit. Rev. Plant Sci. 31, 1–46.

Lesecque, Y., Mouchiroud, D., Duret, L., 2013. GC-Biased Gene Conversion in

Yeast Is Specifically Associated with Crossovers: Molecular Mechanisms and

Evolutionary Significance. Mol. Biol. Evol. 30, 1409–1419.

Lewis, C.A., Crayle, J., Zhou, S., Swanstrom, R., Wolfenden, R., 2016. Cytosine

deamination and the precipitous decline of spontaneous mutation during

Earth’s history. Proc. Natl. Acad. Sci. U. S. A. 113, 8194–8199.

Lewis, L.A., McCourt, R.M., 2004. Green algae and the origin of land plants. Am. J.

Bot. 91, 1535–1556.

Li, G.-M., 2008. Mechanisms and functions of DNA mismatch repair. Cell Res. 18,

85–98.

Li, H., Durbin, R., 2010. Fast and accurate long-read alignment with Burrows–

Wheeler transform. Bioinformatics 26, 589–595.

Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G.,

Abecasis, G., Durbin, R., 1000 Genome Project Data Processing Subgroup,

2009. The Sequence Alignment/Map format and SAMtools. Bioinforma. Oxf.

Engl. 25, 2078–2079.

Li, J., Deng, H.-W., 2005. Estimation of the rate and effects of deleterious genomic

mutations in finite populations with linkage disequilibrium. Heredity 95, 59–68.

Li, W.K.W., 1994. Primary production of prochlorophytes, cyanobacteria, and

eucaryotic ultraphytoplankton: Measurements from flow cytometric sorting.

Limnol. Oceanogr. 39, 169–175.

Lind, P.A., Andersson, D.I., 2008. Whole-genome mutational biases in bacteria.

Proc. Natl. Acad. Sci. U. S. A. 105, 17878–17883.

Long, H., Kucukyildirim, S., Sung, W., Williams, E., Lee, H., Ackerman, M., Doak,

T.G., Tang, H., Lynch, M., 2015a. Background Mutational Features of the

Radiation-Resistant Bacterium Deinococcus radiodurans. Mol. Biol. Evol. 32,

2383–2392.

  200  

Long, H., Sung, W., Miller, S.F., Ackerman, M.S., Doak, T.G., Lynch, M., 2015b.

Mutation rate, spectrum, topology, and context-dependency in the DNA

mismatch repair-deficient Pseudomonas fluorescens ATCC948. Genome Biol.

Evol. 7, 262–271.

Lujan, S.A., Clausen, A.R., Clark, A.B., MacAlpine, H.K., MacAlpine, D.M., Malc,

E.P., Mieczkowski, P.A., Burkholder, A.B., Fargo, D.C., Gordenin, D.A.,

Kunkel, T.A., 2014. Heterogeneous polymerase fidelity and mismatch repair

bias genome variation and composition. Genome Res. 24, 1751–1764.

Lynch, M., 2010a. Evolution of the mutation rate. Trends Genet. TIG 26, 345–352.

Lynch, M., 2010b. Rate, molecular spectrum, and consequences of human mutation.

Proc. Natl. Acad. Sci. 107, 961–968.

Lynch, M., 2008. The Cellular, Developmental and Population-Genetic Determinants

of Mutation-Rate Evolution. Genetics 180, 933–943.

Lynch, M., Blanchard, J., Houle, D., Kibota, T., Schultz, S., Vassilieva, L., Willis, J.,

1999. Perspective: Spontaneous Deleterious Mutation. Evolution 53, 645–

663.

Lynch, M., Conery, J., Burger, R., 1995. Mutation Accumulation and the Extinction of

Small Populations. Am. Nat. 146, 489–518.

Lynch, M., Gabriel, W., 1990. Mutation Load and the Survival of Small Populations.

Evolution 44, 1725–1737.

Lynch, M., Hagner, K., 2015. Evolutionary meandering of intermolecular interactions

along the drift barrier. Proc. Natl. Acad. Sci. 112, E30–E38.

Lynch, M., Sung, W., Morris, K., Coffey, N., Landry, C.R., Dopman, E.B., Dickinson,

W.J., Okamoto, K., Kulkarni, S., Hartl, D.L., Thomas, W.K., 2008. A genome-

wide view of the spectrum of spontaneous mutations in yeast. Proc. Natl.

Acad. Sci. U. S. A. 105, 9272–9277.

Ma, X., Rogacheva, M.V., Nishant, K.T., Zanders, S., Bustamante, C.D., Alani, E.,

2012. Mutation hotspots in yeast caused by long-range clustering of

homopolymeric sequences. Cell Rep. 1, 36–42.

Maki, H., 2002. Origins of Spontaneous Mutations: Specificity and Directionality of

Base-Substitution, Frameshift, and Sequence-Substitution Mutageneses.

