HAL Id: tel-01647210https://tel.archives-ouvertes.fr/tel-01647210
Submitted on 24 Nov 2017
HAL is a multi-disciplinary open accessarchive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come fromteaching and research institutions in France orabroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, estdestinée au dépôt et à la diffusion de documentsscientifiques de niveau recherche, publiés ou non,émanant des établissements d’enseignement et derecherche français ou étrangers, des laboratoirespublics ou privés.
Estimation des taux de mutation : implications pour ladiversification et l’évolution du phytoplancton eucaryote
Marc Krasovec
To cite this version:Marc Krasovec. Estimation des taux de mutation : implications pour la diversification et l’évolutiondu phytoplancton eucaryote. Génétique des plantes. Université Pierre et Marie Curie - Paris VI, 2016.Français. �NNT : 2016PA066371�. �tel-01647210�
1
Thèse de doctorat
Université Pierre et Marie Curie
Ecole doctorale « Complexité du vivant », ED 515
Estimation des taux de mutation :
implications pour la diversification et
l’évolution du phytoplancton eucaryote
Marc Krasovec
Le 19 Octobre 2016, à Banyuls sur mer
Gwenaël Piganeau Université Pierre et Marie Curie Directeur de thèse
Sophie Sanchez-Ferandin Université Pierre et Marie Curie Directeur de thèse
Vincent Laudet Université Pierre et Marie Curie Président de Jury
Laurent Duret CNRS, UMR 5558 Rapporteur
Olivier Tenaillon INSERM, UMR 1137 Rapporteur
Delphine Sicard INRA, UMR 1083 Examinateur
2
3
Remerciements
Ma plus profonde gratitude va à mes deux directrices de thèse, Gwenaël
Piganeau et Sophie Sanchez-Ferandin, pour m’avoir donné l’opportunité de réaliser
cette thèse avec elles, et surtout pour le soutien indéfectible et permanent durant
ces trois années. Au-delà de la grande qualité de l’encadrement qu’elles m’ont
apporté, j’ai pris un grand plaisir à travailler avec elles pour leurs nombreuses
qualités aussi bien professionnelles que relationnelles.
Ces trois années de thèse passées avec Gwenaël et Sophie ont été pour moi
un grand épanouissement professionnel et personnel, et constituent une unique et
excellente expérience pour ma vie future.
Je tiens également à adresser mes remerciements aux membres du jury pour
avoir accepté d’évaluer mon travail, Laurent Duret, Olivier Tenaillon, Delphine Sicard
et Vincent Laudet, ainsi que les membres de mes comités de thèse, Delphine
Sicard, Jean-Paul Cadoret et Adam Erye-Walker.
Je tiens aussi à remercier le laboratoire de Biologie Intégrative des
Organismes Marins et l’équipe de génomique environnemental du phytoplancton
pour m’avoir accueilli et permis de réaliser cette thèse.
D’une manière plus générale, je remercie ma famille, en premier lieu ma mère
Christine sans laquelle je ne serais jamais allé aussi loin aussi bien dans mes études
que dans mes avancées personnelles, ainsi que mes frères et sœur Caroline, David,
Frédéric (ou Lélic) et mon frère jumeau, Gabriel, comme moi grand admirateur des
êtres vivants.
Aussi, nombreuses sont les personnes du laboratoire Arago qui m’ont aidé
dans mes travaux, en sein de l’équipe, Nigel Grimsley, Hervé Moreau, Evelyne
Derelle, Sheree Yau, et enfin une grande reconnaissance pour Elodie Desgranges
et Claire Hemon, mes deux collègues de bureau et de laboratoire.
4
Je remercie également les membres de la plateforme cytométrie, David
Pecqueur et Christophe Salmeron, toujours disponibles pour venir à la rescousse
d’un cytomètre en panne.
Pour finir, je remercie mes différents amis, Florian, Sylvain, Alex (vous vous
reconnaitrez) et les doctorants du laboratoire pour les discussions, les soirées avec
une mention spéciale pour les gaming-night, et les amitiés qui resteront bien après la
fin de cette thèse.
Pour citer quelques noms, je remercie bien sûr mon cher collègue de thèse
Hugo L et sa femme, Océane l’aristocrate, Sandrine et ses petits félins, Margot et
son congénère larvaire qui ont toujours des bonbons à me donner, mon premier
ministre imaginaire Mathieu que je remercie pour avoir effectué le déplacement,
Hugo B pour les discussions philosophiques sur Homo sapiens, Marine, Tatiana et
Remy, Mariana, Mathias qui va se faire séquencer, Nathalie, Brian et Elsa, Daniel.
A toutes les personnes évoquées ci-dessus, je vous suis reconnaissant
d’avoir supporté mes discussions parfois inutiles et inintéressantes sur les chats, les
chinchillas (dont Kalam et Glorfindel sont les plus beaux représentants), et mes
idées sensiblement peu démocratiques.
5
SOMMAIRE
Liste des abréviations 7
CHAPITRE 1: INTRODUCTION 9
1. Introduction générale 11
2. Les enjeux de la recherche sur les mutations 12
3. Les variations du taux de mutation 14
4. Les expériences d’accumulation de mutations 15 1. Les premières expériences de Terumi Mukai 15 2. L’effet des mutations sur la fitness 17
1. Les successeurs de Terumi Mukai 17 2. Paysage adaptatif 19
3. Interactions génotype-environnement 22 1. Les changements d’effet des mutations 22
2. Le stress et les hyper mutateurs 23
5. Les estimations directes du taux de mutation 24 1. Les variations inter génomiques du taux de mutation 24
1. La taille du génome 24 2. La taille efficace (Ne) 26 3. Le temps de génération 28 4. Le taux métabolique et la température
2. Les variations intra génomiques du taux de mutation 30 1. Le sens de la transcription et de la réplication 30 2. Le temps de réplication 31 3. Les régions codantes et le niveau d'expression 31 4. La composition en GC 31
6. Nouveaux modèles biologiques 35 1. L’importance écologique du phytoplancton 35
2. Présentation des espèces 36
1. Choix des modèles biologiques 36 2. Les Mamiellophyceae 40 3. Les Trebouxiophyceae 41
1. Présentation générale 41 2. Les transferts horizontaux de gènes 42
7. Les objectifs de thèse 45
6
CHAPITRE 2: EFFETS DES MUTATIONS SUR LA FITNESS 47 CHAPITRE 3: LE TAUX DE MUTATION CHEZ LES MAMIELLOPHYCEAE 61 CHAPITRE 4: LES TRANSFERTS HORIZONTAUX DE GENES: LE CAS DE PICOCHLORUM RCC4223 81 CHAPITRE 5: IMPACT DU TAUX DE MUTATION POUR
LES BIOTECHNOLOGIES 97 CHAPITRE 6: DISCUSSION ET CONCLUSION 113
1. Les variations de fitness indépendantes des mutations 115
1. La plasticité phénotypique 115 2. Les bactéries présentes dans les cultures d’O. tauri 117 3. Le rôle des variations structurelles sur le phénotype 118
2. Les limites à l’estimation du taux de mutation 120
3. Perspectives pour les EAMs 123
4. Conclusion générale 125
Annexes 127 Listes des figures et des tableaux 175
Bibliographie 181 Résumé 214
7
Liste des abréviations
a : Effet de la mutation sur la fitness
ADN : Acide désoxyribonucléique
ARN : Acide ribonucléique
CV : Variation de l’effet des mutations
ΔV : Changement de variance de la donnée de fitness
ΔM : Changement moyen de fitness par génération
EAM : Experience d’accumulation de mutations
G : Taille de génome
GCeq : Contenu en GC du génome à l’équilibre
Ge : Taille de génome codante
GxE : Interactions Genotype-Environement
HGT : Horizontal gene transfer
Μb : Mega base
MMR : Mismatch repair
Ne : Taille efficace de population
OmV1 : Ostreococcus mediterraneus Virus 1
PFGE : Pulsed-field gel electrophoresis
R1 : Taux de mutation de GC vers AT
R2 : Taux de mutation de AT vers GC
RCC : Roscoff culture collection
ROS : Reactive oxygen species
TCR : Transcription-coupled repair
U : Taux de mutation par génome
Uc : Taux de mutation caryotypique par génome
Ud : Taux de mutation délétères par génome
µ : Taux de mutation par nucléotide
8
9
CHAPITRE 1:
INTRODUCTION
10
11
1. Introduction générale
Depuis la publication de l’origine des espèces et du principe de la sélection
naturelle par Charles Darwin en 1859, des générations de biologistes ont étudié les
questions fondamentales qui entourent l’évolution et la diversité du vivant. A cette
époque, la génétique n’est pas connue et Darwin ignore les mécanismes qui
génèrent la variabilité et la diversité soumises à la sélection naturelle. Les lois de
Mendel sont redécouvertes en 1900, et en 1902 Walter Sutton propose la théorie
chromosomique de l’hérédité. L’existence des mutations est démontrée en 1911 par
Thomas Morgan en réalisant des expériences sur des drosophiles. Les mutations
sont le moteur de l’évolution et constituent la base du potentiel adaptatif des
espèces car elles constituent la principale source de diversité sur laquelle peut agir
la sélection. Les biologistes s’intéressent donc depuis longtemps aux rôles des
mutations, et les découvertes du début du 20ème siècle vont aboutir à la théorie
synthétique de l’évolution, en particulier avec les travaux de Sewall Wright, John B.
S. Haldane, Hermann J. Muller ou Julian Huxley (Haldane, 1949, 1937; Muller, 1928;
Wright, 1932). La découverte de l’ADN et de sa structure (Watson and Crick, 1953)
ouvrira la voie aux technologies de séquençage qui permettent d’observer
directement l’apparition des mutations sur un génome, leurs fréquences et leurs
distributions. Leurs effets sur la capacité de survie sont également explorés (Eyre-
Walker and Keightley, 2007; Haldane, 1937; Muller, 1950) pour comprendre les
différents processus évolutifs et adaptatifs des êtres vivants. La théorie neutraliste
de l’évolution de Kimura dans les années 1960 apporte une nouvelle vision de
l’évolution avec la mise en avant du hasard comme force aussi importante que la
sélection, la dérive génétique (Kimura, 1991, 1987, 1968). Il s’agit de la variation
aléatoire des fréquences alléliques dans une population (Charlesworth, 2009),
indépendamment de la sélection ou des migrations. La dérive est plus forte dans des
populations de petite taille, et donc de faible taille efficace (Wright, 1931), et peut
aller à l’encontre de la sélection naturelle (Charlesworth, 2009; Willi et al., 2006). Les
mutations sont soumises à ces forces évolutives et le taux de mutation subit lui
même la sélection naturelle ou le hasard de la dérive génétique.
12
2. Les enjeux de la recherche sur les mutations
La diversité que nous pouvons observer sur Terre au sein des trois empires
du vivant que sont les bactéries, les archées et les eucaryotes est issue des
processus de sélection et de mutations. Les mutations sont une altération de la
molécule d’ADN, à un niveau ponctuel ou chromosomique. Cette altération peut être
le remplacement d’un nucléotide par un autre, une insertion ou une délétion de
séquence, une cassure, une duplication, un réarrangement chromosomique ou
autres modifications de l’ADN. Nous pouvons distinguer deux origines aux
mutations: les mutations issues des erreurs de réplication d’une part, et issues de
facteurs mutagènes d’autres part (rayonnement ultra violet, stress oxydatifs ou
radioactivité par exemple); voir la revue de Maki, 2002 (Maki, 2002) et la Figure 1.
Les mutations constituent un large enjeu pour la recherche en biologie et en
médecine. En recherche fondamentale, elles sont étudiées pour répondre à des
questions centrales sur l’évolution et les capacités d’adaptation des espèces. La
diversité génétique, en partie issues des mutations, est étudiée en écologie pour la
conservation des espèces menacées (Ellegren and Galtier, 2016). En médecine,
elles sont étudiées en raison de leurs implications dans différentes maladies
génétiques et cancers (Ding et al., 2015; Salk et al., 2010). Deux points essentiels
intéressent particulièrement les évolutionnistes et la communauté scientifique en
général:
Le premier est de savoir comment les mutations impactent la fitness des
organismes, c’est à dire leurs capacités de survie et de reproduction. L’effet des
mutations se définit alors comme avantageux (la fitness augmente), neutre (la
fitness ne change pas) ou délétère (la fitness diminue).
Le second point est de comprendre à quelles fréquences les mutations
apparaissent, et quels facteurs influencent le taux de mutation et ces éventuelles
variations aux différentes échelles.
"$!
Nous verrons donc dans un premier temps l’état de l’art sur notre
compréhension des effets des mutations sur la fitness et leurs rôles dans
l’adaptation, suivis d’une liste non exhaustive des facteurs qui expliquent en partie
les variations inter et intra génomiques du taux de mutation.
Ce travail de thèse s’inscrit pleinement dans ces deux problématiques, par
l’étude du taux de mutation et de l’effet des mutations sur la fitness en considérant
cinq espèces d’algues vertes (chlorophytes, plantae, eucaryotes) comme modèles
biologiques.
Figure 1. Processus de mutations, modifié de Gao et al., (Gao et al., 2016). Les mutations sont
issues des erreurs de réplication ou des facteurs mutationnels indépendants de la réplication. Dans
les deux cas, des mécanismes de réparations existent pour corriger une partie de ces mutations. Si la
mutation n’est pas réparée, elle peut être transmise ou non à la descendance en fonction du mode de
reproduction de l’organisme.
ADN intact
Lésion
ADN intact
Pas de dommages
Mutation
Réparation correcte
Réparation non correcte ou partielle
Absence de réparation
Lésion
Mutagènes endogènes ou exogènes
Dommage ADN
pré-réplication
Réplication
Résultat
post-réplication Pas de
mutation Mutation
Erreur de réplication
Mutation létale
Arrêt de la réplication
14
3. Les variations du taux de mutation
Au début des années 1960 apparaît la notion d’horloge moléculaire
(Bromham and Penny, 2003). L’horloge moléculaire avance l’hypothèse d’une
apparition constante et continue des mutations dans un génome. Cette horloge
moléculaire sera utilisée pour dater les phylogénies, mais des études vont invalider
cette hypothèse, avec des variations inter taxons (Britten, 1986; Bromham, 2009) et
intra taxon (Bousquet et al., 1992; Bromham et al., 1996) du taux de mutation. De
plus, les données actuelles montrent des variations importantes au sein d’une même
espèce, par exemple en fonction du mode de reproduction, où le taux de mutation
est plus fort dans une population asexuée (Henry et al., 2012; Neiman et al., 2010).
C’est aussi le cas pour différentes souches de Chlamydomonas reinhardtii (Ness et
al., 2015b) avec une variation d’un facteur 10 entre les taux de mutations les plus
bas et les plus hauts. En plus de ces variations inter espèces, il existent des
variations intra génomiques du taux de mutation, comme dans le génome
mitochondrial des angiospermes (Laroche et al., 1997), ou entre les organelles et
l’ADN nucléaire comme chez la drosophile ou Caenorhabditis elegans (Denver et al.,
2000; Haag-Liautard et al., 2008; Smith, 2015; Xu et al., 2012). Une revue chez les
mammifères expose les nombreuses variations du taux de mutation dans un
génome (Hodgkinson and Eyre-Walker, 2011), que ce soit aux échelles de sites
adjacents, ou de chromosomes entiers. Nous savons par exemple que le taux de
mutation est plus élevé au niveau du chromosome sexuel Y les chimpanzés par
rapport aux autres chromosomes (Consortium, 2005; Ebersberger et al., 2002). Au
niveau intra chromosomique, il a été montré que certains trinucléotides mutent
préférentiellement par rapport à d’autres (Ness et al., 2015b; Sung et al., 2015), ou
que les régions avec de petites séquences répétées mutent plus rapidement que le
reste du génome (Ma et al., 2012; Tesson et al., 2013). Ces variations du taux de
mutation mettent en avant l’importance de comprendre quelles forces évolutives
l’impactent et le font varier aux échelles inter et intra génomiques. Ces types de
résultats sont en partie obtenus par une étude directe du taux de mutation, via les
expériences d’accumulation de mutations (EAM). C’est cette approche qui est
utilisée dans ce travail de thèse sur les cinq espèces modèles.
15
4. Les expériences d’accumulation de mutations 1. Les premières expériences de Terumi Mukai
Les premières estimations du taux de mutation datent des années 1960 avec
les expériences d’accumulation de mutations (EAM) de Terumi Mukai (Keightley and
Eyre-Walker, 1999; Mukai, 1964) sur la drosophile, bien que les premières
expériences portant sur les mutations ont été développées une cinquantaine
d’années plus tôt par Muller (Crow and Abrahamson, 1997; Muller, 1927). A cette
époque, l’estimation du taux de mutation ne se fait pas par séquençage, en raison
de l’absence des technologies modernes, mais par l’estimation du taux de mutation
délétères (Ud) à partir de données de fitness. Le principe des expériences
d’accumulation de mutations est de maintenir des lignées filles issues d’une lignée
mère pendant un certain nombre de générations et de comparer les lignées filles en
fin d’expérience avec le type ancestral (Figure 2). Durant les expériences
d’accumulation de mutations, une série de goulots d’étranglements est nécessaire
pour maintenir une taille efficace (Ne) la plus faible possible dans les lignées. La
taille efficace d’une population, notion introduite par Sewall Wright en 1931 (Wright,
1931), est la part de la population qui participe à la reproduction, ou la taille
théorique qu’aurait la population dans un cas idéal (c’est à dire une population avec
reproduction aléatoire, la panmixie) qui aurait la même diversité que la population
réelle. Plus la taille efficace de la population est grande, plus la sélection est
efficace. Inversement, plus la taille efficace est faible plus la dérive génétique sera
forte. Réduire la taille efficace dans les lignées permet donc d’éliminer au maximum
la sélection naturelle et d’estimer le taux de mutation avant sélection. Nous avons
donc accès à la totalité des mutations (exception faite des mutations létales),
définissant le taux de mutations spontanées (Drake et al., 1998). C’est pour cette
raison qu’une étude de la diversité existante dans une population ou une espèce est
insuffisante pour estimer le taux de mutations spontanées car seule la diversité
après sélection est mesurée. Dans le cas de la drosophile, en raison de la diploïdie
et de la reproduction sexuée, la lignée mère est généralement consanguine
homozygote avant de commencer l’expérience (Keightley et al., 2014a, 2014b,
2009).
"'!
Figure 2. Schéma d’une expérience d’accumulation de mutations. Les lignées sont maintenues avec
une succession de goulots d’étranglements. En fin d’expérience, une comparaison de fitness ou une
comparaison génomique permet d’étudier l’effet des mutations et leurs distributions dans le génome.
De cette façon, des variations de fitness dues à la recombinaison de plusieurs
allèles lors de la méiose sont évitées. Les locus portant tous le même allèle,
l’hypothèse est faite que seules les mutations créent une variation de fitness.
Avec les données de fitness, estimées par le succès de reproduction (nombre
d’œufs et nombre d’éclosions), Mukai développe une méthode statistique et calcule
les paramètres de mutation:
!! ! !" ! !!! ! !!!!!!!! !"#!!!!!!" ! !!! ! !!!!!!! ! !! ! !!!
Où a est l’effet de la mutation, !V le changement de variance de la donnée de
fitness par génération et !M le changement moyen de fitness par génération.
!V et !M peuvent être estimés directement par régression sur les données de
fitness mesurées pendant l’expérience. L’augmentation de la variance de la valeur
de fitness résulte de l’impact des mutations qui vont faire changer la fitness dans le
cas de mutations avantageuses ou délétères. Mukai estime Ud=0.34 mutations
délétères par génome par génération comme première estimation d’un taux de
mutation délétère chez un organisme et E(a)=0.027 comme baisse moyenne de
fitness par génération. Ce taux de mutation est le taux de mutation minimal, car il ne
prend en compte que les mutations délétères (seule la baisse de fitness est prise en
N Lignées Type ancestral
Contrôle Type ancestral
Mutation
17
compte pour les calculs des paramètres de mutations). De plus, il estime le taux de
mutation létal à 0.006 mutations par génération.
Suite à la méthode de Mukai, une autre méthode, par maximum likelihood
(Fry et al., 1999; Keightley, 1994; Keightley and Bataillon, 2000; Keightley and
Caballero, 1997) a été développée. Elle permet notamment d’utiliser des données de
fitness issues d’une EAM comme la méthode de Mukai, mais avec une variance plus
faible.
4.2. L’effet des mutations sur la fitness 1. Les successeurs de Terumi Mukai
La méthode statistique de Mukai est utilisée par différents biologistes pour
estimer Ud chez différents organismes modèles. Une revue a été publiée en 2009
(Halligan and Keightley, 2009). D’une manière générale, il est constaté une baisse
de la fitness chez les lignées mutantes au cours des générations pour toutes les
espèces qui ont été testées, dont quelques exemples sont cités ci-dessous:
- Drosophila melanogaster (Fernández and López-Fanjul, 1996; Fry, 2004,
2001, Fry et al., 1999, 1996; Fry and Heinsohn, 2002; Houle et al., 1992; Huey et al.,
2003; Keightley, 1994; Schrider et al., 2013; Wang et al., 2014);
- Caenorhabditis elegans (Ajie et al., 2005; Baer et al., 2006, 2006; Davies et
al., 1999; Estes et al., 2004; Katju et al., 2014; Vassilieva et al., 2000; Vassilieva and
Lynch, 1999);
- Saccharomyces cerevisiae (Korona, 1999; Wloch et al., 2001; Zeyl and
DeVisser, 2001);
- Daphnia pulex (Deng and Lynch, 1997; Korona, 1999, 1999; Latta et al.,
2013; Schaack et al., 2013);
- Arabidopsis thaliana (Deng and Lynch, 1997; Rutter et al., 2012; Schultz et
al., 1999; Shaw et al., 2000);
18
Il existe aussi des organismes un peu moins étudiés par EAMs, mais de plus
en plus de données sont disponibles sur tout l’arbre du vivant; Chlamydomonas
reinhardtii (Morgan et al., 2014), Tetrahymena thermophila (Brito et al., 2010),
Dictyostelium discoideum (Hall et al., 2013), Escherichia coli (Cao et al., 2014;
Kibota and Lynch, 1996).
De ce fait, il est avancé que la majorité des mutations sont délétères, c’est à
dire qu’elles diminuent la capacité de survie. L’impact des mutations délétères dans
une population ou chez un individu est défini comme le poids des mutations
délétères, ou fardeau génétique (Agrawal and Whitlock, 2012; Charlesworth et al.,
1990): c’est la différence de fitness qu’il existe entre la fitness optimale et la fitness
réelle. Les mutations délétères sont normalement supprimées par la sélection
naturelle, mais la dérive peut les maintenir ou les fixer dans une population. L’effet
des mutations délétères sur les populations a largement été exploré (Agrawal and
Whitlock, 2012; Charlesworth and Charlesworth, 1998; Kondrashov, 1995, 1988,
Lande, 1994, 1988; Lynch et al., 1999), de même que l’estimation par des méthodes
statistiques des paramètres mutationnels dans les populations naturelles (Deng et
al., 2002; Deng and Lynch, 1996; Li and Deng, 2005). Une population de petite taille
efficace est plus sensible aux mutations délétères en raison de la faible efficacité de
la sélection naturelle (Eyre-Walker et al., 2002; Higgins and Lynch, 2001; Houle,
1992; Lande, 1998; Lynch et al., 1995; Lynch and Gabriel, 1990; Willi et al., 2006).
Si la sélection est trop faible, elle ne permet pas une purge efficace des mutations
délétères. Cela peut avoir un impact sur les espèces menacées avec de faibles
tailles de population: la dérive et les mutations délétères peuvent accentuer la perte
de diversité et de viabilité d’une population.
Cependant, le taux de mutation « optimal » résulte d’un compromis entre le
coût des mutations délétères et le bénéfice de mutations avantageuses (Wielgoss et
al., 2013). La taille efficace d’une population joue donc un rôle essentiel dans la
force de sélection et la capacité adaptative de cette population (Gossmann et al.,
2012). Ainsi, la probabilité de fixation d’une mutation dans une population va
dépendre de l’intensité de la dérive et de la sélection, et de l’effet de cette mutation
sur la survie (neutre, avantageux ou délétère).
19
4.2.2. Paysage adaptatif et distribution de l’effet des mutations
Comme nous venons de voir, la majorité des mutations semble être délétère,
mais une partie est neutre ou avantageuse (Hall et al., 2008; Joseph and Hall,
2004). La distribution de fitness des mutations vient en partie du niveau de fitness
d’un génome dans un environnement donné. En faisant l’hypothèse qu’il existe un
niveau de fitness maximal possible dans un environnement, la proportion de
mutations délétères augmente si la fitness du génome se rapproche du maximum.
L’ensemble des fitness possibles se définit comme le paysage adaptatif (Orr, 2005;
Petren, 2013), une notion introduite par Sewall Wright et Fisher (Mousseau and Roff,
1987; Edwards, 2000; Zhang, 2012). Il existe de nombreuses théories sur les
modèles de paysages adaptatifs possibles, en particulier le « single-peak » (Wright,
1932), le « rugged » ou vallée (Martin and Wainwright, 2013; Steinberg and
Ostermeier, 2016) ou le « holey » (Gavrilets, 1997).
Le « single-peak », le plus simple, est un pic de fitness avec un maximum
possible (Figure 3). Dans ce cas, la fitness du génome, en fonction des mutations et
de l’épigénétique (Kaity et al., 2008), va se déplacer sur le pic de fitness entre le
maximum et le minimum. Plus la fitness du génome est proche du maximum, plus
les mutations auront de fortes probabilités d’être délétères et, inversement, un
génome avec un niveau de fitness bas va compter plus de mutations avantageuses
(Tenaillon et al., 2016). Enfin, si la fitness du génome est trop basse, il peut
simplement être éliminé par la sélection.
Le second modèle est le modèle « holey » (Gavrilets, 1997), où la fitness
maximale est définie comme le plancher du paysage adaptatif. Les mutations
avantageuses ne font que maintenir le génome à ce niveau. Ce plancher est marqué
par des puits de fitness, dans lesquelles le génome « tombe » en cas de mutations
délétères.
20
Enfin, le modèle le plus souvent accepté, et qui a déjà été mis en évidence
chez les bactéries (Nahum et al., 2015) ou des espèces comme un téléostéen du
genre Cyprinodon (Martin and Wainwright, 2013), est le « rugged ». Dans ce cas, il
existe de nombreux pics de fitness avec des vallées ou des plateaux sur lesquels le
génome va se déplacer. De plus, une vallée entre des pics de fitness peut entrainer
une différenciation de deux populations, d’où l’importance de cette hypothèse en
évolution. Avec ce modèle, une population avec une faible taille efficace peut
atteindre un pic de fitness plus élevé qu’une population avec une taille efficace plus
grande (Rozen et al., 2008). A cause de l’efficacité de la sélection, une grande
population atteindra rapidement le sommet de fitness le plus proche. En revanche,
une population avec une petite taille efficace pourrait atteindre un pic de fitness plus
élevé, car la dérive génétique déplace la population dans le paysage de fitness.
Dans tous les cas, quel que soit le model admis, ce sont les mutations qui
vont principalement augmenter ou diminuer la fitness du génome sur le paysage
adaptatif et permettre l’accession à une fitness supérieure dans le cas de mutations
avantageuses. Par ailleurs, le paysage adaptatif est spécifiquement défini pour un
génotype et un environnement. La position d’un génome est donc le résultat de
l’interaction génotype-environnement et du contexte génétique. On a donc une
variation du paysage adaptatif suite à une variation environnementale (Matuszewski
et al., 2014) ou le long d’un gradient environnemental (Laughlin and Messier, 2015),
avec un compromis d’adaptation (Elena and Lenski, 2003) entre les environnements
(Figure 4).
Au delà des mutations avantageuses ou délétères, les mutations neutres sont
tout aussi importantes en raison de la variation de la distribution de la fitness des
mutations. Les mutations avantageuses peuvent voir leurs impacts augmentés ou
diminués, et les mutations neutres dans un cas peuvent avoir un effet dans d’autres
conditions. Le changement de distribution de fitness des mutations neutres met en
avant l’importance de la variation existante comme base d’adaptation immédiate à
un changement environnemental (Barrett and Schluter, 2008; Hermisson and
Pennings, 2005). On parle de la « standing genetic variability ».
#"!
Figure 3. Représentation du « fitness landscape ». La fitness du génotype (en bleu) va bouger et
changer en fonction de l’effet des mutations qui vont apparaître. Plus la fitness du génotype est
proche du maximum, plus les mutations auront de probabilité d’être délétères. De même une variation
environnementale peut entrainer un déplacement du génotype sur le paysage de fitness. La
difference entre la position du génotype et le maximum de fitness est definie comme le poids des
mutations délétères.
Figure 4. Changement de fitness d’un genotype entre environnements. La variation de l’effet des
mutations et de la variabilité entre envrironnements. La figure est reprise de Santiago et Richards,
2003 (Elena and Lenski, 2003). Le genotype 1 est specialisé dans l’environnement A mais peu
adapté au B, inversement pour le génotype 2, alors que le génotype 3 est généraliste.
Mutation - neutre - avantageuse - délétère
Fitness du génome
Position du génome
Fitness
!"#$%&% !"#$%'%
()"$%*%
()"$%+%
()"$%,%
22
4.2.3. Interaction génotype-environnement
1. Les changements d’effet des mutations
Différentes études sur des lignées mutantes issues d’expériences
d’accumulation de mutations ont tenté d’explorer les effets d’un changement
environnemental sur la distribution de fitness des mutations en comparant les fitness
d’une même lignée, notamment chez la drosophile (Fry et al., 1996, p. 19996; Fry
and Heinsohn, 2002; Kondrashov and Houle, 1994; Korona, 1999), le nématode
Caenorhabditis elegans (Baer et al., 2006), ou la plante Arabidopsis thaliana (Rutter
et al., 2012). Comme nous l’avons vu dans le paragraphe précédent sur le paysage
adaptatif, nous nous attendons à des changements de fitness selon les conditions.
En laboratoire, différentes variables facilement contrôlables peuvent être testées; on
peut citer le cas de la disponibilité en ressource (Chang and Shaw, 2003) et de la
luminosité (Kavanaugh and Shaw, 2005) chez Arabidopsis thaliana. De ces études,
nous pouvons estimer les paramètres de mutations comme pour les EMAs et les
comparer pour émettre des hypothèses sur les implications biologiques des
mutations, définies au nombre de trois (Martin and Lenormand, 2006).
Premièrement, un changement de U (nombre de mutations par génome par
génération) traduit une différence d’effet des mutations, avec des mutations qui ont
un effet détectable dans une condition mais neutre (ou non détectable suivant le
caractère de fitness considéré) dans une autre. On peut par exemple penser à des
changements d’expression de gènes entre deux conditions.
Deuxièmement, une variation de a (effet moyen d’une mutation par
génération) indique un changement de l’intensité de la sélection car les effets d’une
mutation varient. Or, plus l’effet de la mutation est fort, plus la sélection pourra influer
sur la fréquence de cette mutation dans une population : on attend une plus forte
contre sélection d’une mutation délétère qui a un plus fort impact sur la fitness.
Enfin, si CV varie (c’est à dire la variation de l’effet des mutations), on s’attend
à avoir un effet du stress sur les mutations. Ainsi, si une population est adaptée à
une condition et est proche du maximum de fitness, l’effet des mutations sera le plus
souvent délétère. Mais en cas de stress, la population n’est plus à son optimum de
fitness, ce qui fera varier l’effet des nouvelles mutations.
23
4.2.3. Interaction génotype-environnement
2. Le stress et les hyper mutateurs
En cas de stress, il est traditionnellement admis que les mutations délétères
ont un impact plus fort sur la fitness (Elena and de Visser, 2003). C’est notamment le
cas dans une étude pourtant sur l’impact du stress chez des lignées issues
d’expériences d’accumulation de mutations chez Chlamydomonas reinhardtii
(Kraemer et al., 2015). Cependant, il est à noter que cette observation n’est pas
systématique et différents articles tendent à montrer que le stress n’a pas d’effet sur
l’ampleur de l’impact des mutations délétères (Andrew et al., 2015; Kishony and
Leibler, 2003). L'impact du stress sur les effets des mutations peut être caractérisé
de trois façons (Elena et de Visser, 2003): tout d'abord, la mutation peut être
délétère sans conditions, avec une augmentation de l'effet délétère avec le stress;
Ensuite, la mutation peut être conditionnellement neutre, c’est à dire neutre dans
certaines conditions et délétère dans d'autres; Enfin, la mutation peut être
conditionnellement bénéfique: avantageuse dans certaines conditions, mais délétère
ou neutre dans d'autres.
En cas de stress, chez les bactéries, il a été mis en évidence la présence
d’allèles mutateurs qui vont avoir un impact sur le taux de mutation en l’augmentant
significativement (Couce et al., 2013; Taddei et al., 1997). Ce type de mécanismes
est avantageux dans un environnement défavorable. Les nouvelles mutations vont
apparaître plus fréquemment, ce qui augmente la probabilité des mutations
avantageuses et donc l’adaptation (Giraud et al., 2001; Sniegowski et al., 1997;
Tenaillon et al., 1999). Il n’y a pas d’allèles mutateurs connus chez les eucaryotes,
mais il semble que chez la drosophile, les individus moins adaptés à un nouvel
environnement ont un taux de mutation plus élevé que les autres (Sharp and
Agrawal, 2012). Cette observation est également faite chez la plante A. thaliana
(Jiang et al., 2014) ou chez la levure (Shor et al., 2013). Cette augmentation est
toutefois moins significative que dans le cas des hyper-mutateurs bactériens.
24
5. Les estimations directes du taux de mutation 1. Les variations inter génomiques du taux de mutation
1. La taille du génome
De nos jours, les nouvelles générations de séquenceurs permettent d’estimer
directement le taux de mutation en comparant les génomes de début et de fin d’EAM
(voir le Tableau 1 pour les estimations actuelles). Une base de données en ligne est
également disponible (Wei et al., 2014). Ces estimations ont permis de formuler
différentes hypothèses sur les facteurs biologiques et écologiques qui agissent sur
l’évolution du taux de mutation.
Parmi les premiers articles, Drake propose en 1991, à partir de données sur
des organismes unicellulaires, un nombre de mutations constant par génome
(Drake, 1991; Drake et al., 1998). Cette constante serait de U=0.0033 mutations par
génome par réplication chez les microorganismes. Il s’agit plutôt de formuler que le
taux de mutation U varie moins par rapport au niveau de variation des taux de
mutation µ et des tailles des génomes. De ce fait, le taux de mutation diminue avec
l’augmentation de la taille du génome pour garder le nombre de mutations U par
génome constant à chaque réplication (Figure 5). Dans le cas d’un taux de mutation
qui ne diminue pas avec l’augmentation de la taille du génome, nous obtenons un
nombre de mutations par génome croissant. Cela augmente la probabilité
d’apparition de mutations délétères à chaque réplication, ce qui peut compromettre
la survie. Cette relation ne semble toutefois pas concerner les eucaryotes, où le taux
de mutation augmente avec la taille du génome (Smeds et al., 2016; Sung et al.,
2012a).
25
Tableau 1. Les taux de mutations spontanées estimés par des expériences d'accumulation de
mutations. Dans ce tableau, seules les estimations de taux de mutation par séquençage du génome
entier sont spécifiées. G est la taille du génome en Mb, µ est le taux de mutation par nucléotide par
génome par génération et U est le nombre de mutations par génome par génération. Dans ce tableau
n’apparaissent pas les mesures de taux de mutation obtenues avec des lignées artificiellement
mutantes (suppression d’un mécanisme de réparation de l’ADN) ou issues d’un pédigrées, comme
chez l’homme ou la souris (ces données sont disponibles dans le chapitre 3, tableau S10).