Annu. Rev. Genet. 36, 279–303.

  201  

Marin, B., Melkonian, M., 2010. Molecular phylogeny and classification of the

Mamiellophyceae class. nov. (Chlorophyta) based on sequence comparisons

of the nuclear- and plastid-encoded rRNA operons. Protist 161, 304–336.

Martin, A.P., Palumbi, S.R., 1993. Body size, metabolic rate, generation time, and

the molecular clock. Proc. Natl. Acad. Sci. U. S. A. 90, 4087–4091.

Martin, C.H., Wainwright, P.C., 2013. Multiple Fitness Peaks on the Adaptive

Landscape Drive Adaptive Radiation in the Wild. Science 339, 208–211.

Martin, G., Lenormand, T., 2006. The fitness effect of mutations across

environments: a survey in light of fitness landscape models. Evol. Int. J. Org.

Evol. 60, 2413–2427.

Martincorena, I., Luscombe, N.M., 2013. Non-random mutation: the evolution of

targeted hypermutation and hypomutation. BioEssays News Rev. Mol. Cell.

Dev. Biol. 35, 123–130.

Martincorena, I., Seshasayee, A.S.N., Luscombe, N.M., 2012. Evidence of non-

random mutation rates suggests an evolutionary risk management strategy.

Nature 485, 95–98.

Martinez, J.S., Carter-Franklin, J.N., Mann, E.L., Martin, J.D., Haygood, M.G., Butler,

A., 2003. Structure and membrane affinity of a suite of amphiphilic

siderophores produced by a marine bacterium. Proc. Natl. Acad. Sci. 100,

3754–3759.

Martinez, J.S., Zhang, G.P., Holt, P.D., Jung, H.T., Carrano, C.J., Haygood, M.G.,

Butler, A., 2000. Self-assembling amphiphilic siderophores from marine

bacteria. Science 287, 1245–1247.

Massana, R., 2011. Eukaryotic picoplankton in surface oceans. Annu. Rev.

Microbiol. 65, 91–110.

Mata, T.M., Martins, A.A., Caetano, N.S., 2010. Microalgae for biodiesel production

and other applications: A review. Renew. Sustain. Energy Rev. 14, 217–232.

Mateyak, M.K., Zakian, V.A., 2006. Human PIF helicase is cell cycle regulated and

associates with telomerase. Cell Cycle Georget. Tex 5, 2796–2804.

Matsuba, C., Ostrow, D.G., Salomon, M.P., Tolani, A., Baer, C.F., 2013.

Temperature, stress and spontaneous mutation in Caenorhabditis briggsae

and Caenorhabditis elegans. Biol. Lett. 9, 20120334.

Matuszewski, S., Hermisson, J., Kopp, M., 2014. Fisher’s geometric model with a

moving optimum. Evol. Int. J. Org. Evol. 68, 2571–2588.

  202  

Mittelbach, G.G., Schemske, D.W., Cornell, H.V., Allen, A.P., Brown, J.M et al.,

2007. Evolution and the latitudinal diversity gradient: speciation, extinction

and biogeography. Ecol. Lett. 10, 315–331.

Mooers, A.O., Harvey, P.H., 1994. Metabolic rate, generation time, and the rate of

molecular evolution in birds. Mol. Phylogenet. Evol. 3, 344–350.

Moreau, H., Verhelst, B., Couloux, A., Derelle, E., Rombauts, S., Grimsley, N., Van

Bel, M., Poulain, J., Katinka, M., Hohmann-Marriott, M.F., Piganeau, G.,

Rouzé, P., Da Silva, C., Wincker, P., Van de Peer, Y., Vandepoele, K., 2012.

Gene functionalities and genome structure in Bathycoccus prasinos reflect

cellular specializations at the base of the green lineage. Genome Biol. 13,

R74.

Morgan, A.D., Ness, R.W., Keightley, P.D., Colegrave, N., 2014. Spontaneous

mutation accumulation in multiple strains of the green alga, Chlamydomonas

reinhardtii. Evolution 68, 2589–2602.

Mousseau, T.A., Roff, D.A., 1987. Natural selection and the heritability of fitness

components. Heredity 59 ( Pt 2), 181–197.

Mugal, C.F., Arndt, P.F., Ellegren, H., 2013. Twisted signatures of GC-biased gene

conversion embedded in an evolutionary stable karyotype. Mol. Biol. Evol. 30,

1700–1712.

Mukai, T., 1964. The Genetic Structure of Natural Populations of Drosophila

melanogaster. I. Spontaneous Mutation Rate of Polygenes Controlling

Viability. Genetics 50, 1–19.

Muller, H.J., 1950. Our load of mutations. Am. J. Hum. Genet. 2, 111–176.

Muller, H.J., 1928. The Measurement of Gene Mutation Rate in Drosophila, Its High

Variability, and Its Dependence upon Temperature. Genetics 13, 279–357.

Muller, H.J., 1927. Artificial Transmutation of the Gene. Science 66, 84–87.

Nahum, J.R., Godfrey-Smith, P., Harding, B.N., Marcus, J.H., Carlson-Stevermer, J.,

Kerr, B., 2015. A tortoise–hare pattern seen in adapting structured and

unstructured populations suggests a rugged fitness landscape in bacteria.

Proc. Natl. Acad. Sci. 112, 7530–7535.

Neiman, M., Hehman, G., Miller, J.T., Logsdon, J.M., Taylor, D.R., 2010. Accelerated

mutation accumulation in asexual lineages of a freshwater snail. Mol. Biol.

Evol. 27, 954–963.

  203  

Ness, R.W., Kraemer, S.A., Colegrave, N., Keightley, P.D., 2015a. Direct estimate of

the spontaneous mutation rate uncovers the effects of drift and recombination

in the Chlamydomonas reinhardtii plastid genome. Mol. Biol. Evol.

Ness, R.W., Morgan, A.D., Colegrave, N., Keightley, P.D., Ness, R.W., Morgan,

A.D., Colegrave, N., Keightley, P.D., 2012. Estimate of the Spontaneous

Mutation Rate in Chlamydomonas reinhardtii. Genetics 192, 1447–1454.

Ness, R.W., Morgan, A.D., Vasanthakrishnan, R.B., Colegrave, N., Keightley, P.D.,

2015b. Extensive de novo mutation rate variation between individuals and

across the genome of Chlamydomonas reinhardtii. Genome Res. 25, 1739–

1749.

Not, F., Siano, R., Kooistra, W.H.C.F., Simon, N., Vaulot, D., Probert, I., 2012.

Diversity and Ecology of Eukaryotic Marine Phytoplankton. Adv. Bot. Res.

Orr, H.A., 2005. The genetic theory of adaptation: a brief history. Nat. Rev. Genet. 6,

119–127.

Ossowski, S., Schneeberger, K., Lucas-Lledó, J.I., Warthmann, N., Clark, R.M.,

Shaw, R.G., Weigel, D., Lynch, M., 2010. The rate and molecular spectrum of

spontaneous mutations in Arabidopsis thaliana. Science 327, 92–94.

Ota, S., Matsuda, T., Takeshita, T., Yamazaki, T., Kazama, Y., Abe, T., Kawano, S.,

2013. Phenotypic spectrum of Parachlorella kessleri (Chlorophyta) mutants

produced by heavy-ion irradiation. Bioresour. Technol. 149, 432–438.

Palenik, B., Grimwood, J., Aerts, A., Rouzé, P., Salamov, A et al., 2007. The tiny

eukaryote Ostreococcus provides genomic insights into the paradox of

plankton speciation. Proc. Natl. Acad. Sci. U. S. A. 104, 7705–7710.

Park, C., Qian, W., Zhang, J., 2012. Genomic evidence for elevated mutation rates in

highly expressed genes. EMBO Rep. 13, 1123–1129.

Park, S.-J., Choi, Y.-E., Kim, E.J., Park, W.-K., Kim, C.W., Yang, J.-W., 2012. Serial

optimization of biomass production using microalga Nannochloris oculata and

corresponding lipid biosynthesis. Bioprocess Biosyst. Eng. 35, 3–9.

Paul, S., Million-Weaver, S., Chattopadhyay, S., Sokurenko, E., Merrikh, H., 2013.

Accelerated gene evolution through replication-transcription conflicts. Nature

495, 512–515.

Perrineau, M.-M., Gross, J., Zelzion, E., Price, D.C., Levitan, O., Boyd, J.,

Bhattacharya, D., 2014. Using Natural Selection to Explore the Adaptive

Potential of Chlamydomonas reinhardtii. PLOS ONE 9, e92533.

  204  

Petren, K., 2013. The Evolution of Landscape Genetics. Evolution 67, 3383–3385.

Phifer-Rixey, M., Bonhomme, F., Boursot, P., Churchill, G.A., Piálek, J., Tucker,

P.K., Nachman, M.W., 2012. Adaptive Evolution and Effective Population Size

in Wild House Mice. Mol. Biol. Evol. 29, 2949–2955.

Piganeau, G., Eyre-Walker, A., Jancek, S., Grimsley, N., Moreau, H., 2011a. How

and why DNA barcodes underestimate the diversity of microbial eukaryotes.

PloS One 6, e16342.

Piganeau, G., Grimsley, N., Moreau, H., 2011b. Genome diversity in the smallest

marine photosynthetic eukaryotes. Res. Microbiol. 162, 570–577.