Espèces G µ U Références
Arabidopsis thaliana Col-0 157.0 7.00E-09 1.0990 (Ossowski et al., 2010)
Caenorhabditis elegans N2 100.3 2.50E-09 0.2508 (Denver et al., 2009)
Caenorhabditis elegans N2 100.3 3.10E-09 0.3109 (Denver et al., 2009)
Caenorhabditis elegans N2 100.3 1.33E-09 0.1334 (Denver et al., 2012)
Caenorhabditis elegans PB306 100.3 1.62E-09 0.1625 (Denver et al., 2012)
Caenorhabditis briggsae PB800 108.4 1.44E-09 0.1561 (Denver et al., 2012)
Caenorhabditis briggsae HK104 108.4 1.23E-09 0.1333 (Denver et al., 2012)
Pristionchus pacificus PS312 133.1 2.0E-09 0.2663 (Weller et al., 2014)
Drosophila melanogaster Madrid 122.0 3.50E-09 0.4270 (Keightley et al., 2009)
Drosophila melanogaster Florida 122.0 5.49E-09 0.6698 (Schrider et al., 2013)
Drosophila melanogaster Florida 122.0 2.80E-09 0.3416 (Keightley et al., 2014a)
Heliconius melpomene 273.8 2.90E-09 0.7940 (Keightley et al., 2014b)
Chlamydomonas reinhardtii CC-2937 112 2.08E-10 0.0233 (Ness et al., 2012)
Chlamydomonas reinhardtii CC-124 112 6.76E-11 0.0076 (Sung et al., 2012a)
Chlamydomonas reinhardtii 112 9.63E-10 0.1079 (Ness et al., 2015b)
Paramecium tetraurelia d4-2 72.1 1.94E-11 0.0014 (Sung et al., 2012b)
Saccharomyces cerevisiae FY10 12.3 3.30E-10 0.0041 (Lynch et al., 2008)
Saccharomyces cerevisiae 12.3 1.67E-10 0.0021 (Zhu et al., 2014)
Schizoaccharomyces pombe ED668 12.6 2.00E-10 0.0025 (Farlow et al., 2015)
Schizoaccharomyces pombe 12.6 1.70E-10 0.0021 (Behringer and Hall, 2015)
Dictyostelium discoideum AX4 34.2 2.90E-11 0.0010 (Saxer et al., 2012)
Burkholderia cenocepacia HI2424 7.7 1.33E-10 0.0010 (Dillon et al., 2015)
Escherichia coli 3k 4.6 1.88E-10 0.0009 (Lee et al., 2012)
Escherichia coli 6k 4.6 2.45E-10 0.0011 (Lee et al., 2012)
Mesoplasma florum L1 0.8 9.78E-09 0.0078 (Sung et al., 2012a)
Mycobacterium tuberculosis H37Rv 4.4 2.58E-10 0.0011 (Ford et al., 2011)
Salmonella typhimurium LT2 4.8 7.00E-10 0.0034 (Lind and Andersson, 2008)
Bacillus subtilis 4.2 3.28E-10 0.0014 (Sung et al., 2015)
Pseudomonas aeruginosa 6.6 7.92E-11 0.0005 (Dettman et al., 2016)
Deinococcus radiodurans BBA816 3.2 4.99E-10 0.0016 (Long et al., 2015a)
Mycobacterium smegmatis 7.0 5.27E-10 0.0036 (Kucukyildirim et al., 2016)
#'!
Figure 5. Relation entre le taux de mutation et la taille du génome. Figure reprise de Sung, 2012
(Sung et al., 2012a). On observe une diminution du taux de mutation avec une augmentation de la
taille du génome chez les microorganismes. Cela se traduit par des apparitions peu fréquentes des
mutations délétères dans les plus grands génomes.
5.1.2. La taille efficace (Ne)
Un autre facteur essentiel est la taille efficace qui va conditionner l’intensité
de sélection à laquelle sera soumis le taux de mutation (Charlesworth, 2009; Lanfear
et al., 2014), avec la notion de barrière de dérive (Martincorena and Luscombe,
2013; Sung et al., 2012a). Selon Lynch, le taux de mutation est plus faible chez les
microorganismes en raison de leur grande taille efficace de population qui permet
une sélection efficace (Lynch, 2010a). Le taux de mutation pourrait cependant être
attendu plus petit chez les organismes multicellulaires en raison des dommages
somatiques liés aux mutations délétères (Lynch, 2008), en particulier les cancers
(Cowin et al., 2010; Knudson, 2000). Chez les organismes pluricellulaires, le taux de
Taille du génome (Mb)
!
10-11
10-10
10-9
10-8
10-7
10-6
10-3 10-2 10-1 10 101 102
virus
archées
eucaryotes
bacteries
#(!
mutation varie en fonction des tissus (Lynch, 2010a), et le taux de mutation dans la
lignée germinale est inférieur aux taux de mutation des cellules somatiques (Lynch
and Hagner, 2015), limitant la transmission de mutations délétères au générations
suivantes. Le coût des mutations délétères va pousser vers la sélection d’un taux de
mutation faible, avec un taux de mutation théorique défini comme optimal (Figure 6).
Mais ce taux de mutation optimal n’est jamais atteint en raison de la dérive
génétique. Il existe donc une limite, dite la « barrière de dérive », qui empêche
d’atteindre un taux de mutation optimal par la sélection, qui est un compromis entre
l’adaptation, le coût des mutations délétères sur la fitness et le coût de réplication
(Martincorena and Luscombe, 2013). Pour conclure, le taux de mutation réel est le
plus proche du taux de mutation optimal chez les organismes à grande taille efficace
(comme les microorganismes), que celui des organismes à taille efficace de
population plus faible, comme les métazoaires (Figure 7).
Figure 6. La barrière de dérive et le coût de la réplication. Figure reprise de Martincorena et
Luscombe, 2013 (Martincorena and Luscombe, 2013). La dérive impose une limite à la sélection du
taux de mutation, qui ne peut atteindre le taux de mutation optimal, défini comme le compromis entre
le coût des mutations délétères et le coût de la fidélité de réplication. Les espèces avec une grande
taille efficace sont plus susceptibles de se rapprocher du taux de mutation optimal.
Coû
t de
fitne
ss Taux de
mutation optimal Coût des mutations délétères
Taux de mutation !
Coût de réplication
Limite de
dérive
Taux de mutation observé
#)!
Figure 7. Relation entre taille efficace et taux de mutations. Figure reprise de Ness, 2012 (Ness et al.,
2012). La taille efficace de la population définit l’efficacité de la sélection, et donc la capacité à
atteindre le taux de mutation le plus bas possible pour limiter l’apparition des mutations délétères.
5.1.3. Le temps de génération
Le temps de génération étant variable en fonction des caractéristiques
biologiques ou écologiques des espèces, le nombre de mutations qui apparaissent
par unité de temps varie également. Des études ont tenté de comprendre l’influence
du temps de génération sur le taux de mutation (Laird et al., 1969), notamment chez
les vertébrés (Martin and Palumbi, 1993; Mooers and Harvey, 1994). D’une manière
générale, il est observé une diminution du taux de mutation avec l’augmentation du
temps de génération (Tableau 2). Des études plus récentes sur les mollusques
(Thomas et al., 2010) ou les bactéries (Weller and Wu, 2015) tendent à confirmer
cette hypothèse. Cela signifie une plus forte capacité à créer de nouvelles mutations
et donc à s’adapter pour les espèces à temps de génération court.
Taille efficace
104 105 106 107 108 10-10
10-9
10-8
10-7 M. domesticus
H. sapiens
C. elegans
A. thaliana
P. falciparum
N. crassa
C. reinhardtii
S. serevisiae
D. melanogaster
!
29
Tableau 2. Corrélation entre le temps de génération et le taux de mutation. Données de Martin et
Palumbi (Martin and Palumbi, 1993). On observe une diminution du taux de mutation avec une
augmentation du temps de génération et une baisse du taux métabolique.
Espèces Substitutions par site par
milliard d'années
Taux
métabolique
(O2/kg/h)
Temps de
génération (jours)
Douroucouli 2.1 450 880
Singe araignée 1.9 415 1 700
Macaque 1.8 430 1 095
Gibbon 1.7 370 3 410
Orang-outang 1.2 230 4 290
Gorille 1.2 200 3 438
Chimpanzé 1.2 220 3 190
Humain 1.1 210 6 200
5.1.4. Le taux métabolique et la température
En plus du temps de génération vu précédemment, Martin et ses
collaborateurs montrent une augmentation du taux de mutation avec une
augmentation du taux métabolique mesurée par la respiration (Martin and Palumbi,
1993). Cette augmentation est en général expliquée par la plus importante
production d’espèces réactives d’oxygène (ROS) qui induisent un stress oxydatif
(Baer et al., 2007). Les ROS, s’ils sont produits en trop grand nombre par
l’organisme, peuvent provoquer des mutations, en particulier par l’oxydation de la
guanine (Foster et al., 2015) ou la déamination de la cytosine (Cooke et al., 2003;
Dizdaroglu, 1992; Hurst and Williams, 2000).
Au delà du taux métabolique, la température pourrait également influer sur le
taux de mutation (Lewis et al., 2016; Wolfenden, 2014). Selon Wolfenden, les
sources hydrothermales auraient pu être un accélérateur pour l’évolution en raison
de la forte température qui augmente la vitesse des réactions enzymatiques, comme
l’hydrolyse des peptides, et l’instabilité de l’ADN. Ainsi, les réactions chimiques
provoquant des changements irréversibles auraient été plus fréquentes, notamment
30
les déaminations hydrolytiques des cytosines et adénines qui deviennent des
uraciles et xanthines (Wolfenden, 2014).
En lien avec les deux points précédents, il existe une théorie dite « metabolic
theory of ecology », qui propose une accélération de l’évolution moléculaire avec la
température. Cela se traduit par plus de spéciations et divergences en régions
tropicales, chez plusieurs taxons, dont les plantes, les amphibiens ou les
mammifères (Gillman et al., 2010; Mittelbach et al., 2007; Rolland et al., 2014;
Wright et al., 2010).
5.2. Les variations intra génomiques du taux de mutation 1. Le sens de la transcription et de la réplication
Une étude sur Bacillus subtilis (Paul et al., 2013) suggère une hétérogénéité
du taux de mutation en fonction du sens de la réplication et de la transcription sur le
brin d’ADN. Une augmentation du taux de mutation est observée dans les zones
dites de «conflit réplication-transcription». Le taux de mutation est plus élevé dans
les gènes orientés inversement au sens de réplication, ce qui signifie une variation
du taux d’évolution entre gènes. Ce «conflit réplication-transcription» a également
été mis en évidence par d’autres études portant sur des lignées issues
d’expériences d’accumulations de mutations (Schroeder et al., 2016). Le taux de
mutation est également plus fort dans certaines zones, appelés « points chauds de
mutations ». Chez les bactéries, notamment Escherichia coli, ces points chauds ont
été localisés au niveau des points de blocage ou collision entre les fourches de
réplication des deux brins matrices et non matrices (Foster et al., 2013). De même,
la réplication est plus ou moins fidèle selon l’orientation des brins sens et anti-sens,
ce qui a également une influence sur le taux de mutation (Fijalkowska et al., 1998).
31
5.2.2. Le temps de réplication
Au-delà du sens de la réplication, le temps de réplication induit un taux de
mutation plus fort en fin de réplication, phénomène bien connu chez les mammifères
(Chen et al., 2010; Stamatoyannopoulos et al., 2009). C’est à dire que plus le temps
de réplication est long, plus le taux de mutation peut être élevé en fin de réplication.
Les deux hypothèses avancées pour expliquer ce phénomène sont la diminution du
stock de nucléotides disponibles et la perte d’efficacité des mécanismes de
réparation de l’ADN (MisMatch Repair ou MMR). Les MMR permettent de réduire
l’apparition des mutations au cours de la réplication (Fukui and Fukui, 2010; Jiricny,
2006; Kunkel and Erie, 2015; Li, 2008). Nous savons, par des expériences
d’accumulation de mutations avec des lignées artificiellement déficientes en MMR
(Denver et al., 2005; Jiricny, 2006; Lang et al., 2013; Lee et al., 2012; Long et al.,
2015b; Sung et al., 2015), que ces mécanismes de réparation réduisent d’environ un
facteur 100 le taux de mutation et peuvent changer le sens et la distribution des
mutations en fonction de leur activation. Ce biais mutationnel en fin de réplication
existe aussi chez les bactéries (Hudson et al., 2002) et chez la levure (Lujan et al.,
2014). Le type et le taux d’erreur lors de la réplication peuvent également dépendre
du type d’ADN polymérase. En effet, les différentes ADN polymérases n’ont pas les
mêmes niveaux de fidélité, induisant plus ou moins d’erreurs (Hestand et al., 2016;
Kunkel and Bebenek, 2000). Chez les eucaryotes, il existe par exemple de
nombreuses polymérases avec des fonctions et capacités enzymatiques différentes
(Hubscher et al., 2002).
32
5.2.3. Les régions codantes et le niveau d'expression
Une troisième raison aux variations intra génomiques vient de la différence du
taux de mutation entre les régions codantes et non codantes du génome, et le
niveau d’expression. Le taux de mutation semble en effet plus faible dans les gènes
fortement exprimés (Eyre-Walker and Bulmer, 1995; Martincorena et al., 2012). Les
expériences d’accumulation de mutations ont permis de le confirmer, notamment
chez la levure (Zhu et al., 2014). Deux explications peuvent être avancées pour
l’expliquer. Les MMR, qui peuvent être plus efficaces en région codante (Foster et
al., 2015), et les transcription-coupled repairs (TCR), capables de réparation dans
les régions fortement exprimées (Hanawalt and Spivak, 2008).
Cependant différentes étude faites chez Escherichia coli (Beletskii and
Bhagwat, 1996; Chen and Zhang, 2013; Klapacz and Bhagwat, 2002) contredisent
ces résultats et montrent que les gènes fortement exprimés mutent plus rapidement
que les autres. L’une des hypothèses avancées est le lien entre le taux de
transcription et la mutabilité de la région transcrite: le processus de transcription peut
perturber la réplication (Kim and Jinks-Robertson, 2012), comme vu dans le
paragraphe traitant du sens de la réplication et de la transcription.
5.2.4. La composition en GC
Enfin, la composition en GC a une influence sur le taux de mutation, par le biais de
la proportion transversions/transitions et la proportion des mutations A-T vers G-C
ou inversement. Hershberg et Petrov ont montré un biais mutationnel chez les
bactéries (Hershberg and Petrov, 2010), avec une proportion plus importante de
mutations depuis les nucléotides G-C vers A-T par rapport aux autres types de
substitutions. Les expériences d’accumulation de mutations montrent généralement
aussi un biais de mutation de G-C vers A-T, chez Caenorhabditis elegans (Denver et
al., 2009), Arabidopsis thaliana (Ossowski et al., 2010), Escherichia coli (Lee et al.,
2012), Salmonella typhimurium (Lind and Andersson, 2008), par exemple. Cette
observation n’est cependant pas systématique chez les bactéries, avec deux contre-
exemples (Dillon et al., 2015; Long et al., 2015a), voir le Tableau 3. Certains types
33
de mutations fréquentes comme la déamination de la cytosine (Coulondre et al.,
1978; Fryxell and Zuckerkandl, 2000) et l’oxydation de la guanine sont connus pour
induire des mutations de G-C vers A-T (Cooke et al., 2003; Dizdaroglu, 1992). Ce
biais mutationnel est bien connu chez les mammifères, où les sites CpG, c’est à dire
les dinucléotides CG, mutent plus rapidement que le reste du génome (Hodgkinson
and Eyre-Walker, 2011). Le taux de mutation des sites CpG est ~10 fois plus
important que pour les autres sites. De ce fait, les dinucléotides CpG ne sont
présents qu’a 20% de leur fréquence attendue dans le génome humain (Lander et
al., 2001). Cependant, cette relation n’est pas aussi simple, car il existe aussi chez
les mammifères des régions dite « CpG islands », très riches en GC (Bird, 1986). Or,
dans ces régions d’environ 1kb, le taux de mutation est inferieurs à celui des CpGs
situés ailleurs dans le génome (Cohen et al., 2011). Cela s’expliquerait par la
stabilité de la méthylation des cytosines, influencer par la richesse des nucléotides
adjacents en GC (Elango et al., 2008).
Face à cela, nous pouvons nous attendre à observer une baisse de la teneur
en GC dans certains génomes au cours des générations. Or, chez les bactéries,
certains génomes sont très riches en GC (proche de 70%). Cela s’explique en partie
par la sélection pour des codons optimaux plus riches en GC (Hildebrand et al.,
2010). En effet, même des mutations synonymes peuvent avoir un impact sur la
fitness, comme démontré précédemment (Glémin, 2010) en raison du biais d’usage
du code (Ikemura, 1981). Le biais d’usage du code se traduit par l’utilisation
préférentielle de certains codons par rapport à d’autres, notamment en fonction de la
quantité de séquences qui codent pour l’ARN de transfert associé à ces codons.
La conversion génique biaisée peut aussi expliquer une augmentation de la
teneur en GC d’un génome (Chen et al., 2007; Duret and Galtier, 2009; Galtier et al.,
2001; Glémin et al., 2015; Mugal et al., 2013). Il s’agit d’un biais de réparation des
mésappariements, généralement lors de la recombinaison, qui conduit à
enrichissement en GC du génome. Ce phénomène semble aussi présent chez les
bactéries (Lassalle et al., 2015), qui recombinent moins que les eucaryotes étudiés
généralement pour la conversion génique biaisée.
34
De plus, des variations dans l’orientation des mutations ont également été
observées entre le génome nucléaire et le génome des organelles chez
Chlamydomonas reinhardtii (Ness et al., 2015a). Chez Chlamydomonas reinhardtii,
la composition en GC des organelles (47%) est plus faible que celle du génome
nucléaire (63%), ce qui peut expliquer en partie cette différence.
Pour prédire le nombre de mutations en fonction de la composition du
génome, il est utile de calculer le GC% à l’équilibre (Sueoka, 1962), c’est à dire la
teneur en GC du génome pour laquelle il y a autant de mutations de type G-C vers
A-T que A-T vers G-C. Sachant que les mutations sont biaisées de G-C vers A-T, le
taux de mutation est en général plus fort pour les nucléotides G et C que pour A et
T. Le GCeq se calcule avec les équations suivantes :
𝑅!=(GC→AT)𝐺𝐶!
, 𝑅!=(AT→GC)𝐴𝑇!
, GCeq = 𝑅!
𝑅! + 𝑅!
avec GC→AT le nombre de mutations de type G-C vers A-T et 𝐺𝐶! le nombre de G et
C dans le génome.
Tableau 3. Le biais de GC vers AT, dans la dernière colonne du tableau, est le rapport du taux de
mutation de GC vers AT sur celui de AT vers GC. Les données sont reprises de Dillon et
collaborateurs en 2015 (Dillon et al., 2015). Espèce (%GC) A/T->T/A G/C->C/G A/T->G/C G/C->A/T Biais vers AT
B. cenocepacia (67) 2.67 2.38 12.23 9.95 0.81
E. coli (51) 2.8 2.88 15.38 18.79 1.22
M. florum (27) 15.67 185.36 62.68 1000.97 15.97
H. sapiens (45) 129 295 581 1219 2.1
D. melanogaster (42) 98.06 74.52 149.14 643.95 4.32
S. cerevisiae (38) 3.03 7.82 12.43 27.55 2.22
A. thaliana (36) 43.56 123.63 165.52 1035.38 6.26
C. elegans (35) 17.5 16.89 24.19 101.32 4.19
35
6. Nouveaux modèles biologiques 1. L’importance écologique du phytoplancton
Le phytoplancton est composé de la partie photosynthétique du plancton,
présente à l’échelle mondiale dans tous les écosystèmes aquatiques (de Vargas et
al., 2015). Ce n’est cependant pas un terme qui désigne un groupe monophylétique,
et ne constitue donc pas un groupe naturel d’organismes au sens évolutif. Il inclut
des organismes issus de différents règnes, parmi les eucaryotes et les bactéries,
notamment les cyanobactéries. Le phytoplancton eucaryote est très diversifié et se
retrouve dans tous les règnes excepté les unicontes (qui comprennent entre autres
les fungis et les métazoaires). La production primaire du phytoplancton constitue
environ la moitié de la production terrestre (Field et al., 1998) et la base de la plupart
des écosystèmes océaniques (Li, 1994; Worden et al., 2004; Jardillier et al., 2010).
Le phytoplancton est donc essentiel pour les transferts trophiques, et joue
également un rôle fondamental dans les cycles biogéochimiques de la planète
(Worden et al., 2015). Par exemple, les diatomées sont responsables d’environ 40%
de la production primaire océanique (Boyd and Newton, 1995) et jouent un rôle clé
dans les cycles biogéochimiques, comme l’export de carbone (Boyd and Newton,
1999; Buesseler, 1998).
Dans le cadre de ce travail de thèse, nous nous intéressons aux
Chlorophytae (Friedl and Rybalka, 2012; Leliaert et al., 2012; Lewis and McCourt,
2004), ou «algues vertes», qui regroupent 4 300 espèces dans le règne eucaryote
de la lignée verte (archaeplastidae ou plantae). La photosynthèse est apparue dans
la lignée verte avec la première endosymbiose par transfert du chloroplaste d’une
cyanobactérie il y a environ 1.6 milliard d’années dans une cellule eucaryote (Yoon
et al., 2004). Parmi les chlorophytes, il existe une importante diversité de forme de
vie (De Clerck et al., 2012): des espèces unicellulaires, pluricellulaires, d’eaux
douces, marines ou saumâtres, des espèces coloniales ou non, et des espèces
symbiotiques.
36
6.2. Présentation des espèces 1. Choix des modèles biologiques
L’objectif du travail de doctorat est d’acquérir une meilleure compréhension
des processus évolutifs et adaptatifs du pico-phytoplancton eucaryote. Il faut
souligner l’importance des progrès que de telles expérimentations permettent
aujourd’hui dans les recherches menées par la communauté scientifique sur
l’évolution. Cette thèse apporte une importante contribution à la littérature existante
sur les expériences d’accumulation de mutations et permet d’évaluer le potentiel
adaptatif d’un groupe écologique majeur.
Pour cela, nous avons choisi cinq espèces d’algues vertes (Figure 9):
Ostreococcus tauri RCC4221 (Blanc-Mathieu et al., 2014; Derelle et al., 2006),
Ostreococcus mediterraneus RCC2590 (Subirana et al., 2013), Bathycoccus
prasinos RCC1105 (Moreau et al., 2012), Micromonas pusilla RCC299 (Worden et
al., 2009) et Picochlorum sp. RCC4223. Toutes appartiennent à la classe des
Mamiellophyceae (Marin and Melkonian, 2010), sauf le genre Picochlorum qui
appartient à la classe des Trebouxiophyceae (Henley et al., 2004); voir l’arbre
phylogénétique, Figure 8. Les fiches détaillées des souches sont disponibles en
Annexes. Cinq raisons nous ont orienté vers ces choix:
Premièrement, la culture de toutes ces espèces est bien connue en
laboratoire, dans du milieu L1 (voir la composition du L1 en annexe) à 20 °C, avec
un cycle jour-nuit de 8h-16h. Les cultures sont clonales, mais pas axéniques, c’est-
à-dire qu’elles contiennent des bactéries. La maîtrise de la culture est une étape
essentielle pour la mise en place d’expériences et de protocoles avec ces espèces.
Pour les expériences, toutes les souches proviennent de la Roscoff Culture
Collection (http://roscoff-culture-collection.org/), une banque de microorganismes
basée en France et disponible pour la recherche.
37
Deuxièmement, ces espèces sont devenues des modèles d’étude avec une
importante bibliographie qui nous donne accès à différentes informations biologiques
ou écologiques. C’est surtout le cas des Mamiellophyceae, avec quelques exemples
relatés dans la littérature (Abby et al., 2014; Blanc-Mathieu et al., 2014, 2013; Demir-
Hilton et al., 2011; Grimsley et al., 2010; Jancek et al., 2008; Palenik et al., 2007;
Piganeau et al., 2011b; Rodríguez et al., 2005; Šlapeta et al., 2006; Sullivan et al.,
2015).
Troisièmement, en lien avec l’argument précédent, le génome de ces
espèces a été entièrement séquencé, ce qui est essentiel pour une étude du taux de
mutation. Les génomes et données associées sont disponibles sur deux sites,
ORCAE (Sterck et al., 2012) pour l’annotation et Picoplaza (Vandepoele et al., 2013)
pour l’analyse comparative des génomes. Ce n’est cependant pas le cas pour
Picochlorum RCC4223, dont l’assemblage et l’annotation du génome font partie du
travail de thèse.
Quatrièmement, elles possèdent une large diversité génétique et génomique:
un petit génome haploïde de 13 à 21 Mb (Tableau 4), avec des variations en GC qui
vont de 46 à 63%. Ces différences génomiques nous intéressent précisément dans
le cadre des EAMs pour tester les différentes hypothèses exposées en seconde
partie de cette introduction.
Tableau 4. Diversité génomique des espèces utilisées pour les expériences d’accumulation de
mutations. La diversité génétique de nos modèles, notamment la composition en GC et la taille du
génome, nous intéressent pour tester leurs rôles dans la variation du taux de mutation.
Espèces RCC Génome (Mb) %GC Gènes Génome codant (%)
Ostreococcus tauri 4221 12.5 56 8 116 81.21
Ostreococcus mediterraneus 2590 13.5 69 7 492 84.25
Bathycoccus prasinos 1105 15.1 48 7 847 83.09
Micromonas pusilla 299 21.0 63 10 286 81.85
Picochlorum sp. 4223 13.7 46 8 755 79.45
38
Enfin, les algues vertes d’une manière générale font l’objet de recherches
pour leur potentiel biotechnologique (Becker, 2007; Brennan and Owende, 2010;
Chisti, 2007; Mata et al., 2010). La possibilité d’exploiter les lipides des algues,
notamment pour la recherche de biocarburant (Brennan and Owende, 2010; Hannon
et al., 2010), a poussé de nombreux chercheurs à optimiser les protocoles de
production ou d’extraction des lipides chez certaines espèces, notamment chez les
Trebouxiophyceae (Dassey and Theegala, 2013; Garzon-Sanabria et al., 2012;
Gerken et al., 2013; S.-J. Park et al., 2012; Tran et al., 2014; Yang et al., 2014; Zhu
and Dunford, 2013). Une étude récente a également mis en évidence une potentielle
application médicale (Black et al., 2014) du genre Nannochloris. Brièvement, les
Nannochloris eukaryotum (ou Picochlorum eukaryotum) pénètrent spontanément
dans des cellules humaines de l’épithélium pigmentaire de la rétine. Les algues qui
entrent sont viables et la photosynthèse est active, avec division cellulaire. Ces
cellules de la rétine jouent un rôle crucial dans la formation du réseau vasculaire de
la rétine en régulant l’expression de la production de facteurs de croissance
vasculaire, qui est fonction de la concentration en dioxygène. Plusieurs pathologies
oculaires sont liées à des problèmes de régulation de ces facteurs de croissance.
La production de dioxygène via la photosynthèse par les Nannochloris entrées dans
les cellules de la rétine semble donc, pour les auteurs, une piste à explorer.
La connaissance du taux de mutation est particulièrement importante ici, en
raison de son utilité pour les recherches d’évolution expérimentale qui peuvent être
utilisé pour sélectionner des lignées d’intérêts. C’est la raison pour laquelle un
chapitre sera consacré à cette question, en se focalisant sur l’espèce Picochlorum
RCC4223.
$*!
Figure 8. Arbre phylogénétique des Chlorophyta, repris de Marin et Melkonian (Marin and Melkonian,
2010), réalisé à partir des séquences qui codent l’ARNr 18S. Les Mamiellophyceae constituent un
groupe basal ayant divergé de façon précoce alors que les Trebouxiophyceae sont plus dérivés.
Picochlorum RCC4223
Picochlorum oklahomensis
Chlorella vulgaris
Dunaliella salina
Chlamydomonas reinhardtii
Oltmannsiellopsis viridis
Acrosiphonia sp.
Tetraselmis striata
Nephroselmis astigmatica
Nephroselmis rotunda
Micromonas pusilla
Ostreococcus tauri
Pyramimonas disomata
Pyramimonas olivacea
Coleochaete nitellarum (groupe externe)
Prasinoderma coloniale
Picocystis salinarum
Monomastix minuta
Bathycoccus prasinos
Crustomastix stigmata
Ulvophycea
Chlorophycea
Trebouxiophycea
Nephroselmidophycea
Mamiellophycea
Pyramimonadales
Acrosiphonia
%+!
Figure 9. Photographies en microscopie électronique des espèces utilisées pour les expériences
d’accumulation de mutations. A. Bathycoccus prasinos (Yau et al., 2015). B. Micromonas pusilla
(Yau et al., 2015). C. Ostreococcus sp (Yau et al., 2015). D. Picochlorum sp (photo de Claire Hemon).
6.2.2. Les Mamiellophyceae
Les Mamiellophyceae constituent une part de ce que qui est défini comme le
pico-phytoplancton eucaryote (Massana, 2011). Ils sont ubiquistes et ont été isolées
en mer Méditerranée, et dans les océans Atlantique et Pacifique (de Vargas et al.,
2015; Demir-Hilton et al., 2011). Ce groupe comprend notamment les plus petits
eucaryotes libres connus, avec une taille de l’ordre du micromètre, dont le plus
étudié est Ostreococcus tauri, qui fut découvert dans l’étang de Thau (France) en
1994 (Courties et al., 1994). Ils ont une organisation cellulaire très simple, avec
seulement une mitochondrie et un chloroplaste, et sont caractérisés par une
absence de paroi cellulaire.
Les quatre espèces de Mamiellophyceae étudiées appartiennent à l’ordre des
Mamiellales, dont la première divergence est datée de 65 millions d’années, et
correspond à la divergence du genre Micromonas à la fin du crétacé ("lapeta et al.,
2006). Enfin, il faut noter une très grande diversité au sein de la classe des
Mamiellophyceae (Piganeau et al., 2011a). Malgré la proximité phylogénétique des
différentes espèces, il est à noter qu’au sein même des espèces Ostreococcus tauri
et O. mediterraneus par exemple, 14 et 6 souches génétiquement distinctes ont été
mises en évidence.
100 nm
1.44 µm 50 nm
!" #" $" %"
%"!
Les différentes espèces de Mamiellales connues possèdent des
chromosomes particuliers, appelés «outlier chromosomes», qui ont une composition
en GC inferieure au reste du génome, avec de nombreuses régions répétées. En
tout, O. tauri possède 20 chromosomes, O. mediterraneus et B. prasinos 19, M.
pusilla 17. Le caryotype de ces quatre espèces est présenté sur la Figure 10.
Figure 10. Migration par PFGE de l’ADN complet des 4 espèces de Mamiellophyceae. B. prasinos
possède 19 chromosomes, O. tauri 20, O. mediterraneus 19 et M. pusilla 17. Les marqueurs de taille
sont le phage Lambda (premier puits à gauche), et la levure (dernier puits à droite).
6.2.3. Les Trebouxiophyceae 1. Présentation générale
La classe des Trebouxiophyceae a évolué plus récemment que celle des
Mamiellophyceae dans l’arbre des Chlorophyta, et possède aussi des genres bien
connus en biologie, comme Chlorella. Il existe également des génomes séquencés
chez les Trebouxiophyceae (Blanc et al., 2012, 2010; Gao et al., 2014; Pombert et
al., 2014). Celui qui se rapproche le plus de notre souche Picochlorum RCC4223 est
la souche Picochlorum SE3 (Foflonker et al., 2016, 2015), avec un génome de 13.5
Y !
Ot Om Bp
Mp
250
450 555
680
815
1 900
915
1 640
1 100
945
!"#$%&'%
(&!%
)""%
$"*%'*'#$%
Taille en Mb
Taille en Mb
42
Mb et un GC de 46% (Foflonker et al., 2015). Différentes stratégies de divisons
cellulaires sont connues (Yamamoto et al., 2007): la fission (Picochlorum bacillaris),
le bourgeonnement (Nannochloris coccoides) et l’autosporulation (N. eucaryotum, N.
atomus).
An sein des Trebouxiophyceae, deux genres nous intéressent: Nannochloris
et Picochlorum, auxquels appartient la souche RCC4223. La phylogénie n’est pas
encore totalement établie (Henley et al., 2004; Yamamoto et al., 2007, 2003, 2001),
et des changements de noms entre les deux genres ont eu lieu pour différentes
espèces ou souches. Ainsi, il existe des synonymes, d’où une possible confusion.
D’après les connaissances actuelles, les espèces du genre Picochlorum sont
caractérisées par une halotolérance importante (Foflonker et al., 2015; Henley et al.,
2002; von Alvensleben et al., 2013), jusqu’à 90 g.L-1.
6.2.3. Les Trebouxiophyceae 2. Les transferts horizontaux de gènes
Le genre Picochlorum peut permettre de répondre en partie à une troisième
question concernant l’évolution et la diversification du phytoplancton eucaryote:
Quelle est la part des transferts horizontaux de gènes (« Horizontal Gene
Transfert », HGTs) dans la diversification du phytoplancton?
En effet, des HGTs ont été mis en évidence chez plusieurs espèces
eucaryotes appartenant aux Chlorophyta (Picochlorum SE3 (Foflonker et al., 2015),
B. prasinos (Moreau et al., 2012), Chloromonas brevispina (Raymond, 2014) et
Chlorella variabilis (Blanc et al., 2010)) ainsi que chez des algues rouges
(Rhodobionta) (Galdieria phlegrea par exemple (Qiu et al., 2013)). Ces transferts de
gènes permettent l’acquisition de nouveaux gènes et nouvelles fonctions qui
augmentent la diversité et les capacités adaptatives. Les HGTs sont bien connus et
fréquents chez les bactéries et les archées (Vos et al., 2015), et chez les eucaryotes
(Schönknecht et al., 2014). Il a été proposé que les eucaryotes capables de survivre
à des environnements extrêmes auraient conservés plus de gènes d’origine
43
bactérienne acquis par transferts horizontal, comme pour Galdieria sulphuraria
(Schönknecht et al., 2013). L’étude d’un autre génome de Picochlorum, halotolérant
et themotolérant, pourrait donc fournir de nouvelles données sur l’hypothèse des
HGTs vers les Planta.
Pour les différentes raisons évoquées plus haut (HGTs et potentiels
biotechnologiques), il nous a semblé important d’inclure Picochlorum RCC4223 dans
nos études sur le taux de mutation chez les algues vertes. C’est pourquoi, en plus
des expériences d’accumulation de mutations et des résultats associés, une partie
du travail de thèse consiste dans l’assemblage et l’annotation de ce nouveau
génome.
44
45
7. Les objectifs de thèse Quels sont les impacts des nouvelles mutations sur la fitness du pico-phytoplancton eucaryote (Chlorophyta)?
Pour répondre à cette question, nous avons effectué des EAMs sur les quatre
espèces de Mamiellophyceae présentées précédemment, en suivant l’évolution de
la fitness au cours du temps. La fitness est estimée par le nombre de divisions
cellulaires par jour, depuis le T0 au Tfinal. Au total, cette étude de fitness portera sur 7
lignées de M. pusilla, 8 de B. prasinos, 23 d’O. mediterraneus et 19 d’O. tauri. A cela
s’ajoute, en fin d’expérience, des tests de fitness dans différentes conditions de
salinité et en condition de stress (présence d’herbicides). L’objectif est d’observer ou
non des changements de fitness entre environnements, qui seraient le résultat de
changements d’effet des mutations.
Quel est le taux de mutations spontanés des algues vertes (Chlorophytes) et quels sont les facteurs qui l’influencent?
Les lignées utilisées pour estimer le taux de mutation sont issues d’EAMs
identiques au protocole utiliser pour répondre à la première question exposée ci-
dessus. Les mutations sont un évènement rare, ce qui pose deux contraintes
expérimentales: il faut suffisamment de lignées et suffisamment de générations pour
pouvoir observer des mutations en fin d’expérience. 40 lignées par espèce ont été
maintenues le plus longtemps possible pour obtenir le plus de générations
indépendantes possibles dans nos conditions expérimentales. Le génome de ces
lignées est séquencé par Illumina (162 en tout), et un travail bioinformatique nous
permet d’estimer directement le taux de mutation et leurs répartitions dans le
génome. Deux questions sous jacentes se posent, celles de la variabilité inter
génomique et intra génomique du taux de mutation.
46
Quel est le rôle des HGTs dans la diversification des algues vertes (Chlorophytes)?
Enfin, la possibilité d’étudier un nouveau génome (celui de Picochlorum
RCC4223) permet d’explorer d’autres mécanismes d’adaptation. Les HGTs ont été
proposés chez les algues vertes comme un mécanisme de diversité. Ce nouveau
génome confirmera ou pas cette hypothèse en mettant en évidence des transferts
horizontaux de gènes vers Picochlorum. Les HGTs candidats chez Picochlorum SE3
vont être recherchés dans le nouveau génome de RCC4223. De plus, une partie
expérimentale et une partie de génomique comparative vont permettre de
caractériser la nouvelle souche.
Quelles sont les implications du taux de mutation pour la domestication des algues vertes ?
Le taux de mutation de Picochlorum RCC4223 est estimé de la même façon
que pour les Mamiellophyceae. Par contre, l’expérience ne compte que 12 lignées et
le type ancestral. Ce taux de mutation donne l’opportunité de discuter du taux de
mutation d’une espèce d’algue verte qui présente des intérêts pour les
biotechnologies. La connaissance de son taux de mutation peut donc être un
paramètre à prendre en compte dans le choix des espèces.
47
CHAPITRE 2:
L’EFFET DES MUTATIONS SUR LA
FITNESS
48
49
Quels sont les impacts des nouvelles mutations sur la fitness du pico-phytoplancton eucaryote (Chlorophyta)?
Pour tenter de comprendre l’impact des mutations sur la fitness chez les
algues vertes, nous avons effectué des EAMs sur 40 lignées de chaque espèce de
Mamiellophyceae. Cette étude est la première du genre chez les Mamiellophyceae,
qui n’ont jamais fait l’objet d’EAMs. Selon les espèces, les lignées ont été
maintenues de 204 à 378 jours, avec une série de goulots d’étranglements à une
cellule tous les 14 jours. Contrairement à la plupart des microorganismes ayant déjà
fait l’objet d’EAMs, les cultures ne sont pas maintenues en milieu solide, mais
liquide. Pour cette raison, nous avons utilisé la cytométrie en flux pour suivre la
croissance des lignées et des contrôles. Toutes les lignées sont issues d’un clone
T0, et maintenues avec une taille efficace réduite au maximum pour les lignées, et
100 fois plus grande pour le contrôle. Le contrôle, avec une sélection efficace,
maintient la fitness du type ancestral au niveau optimal.
La fitness est estimée par le nombre de divisions cellulaires par jour. En
raison des pertes de lignées remplacées par les survivantes en cours d’expérience,
nous ne considérons que les lignées totalement indépendantes pour les analyses
statistiques. Au suivi de la fitness s’ajoutent deux tests pour explorer l’interaction
génotype-environnement sur l’effet des mutations. Pour cela, la fitness des lignées
est mesurée dans différentes conditions: une variation de salinité sur un gradient de
5 à 65 g.l-1, et deux conditions en présence d’herbicides. Les espèces choisies ont
une large tolérance aux changements de salinité: nous avons voulu voir la réponse
des lignées mutantes à ces changements. Les milieux avec herbicides permettent
d’étudier la réponse au stress.
Cette étude montre une baisse de fitness chez O. tauri, en accord avec la
littérature sur le sujet (Halligan and Keightley, 2009). Nous mettons aussi en avant
l’importance de l’interaction GxE dans l’adaptation. En effet, certaines lignées
montrent des variations significatives de fitness (augmentation ou diminution) dans
les conditions de tests GxE qui n’ont pas été détectées pendent l’EAM. Par ailleurs,
nous discutons des possibles problèmes expérimentaux, notamment la forte perte
de lignées pour certaines espèces, en particulier B. prasinos et M. pusilla.
Le matériel supplémentaire de ce chapitre est disponible page 137 à 142.
50
INVESTIGATION
Fitness Effects of Spontaneous Mutations inPicoeukaryotic Marine Green AlgaeMarc Krasovec,*,1 Adam Eyre-Walker,§ Nigel Grimsley,* Christophe Salmeron,† David Pecqueur,†
Gwenael Piganeau,*,1 and Sophie Sanchez-Ferandin** Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie Intégrative des Organismes Marins (BIOM), ObservatoireOcéanologique, F-66650 Banyuls/Mer, France †Sorbonne Universités, UPMC Univ Paris 06, CNRS, ObservatoireOcéanologique de Banyuls (OOB) , F-66650 Banyuls/Mer, France and §School of Life Sciences, University of Sussex,Brighton BN1 9QG, United Kingdom
ABSTRACT Estimates of the fitness effects of spontaneous mutations are important for understanding theadaptive potential of species. Here, we present the results of mutation accumulation experiments over 265–512 sequential generations in four species of marine unicellular green algae, Ostreococcus tauri RCC4221,Ostreococcus mediterraneus RCC2590, Micromonas pusilla RCC299, and Bathycoccus prasinos RCC1105.Cell division rates, taken as a proxy for fitness, systematically decline over the course of the experiment inO.tauri, but not in the three other species where the MA experiments were carried out over a smaller numberof generations. However, evidence of mutation accumulation in 24 MA lines arises when they are exposedto stressful conditions, such as changes in osmolarity or exposure to herbicides. The selection coefficients,estimated from the number of cell divisions/day, varies significantly between the different environmentalconditions tested in MA lines, providing evidence for advantageous and deleterious effects of spontaneousmutations. This suggests a common environmental dependence of the fitness effects of mutations andallows the minimum mutation/genome/generation rates to be inferred at 0.0037 in these species.
KEYWORDS
spontaneousmutation
mutationaccumulation
fitness effectsmarine pico-phytoplankton
single cellcultures
Mutations are the main drivers of genetic diversity that enable speciesto adapt by natural selection. Estimating the spontaneousmutation rateand the fitness effects of mutations is, thus, essential for a betterunderstanding of the evolution and the adaptive potential of species(Wright 1932; Kondrashov 1988). A proportion of new mutations aredeleterious (Charlesworth and Charlesworth 1998; Keightley andLynch 2003; Lynch et al. 1999), and some of the strongest evidencefor this comes frommutation accumulation (MA) experiments, pioneeredby Mukai in Drosophila melanogaster (Mukai 1964). The accumula-tion of mutations can be measured experimentally by monitoring thegrowth, or other fitness traits, of independent lines starting from one
genotype for a given number of generations (see Halligan andKeightley 2009 for a review). Serial bottlenecks make natural selectionineffective in the face of genetic drift and permit deleterious muta-tions to segregate and become fixed in MA lines. Since Mukai’s firstexperiments in Drosophila, many MA experiments have been per-formed in different organisms: Arabidospis thaliana (Shaw et al. 2000),Caenorhabditis elegans (Ajie et al. 2005; Katju et al. 2014; Vassilieva et al.2000; Vassilieva and Lynch 1999), Daphnia pulex (Deng et al. 2002;Deng and Lynch 1997; Schaack et al. 2013), Dictyostelium discoideum(Hall et al. 2013), D. melanogaster (Fernández and López-Fanjul 1996;Fry 2004, 2001; Fry et al. 1999; Keightley 1994; Schrider et al. 2013),Saccharomyces cerevisiae (Wloch et al. 2001; Zeyl and DeVisser 2001),and Tetrahymena thermophila (Long et al. 2013). Generally, these ex-periments show a decrease of fitness in the MA lines as the experimentprogresses, consistent with a substantial proportion of spontaneousmutations being deleterious.
MA experiments also enable the relationship between the fitnesseffects of mutations and the environment to be explored. Knowledgeabout genotype–environment (GxE) interactions is essential to under-stand the adaptation process, because fitness effects of mutations maychange with time and spatial scales. InD. melanogaster (Fry et al. 1996;Kondrashov and Houle 1994), C. elegans (Baer et al. 2006) or S. cer-evisiae (Korona 1999), the fitness effects of spontaneous mutations
Copyright © 2016 Krasovec et al.doi: 10.1534/g3.116.029769Manuscript received March 29, 2016; accepted for publication May 5, 2016;published Early Online May 10, 2016.This is an open-access article distributed under the terms of the CreativeCommons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproductionin any medium, provided the original work is properly cited.Supplemental material is available online at www.g3journal.org/lookup/suppl/doi:10.1534/g3.116.029769/-/DC11Corresponding authors: Pierre and Marie Curie University (UPMC), 1 Avenue deFontaulé, 66650 Banyuls-sur-Mer, France. E-mails: [email protected];[email protected]
Volume 6 | July 2016 | 2063
change with environmental conditions. However, this interaction is notsystematic; in the case ofA. thaliana, one experiment showed a positiveGxE interaction in fitness effects of mutations (Rutter et al. 2012),whereas other studies did not (Chang and Shaw 2003; Kavanaughand Shaw 2005). The nature of the change in mutational effect withenvironmental conditions allows us to infer three biological implica-tions (Martin and Lenormand 2006): (i) a change in the genomicmutation rate U can be interpreted as changes in the expression ofmutated genes, (ii) an increase of the fitness variance suggests a varia-tion in the fitness effects of mutation between environments (iii), achange in the average fitness measuredmight be explained by increasedselection strength in harsh conditions.
In harsh environments, the effects of deleterious mutations areexpected to increase, because of the biological and ecological pressureinduced by stress. However, this view is disputed by experimental evidencein Escherichia coli (Kishony and Leibler 2003) and C. elegans (Andrewet al. 2015). In general, the interaction between stress and fitness effects ofmutationsmay be categorized as follows (Elena and deVisser 2003): first,unconditionally deleterious, with the magnitude of the stress increasingthe deleterious effect; second, conditionally neutral, i.e., neutral in someconditions and deleterious in others; third, conditionally beneficial, i.e.,advantageous in some conditions but deleterious in others.
While most MA experiments have been performed in model or-ganisms, no results are available inmarine phytoplanktonic eukaryotes.Here, we report MA experiments in four haploid marine green algae(Chlorophyta): Ostreococcus tauri RCC4221 (Blanc-Mathieu et al.2014), Ostreococcus mediterraneus RCC2590 (Subirana et al. 2013),Micromonas pusilla RCC299 (Worden et al. 2009), and Bathycoccusprasinos RCC1105 (Moreau et al. 2012). All species belong to theMamiellales order (class Mamiellophyceae, Marin and Melkonian2010), and are widespread members of the marine phytoplankton(De Vargas et al. 2015) that sustain the marine ecosystem in coastalareas (Worden et al. 2004). These green algae contain the smallestknown free-living eukaryotes (Courties et al. 1994), defined as thepico-phytoplankton (see Massana 2011 for a review). They have asimple cell organization, with only one chloroplast and one mitochon-drion, and a small genome of 13–21 Mb.
MATERIALS AND METHODS
Biological modelsWe performed MA experiments on four haploid marine green algae(Chlorophyta): O. tauri RCC4221, O. mediterraneus RCC2590, M.pusilla RCC299, and B. prasinos RCC1105. All cultures are availablefrom the Roscoff Culture Collection (http://roscoff-culture-collection.org/). The identity of each strain was confirmed by 18S rDNA sequenc-ing and PFGEmigration (Schwartz and Cantor 1984) at the start of theexperiment. All species were kept in L1 liquid medium (salinity of35 g/L) with a light:dark (LD) cycle of 8:16 (8 hr light 16 hr dark) in24-well plates, at 20�, except for B. prasinos RCC1105, for which thecycle was 12:12 LD.
MA experimentsEach experiment was started with one single cell, which divided toproduce the ancestral population, fromwhich single cells were sampledtogenerate independent lines byonecell inoculation (Figure1). For eachspecies, we inoculated 40MA lines, kept in 24-well microtiter plates. Asa control, the ancestral population was cultured in the same conditions,but with an inoculation of 100 cells, to maintain a larger effectivepopulation size. We kept one microplate of controls, i.e., 24 controlreplicates.
Classically, inMA experiments of unicellular organisms, a colony ofcells is transferred to a fresh agar plate at each bottleneck to allow theseparation of the cells and the random sampling of a new cell. However,this is not possible in these species as they do not grow on the surface ofgelledmedia, and only grow slowlywithin gelledmedium, in contrast toS. cerevisiae, D. discoideum or Chlamydomonas reinhardtii (Hall et al.2013; Morgan et al. 2014; Wloch et al. 2001). Nevertheless, they areeasily cultured in liquid medium in the laboratory. Therefore, we de-veloped an experimental protocol combining flow cytometry, whichhas the advantage of counting individual cells while verifying cell sizeand fluorescence, and transfer of single cells in liquid media. Bottle-necks of MA lines to one cell were performed every 14 d. However,since the number of sampled cells follows a Poisson distribution, theprobability of line loss by sampling one single cell is 0.37. Indeed, incontrast with agar plate protocols, a colony cannot be observed in liquidmedium, and the cell densities were never large enough to be seen asgreen. Thus, we measured the number of cells in our wells and calcu-lated the volume needed to extract 10 cells, from which we sampled sixfor the next new six wells with fresh media. Thus, we maintained sixreplicates per line at each bottleneck.
If we assume that cells are uniformly distributed through themedium, the number of sampled cells, N, is Poisson distributed:
P�N; �N
� ¼ e2�N �NN
N!(1)
We inoculated those cells into a volume V from which we drewaliquots such that we ultimately discarded a proportion q of thesample. For a particular sample, the probability that all N cells arediscarded is simply qN. Thus, the overall probability that we discard allcells and hence lose a line is:
G ¼XNN¼0
P�N; �N
�qN (2)
If we wanted to include pipetting error, we could model this byassuming that the volume sampled differs from that intended by afactor a which is g distributed with a mean of 1 and a shape param-eter of b. Now equation 1 becomes:
P�N; �N;b
� ¼ZN
a¼0
e2a�Νða�NÞNN!
Dða;bÞda (3)
This is actually a negative binomial:
P�N; �N;b
� ¼ 1N!GðbÞ
�NN�1b
�b��Nþb
�2N2bGðNþbÞ (4)
So the probability of observing k or more line losses over t transfers isgiven by multiplying G from equation (2) by k and t.
One fifth of themicrotiter plate’s volumewas used for Cell counting,using a FACSCanto II flow cytometer (Becton Dickinson, FranklinLakes, NJ) equipped with an air-cooled laser providing 15 mW at488 nm with the standard filter set-up. Becton Dickinson TrucountTM
beads were used to calculate the abundance of the cells as described byPecqueur et al. (2011). A total of 20ml of mixed fluorescent beads 1mmin diameter (Molecular Probes Inc., Eugene, OR) were added as aninternal standard to 300 ml of the diluted sample (20th dilution). Theflow rate of the cytometer was set to high (acquisition time: 1 min).Eukaryotic pico-phytoplankton cells were detected and analyzed usingnatural chlorophyll fluorescence (chlorophyll a FL3 670 nm LP). The
2064 | M. Krasovec et al.
flow cytometry data were analyzed using BD FACSDiva (BectonDickinson).
In total, the experiments involved 27 bottlenecks over 378 d forO. tauri, 21 bottlenecks over 294 d forO. mediterraneus, 21 bottlenecksover 302 d forM. pusilla, and 16 bottlenecks over 224 d for B. prasinos(Table 1).
Estimation of fitnessWe estimated the fitness of lines from the number of divisions/day, G,calculated over a period of 14 d using the equation:
G ¼ e½lnðNt=1Þ=t� (5)
Nt is the final number of cells just before the bottleneck and t = 14 thenumber of days between two bottlenecks (t = 14). G is the number ofgenerations/day. To compareG between differentMA lines over time,the relative fitness, Gr (Gr = GMA/Gcontrol), was computed. The effec-tive population size of MA lines and control line populations at eachbottleneck was estimated as the harmonic mean of the population sizebetween t = 1 to t = 14 days. Following Chevin (2011), the fitnesseffects of mutations in the MA lines at the end of the experiment weremeasured by estimating the selection coefficient scaled by the gener-ation time, ST.
ST ¼ lnðGMAÞ2 lnðGcontrolÞlnðGcontrolÞ
ln2 (6)
Fitness assays in stressful conditionsUpon completion of the MA experiments in O. mediterraneus, M.pusilla, and B. prasinos, we used MA lines that had survived from thefirst to the last generations in each species for further investigations in
stressful conditions: nineMA lines ofO. mediterraneus, sevenMA linesof M. pusilla, and eight MA lines of B. prasinos. For O. mediterraneus,24 MA lines reached the end of the experiment, of which nine werechosen randomly for practicality.
Before starting fitness assays, we transferredMA lines in L1mediumflasks and let them grow for 2 wk to have enough cells to inoculatecultures. Fitness assays were performed in 48-well microtiter plates,with a starting population of�50,000 cells/well. For herbicide tolerancetests, we used Diuron at 10 mg/L and Irgarol 1051 at 1 mg/L (Sanchez-Ferandin et al. 2013). We tested salinities of 5, 20, 35, 50, and 65 g/Lusing L1 medium supplements (Guillard and Hargraves 1993). Thenumber of biological replicates was three for each MA line and fourfor each control. Cell concentrations were obtained by flow cytometry7 d after plate inoculation and STwas estimated as specified above. Thiscorresponds to a total of 52 wells measures for M. pusilla, 58 for B.prasinos, and 64 for O. mediterraneus. In O. tauri, the MA experimentwas completed 6 months before the start of the fitness assays understressful conditions, so fitness assays could not be performed for thisspecies.
Statistical analysisFirst, to investigate the relationship between fitness,G, and the numberof sequential generations, we used data from those lines that survivedthroughout the experiment: 21 lines for O. tauri, 24 for O. mediterra-neus, eight for B. prasinos, and seven for M. pusilla. We performed anANOVA on the control data to test whether G changed significantlybetween bottleneck times. The change in fitness of MA lines as a func-tion of time was thereafter analyzed by dividing the growth rate in theMA lines by the growth rate in the control, Gr, to remove the variationin the experimental set-up through time. For each line, the relationshipbetween the relative fitness (Gr) and the number of generations wastested using Pearson’s correlation.
Figure 1 Mutation accumulation (MA) experiments in pico-algae. Flow cytometer measurements were performed every 14 d to make one cellbottlenecks for each line. The ancestral culture of each species came from one single cell, inoculated in a well to grow enough cells to start theexperiment. The ancestral culture was maintained with higher effective population size in the control lines (inoculation of 100 cells) and MA linesby reinoculating one single cell, in six replicates per line, in 24-well microtiter plates.
Volume 6 July 2016 | Effects of Mutations in Algae | 2065
Second, for fitness assays in stressful conditions, ST was calculatedin all conditions using GMA and Gcontrol at each condition as explainedabove. We used a pairwise Student’s test to detect changes betweenMA lines and control. The p-value was corrected for multiple testingusing the Bonferroni-Holm method (Holm 1979), as implementedin R. Because MA lines could have fixed more than one mutationduring MA experiments, the selection coefficient is estimated for apotential set of mutations, including their possible epistatic effectson fitness.
To check that the environmental assays were indeed stressful for ourcultures,Gcontrol of the 24 controls at the end of theMA experiment wascompared to Gcontrol of the four controls in each of the environmentalconditions. A significant decrease of G in an environmental conditionconfirmed its stressful effect.
Finally, the salinity of 35 g/L is the standard salinity of culture. Weperformed a Fisher-Snedecor test to detect changes in variance betweenthe standard salinity and the other salinities.
Statistical analyses were performed with R (version 3.1.1) (R CoreTeam 2014).
Data availabilitySupplemental Material, Table S1, Table S2, Table S3, and Table S4contain fitness data of each MA line during the experiments. TableS5, Table S6, and Table S7 contain fitness data for fitness assays inherbicides and salinity gradient conditions. Control data during MAexperiments are provided in Table S8, Table S9, Table S10, andTable S11.
RESULTS
MA experimentsThe average effective population sizes across the experiment were sixcells for O. mediterraneus and M. pusilla and eight cells in B. prasinosand O. tauri (Table 1). The effective population size in the control,which was started with an initial cell number of 100, was estimatedto be 600 forM. pusilla, 650 forO. mediterraneus, and 700 for the othertwo species. Between each bottleneck, depending on species and lines,the lines divided 10–20 times, corresponding to 512 independent se-quential generations/line forO. tauri, 272 forO. mediterraneus, 265 forB. prasinos, and 272 for M. pusilla, on average (Table 1).
Fitness effects of mutations during the MA experimentWemeasured the fitness of ourMA lines as the number of cell divisionsthat occurred between two bottlenecks. There was no increase ordecrease in the growth rate of the control lines with generation time,but there was a significant variation between bottleneck times(ANOVA, p-value , 0.001) for all species. The fitness values ofMA lines were thus divided by the mean fitness estimation of thecontrol, Gcontrol, to yield relative fitness values, Gr; this was done to
eliminate any changes in fitness due to uncontrolled variation in theexperimental set-up.
The average Gr of O. tauriMA lines per bottleneck event decreasessignificantly with time (Pearson correlation test, r = 20.49, p-value =0.047). Also, four independent MA lines of the 21 had an individu-ally significant decrease of Gr (Pearson correlation test; r = 20.54,p-value = 0.026; r = 20.51, p-value = 0.035; r = 20.56, p-value =0.018; and r = 20.55, p-value = 0.022) (Table S4).
In O. mediterraneus, Gr significantly increased in one line (Pearsoncorrelation test, r = 0.52, p-value, 0.05). This line is the only one witha significant increase in fitness. No significant increase or decrease ofwithin-species fitness variation of Gr was detected forM. pusilla (TableS1), B. prasinos (Table S2), and O. mediterraneus (Table S3).We alsoinvestigated whether the number of lines lost varied over the course ofthe experiments: the data are consistent with a constant line loss overthe course of the experiments in all four species. However, the observednumber of lines lost was higher than expected by chance for a coeffi-cient of variation in sampling error equal or smaller to 5% (Table 2) inall species.
Fitness effects in stressful conditions
Herbicide stress: Both herbicides significantly decreased fitness in thecontrol lines in all tested species when compared to those culturedwithout herbicide (Wilcoxon test, p-value , 0.001); the herbicides re-duced growth rate by 52% and 74% for B. prasinos, 40% and 42% forM.pusilla, and 52% and 48% for O. mediterraneus, in Irgarol 1051 andDiuron media, respectively. In some cases, the variance significantlyincreased in MA lines (Fisher-Snedecor test, p-value , 0.05 in Irgarol1051 for O. mediterraneus and M. pusilla; p-value , 0.001 for B.prasinos with the two herbicides). A change of variance is as expectedin stressful conditions, because of the revelation of mutation effects.
For each species, the selection coefficients, ST, are shown in Figure 2.In contrast with the MA experimental conditions, some MA linesshowed significantly lower or higherfitnesses with a significant negativeor positive selection coefficient. In addition, ST changed between thetwo conditions for some identical MA lines.
In all, one MA line had a significantly positive selection coefficient,while two MA lines had a significantly negative selection coefficient inthe two conditions.
In summary, out of 24 tested lines, 12 lines (50%) had a significantlynegative ST in at least one herbicide, whereas five lines (21%) had asignificantly positive ST.
Osmolarity stress: MA and control lines were exposed to lower(salinities of 5 and 20 g/L) and higher (salinities of 50 and 65 g/L) levelsof salinity than the seawater of their natural environment (35 g/L).Below, we define an environment as stressful if the controls grow moreslowly in this environment than in standard conditions, the magni-tude of stress being estimated by the growth rate reduction. Both high
n Table 1 Summary of mutation accumulation experiments for four species
Species Number of Lines Average Number of Generations Per Line Ne T0–Tf (d)
O. tauri RCC4221 21 512 8 378O. mediterraneus RCC2590 24 272 6 294M. pusilla RCC299 7 272 6 302B. prasinos RCC1105 8 265 8 224
The number of lines is the number of surviving independent lines since the start of the experiment (T0) to the end (Tf).Ne is the average of effective population size betweeneach bottleneck. The last column is the total duration of the experiment. The probability of line loss was estimated using equation (2) in theMaterials and Methods section,N = 10, and q = 0.4. Expected number of line losses (Lexp) is estimated for each species as a function of the coefficient of variation in sampling cells (Table 2).
2066 | M. Krasovec et al.
and low salinities are stressful for B. prasinos. In contrast, the controllines of bothM. pusilla and O. mediterraneus grew faster in the slightlylower salinity treatment (20 g/L), andO. mediterraneus also grew fasterin the lowest salinity treatment (5 g/L) than in the standard conditions(35 g/L), suggesting that lower salinity is not necessarily stressful.A change in the selection coefficient of MA lines is thus not necessarilya consequence of a stress, but just due to benign changes of an envi-ronmental parameter.
Stress may be expected to increase the fitness variance. To test this,we compared the variance of ST in each condition with the standardconditions (35 g/L). The variance of the fitness of MA lines was signif-icantly higher for O. mediterraneus in the higher salinity, the moststressful condition (p-value , 0.01). This was also the case for B.prasinos in the two higher and lower salinities (p-value , 0.001) andat 20 g/L (p-value, 0.05). In contrast, we did not detect any significantchange of the variance in the fitness of M. pusilla MA lines betweentested conditions.
The three species showed contrasting patterns in terms of thedirection of selection coefficient variation, estimated from the numberof cell divisions/day (Figure 3). In O. mediterraneus, ST was systemat-ically negative for theMA lines. In particular, the decrease of STwas themost significant in the highest salinity, which was the most stressful. B.prasinos andM. pusillaweremuchmore variable. In B. prasinos, almostall MA lines had a significantly higher fitness than the control understressful conditions, whereas in M. pusilla approximately half of thelines with significantly different fitness to the control had higher fitness,and half had lower fitness. Strikingly, the MA lines in B. prasinos withhigher fitness under low salinity also had higher fitness in highersalinity.
In conclusion, all 24 MA lines investigated had a significant loweror higher selection coefficient than the control lines in at least onecondition, in accordance with the accumulation of spontaneous muta-tions in each MA line and a variation in the effects of spontaneousmutations in different environments.
DISCUSSION
No fitness decrease in three out of four species: nomutations or mutations with no fitness effects?Except forO. tauri, mostMA lines did not show any evidence of fitnessdecrease during the experiment. This is despite running the experimentwith a low average effective population size of around eight individuals,at maximum, over 265–272 generations. Several factors might explainthe absence of fitness decrease in most MA lines.
First, it could be due to a very low mutation rate. The low mutationrate could be a result of large effective population sizes in these species,that enable selection for lowermutation rate, limiting the appearance of
deleterious mutations (Lynch 2010; Sung et al. 2012). Nevertheless, itis possible to estimate a minimum mutation rate, assuming that asignificant fitness difference between the controls and the MA linesmight be the result of at least one mutation. Since each of the MAlines has a significant fitness difference with the control in at leastone condition, this corresponds to nine mutations for O. mediterra-neus, seven for M. pusilla, and eight for B. prasinos. Depending onthe number of generations and the genome size, the minimum mu-tation rate is thus 2.72210 mutations/site/generation for O. mediter-raneus (i.e., 0.0037 mutations/genome/generation), 1.75210 for M.pusilla (i.e., 0.0037 mutations/genome/generation), and 2.52210 forB. prasinos (i.e., 0.0038 mutations/genome/generation). These esti-mates are consistent with estimates in other unicellular organisms,like C. reinhardtii (Ness et al. 2012) with 2.08210 mutations/site/generation, or S. cerevisiae with 3.30210 mutations/site/generation(Lynch et al. 2008), Schizosaccharomyces pombe with 2.00210
mutations/site/generation (Farlow et al. 2015), Burkholderia ceno-cepacia with 1.33210 mutations/site/generation (Dillon et al. 2015),or E. coli with 2.45210 mutations/site/generation (Lee et al. 2012).Thus, fitness assays suggest that the minimum mutation rates ofour strains are not lower than those in other species and are close tothe constant mutation rate proposed by Drake (Drake 1991), that isU = 0.0033 in microorganisms.
Second, our measure of fitness may not be well suited to detect theeffect of mutations. In a MA experiment in D. discoideum, Hall andcoworkers followed eight fitness traits, and showed that two of themdidnot decrease (Hall et al. 2013).Wemeasured fitness as the rate at whichthe population increased over the 2 wk period between two bottlenecks.Most of the species tend to divide once a day, in rhythm with thenatural LD cycle, and so this is probably a robust character, particularlyunder the benign lab conditions. Likewise, cell death may not occurvery often under laboratory conditions. However, the fact that all MAlines show significant fitness differences with the control lines understressful conditions suggests that at least some mutations with fitnesseffects have occurred. Indeed, the fitness effects of mutations changeacross environments. Previous mutation experiments in Caenorhabditis(Baer et al. 2006) andD.melanogaster (Fry et al. 1996; Fry andHeinsohn2002) suggest thatmutational parameters change, as expected because ofGxE interactions.
Third, although all of these species are usually haploid, some linesmay have become diploid during the experiment, which may havemasked the effects of some deleterious mutations. However, we wouldexpect an increase of cell size with ploidy change, but this was notobserved by flow cytometry.
Finally, the duration of the experimentmay not have been sufficientto detect the effects of deleterious mutations. A decrease of fitness was
n Table 2 Statistical probabilities of line loss
CV pO. tauri O. mediterraneus B. prasinos M. pusilla
Lexp P(L $ Lobs) Lexp P(L $ Lobs) Lexp P(L $ Lobs) Lexp P(L $ Lobs)
0 0.0025 2.7 0 2.1 0 2.4 0 1.7 00.05 0.0026 2.8 0 2.2 0 2.5 0 1.8 00.4 0.0150 16.2 0.09 12.6 0 14.4 0 10.2 00.5 0.0260 28.1 0.89 21.8 0.5 25.0 0.0000 17.7 0.0033
Statistical probabilities of line loss, with p the probability of line loss at each bottleneck, Lexp the expected number of line losses for each experiment, and Lobs thenumber of observed line losses. Probability of observing Lobs or more line losses, as a function of the number of lines, the number of bottlenecks, t (16, 21, and27 bottlenecks depending on species), and the coefficient of variation of the sampling error (g distribution with average 1 and Coefficient of Variation CV). As anexample, for O. tauri, the probability of obtaining the observed line loss, Lobs, over the number of bottlenecks performed, with a CV of 0.04, is 0.09 [P(L $ Lobs)], theexpected line loss, Lexp, being 2.8.
Volume 6 July 2016 | Effects of Mutations in Algae | 2067
observed in O. tauri, which was allowed to accumulate mutationsover a longer period than the other three species (512 generations ascompared to the 272 and 265 in the other species). Indeed, recentMA experimental studies in C. reinhardtii (Morgan et al. 2014) andD. discoideum (Hall et al. 2013) reported a decrease in fitness withsimilar effective population sizes and higher numbers of sequentialgenerations (Ne = 6.5 during �1000 generations, and Ne = 7.5 dur-ing �994 generations, respectively). However, increasing the num-ber of sequential generations beyond 200 was not possible: inB. prasinos and M. pusilla, the MA experiments had to be stoppedas a consequence of the high line loss at each bottleneck. The num-ber of lines lost was leading to a stagnation of the total number ofindependent generations in the experiments. Line loss occurred ateach bottleneck from the start of the experiment and there was notrend (increase or decrease) in the number of lines lost with time.There are three possible explanations for line loss.
First, it could be due to sampling error, since single cell transfercannot be checked by eye or light microscopy due to small cell size.The probability of sampling one single cell from a volume follows aPoisson distribution and the probability of sampling no cell is thus0.37. To overcome this high rate of loss, our experimental procedurewas to sample a volume of culture predicted by flow cytometry tocontain 10 cells and divide this into six wells of a culture plate (seeMaterials and Methods). The probability of line loss is thus smallerthan 1022 in all experiments (Table 2). Coefficients of variationbetween 0.4–0.5 are needed to account for the observed line loss.However, since cytometry counts and pipetting errors are below 1%,it is highly unlikely that the sampling procedure is responsible forthe observed level of line loss.
Second, line loss may be the consequence of lethal mutations orstrong selection imposed by the experiment. If the experiment wasassociated with selection, we would expect the growth rates from thecontrol cultures, reinoculated at the same time with 100 cells, toincrease over the course of the experiment. There is no evidence forthis in any experiment. On the other hand, if lethal mutations areresponsible for the line loss, the rate of lethal mutations per gener-ation can be estimated by the proportion of lost lines divided by thenumber of generations and is 0.025 and 0.019 per genome pergeneration in B. prasinos and M. pusilla, respectively. Comparedto the known spontaneous mutation rates in other microorganisms(Drake 1991) and the estimations above, these lethal mutation rates
would be five to sevenfold higher than the spontaneous mutationrates reported above. This corresponds to lethal mutation rates thatare too high to be viably supported by a population.
A third hypothesis is that line loss is not the consequence of celldeath but the consequence of the absence of cell division. In labconditions, living cells usually engage in cell division at the end of theday, after light exposure, provided nutrients are available. Withoutbottleneck to one single cell, line loss in culture maintenance isexceptional. However, if cell division is triggered by an environmen-tal factor produced by the culture, it may be halted as a consequenceof the reinoculation step of one single cell. Consistent with this hy-pothesis, we observed that lost lines were transferred from signifi-cantly smaller volumes; from 2 ml on average, while maintained lineshave been transferred from 4 ml, on average, for M. pusilla and B.prasinos (Student’s test, p-values , 0.001 and , 0.01, respectively).The difference in line loss rates between species could thus be theconsequence of a difference in dependence of cell division to anenvironmental factor, lost during the reinoculation step. This envi-ronmental factor may be a metabolite produced by the culture, e.g., aphytohormone (Bartel 1997; Piotrowska-Niczyporuk and Bajguz2014). This high level of line loss reveals a knowledge gap on theinduction of cell division in nonmodel microorganisms and reducesthe amount of data available for fitness estimates. However, it doesnot alter the growth rate estimates of the maintained lines or theestimations of mutations per generation.
Increase or decrease of fitness understressful conditionsChanges in environmental conditions clearly enable the detection ofsubstantial variation in fitness between MA lines. This is as expectedif the fitness effect of mutation changed between environments. Thevariance between the MA lines is greater than the variance between thecontrol lines, suggesting that some mutations, not detected in MAstandard conditions, have been fixed in our MA lines. The significantvariation in fitness of some MA lines may be the result of severalnonmutually exclusive factors.
First, stressful conditions might exacerbate already existingfitness differences (Kondrashov and Houle 1994), so the MA linesmay have accumulated more slightly deleterious mutations thanthe control lines because they have smaller Ne, but the overalldifference in fitness between the MA and control lines is not
Figure 2 Selection coefficients, ST, inmedia containing Irgarol 1051 or Diu-ron herbicides. Empty circles with anumber: MA lines with significant STdifferences (Student’s test, p-value ,0.01). Left to right in the two graphs:B. prasinos in orange (eight MA lines),M. pusilla in blue (seven MA lines),and O. mediterraneus in green (nineMA lines). The ST of controls are pre-sented as white plots on the left of theMA lines. MA, mutation accumulation.
2068 | M. Krasovec et al.
detectable under the standard MA conditions. However, such dif-ferences in fitness might be detectable in a stressful environmentbecause the selection intensity changes (Martin and Lenormand2006). A change in selection intensity might come about through achange in the environment (Fry and Heinsohn 2002; Rutter et al.2012), or a change in the effect of an allele, for example by achange in gene expression. In another green algae, C. reinhardtii,Kraemer and coworkers also highlight the effects of stress on theamplification of deleterious mutations and their impact on fitness(Kraemer et al. 2015).
Second, the fixation of mutations, particularly slightly dele-terious mutations, is faster in the MA lines because they havesmaller Ne. As a consequence, these slightly deleterious muta-tions, which could become advantageous in a novel environ-ment, can accumulate in the MA lines but not in the controls.They may thereby increase the fitness in some of these MA lines.In addition, both the control and MA lines have accumulatedmutations that are neutral under the original conditions butdeleterious under the stressful conditions, causing the fall offitness among MA lines.
ConclusionWe investigated the accumulation of mutations in four marine greenpicoalgae. Despite a modest number of sequential generationsper MA line, we found evidence for a variation in fitness effectsof spontaneous mutations from benign to stressful environments.This allowed us to estimate a minimum per genome mutation rateof 0.0037.
ACKNOWLEDGMENTSWe acknowledge Hervé Moreau, Sheree Yau, and the Genomics ofPhytoplankton lab for support and stimulating discussions. We alsothank three anonymous referees for their constructive comments ona previous version of this manuscript. We are grateful to SebastienPeuchet, Aurelien De Jode, Claire Hemon, and Elodie Desgranges fortechnical assistance with the mutation accumulation experimentsfrom 2011–2013, and to the Agence Nationale de la Recherche(ANR) for supporting them (PICOVIR, DECOVIR, TARA-GIRUS;BLAN07- 1_200218, ANR-12-BSV7-0009, ANR-09-PCS-GENM-218). This work was funded by grant ANRJCJC-SVSE6-2013-0005to G.P. and S.S.F.