Pinter, S.F., Aubert, S.D., Zakian, V.A., 2008. The Schizosaccharomyces pombe

Pfh1p DNA helicase is essential for the maintenance of nuclear and

mitochondrial DNA. Mol. Cell. Biol. 28, 6594–6608.

Polak, P., Arndt, P.F., 2008. Transcription induces strand-specific mutations at the 5’

end of human genes. Genome Res. 18, 1216–1223.

Pombert, J.-F., Blouin, N.A., Lane, C., Boucias, D., Keeling, P.J., 2014. A lack of

parasitic reduction in the obligate parasitic green alga Helicosporidium. PLoS

Genet. 10, e1004355.

Project, the 1000 G., 2011. Variation in genome-wide mutation rates within and

between human families. Nat. Genet. 43, 712–714.

Qiu, H., Price, D.C., Weber, A.P.M., Reeb, V., Yang, E.C., Lee, J.M., Kim, S.Y.,

Yoon, H.S., Bhattacharya, D., 2013. Adaptation through horizontal gene

transfer in the cryptoendolithic red alga Galdieria phlegrea. Curr. Biol. CB 23,

R865-866.

Raymond, J.A., 2014. The ice-binding proteins of a snow alga, Chloromonas

brevispina: probable acquisition by horizontal gene transfer. Extrem. Life

Extreme Cond. 18, 987–994.

Read, B.A., Kegel, J., Klute, M.J., Kuo, A., Lefebvre, S.C et al., 2013. Pan genome

of the phytoplankton Emiliania underpins its global distribution. Nature 499,

209–213.

Rebolledo-Jaramillo, B., Su, M.S.-W., Stoler, N., McElhoe, J.A., Dickins, B.,

Blankenberg, D., Korneliussen, T.S., Chiaromonte, F., Nielsen, R., Holland,

M.M., Paul, I.M., Nekrutenko, A., Makova, K.D., 2014. Maternal age effect and

severe germ-line bottleneck in the inheritance of human mitochondrial DNA.

Proc. Natl. Acad. Sci. 111, 15474–15479.

  205  

Rodríguez, F., Derelle, E., Guillou, L., Le Gall, F., Vaulot, D., Moreau, H., 2005.

Ecotype diversity in the marine picoeukaryote Ostreococcus (Chlorophyta,

Prasinophyceae). Environ. Microbiol. 7, 853–859.

Rolland, J., Condamine, F.L., Jiguet, F., Morlon, H., 2014. Faster speciation and

reduced extinction in the tropics contribute to the Mammalian latitudinal

diversity gradient. PLoS Biol. 12, e1001775.

Rozen, D.E., Habets, M.G.J.L., Handel, A., de Visser, J.A.G.M., 2008.

Heterogeneous Adaptive Trajectories of Small Populations on Complex

Fitness Landscapes. PLoS ONE 3, e1715.

Rumin, J., Bonnefond, H., Saint-Jean, B., Rouxel, C., Sciandra, A., Bernard, O.,

Cadoret, J.-P., Bougaran, G., 2015. The use of fluorescent Nile red and

BODIPY for lipid measurement in microalgae. Biotechnol. Biofuels 8, 42.

Rutter, M.T., Roles, A., Conner, J.K., Shaw, R.G., Shaw, F.H., Schneeberger, K.,

Ossowski, S., Weigel, D., Fenster, C.B., 2012. Fitness of Arabidopsis thaliana

mutation accumulation lines whose spontaneous mutations are known. Evol.

Int. J. Org. Evol. 66, 2335–2339.

Salk, J.J., Fox, E.J., Loeb, L.A., 2010. Mutational Heterogeneity in Human Cancers:

Origin and Consequences. Annu. Rev. Pathol. Mech. Dis. 5, 51–75.

Saxer, G., Havlak, P., Fox, S.A., Quance, M.A., Gupta, S., Fofanov, Y., Strassmann,

J.E., Queller, D.C., 2012. Whole genome sequencing of mutation

accumulation lines reveals a low mutation rate in the social amoeba

Dictyostelium discoideum. PloS One 7, e46759.

Schaack, S., Allen, D.E., Latta, L.C., Morgan, K.K., Lynch, M., 2013. The effect of

spontaneous mutations on competitive ability. J. Evol. Biol. 26, 451–456.

Schäfer, H., Abbas, B., Witte, H., Muyzer, G., 2002. Genetic diversity of “satellite”

bacteria present in cultures of marine diatoms. FEMS Microbiol. Ecol. 42, 25–

35.

Schaum, C.E., Collins, S., 2014. Plasticity predicts evolution in a marine alga. Proc.

Biol. Sci. 281.

Schaum, C.-E., Rost, B., Collins, S., 2015. Environmental stability affects phenotypic

evolution in a globally distributed marine picoplankton. ISME J.

Scheinin, M., Riebesell, U., Rynearson, T.A., Lohbeck, K.T., Collins, S., 2015.