Figure 3 Selection coefficients in five salinity con-ditions. Empty circles with number are MA lines withsignificant differences to controls (Student’s test,p-value , 0.01). (A) O. mediterraneus in green, nineMA lines. (B) M. pusilla in blue, seven MA lines. (C)B. prasinos in orange, eight MA lines. The ST ofcontrols are presented as white plots on the left ofthe MA lines. MA, mutation accumulation.
Volume 6 July 2016 | Effects of Mutations in Algae | 2069
LITERATURE CITEDAjie, B. C., S. Estes, M. Lynch, and P. C. Phillips, 2005 Behavioral degra-
dation under mutation accumulation in Caenorhabditis elegans. Genetics170: 655–660.
Andrew, J. R., M. M. Dossey, V. O. Garza, M. Keller-Pearson, C. F. Baer et al.,2015 Abiotic stress does not magnify the deleterious effects of sponta-neous mutations. Heredity 115: 503–508.
Baer, C. F., N. Phillips, D. Ostrow, A. Avalos, D. Blanton et al.,2006 Cumulative effects of spontaneous mutations for fitness in Cae-norhabditis: role of genotype, environment and stress. Genetics 174:1387–1395.
Bartel, B., 1997 Auxin biosynthesis. Annu. Rev. Plant Physiol. Plant Mol.Biol. 48: 51–66.
Blanc-Mathieu, R., B. Verhelst, E. Derelle, S. Rombauts, F.-Y. Bouget et al.,2014 An improved genome of the model marine alga Ostreococcus tauriunfolds by assessing Illumina de novo assemblies. BMC Genomics 15:1103.
Chang, S.-M., and R. G. Shaw, 2003 The contribution of spontaneousmutation to variation in environmental response in Arabidopsis thaliana:responses to nutrients. Evolution 57: 984–994.
Charlesworth, B., and D. Charlesworth, 1998 Some evolutionary conse-quences of deleterious mutations. Genetica 102–103: 3–19.
Chevin, L.-M., 2011 On measuring selection in experimental evolution.Biol. Lett. 7: 210–213.
Courties, C., A. Vaquer, M. Troussellier, J. Lautier, M. J. Chrétiennot-Dinetet al., 1994 Smallest eukaryotic organism. Nature 370: 255.
Deng, H.-W., G. Gao, and J.-L. Li, 2002 Estimation of deleterious genomicmutation parameters in natural populations by accounting for variablemutation effects across loci. Genetics 162: 1487–1500.
Deng, H. W., and M. Lynch, 1997 Inbreeding depression and inferreddeleterious-mutation parameters in Daphnia. Genetics 147: 147–155.
De Vargas, C., S. Audic, N. Henry, J. Decelle, F. Mahé et al., 2015 Oceanplankton. Eukaryotic plankton diversity in the sunlit ocean. Science 348:1261605.
Dillon, M. M., W. Sung, M. Lynch, and V. S. Cooper, 2015 The rate andmolecular spectrum of spontaneous mutations in the GC-rich multi-chromosome genome of Burkholderia cenocepacia. Genetics 200: 935–946.
Drake, J. W., 1991 A constant rate of spontaneous mutation in DNA-basedmicrobes. Proc. Natl. Acad. Sci. USA 88: 7160–7164.
Elena, S. F., and J. A. G. de Visser, 2003 Environmental stress and theeffects of mutation. J. Biol. 2: 12.
Farlow, A., H. Long, S. Arnoux, W. Sung, T.G. Doak et al., 2015 TheSpontaneous mutation rate in the fission yeast Schizosaccharomycespombe. Genetics 201: 737–744.
Fernández, J., and C. López-Fanjul, 1996 Spontaneous mutational variancesand covariances for fitness-related traits in Drosophila melanogaster.Genetics 143: 829–837.
Fry, J. D., 2001 Rapid mutational declines of viability in Drosophila. Genet.Res. 77: 53–60.
Fry, J. D., 2004 On the rate and linearity of viability declines in Drosophilamutation-accumulation experiments: genomic mutation rates and syn-ergistic epistasis revisited. Genetics 166: 797–806.
Fry, J. D., and S. L. Heinsohn, 2002 Environment dependence of mutationalparameters for viability in Drosophila melanogaster. Genetics 161: 1155–1167.
Fry, J. D., S. L. Heinsohn, and T. F. C. Mackay, 1996 The contribution ofnew mutations to genotype-environment interaction for fitness in Dro-sophila melanogaster. Evolution 50: 2316–2327.
Fry, J. D., P. D. Keightley, S. L. Heinsohn, and S. V. Nuzhdin,1999 New estimates of the rates and effects of mildly deleteriousmutation in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 96:574–579.
Guillard, R. R. L., and P. E. Hargraves, 1993 Stichochrysis immobilis is adiatom, not a chrysophyte. Phycologia 32: 234–236.
Hall, D.W., S. Fox, J.J. Kuzdzal-Fick, J.E. Strassmann, and D.C. Queller,2013 The rate and effects of spontaneous mutation on fitness traits in
the social amoeba, Dictyostelium discoideum. G3 (Bethesda) 3: 1115–1127.
Halligan, D. L., and P. D. Keightley, 2009 Spontaneous mutation accumu-lation studies in evolutionary genetics. Annu. Rev. Ecol. Evol. Syst. 40:151–172.
Holm, S., 1979 A simple sequentially rejective multiple test procedure.Scand. J. Stat. 6: 65–70.
Katju, V., L.B. Packard, L. Bu, P.D. Keightley, and U. Bergthorsson,2014 Fitness decline in spontaneous mutation accumulation lines ofCaenorhabditis elegans with varying effective population sizes. Evolution69: 104–116.
Kavanaugh, C. M., and R. G. Shaw, 2005 The contribution of spontaneousmutation to variation in environmental responses of Arabidopsis thali-ana: responses to light. Evolution 59: 266–275.
Keightley, P. D., 1994 The distribution of mutation effects on viability inDrosophila melanogaster. Genetics 138: 1315–1322.
Keightley, P.D., and M. Lynch, 2003 Toward a realistic model of mutationsaffecting fitness. Evolution 57: 683–685.
Kishony, R., and S. Leibler, 2003 Environmental stresses can alleviate theaverage deleterious effect of mutations. J. Biol. 2: 14.
Kondrashov, A. S., 1988 Deleterious mutations and the evolution of sexualreproduction. Nature 336: 435–440.
Kondrashov, A. S., and D. Houle, 1994 Genotype-environment interactionsand the estimation of the genomic mutation rate in Drosophila mela-nogaster. Proc. Biol. Sci. 258: 221–227.
Korona, R., 1999 Genetic load of the yeast Saccharomyces cerevisiae underdiverse environmental conditions. Evolution 53: 1966–1971.
Kraemer, S. A., A. D. Morgan, R. W. Ness, P. D. Keightley, and N. Colegrave,2015 Fitness effects of new mutations in Chlamydomonas reinhardtiiacross two stress gradients. J. Evol. Biol. 29(3): 583–593.
Lee, H., E. Popodi, H. Tang, and P. L. Foster, 2012 Rate and molecularspectrum of spontaneous mutations in the bacterium Escherichia coli asdetermined by whole-genome sequencing. Proc. Natl. Acad. Sci. USA109: E2774–E2783.
Long, H. A., T. Paixão, R. B. R. Azevedo, and R. A. Zufall,2013 Accumulation of spontaneous mutations in the ciliate Tetrahy-mena thermophila. Genetics 195: 527–540.
Lynch, M., 2010 Evolution of the mutation rate. Trends Genet. 26: 345–352.Lynch, M., J. Blanchard, D. Houle, T. Kibota, S. Schultz et al.,
1999 Perspective: spontaneous deleterious mutation. Evolution 53: 645–663.
Lynch, M., W. Sung, K. Morris, N. Coffey, C. R. Landry et al., 2008 Agenome-wide view of the spectrum of spontaneous mutations in yeast.Proc. Natl. Acad. Sci. USA 105: 9272–9277.
Marin, B., and M. Melkonian, 2010 Molecular phylogeny and classificationof the Mamiellophyceae class. nov. (Chlorophyta) based on sequencecomparisons of the nuclear- and plastid-encoded rRNA operons. Protist161: 304–336.
Martin, G., and T. Lenormand, 2006 The fitness effect of mutations acrossenvironments: a survey in light of fitness landscape models. Evolution 60:2413–2427.
Massana, R., 2011 Eukaryotic picoplankton in surface oceans. Annu. Rev.Microbiol. 65: 91–110.
Moreau, H., B. Verhelst, A. Couloux, E. Derelle, S. Rombauts et al.,2012 Gene functionalities and genome structure in Bathycoccus prasi-nos reflect cellular specializations at the base of the green lineage. GenomeBiol. 13: R74.
Morgan, A. D., R. W. Ness, P. D. Keightley, and N. Colegrave,2014 Spontaneous mutation accumulation in multiple strains ofthe green alga, Chlamydomonas reinhardtii. Evolution 68: 2589–2602.
Mukai, T., 1964 The genetic structure of natural populations of Drosophilamelanogaster. I. Spontaneous mutation rate of polygenes controlling vi-ability. Genetics 50: 1–19.
Ness, R. W., A. D. Morgan, N. Colegrave, and P. D. Keightley,2012 Estimate of the spontaneous mutation rate in Chlamydomonasreinhardtii. Genetics 192: 1447–1454.
2070 | M. Krasovec et al.
Pecqueur, D., F. Vidussi, E. Fouilland, E. L. Floc’h, S. Mas et al.,2011 Dynamics of microbial planktonic food web components during ariver flash flood in a Mediterranean coastal lagoon. Hydrobiologia 673:13–27.
Piotrowska-Niczyporuk, A., and A. Bajguz, 2014 The effect of natural andsynthetic auxins on the growth, metabolite content and antioxidant re-sponse of green alga Chlorella vulgaris (Trebouxiophyceae). Plant GrowthRegul. 73: 57–66.
R Core Team, 2014 R: A Language and Environment for Statistical Com-puting, R Foundation for Statistical Computing, Vienna, Austria.
Rutter, M. T., A. Roles, J. K. Conner, R. G. Shaw, F. H. Shaw et al.,2012 Fitness of Arabidopsis thaliana mutation accumulation lineswhose spontaneous mutations are known. Evolution 66: 2335–2339.
Sanchez-Ferandin, S., F. Leroy, F.-Y. Bouget, and F. Joux, 2013 A new,sensitive marine microalgal recombinant biosensor using luminescencemonitoring for toxicity testing of antifouling biocides. Appl. Environ.Microbiol. 79: 631–638.
Schaack, S., D. E. Allen, L. C. Latta, K. K. Morgan, and M. Lynch, 2013 Theeffect of spontaneous mutations on competitive ability. J. Evol. Biol. 26:451–456.
Schrider, D. R., D. Houle, M. Lynch, and M. W. Hahn, 2013 Rates andgenomic consequences of spontaneous mutational events in Drosophilamelanogaster. Genetics 194: 937–954.
Schwartz, D. C., and C. R. Cantor, 1984 Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37: 67–75.
Shaw, R. G., D. L. Byers, and E. Darmo, 2000 Spontaneous mutationaleffects on reproductive traits of Arabidopsis thaliana. Genetics 155: 369–378.
Subirana, L., B. Péquin, S. Michely, M. L. Escande, J. Meilland et al.,2013 Morphology, genome plasticity, and phylogeny in the genus Os-treococcus reveal a cryptic Sspecies, O. mediterraneus sp. nov. (Mamiel-lales, Mamiellophyceae). Protist 164: 643–659.
Sung, W., M. S. Ackerman, S. F. Miller, T. G. Doak, and M. Lynch,2012 Drift-barrier hypothesis and mutation-rate evolution. Proc. Natl.Acad. Sci. USA 109: 18488–18492.
Vassilieva, L. L., and M. Lynch, 1999 The rate of spontaneous mutation forlife-history traits in Caenorhabditis elegans. Genetics 151: 119–129.
Vassilieva, L. L., A. M. Hook, and M. Lynch, 2000 The fitness effects ofspontaneous mutations in Caenorhabditis elegans. Evolution 54: 1234–1246.
Wloch, D. M., K. Szafraniec, R. H. Borts, and R. Korona, 2001 Directestimate of the mutation rate and the distribution of fitness effects in theyeast Saccharomyces cerevisiae. Genetics 159: 441–452.
Worden, A. Z., J. K. Nolan, and B. Palenik, 2004 Assessing the dynamicsand ecology of marine picophytoplankton: the importance of the eu-karyotic component. Limnol. Oceanogr. 49: 168–179.
Worden, A. Z., J. H. Lee, T. Mock, P. Rouzé, M. P. Simmons et al.,2009 Green evolution and dynamic adaptations revealed by genomes ofthe marine picoeukaryotes Micromonas. Science 324: 268–272.
Wright, S., 1932 The roles of mutation, inbreeding, crossbreeding, andselection in evolution. Proc. Sixth Int. Congr. Genet. 1: 356–366.
Zeyl, C., and J. A. DeVisser, 2001 Estimates of the rate and distribution offitness effects of spontaneous mutation in Saccharomyces cerevisiae. Ge-netics 157: 53–61.
Communicating editor: S. I. Wright
Volume 6 July 2016 | Effects of Mutations in Algae | 2071
61
CHAPITRE 3:
LE TAUX DE MUTATION CHEZ LES
MAMIELLOPHYCEAE
62
63
Quel est le taux de mutations spontanées des algues vertes (Chlorophytes) et comment varie-t-il ?
Les lignées mutantes issues des EAMs ont accumulé de ~80 à ~500
générations indépendantes. Ce chapitre traite des données génomiques de ces
lignées, dont 153 ont été séquencées par Illumina MiSeq et HiSeq, ainsi que les 4
types ancestraux.
Il n’est question ici que des Mamiellophycea, le taux de mutation de
Picochlorum RCC4223 étant abordé dans le chapitre 5. L’intégralité des données fut
traitée avec le même pipeline informatique. En résumé, les génomes sont alignés
sur le génome de référence disponible avec BWA (Li and Durbin, 2010); les fichiers
de sortie sont traités avec Samtools (Li et al., 2009); les mutations sont identifiées
avec GATK (DePristo et al., 2011).
Une importante variation du taux de mutation est mise en évidence et
discutée. Les régions non codantes et peu exprimées mutent plus que les autres
régions du génome. Cela peut s’expliquer par des mécanismes de réparation liés à
la transcription, appelés transcription-coupled repair (TCR).
Les taux de mutation obtenus sont mis en relation avec ceux de la littérature
existante sur les EAMs et les études de pédigrées (humain et souris). Nous
discutons du rôle de la taille du génome et de la distance entre le GC% réel et celui
à l’équilibre dans les variations inter espèces du taux de mutation. En effet, un biais
de mutation est observé, avec une plus forte fréquence de mutation de GC vers AT
qu’inversement. Cette augmentation du taux de mutation pour les nucléotides G et C
induit un plus fort taux de mutation pour les génomes éloignés de leurs équilibres en
GC.
En résumé, cette étude met en avant différents facteurs de variations intra et
inter génomiques et tente d’apporter des réponses quand à l’évolution du taux de
mutation chez les eucaryotes.
Le matériel supplémentaire de ce chapitre est disponible page 143 à 155.
64
65
The rate of spontaneous mutation rates in pico-algae and implications for mutation rate variation
Krasovec Marc*, Eyre-Walker Adam‡, Sanchez-Ferandin Sophie*, Piganeau
Gwenael*.
* Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie Intégrative des
Organismes Marins (BIOM), Observatoire Océanologique, F-66650, Banyuls/Mer,
France
‡ School of Life Sciences, University of Sussex, Brighton BN1 9QG, United Kingdom
Keywords: Spontaneous mutation rate, Mutation accumulation, Effective population
size, GC content, Phytoplankton. Corresponding authors: [email protected]
ABSTRACT Mutation, the ultimate source of genetic variation, has been studied by generations
of evolutionary biologists. Genome wide spontaneous mutation rates have been
estimated by mutation accumulation experiments in many model species. Here, we
report mutation rate estimations in four marine green algal species Bathycoccus
prasinos, Ostreococcus tauri, Ostreococcus mediterraneus and Micromonas pusilla.
There is a twofold variation of spontaneous mutation rate between species from
µ=4.4 x 10-10 mutations per nucleotide per generation to 9.8 x 10-10. Within genomes,
there is a threefold increase in the mutation rate in lowly transcribed regions,
consistent with transcription-coupled DNA repair. The mutation rate variation
between species can be explained by genome size, consistent with a lower fidelity of
replication in larger genomes. Additionally, we provide evidence that departure from
equilibrium GC content impacts the mutation rate, accounting for up to a 70%
increase of the mutation rate in some eukaryotic species.
66
INTRODUCTION Mutations are responsible for the genetic variability within organisms (Wright,
1932), which permit adaptation by natural selection. Thus, estimation of the mutation
rate (µ) is important for a better understanding of evolution and adaptability.
Estimating the mutation rate was difficult until recently, because mutations are rare
events, so methods either relied on reporter constructs, for example the reversion to
antibiotic resistance, or phylogenetic methods which required knowledge of
divergence times and assumptions of neutrality. However, new sequencing
technologies have allowed the estimation of the mutation rate from either offspring-
parent trios, in humans (Abecasis et al., 2010; Conrad et al., 2011) and mice
(Adewoye et al., 2015; Uchimura et al., 2015), or mutation accumulation (MA)
experiments (Halligan and Keightley, 2009; Lynch et al., 2008) in organisms such as
Drosophila melanogaster (Haag-Liautard et al., 2007; Keightley et al., 2014a, 2009),
Arabidopsis thaliana (Ossowski et al., 2010), Caenorhabditis elegans (Denver et al.,
2012, 2009, 2004), unicellular eucaryotes such as Saccharomyces cerevisiae (Lang
and Murray, 2008; Lynch et al., 2008; Wloch et al., 2001; Zhu et al., 2014) and
bacteria such as Escherichia coli (Lee et al., 2012) and Salmonella typhimurium
(Lind and Andersson, 2008). The mutation rate varies considerably across the tree of
life from 1.94 x 10-11 in the ciliate Paramecium tetraurelia (Sung et al., 2012b) to 9.78
x 10-9 in the bacteria Mesoplasma florum (Sung et al., 2012a).
The variation of mutation rate between species appears to be correlated to
two factors – genome size (Drake, 1991; Drake et al., 1998), and in particular the
size of the protein coding component of the genome (Lynch, 2010a), and effective
population size (Lynch, 2010a; Sung et al., 2012a). Both of these correlations may
arise because of the limitations that genetic drift imposes on selection to minimize
the mutation rate (Sung et al., 2012a). In asexual species, selection will favour an
intermediate mutation rate, which generates sufficient advantageous mutations,
whilst not generating too many deleterious mutations. In contrast, in sexual species,
selection always acts to minimize the mutation rate because a modifier of the
mutation rate only stays linked the mutations it causes for a short period of time and
deleterious mutations are more prevalent than advantageous mutations, increasing
the genetic load (Agrawal and Whitlock, 2012).
67
However, genetic drift ultimately limits the degree to which the mutation rate
can be reduced (Martincorena and Luscombe, 2013), because the strength of
selection acting on a modifier is equal to γ*U*s, where, γ is the proportional decrease
in the mutation rate, U is the genomic rate of mutation and s is the average strength
of selection against deleterious mutations. If γ*U*s<1/Ne then selection will be
ineffective against the modifier and the mutation rate cannot be reduced further.
Hence we expect the per site rate of mutation to depend upon the effective
population size (Charlesworth, 2009; Lanfear et al., 2014) – species with larger Ne
should have lower mutation rates – and genome size – the more selected sites there
are the lower the mutation rate should be. These predictions appear to be largely
upheld (Lynch, 2010a).
It has also been observed that there is variation in the mutation rate within a
genome at a number of different scales, from differences between chromosomes, to
variation between regions on a chromosome and variation between adjacent sites
(Hodgkinson and Eyre-Walker, 2011; Schrider et al., 2011). As an example, the Y-
chromosome in humans and chimps mutates faster than the other chromosomes
(Ebersberger et al., 2002). It is also known known that mitochondria has a higher
mutation rate than nuclear genome in Caenorhabditis elegans (Denver et al., 2009,
2000), Homo sapiens (Rebolledo-Jaramillo et al., 2014) and Drosophila
melanogaster (Haag-Liautard et al., 2008; Keightley et al., 2009). Within
chromosomes, it has been shown that nucleotide context affects the mutability of a
site in Chlamydomonas reinhardtii (Ness et al., 2015b), Bacillus subtilis (Sung et al.,
2015) and humans (Aggarwala and Voight, 2016; Gojobori et al., 1982). In
mammals, the most conspicuous effect is the high mutability of CpG dinucleotides
resulting from cytosine deamination (Coulondre et al., 1978; Fryxell and
Zuckerkandl, 2000), which leads to an 80% reduction in the frequency of the CpG
dinucelotide in the human genome (Lander et al., 2001).
Gene expression also affects the rate of mutation and its effect is
controversial. First, the mutation rate seemed lower in highly expressed genes
(Martincorena et al., 2012). However, analysis on MA lines in Escherichia coli
highlighted that the mutation rate increases with gene expression (Chen and Zhang,
2013). The last findings is congruent with observations in Saccharomyces cerevisiae
68
and humans (C. Park et al., 2012; Polak and Arndt, 2008). This phenomenon,
resulting from an alteration of DNA sequence associated with transcription process,
is known as transcription-associated mutagenesis (Kim and Jinks-Robertson, 2012).
In this study, we provide the first estimates of the spontaneous mutation rate
in 4 species of haploid green algae (Chlorophyta, Mamiellophyceae (Marin and
Melkonian, 2010)): Ostreococcus tauri RCC4221 (Blanc-Mathieu et al., 2014), O.
mediterraneus RCC2590 (Subirana et al., 2013), Micromonas pusilla RCC299
(Worden et al., 2009) and Bathycoccus prasinos RCC1105 (Moreau et al., 2012),
with compact genomes containing 83% to 84% coding sequences. Green algae
constitute one of the most important photosynthetic group on Earth, with an
ubiquitous repartition in global ocean (de Vargas et al., 2015), and play a
fundamental role in foodweb and biogeochimical cycles (Worden et al., 2015). These
green algae span a large evolutionary divergence as revealed by a high proportion of
species-specific genes, and high amino-acid divergence between orthologous genes
(Jancek et al., 2008; Šlapeta et al., 2006). Their genome size ranges from 13 Mb to
21 Mb and their average GC content from 48 to 63 %.
Combined with spontaneous mutation rates from previous studies, these new
data enable the exploration of the role of genome size, transcription rates and GC
content on mutation rate variation.
MATERIAL AND METHODS MA experiments
Mutation accumulation experiments were performed on four haploid marine
green algae (Chlorophyta): Ostreococcus tauri RCC4221, O. mediterraneus
RCC2590, Micromonas pusilla RCC299 and Bathycoccus prasinos RCC1105. All
strains are maintained in the Roscoff Culture Collection (RCC), in France
(http://roscoff-culture-collection.org/). MA lines were started from a clonal population
and maintained in L1 liquid medium in 24 wells of a microtiter plate, with a one-cell
bottleneck every 14 days (Krasovec et al., 2016). Serial bottlenecks allowed to
largely removes the influence of natural selection (the average effective population
size, estimated with the harmonic mean of cell number, varied between 6 and 9
across the four species, Table S1).
69
Cell concentrations of MA lines were measured by flow cytometry using a
FACSCanto II flow cytometer (Becton Dickinson, Franklin Lakes, NJ, U.S.A.),
relative to their natural chlorophyll fluorescence (FL3 acquisition at 670 nm) and size
scatter (SSC) acquisitions. Depending of cell concentration, the volume
corresponding to one cell was inoculated into a new well plate with new media (we
always assumed N0=1 to estimated the effective population size). The number of
generations per day, G, was estimated as follows:
𝐺 = 𝑒[!" (!"! )/!]
where Nt is the cells number in the well at bottleneck time, and t = 14 days. MA
experiments were performed over a period of 224 to 378 days depending on the
species and MA lines accumulated between 80 and 500 independent generations
(Table S1).
Sequencing DNA of ancestral types and MA lines were extracted as described previously
(Winnepenninckx et al., 1993) and sequenced with Illumina technology. All library
preparations and sequencing were performed by GATC biotech® (Konstanz,
Germany). Two different sequencing technologies were used: MiSeq for O.tauri and
O. mediterraneus, and HiSeq for B. prasinos and M. pusilla. Reads from ancestral
types and MA lines were aligned to the reference genomes using BWA (Li and
Durbin, 2010) (M. pusilla: GCA_000151265.1; O. tauri: GCF_000214015.2; B.
prasinos: ; O. mediterraneus in preparation) and SAMtools (Li et al., 2009) were
used to obtained bam and mpileup files. The four ancestral types and 150 MA lines
were sequenced: 40 for O. tauri, 37 for O. mediterraneus, 37 for M. pusilla and 36 for
B. prasinos.
Mutation identifications Mutations were called from mpileup files (Li et al., 2009) using GATK
(DePristo et al., 2011). The final mutation candidates were filtered to remove low
mapping quality regions (<50), low coverage regions (<5 reads), and shared
mutations between all MA lines. The number of callable sites per genome above
these thresholds was computed to estimate the per base pair mutation rate (97 to
99% of the genomes was callable (Table S2)). All mutation candidates were
70
compared to the ancestral type to discard spurious candidates that result from
discrepancies between the reference genome and the ancestral strain at the start of
the MA experiment (e.g. 9 substitutions in O. tauri RCC4221 occurred between 2001
and 2009 (Blanc-Mathieu et al., 2014)). Sanger re-sequencing of 22 random
mutation candidates were found to be correct (true positive rate = 100%). Whether
the mutation was non-synonymous, synonymous, intronic or intergenic was
extracted with snpEff (Cingolani et al., 2012). This calling method has been used for
base substitution and indels mutations.
Mutation rate at equilibrium GC content Let R1 be equal to the rate of mutation from GC to AT, R2 from AT to GC, R3
the rate of mutation between A and T, and R4 be the rate between G and C
𝑅!= (NN→NN)!!!
(1)
NNn is the number of GC or AT sites in the genome; NN→NN is the number of
mutations from GC→AT or GC→AT; Then it is straightforward to show that the GC-
content at mutational equilibrium (Sueoka, 1962)
𝐺𝐶!" = !!
!!!!! (2)
Assuming that R1, R2, R3 and R4 are constant, the expected mutation rate at
equilibrium is
µμeq = GCeq * (R1 + R3) + (1-‐GCeq) * (R2 + R4) (3)
Mutation spectrum tests To investigate the effects of context we extracted the 10bp either side of each
mutated site and used binomial tests to investigate whether a particular trinucleotide,
either NXN or NNX, where X is the mutated site, has a significantly higher or lower
mutation rate. We also ran a logistic regression to test whether the GC content
surrounding the site affected whether the site had a mutation or not.
To investigate whether gene expression affected the rate of mutation we used
STAR (Dobin et al., 2013) to compute the coverage of the genome by RNAseq data,
available from the ORCAE web site (Sterck et al., 2012), for B. prasinos (RNAseq
data from Moreau and co-workers (Moreau et al., 2012)) and O. tauri (RNAseq data
from Blanc-Mathieu and co-workers (Blanc-Mathieu et al., 2014)).Statistical analyses
were performed with R (version 3.1.1) (R Development Core Team, 2011).
71
RESULTS Mutation rates within Mamiellophyceae
We have performed an MA experiment in four species of algae. All together,
we found 238 single nucleotide mutations and 48 indels, summarized in Table 1.
Mutation types are provided in Tables S3 to S8. The numbers of synonymous and
non-synonymous mutations are as expected if mutations are randomly distributed
across sites for all species (Table 2), consistent with a lack of selection on non-
synonymous spontaneous mutations along the MA experiments. We thus assume
that the rates and patterns of mutation are not affected by selection.
The base substitution mutation rate (µbs) and the insertions-deletions mutation
rate (µID) per nucleotide per generation were estimated on callable sites, which
represented 97 to 99% of the genome (Table S2). The total mutation rate, µtot, is the
sum of µbs and µID. Mutation rates varied (not significantly, Kruskal-Wallis test) over
two-fold from 4.4 x 10-10 mutations per site per generation in B. prasinos to 9.8 x 10-
10 in M. pusilla.
Table 1. Summary of spontaneous mutation rates in four Mamiellophyceae species. BS is the number
of base-substitution mutations, Ins the number of insertions and Del the number of deletions. G is the
genome size in Mb and µ the mutation rate per nucleotide per genome per generation. TotGen is the
total number of generations accumulated per species.
Species TotGen G (Mb) BS Ins Del µbs -10 µID -10 µtot -10
O. tauri 17 250 12.46 91 5 8 4.19 0.60 4.79
O. mediterraneus 8 380 13.34 54 3 8 4.92 1.00 5.92
B. prasinos 4 145 14.96 22 5 5 3.02 1.37 4.39
M. pusilla 4994 20.99 71 2 12 8.15 1.61 9.76
Non-random mutation events in the genome:
It has been reported that the rate of mutation at a site varies between
nucleotides, and that some trinucleotides are more mutable than others, both in
eukaryotes (Ness et al., 2015b) and bacteria (Sung et al., 2015). However, we did
not detect any influence of adjacent nucleotides or GC content upon the mutation
rate in our data. The analysis of the distribution of mutations across these four
species reveals significant deviations from a uniform distribution of mutations along
the genome.
72
First, mutation events tend to cluster within adjacent nucleotides: of our 238
base substitution mutations across all species, 37 occurred adjacent to one another.
These clustered mutations probably represent single mutational events since each
multiple mutation is found within a single strain. No mutations were found in the
mitochondria or chloroplast genomes of these species; this is perhaps not surprising
since both genomes are small relative to the nuclear genome and both have lower
nucleotide diversity than the nuclear genome suggesting that they might have lower
mutation rates, consistent with patterns seen in higher plants (Smith, 2015).
Second, there is an excess of mutations in non-coding (Chi-Square, P-
value<0.01) and lowly expressed sequences (Wilcoxon test, P-value<0.001) as
opposed to coding regions (Table S9). The mutation rate varies by three fold (Table
2), in opposition to which is observed both in humans and yeast (C. Park et al.,
2012).
Third, there are significantly more deletions than insertions (Binomial test, P-
value<0.05) if we combine the data from all species. A deletion bias has been
reported in species among the three domain of life (Kuo and Ochman, 2009), and
may have contributed to the compact genomes of Mamiellophyceae species. Most
indels appeared in non-coding regions, and from the 20 indels occurring in coding
regions, there are 14 frame shifts, 2 codon insertions and 4 codon deletions.
Last, mutations are overrepresented at the first and last 1000 bp of
chromosomes (Binomial test, P-value < 0.001). However, despite the hypervariable
telomeric regions described above, there are no significant differences in the
mutation rate between chromosomes (Chi-Squared test, ns).
Table 2. Mutation rate variation between coding and non-coding sequences. The bias of mutation
toward non-coding sequences is significant, with P-value<0.01 (Chi-squared test). Syn and non-syn
are the synonymous and non-synonymous point mutations.
Species
% genome
non-coding
: coding
µ x 10-10
coding
regions
µ x 10-10
non-coding
regions
N mutations
syn : non-syn
O. tauri 18.4 : 81.6 3.9 8.9 19 : 42
O. mediterraneus 15.6 : 84.4 5.0 11.7 9 : 34
B. prasinos 16.9 : 83.1 3.4 14.7 5 : 10
M. pusilla 18.1 : 81.9 8.15 16.1 15 : 41
($!
The direction of base-substitution mutations The mutational spectrum of the Mamiellophyceae is biased towards GC to AT
mutations (significant for O. tauri and M. pusilla; Binomial test, P-value<0.01 and P-
value<0.05, respectively) (Figure 1 and S1). The equilibrium GC content, GCeq, is
substantially lower than the current GC content (GCeq = 36.8% and GCobs = 59.0%
for O. tauri, 43.5% and 56.0% for O. mediterraneus, 46.2% and 63.8 for M. pusilla
and 36.8% and 48.0 for B. prasinos), which suggests that other forces are acting to
maintain the GC content above its mutational equilibrium. It can be noticed that two
chromosomes are defined as outlier chromosomes in Mamiellophyceae because
they have a lower GC content than the other chromosomes, and are closer to the
GCeq. These chromosomes have a GC% of 51.3% in M. pusilla, 49.9% in O.
mediterraneus, 54.3% in O. tauri and 41.9% in B. prasinos.
Figure 1. The GC to AT and AT to GC mutations in the four species. GC to AT bias is significant in
O.tauri and M. pusilla (Binomial test, P-value = 4-7 and 0.02, respectively).
Inter-genomic variation in the mutation rate in eukaryotes Several ecological and biological factors have been proposed to explain the
variation in the mutation rate between species, such as genome size and effective
population size. We compiled the available estimates of the spontaneous mutation
rate from whole genome sequencing in wild-type strains (Table S10), adding the new
mutation rate estimates from this study.
1 2 3 4 5 6 7 8
020
4060
60
GC!AT AT!GC GC!AT AT!GC O. tauri O. mediterraneus B. prasinos M. pusilla
0
20
30
60
*
GC!AT AT!GC GC!AT AT!GC
16
30
18
8
3
37
19
***
(%!
Following Sung and co-workers, we performed a meta analysis to investigate
the effective population size effect on the mutation rate (Sung et al., 2012a). Using
Ne estimates provided in Table S10, we observe a significant decrease of the
mutation rate with the effective population size with all species (n=17, Pearson
correlation P-value<0.001, "=-0.71) (Figure 2). There is a negative correlation between genome size (G) and mutation rates
in bacteria (n=8, Pearson correlation, P-value=0.001, "=-0.95) and a positive
correlation between G and # in eukaryotes, where the mutation rate increases with
genome size (n=18, Pearson correlation, P-value=0.001, "=0.69, Figure 3A). These
results are consistent with a previous meta analysis by Lynch and Sung et al.
(Lynch, 2010a; Sung et al., 2012a), where it was suggested that the proportion of
coding regions, rather than genome size was the relevant parameter. The increase
of U with genome size in eukaryotes reveals an increase of the number of mutations
per genome at each division (n=18, Pearson correlation, P-value=0.0001, "=0.92,
Figure 3C). Note that there are two! outlier species in eukaryotes, Dictyostelium
discoideum and Paramecium tetraurelia (Figure 3). Exclude these two species would
provide more significant results. Additionally, the relation between genome size and
mutation rate is also observed using the size of the protein coding genome,
excluding the two outliers species (n=16, Pearson correlation, P-value=0.0001,
"=0.84, Figure 3B).
Figure 2. Correlation of the base substitution mutation rate and the effective population size (n=17,
Pearson correlation P-value<0.001, "=-0.71).
4 5 6 7 8 9
-11
-10
-9-8
-7
Log_Ne
Log_
µ
Bacteria Unicellular Eukaryotes Mamiellophyceae Metazoans Arabidopsis
Log1
0 of
nuc
leot
ide
mut
atio
n ra
te (µ
)
Log10 of effective population size (Ne)
4.0 5.0 6.0 7.0 8.0 9.0
(&!
Figure 3. Correlation of the base
substitution mutation rate, µ, in log10
scale. Raw data come from Table S10.
Blue regressions are done without the 2
outliers, Dictyostelium discoideum and
Paramecium tetraurelia. A. Mutation rates
as a function of the genome size G (n=18
eukaryotes, Pearson correlation, P-
value=0.001, "=0.69; n=16 eukaryotes,
Pearson correlation, P-value<0.0001,
"=0.89; n=8 bacteria, Pearson correlation,
P-value<0.0003, "=-0.95). B. Mutation
rates as a function of effective genome
size, estimated as the coding genome
size, Ge (n=16 eukaryotes, Pearson
correlation, P-value<0.0001, "=0.84). C.
Mutation rate per genome as a function of
genome size (n=18 eukaryotes, Pearson
correlation, P-value<0.0001, "=0.92).
0.0 0.5 1.0 1.5
-11.
0-1
0.0
-9.0
-8.5
-8.0
-7.5
Log_Ge
Log_
µ
!"
0.0 1.0 2.0 3.0
Log1
0 of
gen
omic
mut
atio
n ra
te (U
)
-3
-2
-1
0
1
Log10 of genome size (Mb)
!"#$%&'()Pt Dd
Log10 of effective genome size (Mb)
0.0 0.5 1.0 1.5 2.0
#"
$"
!"#$%&'()Pt Dd
Log10 of genome size (Mb)
0.0 1.0 2.0 3.0
-11.
0
-10.
0
-9.
0
-8.
0
Lo
g10
of n
ucle
otid
e m
utat
ion
rate
(µ)
$"
!"#$%&'()Pt Pt Pt Dd
0 1 2 3
-11.
0-1
0.0
-9.0
-8.5
-8.0
-7.5
Log_G
Log_
µ
!"
0 1 2 3
-3-2
-10
1
Log_G
Log_
U
-11.
0
-10.
0
-9.
0
-8.
0
Lo
g10
of n
ucle
otid
e m
utat
ion
rate
(µ)
('!
One striking feature of the mutation spectrum in Mamiellophyceae is the high
GC->AT mutation bias and the large gap between the observed genomic GC content
and the equilibrium GC content predicted from the pattern of mutation (Table S11).
Departures from the equilibrium GC-content affect the mutation rate; if the mutation
rate is biased towards AT and the observed GC content is above the equilibrium
value, then the mutation rate is elevated relative to its value at the equilibrium GC
content (Figure 3A). If we calculate the mutation rate at the equilibrium GC-content
we find that the observed mutation rate can be up to 2.5-fold higher than expected at
equilibrium. The ratio of the observed and the equilibrium mutation rates is highly
correlated to the ratio of the observed and equilibrium GC content (Pearson, P-value
= 2 x 10e-16, " = 0.99, Figure 4B). The correlation between the observed mutation
rate and GCr is also positive (Pearson correlation, P-value = 0.01, " = 0.51) (Figure
4A). GC->AT bias, estimated as R1/R2, is positively correlated to the nucleotide
mutation rate, excluding Mesoplasma florum and Paramecium tetraurelia (Pearson
correlation, P-value=0.002, #=0.61), Figure S3.
Figure 4. Correlation between mutation rate and gap from GC equilibrium. Pt is Paramecium
tetraurelia and Mp is Mesoplasma florum. A. Observed base-substitution mutation rates as function of
relative gap from GCeq. (Pearson, P-value = 0.01, " = 0.51, excluding Pt). B. Correlation between
relative increase of observed mutation rate from equilibrium mutation rate and relative gap from
GCeq, Pearson, P-value = 2 x 10e-16, " = 0.99.
µ obs
/µeq
GCr (GC/GCeq) GCr (GC/GCeq)
Pt
1 2 3 4
1.0
1.5
2.0
2.5
tab$Rgc
tab$
Rµ
!" #"Bacteria Unicellular Eukaryotes Mamiellophyceae Metazoans Arabidopsis
Mp
1.0 2.0 3.0 4.0
1.0
1.
5
2.0
2.
5
µ obs
/µeq
Pt
µ obs
µ eq
!"
Mp
1 2 3 4
-11
-10
-9-8
-7
tab$Rgc
Log_
µ
-11.
0
-10.
0
-9.0
-8.0
-
7.0
Log1
0 of
nuc
leot
ide
mut
atio
n ra
te (µ
)
1.0 2.0 3.0 4.0
77
To test the effect of effective population size, Ne, effective genome size, Ge,
genome size, G and distance to equilibrium GC content, GCr, on the spontaneous
mutation rate, we performed stepwise selection of these predictor variables using the
stepAIC function from R version 3.1.1 (R CoreTeam 2014). Data set was n=11
eukaryotes, excluding the outlier Paramecium tetraurelia. The final fit model included
two parameters, G and GCr (AIC=-28.8). In conclusion, spontaneous mutation rates
in eukaryotes increase with genome size G and with distance to equilibrium GC
content, GCr. In this dataset, the effective population size effect may be cancelled by
the genome size effect as Ne and G are negatively correlated (Pearson correlation,
P-value = 0.004, ρ = -0.64).
DISCUSSION
We have performed mutation accumulation experiments in 4 species of pico-
phytoplankton followed by whole genome sequencing. In total we have observed
238-point mutations and 48 indels. These have allowed us to study various aspects
of the mutation rate. The genome coverage of each mutation accumulation lines is
98% and mutation rates vary from µ=4.4 x 10-10 to 9.8 x 10-10 mutations per
nucleotide per generation.
Within genome variation of mutation rate
We observed a two to three fold difference in the mutation rate of coding and
non-coding regions in our dataset. There are several possible explanations for this
observation.
First, this could simply reflect selection against spontaneous mutations in
coding regions. The MA experiment was designed such that all but the most strongly
deleterious mutations would accumulate. However, strongly deleterious mutations
will lead to line loss, which is something we observed (Krasovec et al., 2016). In
coding regions, approximately one third of nucleotide positions are synonymous and
are thus expected to have little consequence on fitness. If selection occurred during
the MA experiments, mutations in coding regions should be biased towards
synonymous mutations. There is no excess of synonymous mutations in any of the
MA experiments (Chi-squared test, NS), consistent with a lack of selection during the
experiment.
78
Second, the lower mutation rate in coding regions could reflect a difference in
the efficiency of mismatch repair (MMR) between coding and non-coding regions
(Kunkel and Erie, 2015). The MMR efficiency may be optimized in coding region of
the genome (Foster et al., 2015; Lee et al., 2012). In E. coli, MA experiment using
wild type and MMR deficient lines show that the bias between coding and non-
coding sequence disappears in MMR deficient lines (Foster et al., 2015).
Third, the higher mutation rate in non-coding regions could come from
transcription-coupled DNA repairs (TCR) (Hanawalt and Spivak, 2008). This system
allows the repair of lesions in the DNA that are encountered during transcription and
hence is more likely in the regions of the genome that are expressed. In
Mamiellophyceae, genes coding for TCRs have been identified (gene family
HOMO03P001591 from the picoplaza database) (Vandepoele et al., 2013).
In conclusion, mutation rates in Mamiellophyceae do not occur randomly
along the genome, and we report one of the largest differences in the mutation rate
between coding and non-coding sequences in eukaryotes. The difference in the
mutation rate between coding and non-coding may affect mutation rate estimates in
some other species. In our data we were able to call de novo mutations in 98.5% of
the genome, but this fraction is much smaller in some other studies such A. thaliana
(Ossowski et al., 2010) (78%), C. reinhardtii (Ness et al., 2015b, 2012) (75%) and
Heliconius melpomene (Keightley et al., 2014b) (46%). In some of these studies
there is a bias towards coding regions, which will decrease the estimated mutation
rate if there are differences between coding and non-coding regions as we have
reported here.
Inter-specific mutation rate variation The genomic mutation rate varies by about two-fold amongst the four species
of Mamiellophyceae investigated here. Including these in an analysis of all mutation
rate estimates confirms the negative correlation between the mutation rate and
effective population size, the positive correlation between genome size (G and Ge)
and the mutation rate in eukaryotes (Smeds et al., 2016). There are a number of
potential explanations for why the mutation rate might be positively correlated to
genome size. (i) Larger genomes are more costly to replicate and this might lead to a
79
trade-off in fidelity. (ii) As we have shown the mutation rate is higher in non-coding
sequences and larger genomes have a higher proportion of non-coding DNA: i.e
~80% of the genome is coding in Mamiellophyceae, ~20% to ~50% in D.
melanogaster, C. elegans or A. thaliana and less than 2% in H. sapiens and mice;
(iii) it could be due to the negative correlation between genome size and effective
population size. To investigate this last explanation we ran a multiple regression of
the log mutation rate against the log genome size and log effective population size.
The best model only keeps the genome size, which is more relevant than the
effective population size (AIC=-26.1 for G and -24.8 for G and Ne).
In addition to genome size, the departure from the equilibrium GC base
composition is responsible for a substantial part of mutation rate variation between
species, as a consequence of the increase of the mutation rate with an increase of
the relative GC content from equilibrium. The mutation rate expected at equilibrium
GC composition is lower than the observed mutation rate measured especially in
Arabidopsis thaliana (Ossowski et al., 2010) and Mesoplasma florum (Sung et al.,
2012a). Most species have a higher GC content than expected from the GC->AT
and AT->GC mutation rates at the equilibrium and this gap is responsible of an
increase of the mutation rate. The forces that increase the GC content of the
genome thus contribute to an increase in the spontaneous mutation rate in the
majority of species studied by MA experiment (Table S10). Two mechanisms could
be responsible for an increase in GC content above the equilibrium value; selection
and biased gene conversion.
(i) Selection can act on protein coding sequences, synonymous codon use and gene
regulatory sequences, in a manner which is expected to lead to less biased base
composition than the mutational spectrum would cause.
(ii) Biased gene conversion, a byproduct of recombination, has been identified in
many organisms from bacteria (Lassalle et al., 2015) and yeast (Harrison and
Charlesworth, 2011; Lesecque et al., 2013) to humans (Duret and Arndt, 2008; Duret
and Galtier, 2009). There is indirect evidence of recombination in O. tauri (Grimsley
et al., 2010), so that GC biased gene conversion may be involved in GC content of
Mamiellophyceae.
80
CONCLUSION Our analysis of DNM in Mamiellophyceae species has shown that the
spontaneous mutation rate is ~3-fold higher in non-coding than coding regions.
In Eukaryotes, mutation rates increase with effective genome size and the
distance from the GC content equilibrium, providing support that processes
increasing the GC content may influence the spontaneous mutation rate. Because of
this, we propose that the distance a genome is from the GC equilibrium is an
important parameter in determining the mutation rate.
ACKNOWLEDGEMENTS We are grateful to Claire Hemon, Elodie Desgranges and Christophe
Salmeron for technical assistance with the mutation accumulation experiments from
2012 to 2015 and to the Genomics of Phytoplankton lab for support and stimulating
discussions. We acknowledge the O. mediterraneus genome consortium for access
to the complete genome data and the GenoToul Bioinformatics platform from
Toulouse, France, for bioinformatics analysis support and GenoToul cluster
availability. This work was funded by ANRJCJC-SVSE6-2013-0005 to GP and SSF.
81
CHAPITRE 4:
LES TRANSFERTS HORIZONTAUX DE
GENES : LE CAS DE PICOCHLORUM
RCC4223
82
83
Quelle est la part des HGTs dans la diversification des algues vertes (Chlorophytes)?
En plus des mutations, différents processus créent aussi de la diversité
génétique. L’un de ces processus est le transfert horizontal de gènes. Des transferts
horizontaux de gènes ont été proposés chez plusieurs espèces de Chlorophycées, y
compris une espèce de Picochlorum SE3.
Pour cette raison, un nouveau génome de référence d’une nouvelle souche
de Picochlorum, la Picochlorum RCC4223, est étudié pour tester cette hypothèse.
Le génome fut construit à partir de données issues de séquençages PacBio
RS II et Illumina MiSeq 2000. Différents assembleurs ont été utilisés jusqu'à obtenir
un génome de qualité satisfaisante: HGAP (Chin et al., 2013), ABySS (Simpson et
al., 2009), SGA (Simpson and Durbin, 2012), SSPACE (Boetzer et al., 2011) et
Geneious (Kearse et al., 2012). L’annotation à été faite à partir des bases de
données ORCAE (Sterck et al., 2012) et PicoPLAZA (Vandepoele et al., 2013).
27 candidats pour des HGTs sont proposés, et une analyse de génomique
comparative permet d’identifier des familles de gènes surreprésentées chez cette
nouvelle souche par rapport aux autres génomes d’algues vertes connus: plusieurs
retro-transcriptases, une famille de polykétide synthase, une endonucléase et une
hélicase.
En parallèle de ces études génomiques, une caractérisation phénotypique
confirme l’halotolérance déjà observée chez le genre Picochlorum , alliée à une forte
thermotolérance chez RCC4223. De plus, l’étude d’un méta-génome obtenu sur 4
sites d’échantillonnage en mer Méditerranée confirme la présence de séquences
18S appartenant à Picochlorum RCC4223 dans le milieu marin.
Enfin, ce génome constitue une nouvelle ressource pour la communauté
scientifique en générale.
Le matériel supplémentaire de ce chapitre est disponible page 156 à 158.
84
85
Genomic insights into a thermotolerant and halotolerant Trebouxiophyceae: Picochlorum costavermella RCC4223
Marc Krasovec*, Sophie Sanchez-ferandin*, Stephane Rombauts#, Nigel Grimsley*,
Sheree Yau*, Claire Hemon*, Hugo Lebredonchel*, Emmelien Vancaester#, Hervé
Moreau*, Klaas Vandepoele#, Gwenaël Piganeau*
*Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie Intégrative des
Organismes Marins (BIOM), ObservatoireOcéanologique, F-66650 Banyuls/Mer,
France
#Department of Plant Systems Biology (VIB) and Department of Plant Biotechnology
and Bioinformatics (Ghent University), Technologiepark 927, 9052, Ghent, Belgium
Keywords: Picochlorum, Green algae biotechnology, Horizontal gene transfers.
Corresponding authors: [email protected]
ABSTRACT Picochlorum species regroup halotolerant green algae, both studied for their
high tolerance to extreme environments and for their high potential for
biotechnologies. Here, we investigate the new genome of the strain Picochlorum
RCC4223, isolated from an estuary connected to the Mediteranean Sea. The
genome is 13.7 Mb length and contains 9315 genes, its GC content is 46 GC%. The
average gene length is 1155 bp, shorter as compared to other green algae, and the
genome contains 19 extended gene families. This study confirms the presence of
horizontal gene transfers (HGT) from bacteria in the genome of Picochlorum. Last,
18S sequences 100% identical with RCC4223 were present in four meta-genomes
from Mediterranean Sea samples, consistent with a marine habitat of the strain
RCC4223.
86
INTRODUCTION In aquatic and ocean ecosystems, photosynthetic planktonic microorganisms
are taxonomically very diverse, with representative in five of the six super-groups of
the eukaryotic tree of life (Not et al., 2012) and produce an important part of primary
production on Earth (Field et al., 1998; Worden et al., 2004). Chlorophyta (green
algae) are ubiquitous members of phytoplanktonic communities (de Vargas et al.,
2015) and are descendants of the first endosymbiosis, when an unicellular
heterotrophic eukaryote captured a cyanobacteria that evolved into the chloroplast,
1.6 billion years ago (Yoon et al., 2004).
Among Chlorophyta, the Trebouxiophycae is a monophyletic green algae
class proposed by Friedl in 1995 (Friedl, 1995), which contained the representative
genus Chlorella. The Trebouxiophyceae includes phenotypically very diverse
organisms; flagellates, coccoids, colonies and multicellular organisms (De Clerck et
al., 2012), photosynthetic symbiosis with other eukaryotes (Blanc et al., 2010) and
diverse cell division strategies (Yamamoto et al., 2007, 2003). Phylogenetic analysis
place the Trebouxiophycae as a recent group in Chlorophyta evolution (Friedl and
Rybalka, 2012; Leliaert et al., 2012). The lack of morphological discriminating features in the coccoid unicellular
Trebouxiophyceae (e.g Chlorella, Picochlorum, Nannochloris) led to a conundrum on
species description in many genera that has been partially solved by the
generalization of molecular techniques. The same have sometimes been described
as Nannochloris or Picochlorum genus and a distinction was proposed to clarify their
phylogeny (Henley et al., 2004). It was suggested that Picochlorum alga regroup
marine or saline autosporic taxa, supported by 18S rDNA phylogeny, including
Picochlorum RCC4223, Picochlorum SE3 (Foflonker et al., 2015) and Picochlorum
oklahomensis (Henley et al., 2004), while Nannochloris regroup freshwater algae.
They are characterized by a genome size estimated from 13 Mb to 50 Mb
(Yamamoto et al., 2001) according to species, a thick cell wall and halotolerance
(Foflonker et al., 2016, 2015; Henley et al., 2002).
The domestication of new algal species by evolutionary biology appeared to
be one of possible solutions to the challenge imposed by the shortage of natural
resources (Carroll et al., 2014). Biotechnological potential of green algae is the field
of intense investigation. Several biotechnological applications have been proposed
for Picochlorum algae as a consequence of their suitable lipid and protein content for
87
aquaculture (Becker, 2007; Chen et al., 2012), biofuel production (de la Vega et al.,
2011; S.-J. Park et al., 2012; Tran et al., 2014; Zhu and Dunford, 2013) or
bioremediation (von Alvensleben et al., 2013). Interestingly, a recent study suggests
that microalgae from the Picochlorum genus may form symbiosis with human cell
cultures. Black and co-workers (Black et al., 2014) provided evidence that a
spontaneous symbiosis between Picochlorum eukaryotum and retinal humans cells
in culture can be maintained in culture. This suggests that this alga is good model to
study the onset of photosymbiosis.
In this study, we provide the complete genome of Picochlorum RCC4223, a
resource for the investigation of metabolic pathways and genome evolution
mechanisms in Trebouxiophyceae.
MATERIALS AND METHODS
Strain characterisation Picochlorum RCC4223 strain was isolated from the estuary of the river La
Massane (June 2011, France). Water sample was spread on petri dish containing L1
(Guillard and Hargraves, 1993) agar medium. One colony was successively isolated,
cloned and kept in L1 seawater medium flask. We sequenced the complete 18S
rDNA sequence and obtained the karyotype by PFGE, following the protocol
described by Yamamoto (Yamamoto et al., 2001).
Phylogenetic position of Picochlorum RCC4223 was assessed with four
methods with 18S rDNA sequence: maximum likelihood, neighbor joining, maximum
parsimony and bayesian inference.
Phenotypic traits
Picochlorum species are characterized by large range of extremotolerence.
To explore phenotypic traits of Picochlorum RCC4223, fitness tests in two conditions
were performed.
First, halotolerant capacity was tested using fresh water 3N-BBM medium and
salinity gradient (10 to 70 g.L-1 from L1 medium with adjustment of salinity). Algae
were put in 48 well plates, with 5 samples per salinity and 5 controls in standard L1
medium. Plates were maintained one week at 20 °C with 12-12 h light-dark cycle.
88
Second, culture were maintained in the same condition as the halotolerant
test, but only in L1 medium and in two temperature conditions: 20°C and 35°C.
To compare with other green algae, the model species Ostreococcus tauri
(Blanc-Mathieu et al., 2014; Courties et al., 1994) was exposed to the same
conditions. Flow cytometer (Becton Dickinson, Franklin Lakes, NJ, U.S.A.) gave us
the cells concentration to estimate the growth rate using below equation:
𝐺 = 𝑒[!" (!"!!)/!]
with N0 = 5000, Nt the final cell number and t = 7. G is defined as the number of cell
divisions per day.
Picochlorum RCC4223 was isolated from the estuary of a river. As
consequence, it is unsure whether its habitat is mainly freshwater or marine. We
sampled two marine stations (SOLA marine station, 47 27’136 N 03 32’360 E; MOLA
marine station, 42°27‘205 N 03°32’565 E; Mediterranean Sea, France) and two
lagoon stations in Leucate lagoon (Mediterranean Sea, France).
Two hypervariable regions of the 18S rDNA sequence were amplified: the V4
(380 nt length) and the V9 (94 nt length) regions by PCR in eight samples from the
SOLA marine station, 14 samples from the MOLA marine station and 30 samples
from the Leucate lagoon. Sequencing was done by Illumina HiSeq (GATC biotech®,
Konstanz, Germany) and analysed using mothur (Schloss et al., 2009).
Sequencing and genome assembly DNA was extracted using the CTAB protocol modified from Winnepenninckx
and co-workers (Winnepenninckx et al., 1993) and RNA using the Direct-zol™ RNA
MiniPrep Kit from Zymo Research®. Two technologies have been used for whole
genome sequencing.
First, sequencing was done with the SMRT® Technology PacBio RS II by
GATC biotech® (Konstanz, Germany). The genome was assembled by GATC
biotech® (Konstanz, Germany), with InView™ De novo Genome 2.0. HGAP
assembler. Second sequencing was done using MiSeq technology (GATC biotech®,
Konstanz, Germany). Miseq reads were assembled with ABySS (Simpson et al.,
2009).
89
To improve the PacBio HGAP assembly, we removed ABySS contigs smaller
than 1kb length and bacterial contigs from ABySS and HGAP assembly. ABySS
contigs were then aligned to PacBio contigs to build scaffolds using Geneious.
MiSeq reads mapping to the HGAP scaffolds were done with two different assembly
software; SSPACE (Boetzer et al., 2011) and SGA (Simpson and Durbin, 2012).
Parameters and options tested are presented in the supplementary material.
Genome annotations The RNA libraries were constructed by GATC biotech® (Konstanz, Germany)
and sequenced by Illumina HiSeq. Annotation was done using ORCAE (Sterck et al.,
2012) and Picoplaza (Vandepoele et al., 2013) databases. Twenty height HGTs
candidates were proposed by Foflonker and co-workers in Picochlorum SE3
(Foflonker et al., 2015). HGTs candidates were search among the RCC4223
genome using blastp. Seven of the 28 candidates were found.
Additionally, new HGT candidates were identified by searching best blastp
hits against non Chlorophyta genes using the approach used previously in
Bathycoccus (Moreau et al., 2012). Twenty-four candidate genes were thus retrieved
with best blast hit on bacterial genes.
Extended gene families have been explored with Picoplaza platform, by
comparing genes from 38 eukaryotes species (including Metazoa, Funfi,
Chlorophyta, Embryophyta, Rhodophyta, Haptobionta and Stramenopile).
RESULTS
Strain characterisation: The phylogenetic position of Picochlorum costavermella (Figure 1A) inferred
from the 18S rDNA sequence is closely related the other Picochlorum genome
sequenced (Figure 1A), Picochlorum SE3 from Foflonker and co-workers (Foflonker
et al., 2015). Transmission electron photography reveals a small cell of 1 to 2 µm
size, with a simple organisation and a thick cell wall ~50 nm (Figure 1C). The
karyotype is provided in Figure 2, and suggests that the genome is composed of 13
chromosomes from ~95 to ~1 800 kb.
*+!
Phenotypic tests reveal a high tolerance to salinity variations (Figure 1B): the
strain has the faster growth rate in salinities from 20 to 35 g.L-1, and is able to grow
in all salinity concentrations tested. Growth is lower in fresh water and starts to
decrease after a salinity of 40 g.L-1. However, the salinity gradient used here
confirms that the strain may develop in a wide range of salinities. The temperature
assay indicates a similar tolerance to a wide range of temperature. Indeed,
Picochlorum RCC4223 is able to grow at 35 °C (Figure 1D), whereas Ostreococcus
tauri cultures do not survive when exposed to this temperature.
Figure 1. (A) Phylogenetic tree summarizing the position of Picochlorum RCC4223 in green
Chlorophyta, using 18S rDNA sequence. (B) Fitness measures of Picochlorum RCC4223 in salinity
gradient from fresh water to 70 g/L. The proxy for fitness is the number of cell division per day. For
each point, there were 3 replicates started with 5 000 cells. (C) Picochlorum RCC4223 transmission
electron micrograph. Note the thick cell wall. Cell size is about 1 to 2 µm, close to the smallest known
eukaryotes. (D) Fitness measures in high temperature (35°C) compared to standard culture
conditions (20°C). O. tauri grows faster is standard condition, but do not survive at 35°C, contrary to
Picochlorum RCC4223.
0 10 20 30 40 50 60 70
1.6
1.8
2.0
2.2
2.4
2.6
y
moy
1.8
2.0
2.2
2.4 C
ell d
ivis
ion
per d
ay
2.6
6 8 10 12 14
1.8
2.0
2.2
2.4
2.6
2.8
m1
m
68
1012
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8m
1
m
1.6
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
2.0 2.5 3.0 3.5 4.0 4.5 5.0
1.9
2.0
2.1
2.2
2.3
2.4
all
mm
1.9
2.0
2.1
2.2
Cel
l div
isio
n pe
r day
2.3
1.9
6 8 10 12 14
1.8
2.0
2.2
2.4
2.6
2.8
m1
m
68
1012
141.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
2.0 2.5 3.0 3.5 4.0 4.5 5.0
1.9
2.0
2.1
2.2
2.3
2.4
all
mm
20°C 35°C
6 8 10 12 14
1.82.0
2.22.4
2.62.8
m1
m
0
68
10
12
14
1.8 2.0 2.2 2.4 2.6 2.8
m1
m
2.0 2.5 3.0 3.5 4.0 4.5 5.0
1.9
2.0
2.1
2.2
2.3
2.4
all
mm
N0 = 100 000 L1 medium
fw 10 20 30 40 50 60 70
100 nm
1.44 µm 50 nm
Picochlorum Picochlorum
O. tauri
20°C 35°C
C
ell d
ivis
ions
per
day
Cel
l div
isio
ns p
er d
ay
N0 = 5 000 n = 3 fw = fresh water
1.8
2.0
2.2
2.4
2.6
1.6
Salinity
1.9
2.0
2.1
2.3
2.4
0
A B
C D
A RCC 4223
Picochlorum sp SE3
Chlorella variabilis NC64A
Coccomyxa C169
Chlamydomonas reinhardtii
Volvox carteri nagariensis
Micromonas pusilla RCC299
Ostreococcus meditarraneus RCC2590
Ostreococcus lucimarinus RCC2590
Ostreococcus tauri RCC745
Coleochaete pulvinata (outgroup)
100
98
100
100
100
100
100
98
0.01
*"!
Mothur analysis from the two marine stations and the lagoon confirms marine
distribution of RCC4223. Two OTU reference sequences had 100% sequence
identity with V4 and V9 sequences in the three stations. However, RCC4223 V4
region is 100% identical to Picochlorum RCC2935, RCC897, RCC142, RCC140,
RCC14 and RCC4223 V9 region is 100% identical to Picochlorum sp. Azis1. Despite
the 100% identical sequences found in environmental samples, it is thus not possible
to conclude about the presence of this RCC4223 strain. However, it clearly appears
that Picochlorum genus is present both in costal station (SOLA) and offshore station
(MOLA). Associated with a higher growth rate in saline water, RCC4223 seems to be
better adapted to the marine environment, athough it has been isolated in estuary.
Figure 2. PFGE migration of Picochlorum RCC4223 in the left and yeast ladder in the right. 13
chromosomes are identified, with size from 95 to 1 800 Mb. Ch_n N (Sx); Ch_n is the chromosome
number, N is the chromosome size in Mb estimated, (Sx) is the possible contig number associated to
the chromosome (see contig sizes in Table S4). PFGE migration provided a genome size of ~14.1
Mb.
Pico Yladder
!"#$
"""$
%&#$$
'!"$
&("$
($)##$
)("$
($%!#$
($(##$
)!"$
*+,(- $)"$./001/0'2$
*+,(0 $%##$./&3/)3/(02$
*+,(( $&##$./"2$
$*+,( $($&##$./(2$*+,01-1!$$$$$$$($"##$4$-$./-2$
*+,"1% $($-##$4$0$
*+,'3& $($###3)"#$./!2$
*+,) $)-#$*+,(# $&"#$
Mb
92
Genome assembly PacBio sequencing generate 266 217 reads, with mean read length of 6 215
bp and mean coverage of 69.94x. HGAP assembly built 361 contigs and total length
was 21 260 393 bp. Maximum and minimum contig lengths were 965 kb and 2.3 kb
length, with N50=244 Mb. After removal of bacterial contigs, 147 HGAP contigs were
conserved: total length was reduced to 14 233 452 bp with an average 46% GC
content. The statistical results of raw HGAP assembly and assembly report from
GATC biotech® (Konstanz, Germany) are provided in Table S1 and supplementary
materials. Illumina MiSeq sequencing generated 2.3 millions reads of 300 pb,
mapped in 94.63% of the HGAP genome. The best results obtained from ABySS
using Illumina reads are presented in Table S2. The ABySS genome was composed
by 19 896 contigs with N50=11 212 bp. After removal of bacterial contigs and small
contigs below 1 kb, 2 503 were kept and mapped on HGAP with Geneious, SGA
(Table S3) and SSPACE. Final assembly was composed by 40 scaffolds of 10.5 kb
to 1 794 kb, with N50=691 kb, GC content of 46% and total length of 13.74 Mb.
These values are similar to those obtained from the Picochlorum SE3 genome, that
is 13.5 Mb length and 46.1% of GC. Mitochondrial sequence corresponds to one
contig of 42.9 kb and 41% GC, and the chloroplast sequence corresponds to one
contig of 78.2 kb and 31.9% GC. Final assembly is presented in Table S4 and possible correspondences of scaffold sizes and chromosomes are presented in
Figure 2.
Genome annotations
9 315 genes composed the genome of Picochlorum RCC4223 with 2 738
genes smaller than 500 bp and 879 genes smaller than 200 pb (see lengths of Open
Read Frame (ORF) in Figure 3).
The RCC4223 genome reveals a high number of extended gene families.
These extensions are the results of tandem gene duplications. First, genes families
involved in variety of transposons and transposable elements are extended in the
genome of RCC4223 compared to SE3: (i) the reverse transcriptase
HOM03P000019 (53 vs 17; number of copies in SE3 and RCC4223, respectively)
and HOM03P007658 (10 vs 1), and (ii) the transposase HOM03P005338 (15 vs 2)
and MULE transposase domain HOM03P007225 (10 vs 2).
93
Second, the polyketide synthase HOM03P000145 (23 vs 6), which is
implicated in the fatty acid chain formation and polyketide secondary metabolites
production. With 23 copies, this genome contains the most abundant gene repertoire
of polyketide synthases as compared to other green algae. Polyketides are known in
bacteria, plants and fungi, and may be involved in the synthesis of antibiotics,
chemotherapeutic compounds or toxins (Carreras et al., 1997; Hopwood, 1997). In
plants, two molecules are particularly studied, stilbene and chalcone,, both
implicated in phytoalexins synthesis (Schröder and Schröder, 1990).
Third, the DEE superfamily endonuclease (HOM03P005481 and
HOM03P005432, 12 vs 5 and 11 vs 2). DDE family are responsible of coordination
of metal ions for catalysis.
Fourth, DNA helicase Pif1 HOM03P000255 (21 vs 4), involved in DNA repair
and genome stability in telomeres in yeast (Pinter et al., 2008) and human (Mateyak
and Zakian, 2006).
Last, Zinc finger SWIM-type HOM03P007225 (10 vs 2), which is involved in
different biological functions (Laity et al., 2001).
Of the 28 HGT candidates from the strain SE3 (Foflonker et al., 2015), 7 were
found in the RCC4223 genome (09g03890, 03g06310, 08g00570, 10g04270,
15g01560, 15g01560, 17g01380).
In addition, 27 new HGT candidates were identified: 01g04510, 01g02120,
01g05920, 01g07290, 01g09100, 01g10000, 02g01220, 03g02930, 03g03660,
04g02340, 05g00790, 06g02940, 07g01620, 08g03650, 09g00220, 09g01800,
10g00960, 12g02430, 13g00040, 14g01620, 16g00230, 18g00250, 20g00540,
20g00570, 21g00070, 21g00420).
*%!
Figure 3. Open Read Frame (ORF) lengths comparison between Picochlorum species.
Figure 4. Gene family extensions between Picochlorum SE3 and Picochlorum RCC4223.
Histogram of pico
pico
Freq
uenc
y
0 1000 2000 3000 4000 5000
020
040
060
0
Histogram of batash
batash
Frequenc
y
0 1000 2000 3000 4000 5000
050
100150
200250
Picochlorum RCC4223 Picochlorum SE3
Freq
uenc
y
Gene length (bp)
Pic
ochl
orum
RC
C42
23!
Picochlorum SE3 !10 20 30 40 50
10
50
40
30
20
Number of gene families per position
1-2 3-8 9-25 26-75 76-400 400+
95
DISCUSSION Origin of RCC4223
Picochlorum species are commonly found in marine and saline ecosystems
(see Picochlorum strains at http://roscoff-culture-collection.org). The presence of
Picochlorum RCC4223 species in marine stations and its higher fitness in saline
water justify its affiliation to the Picochlorum genus. The new genome of RCC4223
strain provides (i) a new tool to better study extremophile green algae, (ii) and to
explore metabolic pathways in these algae.
HGTs candidates It has been proposed that horizontal gene transfers from Bacteria to Plantae
including green algae, such as Bathycoccus prasinos RCC1105 (Moreau et al.,
2012), Picochlorum SE3 (Foflonker et al., 2015), Chlorella variabilis (Blanc et al.,
2010) and the red algae Galdiera phlegrea (Qiu et al., 2013) are more extended than
previously thought, and are not limited to the transfer of genes from the chloroplast
to the nucleus. HGTs are a fundamental mechanism of adaptation in Bacteria and
Archaea (Vos et al., 2015), by enabling the acquisition of new genes involved in
metabolic pathways, resistance to a stress or other biological interests.
These cross kingdom gene transfers are rare in eukaryotes, but there is
evidence that HGT conferred survival capability to extremophile eukaryotes
(Schönknecht et al., 2013). However, none of the HGT candidates we identified in
Picochlorum RCC4223 can be directly linked to thermotolerance or halotolerance of
Picochlorum.
Some HGT candidates are present in both RCC4223 and SE3, meaning that
these genes have been acquired earlier by their common ancestor. The presence of
species-specific genes HGTs candidates indicates that more recent transfers
occurred, and thus actively and regularly participate to genome evolution and
adaptation of these species.
96
Extended gene families Genes belonging to an over-represented family are disposed at adjacent
sites, suggesting an origin by tandem duplication.
In the case of the polyketide synthase family HOM03P000145, genes from
02g08770 to 02g08840 and from 16g00230 to 16g00280 are disposed in tandem,
with shorter gene length as commonly known in this gene family. Adjacent genes
have very low levels of amino-acid identity (~35%), pointing to a very ancient origin
by duplication.
The zinc finger SWIM-type HOM03P00722 is composed by 3 genes of ~2300
bp and ~95% of amino acid identity. There are also two times 3 short adjacent
genes, whose concatenated sequences have ~95% amino acid identity with the
previous genes of 2300 bp length.
The principle mechanism of gene family extension we observed could be the
division of existing genes that may first appear by duplication, and that are later
shortened by internal stop codons by mutations. This does not necessarily mean
functional loss, and RNA data suggests that all these genes are expressed.
CONCLUSION This study provided a new resource for the study of green algae by bringing a
new Picochlorum genome, from the halotolerant and thermotolerant strain RCC4223.
The genome of Picochlorum RCC4223 is characterized by a high number of genes
compare to other green algae with similar genome size, in part explain by the
extension of several gene families with short ORFs. In addition, we support the
hypothesis of horizontal gene transfers from bacteria to algae. Last, given the
interest of Picochlorum species for biotechnologies, this new genome is an
opportunity to explore deeply their potential.
ACKNOWLEDGEMENTS We are grateful to the Genomics of Phytoplankton lab for support and
stimulating discussions and the GenoToul Bioinformatics platform from Toulouse,
France, for bioinformatics analysis support and GenoToul cluster availability. This
work was funded by ANRJCJC-SVSE6-2013-0005 to GP and SSF.
97
CHAPITRE 5:
IMPACT DU TAUX DE MUTATION POUR
LES BIOTECHNOLOGIES
98
99
Quels sont les impacts du taux de mutation sur la domestication des algues vertes ?
Les espèces du genre Picochlorum sont étudiées pour différentes
applications biotechnologiques. Pour cette raison, mais aussi pour élargir les
connaissances sur le taux de mutation, une EAM a été réalisée avec l’espèce
Picochlorum RCC4223.
12 lignées ont été suivies pendant environ 150 générations par lignées sur
199 jours. Contrairement aux expériences avec les Mamiellophyceae, il n’y a pas de
témoin pour mieux suivre l’évolution de la fitness des lignées au cours du temps. La
méthode pour l’identification des mutations est identique à celle exposer dans le
chapitre 3, et le génome de référence est présenté dans le chapitre 4.