Experimental evolution gone wild. J. R. Soc. Interface 12, 20150056.

  206  

Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B.,

Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres,

B., Thallinger, G.G., Horn, D.J.V., Weber, C.F., 2009. Introducing mothur:

Open-Source, Platform-Independent, Community-Supported Software for

Describing and Comparing Microbial Communities. Appl. Environ. Microbiol.

75, 7537–7541.

Schönknecht, G., Chen, W.-H., Ternes, C.M., Barbier, G.G., Shrestha, R.P., Stanke,

M., Bräutigam, A., Baker, B.J., Banfield, J.F., Garavito, R.M., Carr, K.,

Wilkerson, C., Rensing, S.A., Gagneul, D., Dickenson, N.E., Oesterhelt, C.,

Lercher, M.J., Weber, A.P.M., 2013. Gene Transfer from Bacteria and

Archaea Facilitated Evolution of an Extremophilic Eukaryote. Science 339,

1207–1210.

Schönknecht, G., Weber, A.P.M., Lercher, M.J., 2014. Horizontal gene acquisitions

by eukaryotes as drivers of adaptive evolution. BioEssays 36, 9–20.

Schrider, D.R., Houle, D., Lynch, M., Hahn, M.W., 2013. Rates and genomic

consequences of spontaneous mutational events in Drosophila melanogaster.

Genetics 194, 937–954.

Schrider, D.R., Hourmozdi, J.N., Hahn, M.W., 2011. Pervasive multinucleotide

mutational events in eukaryotes. Curr. Biol. CB 21, 1051–1054.

Schröder, J., Schröder, G., 1990. Stilbene and chalcone synthases: related enzymes

with key functions in plant-specific pathways. Z. Für Naturforschung C J.

Biosci. 45, 1–8.

Schroeder, J.W., Hirst, W.G., Szewczyk, G.A., Simmons, L.A., 2016. The Effect of

Local Sequence Context on Mutational Bias of Genes Encoded on the

Leading and Lagging Strands. Curr. Biol. CB.

Schultz, S.T., Lynch, M., Willis, J.H., 1999. Spontaneous deleterious mutation in

Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 96, 11393–11398.

Schwartz, D.C., Cantor, C.R., 1984. Separation of yeast chromosome-sized DNAs

by pulsed field gradient gel electrophoresis. Cell 37, 67–75.

Shapiro, J.A., Huang, W., Zhang, C., Hubisz, M.J., Lu, J., Turissini, D.A., Fang, S.,

Wang, H.-Y., Hudson, R.R., Nielsen, R., Chen, Z., Wu, C.-I., 2007. Adaptive

genic evolution in the Drosophila genomes. Proc. Natl. Acad. Sci. U. S. A.

104, 2271–2276.

  207  

Sharp, N.P., Agrawal, A.F., 2012. Evidence for elevated mutation rates in low-quality

genotypes. Proc. Natl. Acad. Sci. U. S. A. 109, 6142–6146.

Shaw, R.G., Byers, D.L., Darmo, E., 2000. Spontaneous Mutational Effects on

Reproductive Traits of Arabidopsis thaliana. Genetics 155, 369–378.

Shor, E., Fox, C.A., Broach, J.R., 2013. The Yeast Environmental Stress Response

Regulates Mutagenesis Induced by Proteotoxic Stress. PLOS Genet 9,

e1003680.

Simpson, J.T., Durbin, R., 2012. Efficient de novo assembly of large genomes using

compressed data structures. Genome Res. 22, 549–556.

Simpson, J.T., Wong, K., Jackman, S.D., Schein, J.E., Jones, S.J.M., Birol, I., 2009.

ABySS: a parallel assembler for short read sequence data. Genome Res. 19,

1117–1123.

Šlapeta, J., López-García, P., Moreira, D., 2006. Global Dispersal and Ancient

Cryptic Species in the Smallest Marine Eukaryotes. Mol. Biol. Evol. 23, 23–29.

Smeds, L., Qvarnstrom, A., Ellegren, H., 2016. Direct estimate of the rate of germline

mutation in a bird. Genome Res.

Smith, D.R., 2015. Mutation rates in plastid genomes: they are lower than you might

think. Genome Biol. Evol. 7, 1227–1234.

Sniegowski, P.D., Gerrish, P.J., Lenski, R.E., 1997. Evolution of high mutation rates

in experimental populations of E. coli. Nature 387, 703–705.

Stamatoyannopoulos, J.A., Adzhubei, I., Thurman, R.E., Kryukov, G.V., Mirkin, S.M.,

Sunyaev, S.R., 2009. Human mutation rate associated with DNA replication

timing. Nat. Genet. 41, 393–395.

Steinberg, B., Ostermeier, M., 2016. Environmental changes bridge evolutionary

valleys. Sci. Adv. 2, e1500921.

Sterck, L., Billiau, K., Abeel, T., Rouzé, P., Van de Peer, Y., 2012. ORCAE: online

resource for community annotation of eukaryotes. Nat. Methods 9, 1041.

Subirana, L., Péquin, B., Michely, S., Escande, M.-L., Meilland, J., Derelle, E., Marin,

B., Piganeau, G., Desdevises, Y., Moreau, H., Grimsley, N.H., 2013.

Morphology, Genome Plasticity, and Phylogeny in the Genus Ostreococcus

Reveal a Cryptic Species, O. mediterraneus sp. nov. (Mamiellales,

Mamiellophyceae). Protist 164, 643–659.

Sueoka, N., 1962. On the genetic basis of variation and heterogeneity of DNA base

composition. Proc. Natl. Acad. Sci. U. S. A. 48, 582–592.

  208  

Sullivan, S., Petersen, J., Blackwood, L., Papanatsiou, M., Christie, J.M., 2015.

Functional characterization of Ostreococcus tauri phototropin. New Phytol.

Sung, W., Ackerman, M.S., Gout, J.-F., Miller, S.F., Williams, E., Foster, P.L., Lynch,

M., 2015. Asymmetric Context-Dependent Mutation Patterns Revealed

through Mutation–Accumulation Experiments. Mol. Biol. Evol. 32, 1672–1683.

Sung, W., Ackerman, M.S., Miller, S.F., Doak, T.G., Lynch, M., 2012a. Drift-barrier

hypothesis and mutation-rate evolution. Proc. Natl. Acad. Sci. U. S. A. 109,

18488–18492.

Sung, W., Tucker, A.E., Doak, T.G., Choi, E., Thomas, W.K., Lynch, M., 2012b.

Extraordinary genome stability in the ciliate Paramecium tetraurelia. Proc.

Natl. Acad. Sci. U. S. A. 109, 19339–19344.

Taddei, F., Radman, M., Maynard-Smith, J., Toupance, B., Gouyon, P.H., Godelle,

B., 1997. Role of mutator alleles in adaptive evolution. Nature 387, 700–702.

Tenaillon, O., Barrick, J.E., Ribeck, N., Deatherage, D.E., Blanchard, J.L., Dasgupta,

A., Wu, G.C., Wielgoss, S., Cruveiller, S., Médigue, C., Schneider, D., Lenski,

R.E., 2016. Tempo and mode of genome evolution in a 50,000-generation

experiment. Nature.

Tenaillon, O., Toupance, B., Le Nagard, H., Taddei, F., Godelle, B., 1999. Mutators,

population size, adaptive landscape and the adaptation of asexual

populations of bacteria. Genetics 152, 485–493.

Tesson, S.V.M., Legrand, C., van Oosterhout, C., Montresor, M., Kooistra, W.H.C.F.,

Procaccini, G., 2013. Mendelian inheritance pattern and high mutation rates of

microsatellite alleles in the diatom Pseudo-nitzschia multistriata. Protist 164,

89–100.

Thomas, J.A., Welch, J.J., Lanfear, R., Bromham, L., 2010. A generation time effect

on the rate of molecular evolution in invertebrates. Mol. Biol. Evol. 27, 1173–

1180.

Tran, D., Giordano, M., Louime, C., Tran, N., Vo, T., Nguyen, D., Hoang, T., 2014.

An Isolated Picochlorum Species for Aquaculture, Food, and Biofuel. North

Am. J. Aquac. 76, 305–311.

Uchimura, A., Higuchi, M., Minakuchi, Y., Ohno, M., Toyoda, A., Fujiyama, A., Miura,

I., Wakana, S., Nishino, J., Yagi, T., 2015. Germline mutation rates and the

long-term phenotypic effects of mutation accumulation in wild-type laboratory

mice and mutator mice. Genome Res.

  209  

Uphoff, S., Lord, N.D., Okumus, B., Potvin-Trottier, L., Sherratt, D.J., Paulsson, J.,

2016. Stochastic activation of a DNA damage response causes cell-to-cell

mutation rate variation. Science 351, 1094–1097.

Vandepoele, K., Van Bel, M., Richard, G., Van Landeghem, S., Verhelst, B., Moreau,

H., Van de Peer, Y., Grimsley, N., Piganeau, G., 2013. pico-PLAZA, a

genome database of microbial photosynthetic eukaryotes. Environ. Microbiol.

15, 2147–2153.

Vassilieva, L.L., Hook, A.M., Lynch, M., 2000. The fitness effects of spontaneous

mutations in Caenorhabditis elegans. Evol. Int. J. Org. Evol. 54, 1234–1246.

Vassilieva, L.L., Lynch, M., 1999. The rate of spontaneous mutation for life-history

traits in Caenorhabditis elegans. Genetics 151, 119–129.