En résumé, il est observée une baisse de fitness au cours du temps chez les
lignées en raison des mutations délétères (cependant il n’y a pas de normalisation
par un control comme dans le chapitre 2). Le taux de mutation par génome est plus
élevé que chez les Mamiellophyceae et la majorité des eucaryotes unicellulaires. Il
n’y a que 21 mutations, ce qui est trop peu pour obtenir des résultats statistiques
solides sur la distribution des mutations dans le génome, comme se fut le cas chez
les espèces de Mamiellophyceae.
Cette étude met l’accent sur la variabilité du taux de mutation, y compris entre
espèces proches, et surtout sur l’utilisation du taux de mutations spontanées pour
l’évolution expérimentale et la domestication des algues vertes. En effet, les algues
vertes sont maintenant l’un des groupes le plus représenté parmi les estimations des
taux de mutations spontanées. Cette connaissance peut être prise en compte dans
le choix d’une espèce pour l’élaboration d’un protocole.
100
101
Spontaneous mutation rate of the Chlorophyta Picochlorum RCC4223
Krasovec Marc*, Piganeau Gwenael*, Sanchez-Ferandin Sophie*.
* Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie Intégrative des
Organismes Marins (BIOM), Observatoire Océanologique, F-66650 Banyuls/Mer,
France
Keywords: Mutation rate, Mutation accumulation, Green algae biotechnology,
Picochlorum.
Corresponding authors: [email protected]
ABSTRACT Mutation rate is a crucial parameter to understand evolution and adaptive capacity of
species, because mutations are at the origin of variability on which selection acts.
Spontaneous mutations may be an alternative to mutagenesis for microalgal
domestication purposes. To investigate the potential of spontaneous mutations to
generate genetic variation, we performed a mutation accumulation experiment using
the species Picochlorum RCC4223, a green alga with important biotechnological
potential. A decrease of fitness during experiment due to deleterious mutations is
observed. The spontaneous mutation rate is 10.12 x 10-9 mutations per nucleotide
per genome per generation, one of the highest estimates in unicellular eukaryotes.
102
INTRODUCTION Natural selection allows species to adapt from standing genetic variation,
powered by mutations which constitute the ultimate source of diversity (Wright 1932).
Quantifying the rate of mutations and their effects are thus of primary importance to
better understand evolution. Mutation accumulation (MA) experiments allows to
access to the spontaneous mutation rate (Halligan and Keightley, 2009) thanks to
the development of high-throughput sequencing technologies (see Wei and co-
workers for a database (Wei et al., 2014)). The principle is to maintain MA lines from
an ancestral type with serial bottlenecks to remove selection and fix deleterious
spontaneous mutations. Current estimations of mutation rates range from 1 x 10-9
mutations per nucleotide per generation in metazoans, such as Drosophila
melanogaster (Keightley et al., 2014a, 2009; Schrider et al., 2013), Caenorhabditis
elegans (Denver et al., 2012, 2009) or Heliconius melpomene (Keightley et al.,
2014b), and in order of 1 x 10-10 in microorganisms, such as Saccharomyces
cerevisiae (Lang and Murray, 2008; Lynch et al., 2008; Zhu et al., 2014),
Schizoaccharomyces pombe (Behringer and Hall, 2015; Farlow et al., 2015) and
Escherichia coli (Lee et al., 2012).
The mutation rate is expected to be low so that the mutational load due to
deleterious mutations is limited (Agrawal and Whitlock, 2012). As a consequence,
selection pushes to decrease the mutation rate. Effective population size is therefore
a key parameter because it defines the intensity of selection and drift, which are
inversely related (Charlesworth, 2009). Microorganisms, with high effective
population size, like green algae, are expected to reach a low mutation rate (Lynch,
2010a; Sung et al., 2012a). Inversely, high genetic drift imposes a drift barrier which
prevents the natural selection to reach the optimal mutation rate (Martincorena and
Luscombe, 2013).
In eukaryotes, the mutation rate is positively correlated to the genome size
(Smeds et al., 2016) (Krasovec et al., 2016, in preparation), which varies by 100-fold
from a few Mb to a few Gb. This variation causes an increase of replication cost that
leads to decrease the replication fidelity.
103
Although the knowledge about mutation rate variation between species is
improving, intra-species variation is also commonly observed in MA experiments
(Behringer and Hall, 2016). These variations are thus independent from genome size
and effective population size. In bacteria, mutation rate can increase by 100-fold
because of mutator alleles (Sniegowski et al., 1997; Taddei et al., 1997; Tenaillon et
al., 1999). This boosts the chance to observe the appearance of mutations (including
mutations advantageous). In eukaryotes, stress can induce an increase of the
mutation rate (Jiang et al., 2014), but not as strongly as in bacteria.
In green algae, MA studies are available in a wide range of species. These
MA experiments were conducted to estimate either the fitness effects of mutations
(Kraemer et al., 2015; Krasovec et al., 2016; Morgan et al., 2014) or the
spontaneous mutation rate: Chlamydomonas reinhardtii (Ness et al., 2015b, 2012;
Sung et al., 2012a) and four Mamiellophyceae species (Krasovec et al., 2016, in
preparation). This knowledge is relevant for biotechnological applications of green
algae, like the biofuels production (Brennan and Owende, 2010; Chisti, 2007; Mata
et al., 2010) and proteins for health food or cosmetics (Becker, 2007). All natural
populations harbour standing genetic variability (Barrett and Schluter, 2008) which
enables adaptation to environmental changes and pressures. Thus, domestication of
traits of interest could be obtained from the standing genetic diversity. Alternatively,
adaptation may also occur from new mutations so that the estimation of spontaneous
mutations rates is also paramount to investigate the possible rate of domestication of
green algae.
In this study, we performed a mutation accumulation experiment in
Picochlorum RCC4223, a green algae species belonging to Chlorophyta in the
Trebouxiophyceae family (Henley et al., 2004). It has a small haploid genome of
~13.5 Mb with 79.5% of coding sequences and 46% GC content (Krasovec et al., in
prep). Strains from the Picochlorum genera are versatile alga for large scale
culturing, capable of growing in a wide range of salinities and temperatures
(Foflonker et al., 2016, 2015). They also constitute interesting models in different
fields, such as medicine (Black et al., 2014), biofuels (Wang et al., 2016) and in
aquaculture as dietary complement given its high content in proteins (Chen et al.,
2012).
104
MATERIAL AND METHODS MA experiment: The Picochlorum RCC4223 culture has been isolated from an estuary of the
river La Massane (France) in our lab and has been deposited at the Roscoff Culture
Collection (http://roscoff-culture-collection.org/, France). 12 MA lines were kept from
a clonal ancestral population in 24 well plates, at 20°C with life cycle of 16h-8h dark-
light. MA lines were inoculated by one single cell and maintained by serial one-cell
bottlenecks every 14 days. At bottleneck time, cell concentration was measured with
a FACSCanto II flow cytometer (Becton Dickinson, Franklin Lakes, NJ, U.S.A.) using
natural chlorophyll fluorescence (670 nm used FL3 data) and SSC acquisitions.
Effective population size, Ne, was estimated with the harmonic mean of cell number
between bottlenecks and the number of generations was provided by the following
equation:
Nt is the total number of cells measured by flow cytometer and t the time between
two bottlenecks, i.e 14. Lines were maintained during 199 days and suffered a serial
of 14 bottlenecks. G is also used as a proxy of fitness to estimate the effects of
mutations over time, from T0 to Tf, with a linear model.
Sequencing and mutations identification
We extracted DNA using CTAB protocol for Illumina MiSeq sequencing,
performed by GATC biotech® (Konstanz, Germany). 12 MA lines and the ancestral
type were sequenced. To identify mutations, we used the same method described by
Krasovec and co-workers (Krasovec et al., 2016, in preparation); MiSeq reads were
aligned to the reference genome with BWA (Li and Durbin, 2010), bam files were
treated with SAMtools (Li et al., 2009) and mutations were identified with GATK
(DePristo et al., 2011). Afterwards, final vcf files and mutations candidates were
obtained after following filtered steps: removal of low mapping quality sites (<40), low
covered sites (<5) and candidates shared by two MA lines. SnpEff (Cingolani et al.,
2012) permitted to identify synonymous, non-synonymous, intronic and intergenic
mutation types using the annotation available in ORCAE web site (Sterck et al.,
2012). This mutation calling pipeline was used for base-substitution and insertions-
deletions (indels).
G = e ln Nt /1( )/t!" #$
105
Mutation spectrum
Pearson's chi-squared test was used to test the distribution of observed
mutations and expected distribution. Expected distribution H0 was defined assuming
that mutations appear randomly and independently in the genome.
We compared the distribution of mutations between coding and non coding
regions; the level of expression of mutated sites using STAR (Dobin et al., 2013); the
synonymous and non-synonymous base-substitution mutations; the direction of
mutations from each nucleotide to others and the nucleotide context (between 2 and
10 nucleotides) around mutated sites.
GC bias and GCeq were estimated from the following equations (Sueoka, 1962):
𝑅!=(GC→AT)𝐺𝐶!
, 𝑅!=(AT→GC)𝐴𝑇!
, 𝐺𝐶𝑒𝑞 = 𝑅!
𝑅! + 𝑅!, 𝛥𝐺𝐶 = 𝐺𝐶 − 𝐺𝐶𝑒𝑞
GCn and ATn are the total GC and AT; GC→AT and AT→GC are the number of
nucleotide changes; GCeq is the GC at the equilibrium, meaning the GC content
where the number of mutations from GC to AT and AT to GC is equal.
RESULTS Picochlorum mutation rate
The experiment lasted 199 days, corresponding to an average of 133
generations per MA line with an effective population size of Ne ~6. About ~ 97% of
the genome was usable for mutation identifications (Table 1). MA lines accumulated
21 mutations: 19 base-substitutions (Figure 1) and 2 insertion-deletions (indels)
(Table 2). 19 of these mutations were validated by PCR. Despite MA the fact that
lines were maintained for a similar number of generations, there is a strong
heterogeneity in the mutations distribution between lines (Table 1). Considering all
MA lines, µbs is 9.19 x 10-10 base-substitution mutations per nucleotide, and µID is
9.64-11 indels per nucleotide. Total mutation rate µ is 1.012 x 10- 9 mutations per
nucleotide per generation. It corresponds to Ubs = 0.0119 base-substitution mutations
per genome and UID = 0.0013 indels per genome per generation. No mutation was
found the mitochondria and the chloroplast genomes.
"+'!
The fitness of the MA lines significantly decreased during the experiment
(linear model, " = -0.36, P-value = 1.7 x 10-6), suggesting that some spontaneous
mutations are deleterious. Nevertheless, no fitness measurement of control line with
high effective population size is available to normalize MA lines fitness data (Chevin,
2011; Krasovec et al., 2016). Although the fitness decrease is expected as a
consequence of deleterious mutations, it can’t be exclude that the fitness variation in
MA lines could arise from the experimental set-up
We propose to estimate the arrival of new mutations in a Picochlorum
RCC4223 culture, started from modest an inoculation of N0=10 cells and maintained
for 30 days, assuming U=0.0132 mutations per genome per cell division and one cell
division per day. According to these simple assumptions, this will lead to a culture of
230 cells (~5.4 x 109 cells) corresponding to 230 cell divisions. This culture would thus
contain ~3.57 x 107 mutant cells (3.54 x 10-7 cells with one mutations, 23.4 x 104
cells with 2 mutations, 1543 cells with 3 mutations and 10 cells with four mutations).
Mutation distribution Mutations appearing in non-coding region were higher than expected by
chance but this is not statistically significant. The proportion of synonymous and non-
synonymous mutations was as expected under neutral evolution (Table 2),
consistent with the lack of selection against non-synonymous mutations.
Figure 1. Number of base-substitution mutations observed in MA lines of Picochlorum RCC4223. 19
base-substitutions mutations were detected, and 17 confirmed by PCR.
G!A C!T T!C A!G C!G G!C G!T C!A T!G A!T A!C T!A G C C GG C G C G C
1 2 3 4 5 6 7 8 9 10 11 12
24
68
10
1
2
3
0
Transitions Transversions
107
Table 1. Distribution of the mutations. BS and ID are the base-substitution and insertion-deletion
mutations. G* corresponds to the genome percentage usable for mutations identification.
MA lines G* (%) BS ID Generations
1 97.2 1 0 143
2 97.1 2 0 148
3 97.2 0 0 120
4 97.1 1 0 125
5 97.1 0 0 123
6 97.3 6 0 128
7 97.7 1 0 90
8 96.9 1 0 134
9 97.2 0 0 145
10 97.2 5 1 156
11 98.1 1 0 130
12 97.2 0 1 153
Table 2. The distribution of the mutations in the genome, with the predicted effects from SnpEFF.
Contig Position Reference Mutation Effect
1 1412265 A G Synonymous coding
2 1558965 T A Non synonymous coding
3 1431057 G A Intergenic
3 1438974 C T Synonymous coding
4 388329 G T Intergenic
4 532113 C A Non synonymous coding
4 632871 A G Non synonymous coding
4 726437 T A Non synonymous coding
4 934361 C A Intergenic
6 671466 G A Non synonymous coding
10 496542 C G Non synonymous coding
10 615708 A T Intergenic
12 132864 T C Intergenic
12 160261 C T Synonymous coding
12 545145 T C Intergenic
13 215260 G A Non synonymous coding
13 240891 G C Non synonymous coding
13 475120 C G Intergenic
41 2537 A C Non synonymous coding
27 93213 TG T Frame shift
13 8595 T TTA Frame shift
108
R1 (GC->AT mutation rate) and R2 (AT->GC mutation rate) are respectively
equal to 4.12 x 10-10 and 9.61 x 10-10 mutations per nucleotide per generation. We
obtained a GCeq of 30%, while the observed GC content is 46%. The base
substitution mutation increases by 8.8% as consequence of GC distance from
equilibrium, meaning it has a moderate influence on the high mutation rate in
Picochlorum. No influence of the nucleotide context was observed in the distribution
of the mutations.
Mutation rate variation
The Chlorophyta constitute one of the most represented phylogenetic group in
spontaneous mutation rate estimates by MA experiments. In addition to Picochlorum,
four mutation rates from Mamiellophyceae (Krasovec et al., in preparation) and
several mutation rates from multiple strains from Chlamydomonas reinhardtii (Ness
et al., 2015b, 2012; Sung et al., 2012a) are available (Table 3).
In C. reinharditii, the mutation rate varies by ~40 fold, like observed with all
unicellular eukaryotes. In Mamiellophyceae, µ is ~6.2 x 10-10(±2.5-10); Considering
the other eukaryotes with multiple mutation rate estimates, µ is ~39.3-10(±14.0-10) in
Drosophila melanogaster (Keightley et al., 2014a, 2009; Schrider et al., 2013) and
~21.4-10(±8.1-10) in Caenorhabditis elegans (Denver et al., 2012, 2009). It
corresponds to ~35% intra specific variation of µ. This part of mutation rate variability
is thus independent from species characters such as genome size or effective
population size. This suggests that a mutation rate estimated in a strain or species
may not be extrapolated to phylogenetically closely related species. This implies that
there is no or low phylogenetic constraint on the mutation rate. The mutation rate
observed in RCC4223 is thus not necessarily representative of the Picochlorum
genus mutation rate.
109
Table 3. Available direct spontaneous mutation rate estimations by mutation accumulation
experiments in Chlorophyta, taking into account base-substitutions and indels.
Species G G*% µ -10 U References
C. reinhardtii CC-2937 105 59.0 3.23 0.0362 (Ness et al., 2012)
C. reinhardtii CC-124 121 - 0.676 0.0076 (Sung et al., 2012a)
C. reinhardtii C-1952 104 71.5 4.05 0.0454 (Ness et al., 2015b)
C. reinhardtii CC-2931 104 69.7 15.6 0.1747 (Ness et al., 2015b)
C. reinhardtii CC-1373 104 75.8 28.1 0.3147 (Ness et al., 2015b)
C. reinhardtii CC-2342 104 69.2 11.1 0.1243 (Ness et al., 2015b)
O. tauri RCC4221 13.0 97.5 4.79 0.0062 Krasovec et al., 2016
O. mediterraneus RCC2590 13.5 97.2 5.92 0.0081 Krasovec et al., 2016
M.s pusilla RCC299 21.0 99.6 9.76 0.0205 Krasovec et al., 2016
B. prasinos RCC1105 15.0 99.5 4.39 0.0066 Krasovec et al., 2016
Picochlorum sp RCC4223 14.3 97.0 10.12 0.0132 This study
DISCUSSION High mutation rate
The mutation rate of Picochlorum RCC4223 is one of the highest
spontaneous mutation rates estimated from a microorganism. In unicellular
eukaryotes, higher mutation rate has been reported in three strains of C. reinhardtii
(Ness et al., 2015b).
First, a high mutation rate can be a consequence of low adaptation to lab
conditions. Picochlorum RCC4223 was isolated from brackish water, and we
performed the MA experiment just one year after its isolation, while it was kept in L1
medium. In eukaryotes, the mutation rate can increase in genome with a low fitness
quality or stressful conditions, such as in A. thaliana (Jiang et al., 2014) and D.
melanogaster (Sharp and Agrawal, 2012). This increases the chance of beneficial
mutation appearance. Although a higher mutation rate is a pledge of fast arrival of
new mutations, it also increases deleterious mutation events. Effectively, in
accordance with the literature, the fitness of the MA lines decreases during the
experiment as expected if mutations are deleterious (Ajie et al., 2005; Fry, 2001; Hall
110
et al., 2013; Keightley, 1994; Shaw et al., 2000). However, the large effective
population size in microorganisms allows effective selection against this higher pool
of deleterious mutations, and therefore limits the genetic load (Agrawal and Whitlock,
2012; Lynch and Gabriel, 1990) due to this high mutation rate. Species with a high
effective population size could support a higher mutation rate if necessary for a given
time period, without undergoing too heavily deleterious mutation effects.
Second, the mutation rate variation between MA lines can come from the
stochastic production of DNA repair proteins, reported in Escherichia coli (Uphoff et
al., 2016). This bias could be responsible of an increase of mutation rate in some MA
lines, increasing the global mutation rate from the whole experiment.
Biotechnological potential of Picochlorum RCC4223 Spontaneous mutation rate is determinant to estimate the number of mutants
in a culture of microalgae. In Picochlorum RCC4223, calculation suggests that the
number of mutants generated spontaneously is sufficient for effective and fast
experimental evolution, provided efficient selection procedure to isolate mutants with
relevant trait. For example, single cells with larger sizes or higher lipids content can
be sorted by flow cytometry using fluorescent dyes such as Nile red and BODIPY
505/515 (Rumin et al., 2015). Mutation and selection are of primary importance for
species domestication, as biotechnologies and use of new species are reported as a
possible solution to global challenges (Carroll et al., 2014).
In Picochlorum RCC4223, we expect to quickly reach a genotype of interest
with high effective population size and strong selection. Despite a decrease of fitness
due to deleterious mutations in MA condition, the adaptation potential of Picochlorum
is not impacted. First, high selection due to high effective population size removes
deleterious mutations. Second, mutation effects are environment dependent and a
deleterious mutation in one condition is not necessarily deleterious in other
(Krasovec et al., 2016).
111
The chance to a obtain desirable genotype may be increased by
mutagenesis. In green algae, different protocols have been tested and permit to
obtain cells of interest (Cazzaniga et al., 2014; Ota et al., 2013; Vonlanthen et al.,
2015). However, the mutagen factors also increase the deleterious mutation rate,
and thus the mutation load. Algal populations have so to be carefully exposed to a
mutagen in order to not compromise their survival capacity. In the case of Ultraviolet
irradiation, the survival rate reaches just 10% (Cazzaniga et al., 2014). The use of
mutagens chemicals could be avoided for Picochlorum RCC4223 in culture
condition, providing that the mutation rate and the effective population size are high.
It has recently been shown that experimental evolution with high effective population
size induces an increase of the growth rate over generations without the use of
mutagens in Chlamydomonas reinhardtii (Perrineau et al., 2014).
To conclude, knowledge about green algae mutation rates allows an
estimation of the numbers of mutations appearing in the culture, and may be
considered as a criterion for species selection for domestication purposes.
CONCLUSION This study provided the first direct spontaneous mutation rate estimate in a
Picochlorum species. The mutation rate of RCC4223 appears to be sensibly higher
that mutation rate commonly found in unicellular eukaryotes, including other green
algae, with the exception of a few strains of C. reinhardtii. This high mutation rates
strengthens Picochlorum species as a promising alga in biotechnological
researches.
112
113
CHAPITRE 6:
DISCUSSION GENERALE ET
CONCLUSION
114
115
1. Les variations de fitness indépendantes des mutations 1. La plasticité phénotypique
Les résultats obtenus à partir des données de fitness sur les lignées
mutantes (chapitre 2) indiquent que l’effet des mutations chez le phytoplancton
eucaryote peut être très important. Les lignées n’ont accumulé en moyenne que 2 ou
3 mutations chacune (Tableaux A1 à A3, page 159 à 161). Or elles ont des fitness
significativement différentes, inférieures ou supérieures au contrôle selon les
lignées. Il apparaît donc que quelques mutations induisent une variation de fitness
détectable. En effet, certaines mutations pourraient avoir un fort impact sur la
capacité de survie, notamment dans le cas d’une mutation qui introduit un codon
stop dans une protéine, ou qui réduit l’efficacité d’un facteur de transcription
responsable de la régulation d’une voie métabolique.
Les données de séquençage nous donnent l’opportunité de corréler certaines
mutations avec des données de fitness. Malgré cela, les données disponibles ne
permettent pas de comprendre la relation entre une mutation et un effet mesuré. Par
exemple, la lignées 3 d’O. mediterraneus pousse significativement plus vite dans le
milieu avec Irgarol et moins vite dans le milieu avec le Diuron. Cette lignée a fixé
trois mutations, deux substitutions non synonymes et une délétion avec un décalage
du cadre de lecture (Tableaux A2 et A3). Les gènes impactés sont identifiés (une
glycoside hydrolase, une triphosphate hydrolase et un domaine MYB), mais il n’est
pas possible de conclure sur l’impact réel de l’une des mutations sur la différence de
fitness observée.
Il existe cependant un point qui relativise l’importance du rôle des mutations
dans la variation de fitness observée: deux lignées n’ont pas fixé de mutation et
montrent pourtant un changement significatif de fitness (la lignées 7 d’O. tauri
montre une baisse significative de sa fitness au cours de l’EAM (Tableau A1), et la
lignées 5 de B. prasinos a une fitness plus élevée dans les milieux avec herbicides).
La forte couverture de séquençage sur la presque totalité du génome réduit la
probabilité qu’une mutation soit apparue sans avoir été identifiée.
116
Bien que cela ne concerne que 2 lignées sur la totalité dont la fitness a été
étudiée, ces résultats mettent en avant l’importance de facteurs non mutationnelles
qui peuvent être impliqués dans la variation de la fitness.
Cette différence de fitness peut venir de variations dans la transcription et la
méthylation de gènes (Jones, 2012), ou d’une forte plasticité comme proposé par
Collins et ses collaborateurs chez différentes espèces d’algues vertes (Collins et al.,
2014; Schaum et al., 2015; Schaum and Collins, 2014; Scheinin et al., 2015). La
plasticité est définie comme la capacité pour un même génotype de produire
plusieurs phénotypes en réponse à des variations environnementales. Il est montré
que dans un environnement fluctuant, la moitié de cette réponse peut être apportée
par la plasticité. Si tel est le cas, il est délicat d’affirmer que les changements de
fitness sont issus des mutations (même dans le cas où des mutations ont été
identifiées). Le changement de fitness serait alors lié aussi bien aux mutations qu’à
la plasticité phénotypique. Pourtant, les différences de fitness sont bien observées,
qu’elles soient d’origine mutationnelle ou non. C’est plutôt le rôle précis des
mutations qui est délicat à déterminer dans cette étude sur la fitness.
Par ailleurs, de nombreuses études sur les variations de fitness chez des
lignées issues d’EAMs avaient été réalisées avant que l’accès aux données de
séquençage ne soit aussi facile qu’aujourd’hui (Halligan and Keightley, 2009). Un
changement de fitness était alors interprété comme la conséquence de l’apparition
d’une mutation. A partir de là, la moyenne et la variance du caractère de fitness
permettaient de calculer les paramètres mutationnels. De ce fait, il est possible que
lors de ces études, le rôle des mutations sur la fitness ait parfois été surestimé en
raison de l’absence de données de séquençage.
117
1. 2. Les bactéries présentes dans les cultures d’O tauri
Les EAMs ont permis d’aborder d’autres questions que celles relatives aux
mutations, notamment sur la communauté bactérienne qui pourrait être associée aux
cultures de Mamiellophyceae. Des cas d’interactions entre bactéries et unicellulaires
eucaryotes phytoplanctoniques sont connus (Cole, 1982), comme chez les
diatomées (Bacillariophyceae) (Schäfer et al., 2002). Par exemple, certaines
bactéries peuvent produire des vitamines qui stimulent la croissance du
phytoplancton (Croft et al., 2005).
Aucune culture totalement axénique (c’est à dire sans bactéries) de
Mamiellophyceae n’a pour l’instant été obtenue dans notre laboratoire. Même avec
différentes méthodes (centrifugation, antibiotiques), des bactéries restent présentes
dans la culture. S’il n’est pas possible ou difficile d’obtenir des cultures axéniques, il
est raisonnable de penser que c’est parce que certaines bactéries favorisent ou
stimulent la croissance de la culture.
Si tel est le cas, une diminution de fitness observée ou une perte de lignée
pourraient s’expliquer par l’absence de la bactérie associée à la culture d’algue.
Dans le cas des EAMs, les lignées ont pu être inoculées, de façon stochastique,
avec ou sans bactéries lors des goulots d’étranglement.
Concernant les lignées d’O. tauri ayant survécu à l’ensemble de l’EAM, une
certaine communauté de bactéries devrait être retrouvée en fin d’expérience dans
les cultures si celle-ci. Aussi, on peut supposer que cette communauté bactérienne
aura été inoculée à chaque goulot d’étranglement avec O. tauri. est indispensable
pour favoriser la croissance de la microalgue.
Pour tester cette hypothèse, nous avons étalé sur boite de Pétri 16 milieux de
culture de 16 lignées d’O. tauri et identifié les colonies bactériennes par séquençage
du marqueur ADNr 16S. Les résultats de cette étude sont présenté dans un article
accepté dans la revue Frontiers in Microbiology (Lupette et al., 2016, in press, voir
annexes page 173). Le genre bactérien le plus représenté est Marinobacter, déjà
retrouvé dans des cultures de Dinobiontes ou Haptobiontes (Alavi et al., 2001; Amin
et al., 2009; Hold et al., 2001). Les Marinobacter sont connues pour produire des
118
sidérophores, un chélateur du fer utilisé par le phytoplancton (Martinez et al., 2003,
2000; Vraspir and Butler, 2009), et des vitamines B12 (cobalamine). Il n’est
cependant pas possible de conclure à ce stade de l’étude sur une éventuelle
association symbiotique entre les bactéries identifiées et O. tauri. Pour cela, d’autres
expériences doivent être menées sur des cultures axéniques pour tester les effets
de la présence/absence bactérienne, et cela dans différents milieux de culture. Si
cette relation est confirmée, les pertes de lignées observées lors des EAMs
pourraient peut-être s’expliquer en partie par l’absence de bactéries au moment du
goulot d’étranglement.
1.3. Le rôle des variations structurelles sur le phénotype
Au-delà des mutations étudiées dans les chapitres précédents (les
substitutions et les insertions-délétions), il existe des variations structurelles du
caryotype avec d’importantes conséquences phénotypiques. Les différentes
souches d’une même espèce de Mamiellophycae sont en partie différenciées par
leurs caryotypes, qui présentent des variations au niveau de la taille des
chromosomes dit « outliers » (Subirana et al., 2013). Il s’agit de chromosomes avec
une composition en GC inferieure au reste du génome, et de nombreuses régions
répétées. Il y a 1 ou 2 chromosomes dit « outliers » par génome suivant les espèces,
sur le total des chromosomes (de 17 à 20 suivant l’espèce) qui composent le
caryotype.
Par ailleurs, les Mamiellophycea sont infectés par des prasinovirus
spécifiques (Yau et al., 2015), comme c’est le cas pour le virus modèle d’O. tauri,
OtV5 (Derelle et al., 2008). En laboratoire, l’infection d’une culture d’algue par le
virus induit une très forte mortalité (on parle de lyse de la culture), mais qui n’est pas
totale car il existe une partie de la population d’algues qui est résistante au virus. Les
variations dans la taille des chromosomes « outliers » semblent être en partie
responsables de l’acquisition de cette résistance chez O. tauri (Yau et al., en
révision).
119
Pour ces raisons, une migration par PFGE (Schwartz and Cantor, 1984) sur
l’ensemble des lignées d’O. mediterraneus, M. pusilla et B. prasinos a été réalisée
pour détecter ou non un changement de caryotype au cours des EAMs.
Parallèlement, nous avons testé la sensibilité des lignées d’O. mediterraneus
RCC2590 au virus d’O. mediterraneus, dit OmV0 (Yau et al., 2015).
Il est ressorti de ces deux tests que quatre lignées d’O. mediterraneus n’ont
pas le même caryotype que le type ancestral. Toutes les autres lignées, y compris
chez les autres espèces, n’ont pas changé de caryotype. Le résultat obtenu par
PFGE est présenté sur la Figure 3, avec une variation de la taille du chromosome
11. Aussi, les 4 lignées avec un caryotype modifié étaient sensibles au virus, alors
que toutes les autres et la souche témoin étaient résistantes au virus. Ce n’est
cependant qu’une corrélation, et les mécanismes moléculaires qui peuvent lier ces
deux observations ne sont pas connus.
Par ailleurs, nous ne savons pas si ces cellules constituent une sous-
population au sein de la souche O. mediterraneus RCC2590, caractérisée par une
variation au niveau du chromosome 11, ou si ces variations sont issues du
processus d’accumulation de mutations. Dans la seconde hypothèse, l’estimation du
taux de mutation caryotypique d’O. mediterraneus RCC2590 donne Uc=0.00046
mutations par génome par génération.
Pour tester cela, une expérience est réalisée avec différents clones de la
souche O. mediterraneus RCC2590 isolés par cytométrie en flux. Chaque clone est
mis en présence du virus OmV0. Dans le cas d’une lyse, le caryotype est vérifié par
PFGE. Suivant le résultat, il est possible d’estimer la part de la population de la
souche RCC2590 qui présente cette variation chromosomique, certainement
corrélée avec la résistance au virus OmV0. D’après cette expérience, il apparaît qu’il
y a bien une sous-population, environ 7% des cellules, qui présente cette
particularité caryotypique.
Le séquençage par la technologie PACBIO d’une lignée de chaque caryotype
a permis d’obtenir une meilleure précision dans l’assemblage de ce chromosome,
notamment par la mise en évidence d’une région répétée de 60kb dans la lignée
"#+!
résistante. Ces résultats sont inclus dans un manuscrit portant sur l’analyse du
génome d’O. mediterraneus RCC2590 (Yau et al., en préparation).
Figure 1. Migration PFGE des lignées issues de l’EAM d’O. mediterraneus.. Les numéros d’O.
mediterraneus en blanc sont des lignées identiques au type ancestral, et en en rouge apparaissent
les numéros des lignées qui présentent une variation de caryotype et une sensibilité au virus OmV0.
Les rectangles jaunes indiquent les variations de caryotype observées chez les lignées.
2. Les limites à l’estimation du taux de mutation
Différentes facteurs jouent un rôle dans la détermination du taux de mutation
et dans ses variations (Figure 2). Le taux de mutation est un compromis entre ces
facteurs, que sont la taille du génome et le coût de la réplication, la force de
sélection et de la dérive, ou encore le poids des mutations délétères entre autres.
Les hypothèses qui prédisent l’impact de chacun de ces facteurs sur le taux de
450
555
610
1 900
680
815
375
295
225
945
485
194
48.5
727.5
!"""""#""""$""""""%""""""&"""""""'"""""(""""")""""""*"
!" #"!"# !$#%&'("&))*+&,-#
$%" $%"
"#"!
mutation sont en partie issues des résultats des EAMs. Il est donc nécessaire de
discuter des biais éventuels qui existes avec ce type d’approche expérimentale.
Figure 2. Présentation des différents facteurs qui influencent le taux de mutation.
Premièrement, ces expériences sont réalisées en majorité sur des
organismes connus et maintenus depuis des années en laboratoire. Ces conditions
sont donc devenues des conditions optimales, auxquelles les modèles biologiques
utilisés ont pu s’adapter et dans lesquelles, à part pour certaines expériences
données, ils ne sont pas soumis à la compétition interspécifique, à un
environnement variable ou encore à une forte sélection (après un certain temps
d’adaptation au laboratoire). Prenons le cas des algues vertes dans le cadre des
EAMs chez les Mamiellophyceae: les cultures sont clonales (pas de compétition
avec une autre espèce), adaptées aux conditions du laboratoire (avec un cycle de
vie parfaitement constant depuis des années: lumière et température), dans un
milieu riche jamais limitant (pas de compétition pour la ressource) et sans prédation.
Bien qu’il n’y ait pas d’hyper-mutateurs connus chez les eucaryotes, le taux de
mutation peut varier en cas de stress (Jiang et al., 2014; Sharp and Agrawal, 2012).
Dans la nature, nous pouvons supposer que les espèces ne sont jamais soumises à
des conditions de laboratoire.
!
Mutations délétères MMR et TCR
Dérive Coût de la réplication Taille du génome
Selection Fidélité de le Polymerase
Distance au GC
équilibre
Mutations adaptatives
Coût de la réparation
Mutagènes extérieurs
122
En raison de ces arguments, il est raisonnable de s’interroger sur la
représentativité de ce type d’expérience par rapport au taux de mutation réel dans la
nature. Dans ce cas, davantage d’EAMs réalisées en conditions de stress pourraient
permettre de plus se rapprocher du taux de mutation réel dans la nature. Cela a été
fait avec Caenorhabditis elegans pour la température (Matsuba et al., 2013), mais il
serait intéressant de réaliser ce type d’expérience en condition de stress avec
d’autres espèces. Le taux de mutation peut donc aussi varier en fonction des
conditions expérimentales, expliquant une partie de la variation observée entre les
expériences sur un même organisme. Un article se focalise sur cette question
(Behringer and Hall, 2016), en étudiant les résultats d’EAMs indépendantes chez D.
melanogaster, A. thaliana, C. reinhardtii, C. elegans, S. pombe et S. cerevisiae. Il
apparaît un taux de mutation différent mais un spectre mutationnel statistiquement
identique (c’est à dire que les mêmes biais sont observés, par exemple le biais de
mutations de GC vers AT) chez S. pombe, C. elegans et D. melanogaster
(Behringer and Hall, 2015; Farlow et al., 2015).
Deuxièmement, le nombre de taux de mutation disponibles au niveau de
génomes complets sur des souches « sauvages » avec un nombre relativement
élevé de lignées est faible et non représentatif de l’arbre eucaryote. Il existe des taux
de mutation disponibles par EAMs pour cinq métazoaires et deux levures (tous des
Unikonta), sept Archeplastida (six algues vertes et Arabidopsis thaliana),
Dictyostelium discoideum, Paramecium tetraurelia et neuf bactéries. De plus, la
couverture des grands génomes est souvent inferieure à 80% (78% pour
Arabidopsis thaliana (Ossowski et al., 2010), 46% pour Heliconius (Keightley et al.,
2014b)). D’une manière générale, le taux de mutation n’est pas uniforme, et cela à
toutes les échelles, d’où l’importance d’une couverture la plus grande possible pour
estimer un taux de mutation à l’échelle d’un génome.
123
3. Perspectives pour les EAMs Les EAMs ont eu un rôle majeur pour permettre une meilleure compréhension
des mutations et de leurs effets. Ce travail de thèse est une contribution à ce sujet,
et expose les premiers protocoles utilisant la technique de la cytométrie en flux pour
réaliser des EAMs avec des espèces de pico-phytoplancton qui ne se développent
pas sur boite. Ce dernier point est important car les microorganismes ayant fait
l’objet de recherches par EAMs sont des organismes qui peuvent se développer sur
boite de Pétri, c’est-à-dire en milieu solide. C’est un confort expérimental par rapport
au milieu liquide, mais le nombre d’espèces candidates est limité.