Von Alvensleben, N., Stookey, K., Magnusson, M., Heimann, K., 2013. Salinity

Tolerance of Picochlorum atomus and the Use of Salinity for Contamination

Control by the Freshwater Cyanobacterium Pseudanabaena limnetica. PLoS

ONE 8, e63569.

Vonlanthen, S., Dauvillée, D., Purton, S., 2015. Evaluation of novel starch-deficient

mutants of Chlorella sorokiniana for hyper-accumulation of lipids. Algal Res.

12, 109–118.

Vos, M., Hesselman, M.C., Beek, T.A. te, Passel, M.W.J. van, Eyre-Walker, A.,

2015. Rates of Lateral Gene Transfer in Prokaryotes: High but Why? Trends

Microbiol. 23, 598–605.

Vraspir, J.M., Butler, A., 2009. Chemistry of marine ligands and siderophores. Annu.

Rev. Mar. Sci. 1, 43–63.

Wang, A.D., Sharp, N.P., Agrawal, A.F., 2014. Sensitivity of the Distribution of

Mutational Fitness Effects to Environment, Genetic Background, and

Adaptedness: A Case Study with Drosophila. Evolution 68, 840–853.

Wang, S., Shi, X., Palenik, B., 2016. Characterization of Picochlorum sp use of

wastewater generated from hydrothermal liquefaction as a nitrogen source.

Algal Res.-Biomass Biofuels Bioprod. 13, 311–317.

Watson, J.D., Crick, F.H.C., 1953. Molecular Structure of Nucleic Acids: A Structure

for Deoxyribose Nucleic Acid. Nature 171, 737–738.

Wei, W., Ning, L.-W., Ye, Y.-N., Li, S.-J., Zhou, H.-Q., Huang, J., Guo, F.-B., 2014.

SMAL: A Resource of Spontaneous Mutation Accumulation Lines. Mol. Biol.

Evol. 31, 1302–1308.

  210  

Weller, A.M., Rödelsperger, C., Eberhardt, G., Molnar, R.I., Sommer, R.J., 2014.

Opposing Forces of A/T-Biased Mutations and G/C-Biased Gene Conversions

Shape the Genome of the Nematode Pristionchus pacificus. Genetics 196,

1145–1152.

Weller, C., Wu, M., 2015. A generation-time effect on the rate of molecular evolution

in bacteria. Evol. Int. J. Org. Evol. 69, 643–652.

Wielgoss, S., Barrick, J.E., Tenaillon, O., Wiser, M.J., Dittmar, W.J., Cruveiller, S.,

Chane-Woon-Ming, B., Médigue, C., Lenski, R.E., Schneider, D., 2013.

Mutation rate dynamics in a bacterial population reflect tension between

adaptation and genetic load. Proc. Natl. Acad. Sci. U. S. A. 110, 222–227.

Willi, Y., Van Buskirk, J., Hoffmann, A.A., 2006. Limits to the Adaptive Potential of

Small Populations. Annu. Rev. Ecol. Evol. Syst. 37, 433–458.

Winnepenninckx, B., Backeljau, T., De Wachter, R., 1993. Extraction of high

molecular weight DNA from molluscs. Trends Genet. TIG 9, 407.

Wloch, D.M., Szafraniec, K., Borts, R.H., Korona, R., 2001. Direct estimate of the

mutation rate and the distribution of fitness effects in the yeast

Saccharomyces cerevisiae. Genetics 159, 441–452.

Wolfenden, R., 2014. Massive thermal acceleration of the emergence of primordial

chemistry, the incidence of spontaneous mutation, and the evolution of

enzymes. J. Biol. Chem. 289, 30198–30204.

Worden, A.Z., Follows, M.J., Giovannoni, S.J., Wilken, S., Zimmerman, A.E.,

Keeling, P.J., 2015. Rethinking the marine carbon cycle: Factoring in the

multifarious lifestyles of microbes. Science 347, 1257594.

Worden, A.Z., Lee, J.-H., Mock, T., Rouzé, P., Simmons, M.P et al., 2009. Green

evolution and dynamic adaptations revealed by genomes of the marine

picoeukaryotes Micromonas. Science 324, 268–272.

Worden, A.Z., Nolan, J.K., Palenik, B., 2004. Assessing the dynamics and ecology of

marine picophytoplankton: The importance of the eukaryotic component.

Limnol. Oceanogr. 49, 168–179.

Wright, S., 1932. The roles of mutation, inbreeding, crossbreeding, and selection in

evolution. Proc. Sixth Int. Congr. Genet. 1, 356–366.

Wright, S., 1931. Evolution in Mendelian Populations. Genetics 16, 97–159.