Les nouveaux séquenceurs favorisent les nouvelles études portant sur les
taux de mutation, et il y a une augmentation du nombre de taux de mutation
disponibles par EAM. Néanmoins, des taxons majeurs ne sont pas représentés,
notamment les Straménopiles, les Dinobiontes, les Haptobiontes, les Excavates, les
Rhizarias ou encore l’intégralité des Archées (on parle ici de taux de mutation à
l’échelle d’un génome complet). Il est donc nécessaire d’explorer d’autres modèles
biologiques que ceux connus depuis des années en laboratoire.
Seule une amélioration significative du nombre d’espèces, en explorant
l’intégralité de l’arbre du vivant, apportera des éléments complémentaires sur les
facteurs biologiques et écologiques qui influencent le taux de mutation et ces
variations.
En effet, les conclusions sur les facteurs influençant les variations du taux de
mutation ont été tirées à partir de données obtenues chez les Archeplastida et les
Opistochontes. Les taux de mutation de Paramecium tetraurelia (Sung et al., 2012b)
et Dictyostellium discoideum (Saxer et al., 2012), éloignées de ces deux règnes
eucaryotes, sont justement des « points aberrants » (outliers) concernant, par
exemple, le rôle de la taille du génome.
124
Pour ces raisons, à la suite de ce travail de thèse, une sixième EAM a été
lancée sur une espèce modèle, Phaeodactylum tricornutum RCC2967
(Straménopiles, Bacillariophycea, détails en Annexes), une diatomée dont le
génome est disponible et annoté (Bowler et al., 2008). Son génome fait 27.5 Mb
avec un GC de 48.8%. Dans le cas où l’expérience aboutirait (c’est à dire
conservation d’un nombre suffisants de lignées pour obtenir 8000 générations
indépendantes), ce serait le premier taux de mutation directement estimé sur une
espèce de Straménopiles. L’objectif est d’étendre les connaissances actuelles sur
les taux de mutation à d’autres modèles biologiques.
Le protocole de cette expérience est identique à celui décrit dans le chapitre
2, avec un suivi de 42 lignées qui seront séquencées au bout de ~200 générations
par lignée. Il existe d’autres espèces candidates intéressantes, mais il faut pour cela
un génome publié de bonne qualité, annoté et d’une espèce pour laquelle la
manipulation est la moins complexe possible. On peut par exemple citer
l’Haptobionte modèle Emiliania huxlei, même s’il y a des complications dans
l’assemblage du génome (Read et al., 2013).
Enfin, une dernière expérience est en projet pour étudier l’effet de la
température et du stress chez Picochlorum RCC4223. Cette souche est capable de
se développer jusqu’à 35°C. Une expérience en milieu standard à 20°C et une autre
à 30°C permettront de comparer les deux conditions. Une variation du taux de
mutation peut refléter un effet de la température ou du stress. 20 lignées dans
chaque condition seront suivies pendant 150 générations.
125
4. Conclusion générale
En conclusion, ce travail de thèse a permis l’estimation de 5 nouveaux taux de
mutations spontanées et fournit un nouveau génome d’algue verte assemblé et
annoté. Le nombre d’espèces ayant fait l’objet d’une estimation directe du taux de
mutation par EAMs était de 12 en début de thèse (septembre 2013), puis 25 en fin
de thèse (septembre 2016) en comptant les 5 algues vertes issues de ce travail. Ces
résultats ont permis de répondre en partie à la question de l’origine des variations du
taux de mutation à l’intérieur d’un génome et entre espèces.
Une méta-analyse confirme le rôle de la taille efficace et de la taille du génome
dans l’évolution du taux de mutation. Aussi, nous mettons en évidence l’impact de la
distance relative de la composition en GC du génome par rapport à l’équilibre dans
l’augmentation du taux de mutation.
D’une manière générale, cette contribution participe à résoudre la problématique
globale du rôle des mutations en évolution, et met en avant le rôle des expériences
d’accumulation de mutations dans les avancées faites par les biologistes sur les
questions qui entourent les mutations et l’adaptation.
Pour conclure, il est essentiel de développer des approches d’accumulation de
mutations sur un spectre plus large d’espèces. L’effet des mutations sur la fitness
est de mieux en mieux connu, de même que les spectres mutationnels chez les
modèles classiques en biologie. Il est crucial de s’orienter vers les nouveaux
modèles pour non seulement réévaluer les hypothèses existantes, mais aussi en
développer de nouvelles qui n’auraient peut-être pas émergé avec les
connaissances issues des modèles classiques.
126
127
ANNEXES
128
Page 1 of 3
L1 Medium
Guillard and Hargraves (1993) -‐ please see note at the bottom of this page
This enriched seawater medium is based upon f/2 medium (Guillard and Ryther 1962) but has additional trace metals. It is a general purpose marine medium for growing coastal algae.
To prepare, begin with 950 mL of filtered natural seawater. Add the quantity of each component as indicated below, and then bring the final volume to 1 liter using filtered natural seawater. The trace element solution and vitamin solutions are given below. Autoclave. Final pH should be 8.0 to 8.2.
Component Stock Solution Quantity Molar Concentration in Final Medium
NaNO3 75.00 g L-‐1 dH2O 1 mL 8.82 x 10-‐4 M NaH2PO4· H2O 5.00 g L-‐1 dH2O 1 mL 3.62 x 10-‐5 M Na2SiO3 · 9 H2O 30.00 g L-‐1 dH2O 1 mL 1.06 x 10-‐4 M trace element solution (see recipe below) 1 mL -‐-‐-‐ vitamin solution (see recipe below) 0.5mL -‐-‐-‐
L1 Trace Element Solution
To 950 mL dH2O add the following components and bring final volume to 1 liter with dH2O. Autoclave.
Page 2 of 3
Component Stock Solution Quantity Molar Concentration in Final Medium
Na2EDTA · 2H2O -‐-‐-‐ 4.36 g 1.17 x 10-‐5 M FeCl3 · 6H2O -‐-‐-‐ 3.15 g 1.17 x 10-‐5 M MnCl2·4 H2O 178.10 g L-‐1 dH2O 1 mL 9.09 x 10-‐7 M ZnSO4 · 7H2O 23.00 g L-‐1 dH2O 1 mL 8.00 x 10-‐8 M CoCl2 · 6H2O 11.90 g L-‐1 dH2O 1 mL 5.00 x 10-‐8 M CuSO4 · 5H2O 2.50 g L-‐1 dH2O 1 mL 1.00 x 10-‐8 M Na2MoO4 · 2H2O 19.9 g L-‐1 dH2O 1 mL 8.22 x 10-‐8 M H2SeO3 1.29 g L-‐1 dH2O 1 mL 1.00 x 10-‐8 M NiSO4 · 6H2O 2.63 g L-‐1 dH2O 1 mL 1.00 x 10-‐8 M Na3VO4 1.84 g L-‐1 dH2O 1 mL 1.00 x 10-‐8 M K2CrO4 1.94 g L-‐1 dH2O 1 mL 1.00 x 10-‐8 M
f/2 Vitamin Solution
(Guillard and Ryther 1962, Guillard 1975)
First, prepare primary stock solutions. To prepare final vitamin solution, begin with 950 mL of dH2O, dissolve the thiamine, add the amounts of the primary stocks as indicated in the quantity column below, and bring final volume to 1 liter with dH2O. At the NCMA we autoclave to sterilize. Store in refrigerator or freezer.
Component Primary Stock Solution
Quantity Molar Concentration in Final Medium
thiamine · HCl (vit. B1) -‐-‐-‐ 200 mg 2.96 x 10-‐7 M biotin (vit. H) 0.1g L-‐1 dH2O 10 mL 2.05 x 10-‐9 M cyanocobalamin (vit. B12) 1.0 g L-‐1dH2O 1 mL 3.69 x 10-‐10 M
ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION
Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org
RCC 4221Ostreococcus
tauri
STATUSStatus: DistributedCryopreserved:
IDENTITYClass: MamiellophyceaeOrder: MamiellalesEcotype:Strain name: BCC145000Other names: La Reine (from BCC1000, RCC745)
ORIGINOcean origin: Mediterranean SeaRegion of origin: Thau lagoonCountry of origin: FranceCruise:Isolation station:Isolation depth: 0 mGPS position: +42° 24', +3° 36'Isolation Date: 3/5/1995 00:00:00Isolator: Courties
CULTURESize: 1.0 µmCell shape: CoccoidCell assemblage:Growth medium: L1Growth light: 100 µEinGrowth temperature: 20.0°CRemarks: Clonal cultures obtained from RCC745. Replaces RCC745
RCC 4221
STATUSStatus: DistributedCryopreserved:
IDENTITYClass:Order:Ecotype:Strain name:Other names:
ORIGINOcean origin:Region of origin:Country of origin:Cruise:Isolation station:Isolation depth:GPS position: n/aIsolation Date:Isolator:
CULTURESize:Cell shape:Cell assemblage:Growth medium:Growth light:Growth temperature:Remarks:
ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION
Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org
RCC 2590Ostreococcusmediterraneus
STATUSStatus: DistributedCryopreserved:
IDENTITYClass: MamiellophyceaeOrder: MamiellalesEcotype: clade DStrain name: P_4-03_1Other names: BCC 102000
ORIGINOcean origin: Mediterranean SeaRegion of origin: Gulf of LionCountry of origin: FranceCruise:Isolation station:Isolation depth: 1 mGPS position: +43° 24', +3° 36'Isolation Date: 23/3/2009 00:00:00Isolator: Stephanie Michely
CULTURESize: 1.0 µmCell shape: coccoidCell assemblage:Growth medium: KGrowth light: 100 µEinGrowth temperature: 20.0°CRemarks:
RCC 2590
STATUSStatus: DistributedCryopreserved:
IDENTITYClass:Order:Ecotype:Strain name:Other names:
ORIGINOcean origin:Region of origin:Country of origin:Cruise:Isolation station:Isolation depth:GPS position: n/aIsolation Date:Isolator:
CULTURESize:Cell shape:Cell assemblage:Growth medium:Growth light:Growth temperature:Remarks:
ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION
Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org
RCC 1105Bathycoccus
prasinos
STATUSStatus: DistributedCryopreserved:
IDENTITYClass: MamiellophyceaeOrder: MamiellalesEcotype:Strain name: BBan7Other names: BCC4000
ORIGINOcean origin: Mediterranean SeaRegion of origin: Gulf of LionCountry of origin: FranceCruise:Isolation station: Banyuls Bay, SOLAIsolation depth: 0 mGPS position: +42° 27', +3° 32'Isolation Date: 1/1/2006 00:00:00Isolator: N.Grimsley
CULTURESize:Cell shape:Cell assemblage:Growth medium: KGrowth light: 100 µEinGrowth temperature: 20.0°CRemarks: The strain deposited at RCC appears to be Ostreococcus. We do not know when the contaminationoccured. The Banyuls lab has recloned the culture from a cryopreserved aliquot (RCC4222) that can be ordered.
ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION
Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org
RCC 299Micromonas
pusilla
STATUSStatus: DistributedCryopreserved:
IDENTITYClass: MamiellophyceaeOrder: MamiellalesEcotype: clade AStrain name: NOUM17Other names: NOUM97017, NIES-2672
ORIGINOcean origin: Pacific OceanRegion of origin: Equatorial PacificCountry of origin:Cruise: EbeneIsolation station:Isolation depth: 0 mGPS position: -22° 20', +166° 20'Isolation Date: 10/2/1998 00:00:00Isolator: Boulben S.
CULTURESize: 2.0 µmCell shape: flagellateCell assemblage:Growth medium: KGrowth light: 100 µEinGrowth temperature: 20.0°CRemarks: The clonal version of this strain is RCC 827. We recommend that you RCC 827 rather than RCC 299.
ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION
Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org
RCC 4223Picochlorum
sp
STATUSStatus: DistributedCryopreserved:
IDENTITYClass: TrebouxiophyceaeOrder: ChlorellalesEcotype:Strain name: BCC143000Other names: 10M2F12
ORIGINOcean origin: Mediterranean SeaRegion of origin: Gulf of LionCountry of origin: FranceCruise:Isolation station:Isolation depth: 0 mGPS position: +42° 32', +2° 59'Isolation Date: 11/8/2011 00:00:00Isolator: Subirana
CULTURESize: 1.0 µmCell shape: coccoidCell assemblage:Growth medium: L1Growth light: 100 µEinGrowth temperature: 20.0°CRemarks:
Genome sequence is currently done in the Banyuls Lab.
RCC 4223
STATUSStatus: DistributedCryopreserved:
IDENTITYClass:Order:Ecotype:Strain name:Other names:
ORIGINOcean origin:Region of origin:Country of origin:Cruise:Isolation station:Isolation depth:GPS position: n/aIsolation Date:Isolator:
CULTURESize:Cell shape:Cell assemblage:Growth medium:Growth light:Growth temperature:Remarks:
ROSCOFF CULTURE COLLECTION INTERNATIONAL MARINE CULTURE COLLECTION
Roscoff Culture Collection Station Biologique de Roscoff, Place Georges Teissier, 29680 ROSCOFF Cedex, France Phone : +33 2 98 29 25 64, Fax : +33 2 98 29 23 24 For any question, please contact us. Web site : www.roscoff-culture-collection.org
RCC 2967Phaeodactylum
tricornutum
STATUSStatus: DistributedCryopreserved:
IDENTITYClass: BacillariophyceaeOrder: NaviculalesEcotype:Strain name: Pt1_8.6Other names: CCAP 1055/1, Pt Gen,COUGH, CCMP632
ORIGINOcean origin: Atlantic OceanRegion of origin: BlackpoolCountry of origin: UKCruise:Isolation station:Isolation depth: 0 mGPS position: +54° 0', -4° 0'Isolation Date:Isolator:
CULTURESize: 10.0 µmCell shape: fusiformCell assemblage:Growth medium: F/2Growth light: 100 µEinGrowth temperature: 20.0°CRemarks:
Strain has been fully described in De Martino et al (2007) J Phycol 43: 992-109. Its genome has been sequencedin Bowler, C., Allen, A.E., Badger, J.H., Grimwood, J., Jabbari, K., Kuo, A., Maheswari, U. et al. 2008. ThePhaeodactylum genome reveals the evolutionary history of diatom genomes. Nature. 456:239-44.
137
CHAPITRE 2 Table S1. Normalized Gr from Micromonas pusilla MA lines that survived since the beginning to the end of the mutation accumulation experiment, at each
bottleneck, from 14 to 302 days. Gtot is the total number of generations of the MA line, and p-value the result of linear correlation test to detect an increase or
a decrease of fitness using normalised data. We could not normalize the MA growth rates for days 70 and 98 because the control lines did not grow, but
bottlenecks have been performed.
Line 14 28 42 56 84 112 126 140 154 168 182 196 210 224 245 260 274 288 302 Gtot P-value
1 0.90 1.26 1.02 1.16 1.25 1.33 1.01 1.08 1.05 0.95 1.14 1.07 0.99 1.01 1.19 1.01 1.02 1.00 0.96 275 NS 2 1.00 1.09 1.21 0.97 1.46 1.4 1.02 1.04 1.08 1.12 0.98 1.01 0.93 1.13 1.15 0.92 1.00 1.05 1.15 277 NS 3 1.08 1.13 1.01 0.92 1.23 1.34 0.99 1.1 1.04 1.35 0.95 1.08 0.98 1.00 1.10 1.10 1.09 1.00 1.21 284 NS 4 0.88 1.27 1.01 0.96 1.25 1.53 0.97 1.17 0.95 1.24 1.00 1.13 0.75 1.2 1.01 1.01 0.95 0.80 0.99 261 NS 5 0.94 1.02 1.14 0.90 1.24 1.21 1.14 0.86 0.94 0.96 0.83 1.15 0.81 1.18 0.99 0.87 1.01 0.93 1.13 247 NS 6 0.96 1.09 1.14 1.00 1.25 1.46 1.02 1.10 0.91 1.32 1.01 1.17 0.98 1.12 1.21 0.95 1.01 0.94 1.21 280 NS 7 0.91 1.28 1.04 1.12 1.38 1.33 1.02 1.16 0.99 1.34 0.90 1.08 0.97 1.06 1.22 1.09 0.95 0.91 1.22 285 NS
138
Table S2. Normalized Gr from Ostreococcus mediterraneus MA lines that survived since the beginning to the end of the mutation accumulation experiment,
from 14 to 294 days. Gtot is the total number of generations of the MA line, and p-value the result of linear correlation test to detect an increase or a decrease
of fitness using normalised data.
Line 14 28 42 56 70 84 98 112 126 140 154 168 182 196 210 224 238 252 266 280 294 Gtot P-value 1 1.12 0.98 1.07 1.01 1.07 0.98 1.06 1.13 1.04 1.04 0.91 1.04 1.12 1.00 0.95 0.89 1.11 1.00 1.05 1.03 0.98 287 NS 2 1.12 1.12 1.09 1.06 0.98 1.06 0.99 1.10 0.87 1.01 1.00 1.00 1.06 1.04 0.96 0.92 1.07 0.96 0.98 0.97 0.96 280 NS 3 0.99 0.96 0.99 0.98 0.85 1.12 0.89 0.95 0.91 0.95 0.88 0.98 1.12 0.89 0.90 1.03 0.91 0.97 1.10 0.94 0.95 252 NS 4 0.95 1.07 0.95 1.13 1.06 1.00 0.97 1.02 0.99 1.04 0.95 1.10 1.12 0.88 1.03 0.98 1.02 1.06 1.16 1.00 1.12 288 NS 5 0.90 0.93 1.06 0.85 1.22 0.91 1.00 0.90 0.97 1.12 1.05 1.04 1.09 1.01 0.99 1.05 1.01 0.97 1.03 0.93 0.86 268 NS 6 0.93 0.99 0.98 0.91 1.02 0.95 1.15 0.93 0.86 0.98 1.12 1.02 1.04 1.01 0.97 1.09 0.96 1.11 1.02 0.99 0.95 271 NS 7 1.05 0.95 1.04 0.91 0.97 0.94 1.07 1.13 0.87 0.99 0.98 1.00 1.07 0.93 0.97 0.97 1.06 1.15 0.94 0.97 1.00 271 NS 8 0.90 0.96 0.84 0.92 0.91 0.86 1.05 0.98 1.03 0.98 1.07 1.11 0.96 1.23 0.97 1.14 0.93 0.93 1.01 1.03 1.15 271 increase* 9 1.05 0.94 0.97 1.09 0.98 1.14 0.96 0.92 1.09 1.03 0.99 0.91 1.09 0.95 0.99 1.05 1.11 0.97 1.06 1.00 0.96 278 NS 10 1.00 1.10 1.03 0.92 1.06 0.98 0.96 1.01 0.91 1.07 0.94 0.91 1.02 1.03 0.98 0.91 0.99 0.92 0.92 1.06 0.92 262 NS 11 0.93 1.04 0.93 1.06 1.08 0.97 1.00 1.10 1.07 0.93 1.02 1.06 0.85 1.18 0.98 0.96 0.88 1.10 0.90 0.93 1.01 270 NS 12 0.95 0.99 1.01 0.99 1.03 0.98 0.93 1.01 0.95 1.08 0.89 1.03 0.97 1.01 0.92 1.03 1.00 0.92 1.02 0.86 0.99 260 NS 13 1.03 0.96 1.09 0.97 0.89 1.13 0.89 1.07 0.93 1.02 0.84 0.99 1.05 0.95 1.11 0.95 1.05 1.02 0.95 0.93 1.04 267 NS 14 1.10 0.96 1.02 0.92 1.11 0.91 0.93 1.20 0.89 0.96 1.08 1.00 0.98 0.95 1.08 0.97 1.02 1.15 1.00 1.06 0.94 277 NS 15 0.94 0.92 0.92 1.01 0.95 1.01 1.03 0.89 1.00 0.97 0.90 1.04 1.04 0.90 1.10 0.86 1.11 0.87 0.90 1.13 1.02 259 NS 16 1.00 0.88 0.99 0.99 0.86 1.02 1.15 0.94 0.91 1.16 0.88 1.00 0.95 1.09 1.08 1.11 0.96 1.15 0.94 1.14 0.94 276 NS 17 0.93 0.98 0.94 1.12 0.92 0.97 1.06 0.88 1.08 0.97 1.08 1.09 1.02 1.02 1.03 1.09 1.11 1.00 1.03 1.14 0.96 284 NS 18 0.97 1.00 0.92 1.17 0.97 0.94 0.97 0.98 0.93 1.01 1.02 0.89 1.14 0.84 1.02 0.95 0.95 1.00 0.93 1.05 0.99 262 NS 19 1.03 1.04 0.99 1.02 1.00 1.07 1.03 1.04 1.02 0.97 0.98 1.05 0.98 0.96 1.03 0.98 0.97 0.96 1.05 1.06 1.13 281 NS 20 0.94 1.02 1.03 0.92 1.16 1.04 1.05 0.96 1.13 0.98 1.10 1.05 0.95 1.18 0.93 1.23 0.98 1.12 1.08 0.96 1.04 295 NS 21 0.99 1.00 0.86 1.09 0.92 1.02 0.91 0.93 1.23 0.95 0.91 1.02 0.88 1.06 0.93 1.09 0.88 0.89 1.05 1.04 1.07 264 NS 22 0.95 1.09 1.01 0.96 1.04 1.08 0.94 1.02 0.96 1.00 1.05 1.06 0.88 1.01 0.95 1.02 0.87 1.14 0.90 1.11 1.04 273 NS 23 0.94 1.08 1.12 1.06 1.06 0.95 0.95 0.86 1.00 0.94 1.11 1.00 1.09 0.92 1.07 0.95 1.01 0.92 1.06 0.94 1.11 275 NS 24 1.04 1.04 1.01 1.01 1.08 0.91 0.91 0.91 1.20 0.92 0.98 0.97 0.96 0.95 1.05 0.94 1.01 0.99 1.07 1.01 0.96 269 NS
139
Table S3. Normalized Gr from Bathycoccus prasinos MA lines that survived since the beginning to the end of the mutation accumulation experiment, at each
bottleneck, from 14 to 224 days. Gtot is the total number of generations of the MA line, and p-value the result of linear correlation test to detect an increase or
a decrease of fitness using normalised data.
Lines 14 28 42 56 70 84 98 112 126 140 154 168 182 196 210 224 Gtot P-value
1 0.95 1.25 1.05 1.10 0.97 1.00 1.06 1.07 1.45 0.96 0.89 1.06 1.16 1.00 1.15 1.06 258 NS 2 1.08 1.30 0.95 1.13 1.11 1.18 1.02 1.11 1.38 0.92 0.91 1.02 1.18 0.91 1.20 1.11 269 NS 3 1.03 1.25 0.85 1.17 1.22 1.05 1.19 1.02 1.56 0.93 0.90 0.91 1.14 1.17 1.07 0.91 264 NS 4 1.04 1.12 1.04 0.97 1.01 1.15 1.02 0.79 1.26 0.98 1.05 1.04 1.19 1.15 1.14 0.92 251 NS 5 1.09 1.03 1.13 1.18 1.23 1.35 1.04 0.96 1.41 0.85 1.02 0.93 1.09 0.99 0.89 1.05 262 NS 6 1.04 1.19 0.98 1.18 1.21 1.00 1.06 0.97 1.40 1.02 0.90 0.87 1.20 1.02 1.06 1.06 259 NS 7 1.13 1.12 1.28 1.10 1.12 0.95 1.23 1.13 1.40 0.92 1.05 1.19 1.30 1.22 1.39 0.96 296 NS 8 1.02 1.13 1.10 1.00 1.24 1.12 1.14 1.14 1.34 0.95 1.14 0.80 1.24 1.05 1.04 0.86 263 NS
140
Table S4. Normalized Gr from Ostreococcus tauri MA lines that survived since the beginning to the end of the mutation accumulation experiment, at each
bottleneck, from 140 to 378 days. Gtot is the total number of generations of the MA line, and p-value the result of linear correlation test to detect an increase or
a decrease of fitness using normalised data. For O. tauri, however, there were two exceptions in bottleneck time: one at 11 days, and one after 18 days (Ne=
9.5 for this data point).
Lines 140 151 165 179 192 224 238 252 266 280 294 308 322 336 350 364 378 Gtot P-value 1 1.16 1.12 1.42 1.13 1.21 1.28 1.21 1.20 1.29 1.31 1.13 1.15 1.01 1.03 1.31 1.12 1.10 519 NS 2 1.19 1.26 1.34 1.12 1.27 1.19 1.24 1.21 1.36 1.26 1.15 1.07 1.03 1.17 1.29 1.12 1.16 526 NS 3 1.10 1.39 1.23 1.23 1.16 1.24 1.07 1.15 1.33 1.21 1.10 1.11 0.93 1.11 1.35 1.11 1.21 515 NS 4 1.16 1.21 1.18 1.26 1.20 1.23 1.05 1.23 1.23 1.23 1.17 0.99 1.09 1.09 1.33 1.05 1.08 492 NS 5 1.23 1.31 1.18 1.16 1.14 1.2 1.07 1.23 1.34 1.21 1.18 1.11 1.05 1.07 1.28 1.12 1.08 503 NS 6 1.08 1.31 1.22 1.19 1.21 1.21 1.09 1.26 1.19 1.23 1.27 1.07 1.01 1.08 1.21 1.10 1.13 514 NS 7 1.18 1.6 1.31 1.24 1.17 1.24 1.14 1.18 1.37 1.23 1.21 1.05 1.02 1.12 1.22 1.21 1.06 521 decrease* 8 1.14 1.35 1.29 1.26 1.27 1.34 1.00 1.29 1.3 1.18 1.15 0.95 1.00 1.10 1.23 1.13 1.1 517 decrease* 9 1.22 1.29 1.22 1.29 1.20 1.25 1.07 1.13 1.2 1.26 1.18 1.17 1.02 1.12 1.14 1.21 1.04 509 NS 10 1.09 1.42 1.22 1.15 1.19 1.24 1.25 1.07 1.23 1.34 1.09 1.07 0.93 1.23 1.25 1.19 1.1 526 NS 11 1.18 1.33 1.24 1.16 1.18 1.18 1.16 1.19 1.18 1.32 1.14 1.18 0.99 1.21 1.27 1.2 1.14 525 NS 12 1.19 1.17 1.21 1.18 1.11 1.16 1.16 1.14 1.18 1.33 1.02 1.14 0.87 1.13 1.15 1.23 1.12 498 NS 13 1.19 1.30 1.18 1.12 1.16 1.23 1.13 1.28 1.27 1.25 1.12 1.01 1.04 1.11 1.09 1.23 1.17 511 NS 14 1.11 1.40 1.14 1.22 1.26 1.34 1.16 1.14 1.18 1.36 1.20 1.02 0.99 1.26 1.09 1.18 1.30 526 NS 15 1.08 1.27 1.19 1.22 1.22 1.21 1.16 1.12 1.28 1.3 1.03 0.97 0.98 1.19 1.08 1.26 1.24 498 NS 16 1.19 1.30 1.17 1.27 1.25 1.24 1.08 1.17 1.28 1.16 1.10 0.97 1.00 1.14 1.13 1.28 1.20 520 NS 17 1.18 1.3 1.17 1.25 1.26 1.31 1.11 1.20 1.30 1.12 1.21 1.03 0.95 1.16 1.07 1.33 1.14 511 NS 18 1.18 1.64 1.4 1.24 1.18 1.2 1.22 1.17 1.32 1.12 1.09 1.09 1.03 1.14 1.19 1.20 1.16 521 decrease* 19 1.12 1.28 1.34 1.3 1.24 1.3 1.13 1.23 1.30 1.23 0.99 1.00 1.05 1.15 1.16 1.12 1.14 507 decrease* 20 1.05 1.23 1.40 1.22 1.27 1.21 1.07 1.17 1.35 1.20 1.07 1.01 1.03 1.16 1.15 1.17 1.09 505 NS 21 1.03 1.30 1.31 1.16 1.23 1.27 1.14 1.21 1.16 1.17 1.08 1.03 1.05 1.22 1.00 1.28 1.17 500 NS
141
Table S5. Average of G of MA lines and control of Micromonas pusilla for each environmental test. P-value column indicates the result of the pairwise test to
compare MA lines fitness with the control (NS p-value non significant, * p-value significant at 5%, ** p-value significant at 1%, *** p-value significant at 0.1%).
Line 1 2 3 4 5 Control Irgarol 1 µg.L-1 0.98 0.97 0.52*** 0.78*** 0.37*** 1.08 Diuron 10 µg.L-1 1.08 0.96** 0.93** 1.06 0.89*** 1.05 Salinity 5 g.L-1 0.98 0.80 1.01 0.95 1.03 0.83 Salinity 20 g.L-1 1.64** 1.52*** 1.69** 1.55*** 1.73 1.80 Salinity 35 g.L-1 1.66 1.54** 1.72 1.60 1.79** 1.65 Salinity 55 g.L-1 1.51** 1.46** 1.64** 1.49** 1.66** 1.35 Salinity 65 g.L-1 1.24*** 1.05*** 1.26*** 1.10*** 1.23*** 0.84
Table S6. Average of G of MA lines and control of Bathycoccus prasinos for each environmental test. P-value column indicates the result of the pairwise test
to compare MA lines fitness with the control (NS p-value non significant, * p-value significant at 5%, ** p-value significant at 1%, *** p-value significant at
0.1%).
Line 1 2 3 4 5 6 7 8 Control Irgarol 1 µg.L-1 1.00 0.74*** 1.00 0.88 1.67*** 0.74*** 1.04 1.46*** 0.97 Diuron 10 µg.L-1 0.60 0.52 0.55 0.68 1.08*** 0.47 0.57 0.65 0.52 Salinity 5 g.L-1 1.42*** 1.41*** 1.25*** 0.82 1.13** 1.48*** 1.51*** 0.69 0.72 Salinity 20 g.L-1 2.22** 2.33** 2.15** 1.70** 2.30** 2.36** 2.32** 2.20** 1.93 Salinity 35 g.L-1 2.05 2.03 1.99 1.86** 2.05 2.14 2.08 2.21 2.23 Salinity 55 g.L-1 1.72 1.76 1.56 1.56 1.62 1.70 1.79 1.57 1.88 Salinity 65 g.L-1 1.04** 1.08** 0.81 0.84 0.98 1.14** 1.10** 0.64 0.86
142
Table S7. Average of G of MA lines and control of Ostreococcus mediterraneus for each environmental test. P-value column indicates the result of the
pairwise test to compare MA lines fitness with the control, (NS p-value non significant, * p-value significant at 5%, ** p-value significant at 1%, *** p-value
significant at 0.1%).
Line 1 2 3 4 5 6 7 8 9 Control Irgarol 1 µg.L-1 1.07*** 1.06*** 1.04*** 0.86 0.95 0.78** 0.67*** 0.82 0.73*** 0.89
Diuron 10 µg.L-1 0.87** 0.98 0.92 0.9 0.93 0.91 0.95 0.88** 0.88** 0.96 Salinity 5 g.L-1 1.87 1.83 1.88 1.93 1.90 1.68*** 1.60*** 1.93 1.66*** 1.86
Salinity 20 g.L-1 1.97 2.07 2.08 2.10 2.04 1.79* 1.75* 2.11 2.00 2.00 Salinity 35 g.L-1 1.86 1.80 1.94 1.93 1.71 1.63** 1.65** 1.90 1.82 1.81 Salinity 55 g.L-1 1.34 1.28 1.62 1.46 1.59 1.21 1.54 1.29 1.36 1.49 Salinity 65 g.L-1 0.73*** 0.68*** 0.63*** 0.59*** 1.14 1.14 1.23 0.73*** 0.91*** 1.13
143
CHAPITRE 3
Table S1. Summary of mutation accumulation experiments. Ne is the average of effective population
size during the experiment (estimated using harmonic mean of cell number), and the total line is the
total sequenced lines at the end of the MA experiment. Total generation is the total of independent
generations obtained with all sequenced MA lines. T0 to Tf is the duration of the mutation
accumulation experiment since the inoculation of the MA lines to the DNA extraction. Gen. is
generation
Species Total
line Total gen
Mean gen per
MA line Ne T0 to Tf (days)
O. tauri RCC4221 40 17 250 431 8.5 378
O. mediterraneus RCC2590 37 8 379 235 7 294
M. pusilla RCC299 37 4 145 112 6 299
B. prasinos RCC1105 36 4994 139 8.5 224
Table S2. The part of the genome usable (G*) for mutations calling. G*min is the minimum and G*max
the maximum genome size.
Species G (Mb) G*average (%) G*min (%) G*max (%)
O. tauri RCC4221 13.03 12.60 (97.5) 11.82 (91.54) 12.84 (99.45)
O. mediterraneus RCC2590 13.48 13.10 (97.2) 12.28 (91.10) 13.35 (99.08)
B. prasinos RCC1105 15.07 15.02 (99.6) 14.66 (97.23) 15.03 (99.73)
M. pusilla RCC299 21.11 21.01 (99.5) 20.55 (97.36) 21.07 (99.79)
Table S3. Base-substitution mutations in O. tauri.
Chromosome Position Reference Mutation Effect
1 281349 T C Synonym coding
1 462543 T A -
1 462544 A T -
1 536352 G A -
1 688195 A G -
1 762227 A G Non synonym coding
1 764912 G A -
1 934994 C T Synonym coding
2 202377 C A Non synonym coding
2 744253 G A Synonym coding
2 759388 C T Non synonym coding
144
2 817108 C T Non synonym coding
2 820022 C A Non synonym coding
2 868393 G A Synonym coding
2 1070559 A G Non synonym coding
3 41080 C T Synonym coding
3 127716 G A Non synonym coding
3 210680 A G -
3 353325 C T Non synonym coding
3 379647 C T Non synonym coding
3 779548 T C Synonym coding
3 971494 C T Non synonym coding
4 117 C A -
4 366731 C T Synonym coding
4 524836 G A Non synonym coding
4 735752 C T Non synonym coding
5 5699 C T Non synonym coding
5 405535 G A Synonym coding
5 498490 T G Non synonym coding
5 600053 T A -
5 600056 G A -
5 658543 G A Non synonym coding
5 668815 C T Non synonym coding
6 12972 C T Non synonym coding
6 18960 C T -
6 46323 T G Non synonym coding
6 162319 T C Non synonym coding
6 334481 G C -
6 661927 C T -
6 716579 C T Non synonym coding
7 475871 A G Non synonym coding
7 612454 C T Synonym coding
7 702913 A C Non synonym coding
7 744212 G A Non synonym coding
8 66027 G A -
8 185592 G C -
9 31962 G A Non synonym coding
9 126121 C T Synonym coding
9 393218 C T Non synonym coding
9 398617 C T Synonym coding
9 514297 C T Non synonym coding
145
9 643568 A G Non synonym coding
10 108529 G A Non synonym coding
10 510428 C T Non synonym coding
10 562914 G A Synonym coding
10 587147 G A -
11 222249 A G -
11 446073 T C Synonym coding
11 452825 C A Non synonym coding
11 472590 G A Stop gained
11 474928 A G -
12 94 A G -
12 419488 C A Non synonym coding
12 460233 T G -
13 145936 G A Synonym coding
13 365169 C T Non synonym coding
13 496008 C T Non synonym coding
14 75583 G A Intron
14 210547 G A Non synonym coding
14 231150 G T -
14 257724 C A Non synonym coding
14 374547 G C Synonym coding
14 495621 G A Synonym coding
14 500741 C T Non synonym coding
15 165137 C T Non synonym coding
15 177872 G T Non synonym coding
15 352817 A G Synonym coding
16 460708 C T Synonym coding
16 325515 G T Synonym coding
16 521001 C T Non synonym coding
17 35411 T G Non synonym coding
17 410925 C T -
17 410926 G A -
17 410927 A G -
17 410928 C G -
18 122316 A G -
18 252024 T G -
18 345570 T G -
18 345641 G A -
20 49667 C T Non synonym coding
2 165267 T G -
146
Table S4. Base-substitution mutations in O. mediterraneus.