Wright, S.D., Gillman, L.N., Ross, H.A., Keeling, D.J., 2010. Energy and the tempo of

evolution in amphibians. Glob. Ecol. Biogeogr. 19, 733–740.

  211  

Xu, S., Schaack, S., Seyfert, A., Choi, E., Lynch, M., Cristescu, M.E., 2012. High

mutation rates in the mitochondrial genomes of Daphnia pulex. Mol. Biol.

Evol. 29, 763–769.

Yamamoto, M., Nishikawa, T., Kajitani, H., Kawano, S., 2007. Patterns of asexual

reproduction in Nannochloris bacillaris and Marvania geminata (Chlorophyta,

Trebouxiophyceae). Planta 226, 917–927.

Yamamoto, M., Nozaki, H., Kawano, S., 2001. Evolutionary relationships among

multiple modes of cell division in the genus Nannochloris (chlorophyta)

revealed by genome size, actin gene multiplicity, and phylogeny. J. Phycol.

37, 106–120.

Yamamoto, M., Nozaki, H., Miyazawa, Y., Koide, T., Kawano, S., 2003. Relationship

between presence of a mother cell wall and speciation in the unicellular

microalga Nannochloris (Chlorophyta)1. J. Phycol. 39, 172–184.

Yang, F., Xiang, W., Sun, X., Wu, H., Li, T., Long, L., 2014. A novel lipid extraction

method from wet microalga Picochlorum sp. at room temperature. Mar. Drugs

12, 1258–1270.

Yau, S., Grimsley, N., Moreau, H., 2015. Molecular ecology of Mamiellales and their

viruses in the marine environment. Perspect. Phycol. 83–89.

Yoon, H.S., Hackett, J.D., Ciniglia, C., Pinto, G., Bhattacharya, D., 2004. A molecular

timeline for the origin of photosynthetic eukaryotes. Mol. Biol. Evol. 21, 809–

818.

Zeyl, C., DeVisser, J.A., 2001. Estimates of the rate and distribution of fitness effects

of spontaneous mutation in Saccharomyces cerevisiae. Genetics 157, 53–61.

Zhang, X.-S., 2012. Fisher’s Geometrical Model of Fitness Landscape and Variance

in Fitness Within a Changing Environment. Evolution 66, 2350–2368.

Zhu, Y., Dunford, N.T., 2013. Growth and Biomass Characteristics of Picochlorum

oklahomensis and Nannochloropsis oculata. J. Am. Oil Chem. Soc. 90, 841–

849.

Zhu, Y.O., Siegal, M.L., Hall, D.W., Petrov, D.A., 2014. Precise estimates of mutation

rate and spectrum in yeast. Proc. Natl. Acad. Sci. U. S. A. 111, E2310-2318.

  212  

  213  

  214  

Résumé Les mutations sont la principale source de diversité sur laquelle agit la

sélection pour permettre aux espèces de s’adapter. Les études de l’effet des

mutations sur la survie et du taux de mutation sont donc essentielles pour mieux

comprendre l’évolution. Par une approche d’expérience d’accumulation de

mutations, nous étudions ces deux questions chez cinq modèles d’algues vertes

(Ostreococcus tauri, O. mediterraneus, Bathycoccus prasinos, Micromonas pusilla,

et Picochlorum RCC4223). Il est mis en évidence une diminution de la fitness au

cours du temps en raison des mutations délétères, et une importante interaction

génotype-environnement sur l’effet des mutations. Le taux de mutation varie aux

échelles intra-génomique et inter-spécifique, avec deux principaux résultats: une

augmentation du taux de mutation dans les régions non codantes et une

augmentation du taux de mutation avec la taille du génome chez les eucaryotes et

en fonction de l’écart à l’équilibre en GC du génome. Aussi, l’assemblage et

l’annotation d’une picoalgue du genre Picochlorum permettent d’étudier le rôle des

transferts horizontaux de gènes chez les Chlorophytes.

Abstract Mutations are the main source of diversity on which selection acts to allow

species to adapt. Studies of the effect of mutations on survival and estimation of

spontaneous mutation rates are essential to better understand evolution. Using

mutation accumulation experimental approach, we investigated the issues of

mutation effects and mutation rate in five models of green algae (Ostreococcus tauri,

O. mediterraneus, Bathycoccus Prasinos, Micromonas pusilla, and Picochlorum

RCC4223). It highlighted a decline in fitness over time because of deleterious

mutations, and a significant genotype-environment interaction on the fitness effect of

mutations. The mutation rate varies at inter-specific and intra-genomic scales, with

two main results: a raise of the mutation rate in non-coding regions in accordance

with trancriptional-coupled repair, and an increase of the mutation rate with an

increase of the genome size in eukaryotes and the GC content deviation from the

equilibrium. Also, a new Picochlorum genome is provided to investigate the role of

horizontal gene transfer in the Chlorophyta group.