Chromosome Position Reference Mutation Effect 1 240410 T C Synonym coding 1 281668 A T Non synonym coding 1 384332 T C - 1 500961 T G - 1 504598 G A - 1 960787 G T Non synonym coding 2 783209 C A Synonym coding 3 168617 T G Non synonym coding 3 194253 A T Non synonym coding 4 4863 A G Non synonym coding 4 250707 T C - 4 271238 A G - 4 271242 G T - 4 271243 A G - 4 271249 A C - 4 271258 C T - 4 271264 G T - 5 204024 G A Non synonym coding 5 237455 G A Non synonym coding 5 369175 C T Non synonym coding 5 561353 C A Non synonym coding 6 167738 C T Non synonym coding 6 365873 C T Synonym coding 6 638629 C A Non synonym coding 7 136735 A C Non synonym coding 7 298488 C T Non synonym coding 8 59263 G A Non synonym coding 8 106639 G A Non synonym coding 8 165454 G A Synonym coding 8 246199 T C Non synonym coding 8 285631 G A Synonym coding 8 390757 T A Non synonym coding 8 425236 T G Non synonym coding 8 437922 G C Non synonym coding 8 699362 G A Synonym coding 9 552630 G T Non synonym coding 9 701807 A C Non synonym coding 9 717500 C A - 9 737678 G T Non synonym coding
10 165842 G A Non synonym coding 13 107450 T C Non synonym coding 13 162729 C T Synonym coding 13 586916 T C Non synonym coding
147
14 60175 T A Non synonym coding 14 60217 G A Non synonym coding 14 98081 A C Non synonym coding 15 112247 C A Start gained 16 222414 C T Synonym coding 16 297544 C T Synonym coding 17 368001 G T Non synonym coding 17 422490 C T - 18 272777 A G Non synonym coding 18 299852 A G Non synonym coding 19 81732 C G Non synonym coding
Table S5. Base-substitution mutations in B. prasinos.
Chromosome Position Reference Mutation Effect
1 42082 C A Non synonym coding
1 79489 C T Synonym coding
1 418914 T G Non synonym coding
1 1305044 G C Synonym coding
11 525583 C T Non synonym coding
12 50 T A -
12 122406 T C -
13 208600 T A Non synonym coding
17 72 G C -
18 999 C A Non synonym coding
18 235306 T G -
19 69819 A T -
19 145968 A T -
2 556426 G C Non synonym coding
4 135852 C T Synonym coding
4 531741 C G Non synonym coding
5 87328 C T Non synonym coding
5 145129 A T Intron
5 602981 C G Synonym coding
5 797176 A T Non synonym coding
8 574299 C A Non synonym coding
9 93038 C T Synonym coding
148
Table S6. Base-substitution mutations in M. pusilla.
Chromosome Position Reference Mutation Effect
1 101651 G T -
1 319728 T A -
1 319729 C A -
1 356850 G C Non synonym coding
1 868786 A G -
1 907594 A G -
1 989553 G A Non synonym coding
1 1166944 A G -
1 1311961 A G Non synonym coding
1 1328941 C T -
1 1480609 A C -
1 1531771 T C -
1 1771291 T C -
2 296 C T -
2 197240 G C Non synonym coding
2 318653 C G Non synonym coding
2 318654 A C Non synonym coding
2 318655 G C Non synonym coding
2 371001 G T Non synonym coding
2 629587 T G Non synonym coding
2 1231590 G A Synonym coding
2 1439488 C T Non synonym coding
2 1898300 G T Synonym coding
2 1898302 A C Non synonym coding
2 1898303 C A Non synonym coding
2 1898304 T A Non synonym coding
2 1898305 T C Synonym coding
3 1370371 C G Non synonym coding
3 1375097 G A Non synonym coding
3 1708043 C T Non synonym coding
4 3470 C A Synonym coding
4 334275 G A Synonym coding
4 571514 G A Non synonym coding
4 1224092 G A Synonym coding
5 486431 C A Synonym coding
5 508099 G C Synonym coding
5 556716 C G Non synonym coding
5 896616 C T -
149
5 1108981 G A Non synonym coding
6 1235633 G A Non synonym coding
7 570664 G T Non synonym coding
7 570665 A C Synonym coding
7 570666 G T Non synonym coding
7 672236 G A -
7 746112 G C Synonym coding
8 93285 G T Non synonym coding
8 273349 C T Non synonym coding
8 284318 G T Non synonym coding
8 303063 G A Synonym coding
8 310233 T A Non synonym coding
8 310234 G C Non synonym coding
8 1077655 G T Non synonym coding
9 1126769 A T Synonym coding
11 173723 G A -
11 430804 C T Non synonym coding
11 899300 A G Non synonym coding
11 899309 G A Non synonym coding
12 323466 T C Non synonym coding
12 797741 C T Synonym coding
12 823088 T G Non synonym coding
13 688257 C G Synonym coding
14 346000 G T Synonym coding
14 346390 G C Synonym coding
14 761603 G A Non synonym coding
15 146889 A T Non synonym coding
15 146890 T G Non synonym coding
15 320895 A G Synonym coding
15 408470 A C -
15 410306 C T Non synonym coding
15 504682 G T Non synonym coding
16 329517 C T Non synonym coding
150
Table S7. Insertions in the four species. Chromosome Position Reference Mutation Effect
Bathycoccus prasinos
2 102 A AC -
9 521140 A AAG -
13 570953 T TGCC Codons insertion
14 272 A ACC -
18 523 A AC -
Micromonas pusilla
1 319727 A AC -
2 378439 C CCG Frame shift
Ostreococcus tauri
4 76071 C CG -
10 455685 T TCGTCGG Codons insertion
15 109437 C CG -
17 226384 C CG -
20 153964 G GA -
Ostreococcus mediterraneus
1 384327 G ATT -
8 729406 C CA Frame shift
12 432782 C CTACTG -
Table S8. Deletions in the four species. Chromosome Position Reference Mutation Effect
Bathycoccus prasinos
1 164711 AGGCGAGCAGTG A -
1 164726 AATTCAATTTCAATA A -
5 622569 GA G Frame shift
5 963834 AAATATCTATTG A -
14 329038 TG T -
Micromonas pusilla
1 1787228 TTATTCCTTCGAAGCTTACGTACG T -
1 1924354 CA C Frame shift
1 319750 GTACCTTCGAAGGTATAA G -
3 214 CT C -
5 140463 CGCGAGACCTCG C Frame shift
6 1235612 AGGAGGAGGAGGGGGAGGAGGG A Codons
deletion
8 310219 CGATCTGCGTCCGGTG C Codons
deletion
10 1045182 GCGC G -
10 1160336 TCA T -
11 899291 ACAGACGGCACAGCTGGCG A Codons
deletion
14 474 AACCCTTCGT A -
151
16 287228 AACTCGAGTTGACAAGACC A -
Ostreococcus tauri
1 601169 GA G -
6 46321 CT C Frame shift
8 273361 AAC A Frame shift
8 72783 GACACCCGCGTGTACGGGACCGCGACCC G -
11 222762 GA G Frame shift
12 403601 CGCGAGACCGGCGCACATCGCCGTCGTCGCCACCGTCGGAAACT C Frame shift
13 135 CA C -
17 87 CT C -
Ostreococcus mediterraneus
6 284415 CG C Frame shift
7 156017 GT G -
7 1775 TGTTGCC T -
8 350046 CGTT C Codons
deletion
9 185017 CACGGCGACGACGAACGATGGCG C Frame shift
12 567140 TCG T Frame shift
12 328305 GT G -
13 112767 ATCTATCGTCGCGACGGCGGTCGTCTCTATG A Codons
deletion
Table S9: RNAseq coverage of exons and other sequences, in mutated and no mutated sites in B.
prasinos and O. tauri.
Species Sequence
types
N mutations Mutated site
coverages
Non-mutated
site coverages
P. value
Wilcoxon test
Bathycoccus prasinos Non-exons 13 247 646 0.0004
Exons 19 505 667 0.123
Ostreococcus tauri Non-exons 38 26 149 3.45-7
Exons 64 127 126 0.382
"&#!
Figure S1. The distribution of the base-substitution mutations. GC to AT bias in observed in the four
species, and is significant in O.tauri and M. pusilla.
1 2 3 4 5 6 7 8 9 10 11 12
510
2030
1 2 3 4 5 6 7 8 9 10 11 12
510
2030
1 2 3 4 5 6 7 8 9 10 11 12
510
2030
1 2 3 4 5 6 7 8 9 10 11 12
510
2030
G!A C!T T!C A!G C!G G!C G!T C!A T!G A!T A!C T!A
22
29
8 12
3 1 1 1
3 3 6
0 0 0 0
5 1
3 3 2 2
2
2 4
O. tauri
B. prasinos
O. mediterraneus
M. pusilla
13 10 10
4 4 7 7
4 3 3 2 5
10 9 6 6 5 4 3 1 1 2 2
Transversions Transitions
5
GC to AT > AT to GC (Binomial test,P-value=0.0001)
GC to AT > AT to GC (Binomial test,NS)
GC to AT > AT to GC (Binomial test,P-value=0.02)
GC to AT > AT to GC (Binomial test,NS)
153
Table S10. Spontaneous base-substitution mutation rates estimated by mutation accumulation
experiments in Bacteria and Eukaryotes. G is the genome size in Mb, µ is the mutation rate per
nucleotide and U is the number of mutations per genome per generation. The data from Ness in 2015
is the average of 6 strains. Effective population size come from Lynch supplementary material (Lynch,
2010a), excepted for Mus musculus (Phifer-Rixey et al., 2012), Heliconius melpomene (Keightley et
al., 2014b), Ficedula albicollis (Backström et al., 2013), Arabidopsis thaliana (Cao et al., 2011),
Caenorhabditis elegans (Cutter, 2006 ), Caenorhabditis briggsae (Cutter et al., 2006), Drosophila
melanogaster (Shapiro et al., 2007) and O. tauri (Blanc-Mathieu et al., in preparation). Ge is the
estimation of protein length sequences provided in ensembl.org website database.
Species G Ge µ U Ne References
Homo sapiens 3300.0 24.4 1.29E-08 38.5500 2.00E+04 (Lynch, 2010b)
Mus musculus 2700.0 24.3 5.40E-09 14.5800 2.00E+05 (Uchimura et al., 2015)
Ficedula albicollis 1100 26.1 4.60E-09 5.0600 4.50E+05 (Smeds et al., 2016)
Arabidopsis thaliana 134.4 45.0 7.00E-09 1.0990 2.50E+05 (Ossowski et al., 2010)
Caenorhabditis elegans 100.3 27.2 1.48E-09 0.1479 8.00E+04 (Denver et al., 2012)
Caenorhabditis briggsae 108.4 26.2 1.34E-09 0.1447 6.00E+04 (Denver et al.. 2012)
Pristionchus pacificus 133.1 25.3 2.00E-9 0.2663 - (Weller et al., 2014)
Drosophila melanogaster 148.0 21.2 5.49E-09 0.6698 1.15E+06 (Schrider et al., 2013)
Heliconius melpomene 273.8 17.9 2.90E-09 0.7940 2.00E+06 (Keightley et al., 2014b)
Ostreococcus tauri 13.0 10.6 4.19E-10 0.0054 9.60E+06 This study
Ostreococcus mediterraneus 13.5 11.4 4.92E-10 0.0065 - This study
Bathycoccus prasinos 15.1 12.5 3.07E-10 0.0046 - This study
Micromonas pusilla 21.1 17.3 8.15E-10 0.0172 - This study
Chlamydomonas reinhardtii 112.0 19.7 9.63E-10 0.1079 3.10E+07 (Ness et al., 2015b)
Saccharomyces cerevisiae 12.3 8.8 1.67E-10 0.0021 6.20E+06 (Zhu et al., 2014)
Schizoaccharomyces pombe 12.6 7.1 2.00E-10 0.0025 2.60E+06 (Farlow et al., 2015)
Paramecium tetraurelia 72.1 53.9 1.94E-11 0.0014 1.20E+08 (Sung et al., 2012b)
Dictyostelium discoideum 34.2 21.1 2.90E-11 0.0010 - (Saxer et al., 2012)
Bacillus subtilis 4.2 3.6 3.28E-10 0.0014 6.30E+07 (Sung et al., 2015)
Escherichia coli 4.6 4.1 2.20E-10 0.0010 1.80E+08 (Lee et al., 2012)
Mesoplasma florum 0.8 0.7 9.78E-09 0.0078 1.10E+06 (Sung et al., 2012a)
Burkholderia cenocepacia 7.7 6.8 1.33E-10 0.0010 - (Dillon et al., 2015)
Pseudomonas aeruginosa 6.6 6.0 7.92E-11 0.0005 2.00E+07 (Dettman et al., 2016)
Salmonella typhimurium 4.8 4.3 7.00E-10 0.0034 - (Lind and Andersson, 2008)
Mycobacterium tuberculosis 4.4 4.0 2.58E-10 0.0011 - (Ford et al., 2011)
Deinococcus radiodurans 3.2 2.9 4.99E-10 0.0016 - (Long et al., 2015a)
154
Table S11. Effect of GC gap from equilibrium in base substitution mutation rate. R1, R2, R3 and R3
were used to calculate the GCeq and the mutation rate at equilibrium µeq. The ratio µ/µeq permits to
estimate the elevation of the mutation rate due to the GC gap, i.e in O.tauri the mutation rate
increases by 11.8%.
Species µ GC GCeq GCr GC>AT relative
to AT>GC µ/µeq References
Homo sapiens 1.29E-08 0.420 0.323 1.301 2.098 1.081 (Lynch, 2010b)
Mus musculus 5.40E-09 0.424 0.207 2.051 3.842 1.295 (Uchimura et al., 2015)
Ficedula albicollis 4.60E-09 0.443 0.311 1.426 2.219 1.116 (Smeds et al., 2016)
Arabidopsis thaliana 7.00E-09 0.367 0.138 2.663 6.255 1.640 (Ossowski et al.. 2010)
Caenorhabditis elegans 1.48E-09 0.354 0.193 1.837 4.189 1.225 (Denver et al.. 2012)
Caenorhabditis briggsae 1.34E-09 0.377 0.211 1.784 3.732 1.227 (Denver et al.. 2012)
Pristionchus pacificus 2.00E-09 0.427 0.157 2.711 5.350 1.381 (Weller et al., 2014)
Drosophila melanogaster 5.49E-09 0.419 0.188 2.228 4.318 1.324 (Schrider et al., 2013)
Heliconius melpomene 2.90E-09 0.331 0.248 1.335 3.032 1.044 (Keightley et al., 2014b)
Ostreococcus tauri 4.19E-10 0.590 0.365 1.615 1.737 1.118 This study
Ostreococcus mediterraneus 3.73E-10 0.560 0.433 1.293 1.310 1.017 This study
Bathycoccus prasinos 3.07E-10 0.480 0.366 1.312 1.733 1.029 This study
Micromonas pusilla 8.15E-10 0.638 0.462 1.382 1.166 1.030 This study
Chlamydomonas reinhardtii 9.63E-10 0.619 0.259 2.392 2.864 1.428 (Ness et al., 2015)
Saccharomyces cerevisiae 1.67E-10 0.384 0.311 1.235 2.216 1.067 (Zhu et al., 2014)
Schizoaccharomyces pombe 2.00E-10 0.360 0.264 1.364 2.790 1.122 (Farlow et al., 2015)
Paramecium tetraurelia 1.94E-11 0.279 0.072 3.884 12.921 1.543 (Sung et al., 2012b)
Bacillus subtilis 3.28E-10 0.437 0.443 0.986 1.256 0.999 (Sung et al., 2015)
Escherichia coli 2.20E-10 0.506 0.450 1.124 1.222 1.010 (Lee et al., 2012)
Mesoplasma florum 9.78E-09 0.270 0.059 4.582 15.970 2.628 (Sung et al., 2012a)
Burkholderia cenocepacia 1.33E-10 0.669 0.551 1.213 0.814 0.978 (Dillon et al., 2015)
Pseudomonas aeruginosa 7.92E-11 0.662 0.396 1.671 1.524 1.083 (Dettman et al., 2016)
Salmonella typhimurium 7.00E-10 0.521 0.559 0.932 0.788 1.008 (Lind and Andersson, 2008)
Mycobacterium tuberculosis 2.58E-10 0.656 0.276 2.376 2.622 1.512 (Ford et al., 2011)
Deinococcus radiodurans 4.99E-10 0.668 0.643 1.039 0.555 0.983 (Long et al., 2015)
"&&!
Figure S2. Correlation between the strength of the GC bias (R1/R2) and the nucleotide mutation rate.
Mp is Mesoplasma florum and Pt is Paramecium tetraurelia. (n=23 excluding Pt and Mp, Pearson
correlation, P-value=0.002, "=0.61).
Figure S3. Mutational context of base-substitution mutations. Mutations occur at the last position of
the trinucleotides. This figure takes count of all mutations of the four species add together. Despite
some trinucleotides mutated more frequently as expected by chance, no significant bias is detected.
0 5 10 15
-11
-10
-9-8
-7
tab$R1R2
Log_
µ
Bacteria Unicellular Eukaryotes Mamiellophyceae Metazoans Arabidopsis
R1 (GC to AT) / R2 (AT to GC)
Mp
Pt
-11.
0
-10.
0
-9.0
-8.0
-
7.0
Log1
0 of
nuc
leot
ide
mut
atio
n ra
te (µ
)
0.0 5.0 10.0 15.0
24
68
1012
14
A T G C T
24
68
1012
14
G
24
68
1012
14
C
24
68
1012
14
A T C G A T G C A T G C A T G C A T G C
A T C G A T G C A T G C A T G C A T G C
A T C G A T G C A T G C A T G C A T G C
A T C G A T G C A T G C A T G C A T G C
Nucleotides context of mutations
Mutated site
156
CHAPITRE 4
Table S1. Draw statistical results from Pacbio RS II sequencing and polished step.
Job Metric Value
Polished Contigs 361
N50 Contig Length 244 124
Sum of Contig Lengths 21 260 393
Adapter Dimers (0-10bp) 0.02%
Short Inserts (11-100bp) 0.01%
Number of Bases 1 654 575 141
Number of Reads 266 217
N50 Read Length 10 870
Mean Read Length 6 215
Mean Read Score 0.85
Mapped Reads 237 383
Mapped Read Length of Insert 1 971
Average Reference Length 446,159
Average Reference Bases Called 100.0%
Average Reference Consensus Concordance 99.98%
Average Reference Coverage 69.94
Polymerase Read Quality 0.852
Table S2. Statistical best results from ABySS assembly with MiSeq reads (K=80 and n=10).
n n:200 n:N50 min N80 N50 N20 max sum
Unitigs 20 806 15 924 1 042 200 2 411 10 108 25 033 99 228 41.55e6
Contigs 19 925 15 327 902 200 2 534 11 210 29 270 189 496 41.62e6
Scaffolds 19 896 15 298 889 200 2 536 11 212 29 270 483 331 41.62e6
157
Table S3. SGA results with MiSeq reads mappings in HGAP assembly.
Classified 140 vertices as unique (13.96 Mbp)
Classified 6 vertices as repeat (0.12 Mbp)
Classified 59 vertices as spurious (0.70 Mbp)
Constructed 81 scaffolds from 81 contigs
Total bases: 13.26Mbp
Max scaffold: 964 334 bp
N50 scaffold: 436 237 bp
Mean scaffold: 163 701 bp
Table S4. Total final genome assembly with the 64 contigs. The contig indicated Mt is the
mitochondria and the contig indicated Cl is the chloroplast.
Contig Size (kb) GC%
1 1793.9 46.4
2 1666.5 46.5
3 1505.7 46.4
4 965.3 46.4
5 764.1 46.5
6 691.2 46.4
10 664,0 46.6
7 651.1 46.3
8 588.1 46.6
12 578.9 46.5
9 564.2 46.6
13 475.2 46.9
14 361.5 47.1
16 349.9 47.9
11 349.1 46.3
15 260.0 46.7
18 227.8 46.9
17 225,0 47.5
29 186.6 43.5
19 178.3 46.3
22 94.6 46.4
27 93.3 47.3
20-Cl 78.2 31.9
30 75.5 40.1
92 47.9 36.9
158
101 45.8 36,0
21-Mt 42.9 41.0
24 40.2 51.7
103 39.2 44.9
104 39.1 34.9
111 37.8 35.5
105 37.5 36.4
128 35.0 34.9
114 33.3 44.7
117 28.2 35.1
23 28.1 44.6
130 27.2 35.8
39 27.0 39.8
25 24.7 47.7
40 23.7 38,0
132 21.9 35.1
165 20.6 35.7
41 20.1 60.8
151 19.0 34.6
28 18.2 47.9
26 16.6 44.7
190 16.5 34.7
138 15.2 35.2
42 14.9 45.0
174 14.2 30.9
169 13.7 34.8
43 13.5 57.3
31 12.8 45.9
44 12.7 61.0
180 12.7 40.9
195 12.7 37.1
181 12.3 34.3
208 12.1 37.3
45 11.9 62.7
202 11.5 36.0
199 11.0 35.7
32 10.7 54.6
206 10.7 35.7
46 10.5 46.0
159
CHAPITRE 6 Tableau A1. Mutations des lignées d’O. tauri qui montrent une baisse significative de fitness au cours
de l’expérience d’accumulation de mutations. Dans le cas de mutations inter-géniques, il est indiqué
les deux gènes adjacents.
Lignée Chromosome Position Effet de fitness Gene Annotation
12 3 210680 Inter génique Ostta03g01200
Ostta03g01210
Spermidine
spermine synthases family TPMT
family
12 5 5699 Non synonyme Ostta05g00040 FAD-dependent pyridine nucleotide
disulphide oxidoreductase
12 6 18960 Inter génique Ostta06g00060
Ostta06g00070
Helicase, C-terminal
NA
12 7 612454 Synonyme Ostta07g03740 transducin family protein
12 8 66027 Inter génique Ostta08g00400
ostta08g00410
Zinc finger, CCHC-type
Translation initiation factor 3 subunit D
35 3 353325 Non synonyme Ostta03g02180 Conserved oligomeric Golgi complex
35 10 510428 Non synonyme Ostta10g03080 Zinc finger, C2H2
36 1 688195 Inter génique Ostta01g04240
Ostta01g04250
NA
Methylase domain
36 11 452825 Non synonyme Ostta11g02480 Filamin/ABP280 repeat-like
36 13 365169 Non synonyme Ostta13g02140 tRNA/rRNA methyltransferase
Tableau A2. Délétions et insertions identifiées chez les lignées utilisées pour les essais de fitness.
Lignée Effet de fitness Gene Annotation
Micromonas pusilla 2 Inter génique Mipur14g00010 Polyribonucleotide nucleotidyltransferase
4 Inter génique Mipur01g07370 NA Mipur01g07380 Zinc finger, RING-type
4 Frame shift Mipur02g01650 SKI-interacting protein
5 Inter génique Mipur01g01440 Translation elongation factor Mipur01g01450 Small nuclear RNA activating complex
5 Inter génique Mipur01g01440 Translation elongation factor Mipur01g01450 Small nuclear RNA activating complex
Bathycoccus prasinos 4 insertion de codons Bathy13g02570 General substrate transporter
7 Inter génique Bathy05g04970 General substrate transporter Bathy05g04980 Dynein heavy chain
7 Inter génique Bathy18g00010 TonB-dependent receptor Bathy18g00020 ATP-binding cassette superfamily
Ostreococcus mediterraneus 3 Frame shift Ostme06g01720 Glycoside hydrolase catalytic domain
6 Inter génique Ostme12g03410 NA
160
Tableau A3. Substitutions identifiées chez les lignées utilisées pour les essais de fitness.
Lignée Effet de fitness Gene Annotation
Micromonas pusilla
1 Inter génique Mipur01g06170 Tetratricopeptide-like helical
Mipur01g06160 NA
1 Inter génique Mipur02g00010 Protein binding
NA
1 Inter génique Mipur11g01020 Intracellular protein transport
Mipur11g01030 NA
2 Inter génique Mipur01g03700 Ribosomal protein L21
Mipur01g03710 Heme binding,Cytochrome b5,Fatty acid desaturase
4 Inter génique Mipur01g04900 Protein kinase,ransferase activity
Mipur01g04910 ATPase
4 Synonyme Mipur07g02835 Clusterin-associated protein-1
4 Non synonyme Mipur07g02835 Clusterin-associated protein-1
4 Non synonyme Mipur07g02835 Clusterin-associated protein-1
4 Non synonyme Mipur11g02270 Membrane,transferase activity
Transferring phosphorus-containing groups
4 Non synonyme Mipur15g02150 sulfotransferase activity
5 Inter génique Mipur01g01440 Translation elongation factor,Nucleic acid-binding
Mipur01g01450 Small nuclear RNA activating complex
5 Inter génique Mipur01g01440 Translation elongation factor,Nucleic acid-binding
Mipur01g01450 Small nuclear RNA activating complex
5 Non synonyme Mipur01g04180 SKI-interacting protein
5 Inter génique Mipur15g02130 Multidrug efflux transporter AcrB
Mipur15g02140 Methyltransferase FkbM
1-3 Non synonyme Mipur02g01500 Pectin lyase fold
1-3 Non synonyme Mipur02g01500 Immunoglobulin E-set
1-3 Non synonyme Mipur02g01500 Parallel beta-helix repeat
1-3 Non synonyme Mipur05g02350 Protein kinase, catalytic domain,transferase activity
Transferring phosphorus-containing groups
Bathycoccus prasinos
1 Inter génique Bathy18g01200 RNA polymerase
Bathy18g01210 NA
2 Synonyme Bathy01g00480 Esterase, SGNH hydrolase-type, lipase
2 Inter génique Bathy12g00620 D-galacturonic acid reductase
3 Synonyme Bathy01g00250 NA
3 Inter génique Bathy05g00830 GTP cyclohydrolase II
Bathy05g00840 NA
3 Synonyme Bathy05g03350 ATP-dependent Clp protease proteolytic subunit
4 Non synonyme Bathy05g04130 DNA-binding
6 Non synonyme Bathy01g02250 NA
6 Non synonyme Bathy13g00710 ATP-dependent metalloprotease FtsH
7 Inter génique Bathy19g00710 NA
8 Inter génique Bathy12g00610 NA
Bathy12g00620 NA
161
Ostreococcus mediterraneus 1 Gain d’un start Ostme09g04340 NA
1 Non synonyme Ostme13g00630 Cation/H+ exchanger
2 Non synonyme Ostme05g02160 Cleavage/polyadenylation specificity factor
A subunit, C-terminal
3 Non synonyme Ostme05g01170 Myb domain, plants
3 Non synonyme Ostme05g01310 P-loop containing nucleoside triphosphate hydrolase
4 Non synonyme Ostme05g03160 P-loop containing nucleoside triphosphate hydrolase
5 Non synonyme Ostme07g00860 Steroid receptor RNA activator-protein
coat protein complex II, Sec31
5 Inter génique Ostme17g02510 Putative 5-3 exonuclease
Ostme17g02520 NA
7 Non synonyme Ostme01g01630 COMM domain
7 Non synonyme Ostme08g01390 Exonuclease, phage-type/RecB
8 Non synonyme Ostme09g04240 P-loop containing nucleoside triphosphate hydrolase
8 Non synonyme Ostme09g04420 Regulator of K+ conductance
9 Non synonyme Ostme01g05620 Acetyl-coenzyme A transporter 1
9 Synonyme Ostme13g01030 RNA recognition motif domain, eukaryote
Results
2.0
0.5 Salinity (g/l)
Cell division per day (G)
O . mediterraneus
Cell division per day (G)
Diuron 10 µg/l
Irgarol 1 µg/l
1.0 1.2 1.4 1.6 1.8 2.0
0.0
0.5
1.0
1.5
2.0
a
tab[
1, 2
]
1.0 1.2 1.4 1.6 1.8 2.0
0.0
0.5
1.0
1.5
2.0
a
tab[
3, 2
]
1.5
1.0
0
0.5
B. prasinos M. pusilla
1.5
1.0
5 20 35 50 65 5 20 50 65 1 2 3 4 5 6
0.5
1.0
1.5
2.0
2.5
a
tab[
11, 2
]
35 35
Lines with significant difference in fitness Controls (ancestral line) Lines MA experiment condition
Lines with significant
Controls (ancestral line) Lines
difference in fitness Controls (ancestral line)
O . mediterraneus
!!!!! !!!!!
10 µg/l
!!!!! !!!!!!!!!!
1.0 1.2 1.4 1.6 1.8 2.0
0.0
0.5
1.0
1.5
2.0
a
tab[
5, 2
]
!!!!!!!!!!
Salinity tests: - MA lines were less fit in stressful environment - ancestral type was never outcompeted by MA lines
Herbicide tests: - MA lines were equally, less or more fit depending on species
Marc Krasovec1, Gwenael Piganeau1, Adam Eyre-Walker2 ,Nigel Grimsley1, David Pecqueur3, Christophe Salmeron3, Elodie Desgranges1, Claire Hemon1, Sophie Sanchez-Ferandin1
1 Oceanological Observatory of Banyuls, UMR 7232, Banyuls-sur-mer, 66650, France 2 University of Sussex, Evolution Behaviour and Environment, United Kingdom
3 Oceanological Observatory of Banyuls, UMS 2348, Banyuls-sur-mer, 66650, France
What are the fitness effects of spontaneous mutations in picophytoplankton?
Biological models: Our picophytoplankton models (Ostreococcus mediterraneus, Micromonas pusilla and Bathycoccus prasinos) belong to the Mamiellophyceae class (Chlorophyta). They are the smallest free-living eukaryotes (1 !m) described to date(3). They possess a simple cellular organization with one mitochondrion, one chloroplast and a 13 to 20 Mbp haploid nuclear genome. The spontaneous mutation rate is the lower limit of the rate of adaptation and paramount for understanding the consequences of rapid environmental changes on these species.
Context: Mutations are the main source of diversity upon which natural selection can act(1). The study of mutation rates and their effects on fitness is fundamental to our understanding of evolution rates.
Mutation accumulation (MA) experiments(2) aim to estimate the effects of spontaneous mutations on fitness. We followed the evolution of fitness, measured as the growth rate between bottlenecks, in 40 to 60 lines (MA lines) from 3 strains passaged through serial bottlenecks during 200 to 400 days.
Number of MA lines assayed for fitness effects in stressful conditions
Species Number of lines Total number of generations
O. mediterraneus 9 300 M. pusilla 7 250 B. prasinos 8 250
Mutation Ancestral line n mutant
lines
T0 = one cell per well Cell count by
flow cytometer
How can we estimate the fitness effects of spontaneous mutations in eukaryotic picophytoplankton?
How does the fitness effects of mutations change in stressful environments? -! Salinity tests (5 to 65 g/l)
-! Herbicide tests (irgarol and diuron)
One cell bottleneck each 14 days
Conclusion: Taking the cell division per day as a proxy for fitness, the fitness of MA lines show little or no differences compared with ancestral line. In stressful environments, the difference fitness between MA lines was more striking, particularly for M. pusilla. We found evidence for changes in fitness effects of mutations in B. prasinos exposed to herbicides: where some MA lines outcompete the ancestral line. This study shows the importance of genotype/environment interactions to understand species adaptation. 1 Wright, S., 1932. The roles of mutation, inbreeding, crossbreeding, and selection in evolution. Proc. Sixth Int. Congr. Genet. 1, 356–366.
2 Halligan, D.L., Keightley, P.D., 2009. Spontaneous Mutation Accumulation Studies in Evolutionary Genetics.Annu. Rev. Ecol. Evol. Syst. 40, 151–172. 3 Courties, C., Vaquer, A., Troussellier, M., Lautier, J., Chrétiennot-Dinet, M.J., Neveux, J., Machado, C., Claustre, H., 1994. Smallest eukaryotic organism. Nature 370, 255–255. Funding: CNRS, UPMC Complexité du vivant and ANR SVSE6-0004 PHYTNESS
Summary of MA experiment results
!"#$%#&' ()*+,',%-#&' ()*+,'-./0#1')2'3#-#1+4)-&' 56+-3#'%-'7*-#&&'!!"#!$%&'(%))*+%,-! "#! $!###! %&!'&()*+,*-!./++)0*1/-2!
!!.#!/,-'00*! "#! 3!###! %&!'&()*+,*-!./++)0*1/-2!
!!1#!/)*-'+2-! 4#! 3!###! %&!'&()*+,*-!./++)0*1/-2!
There was no evidence for a variation in fitness in MA lines along the course of the experiment.
56!"#!$%&'(%))*+%,-7!86!.'3)2$2+*-!9(:7!;6!1*(453233,-!9(:!
A B C
!!
Salinity (g/l)
Salinity (g/l) 0.
00.
51.
01.
52.
02.
53.
0
0.5
1
1.5
0 M
ean
fitne
ss re
lativ
e to
th
e co
ntro
l 5 20 35 50 65
6 7 9
6 7
7 6
1 2 3 4 8
9
Results obtained from O. mediterraneus salinity stress
=> high variation in fitness between MA lines, strikingly, 5 MA lines outcompete control
M. pusilla B. prasinos
O. mediterraneus
Marc Krasovec1, Adam Eyre-Walker2 ,Nigel Grimsley1, David Pecqueur1, Christophe Salmeron1, Elodie Desgranges1, Claire Hemon1, Gwenael Piganeau1, Sophie Sanchez-Ferandin1
1 Oceanological Observatory of Banyuls, UMR 7232, Banyuls-sur-mer, 66650, France 2 University of Sussex, Evolution Behaviour and Environment, United Kingdom
What are the fitness effects of spontaneous mutations in picophytoplankton?
Biological models: Our picophytoplankton models (Ostreococcus mediterraneus, Micromonas pusilla and Bathycoccus prasinos) belong to the Mamiellophyceae family (Chlorophyta). They contain the smallest free-living eukaryotes (1 !m) described to date(3) and possess a simple cellular organization with one mitochondrion, one chloroplast and a 13 to 21 Mbp haploid nuclear genome. The spontaneous mutation rate sets the lower limit of the rate of adaptation and is crucial to understand the consequences of rapid environmental changes on these species.
Context: Mutations are the main source of diversity upon which natural selection can act(1). The study of mutation rates and their effects on fitness is fundamental to our understanding of evolution and adaptation rates.
Mutation accumulation (MA) experiments(2) allow the estimation of the fitness effects of spontaneous mutations. MA lines from 3 strains were subcultured through serial bottlenecks during 200 to 400 days to allow the segregation of spontaneous deleterious mutations. The growth rate between bottlenecks was taken as a proxy for fitness.
Mutation Ancestral line n mutant
lines
T0 = one cell per well
Cell count by flow cytometer
How can we estimate the fitness effects of spontaneous mutations in eukaryotic picophytoplankton?
Do the fitness effects of mutations change in stressful environments? -! Salinity tests (5 to 65 g/l)
-! Algicide tests (irgarol and diuron)
One cell bottleneck each 14 days
Conclusion: Taking the cell division per day as a proxy for fitness, the fitness of MA lines shows little differences compared with the control line. However fitness effects of mutations are revealed in stressful conditions. Considering that each significant fitness difference between the control and the MA lines might be result of at least one mutation, the minimum mutation rate is thus 2.72-10 mutations per nucleotide per generation for O. mediterraneus, 1.75-10 for M. pusilla and 2.52-10 for B. prasinos. This study also pinpoints the importance of genotype-environment interactions to understand species adaptation.
1 Wright, S., 1932. The roles of mutation, inbreeding, crossbreeding, and selection in evolution. Proc. Sixth Int. Congr. Genet. 1, 356–366. 2 Halligan, D.L., Keightley, P.D., 2009. Spontaneous Mutation Accumulation Studies in Evolutionary Genetics.Annu. Rev. Ecol. Evol. Syst. 40, 151–172. 3 Courties, C., Vaquer, A., Troussellier, M., Lautier, J., Chrétiennot-Dinet, M.J., Neveux, J., Machado, C., Claustre, H., 1994. Smallest eukaryotic organism. Nature 370, 255–255. Funding: CNRS, UPMC Complexité du vivant and ANR SVSE6-0004 PHYTNESS
=> There is little evidence for variation in fitness in MA lines along the course of the experiment : 5 MA lines decrease, 1 increase.
"#!!"#$%&'(%))*+%,-$!%#!.'/)0$0+*-!&'($!)#!1*(23/0//,-#&'(!
A B C
Species Number of lines
Average generations Ne T0 to Tf (days)
O. tauri RCC4221 21 512 8 378 O. mediterraneus RCC2590 24 272 6 294 M. pusilla RCC299 7 272 6 302 B. prasinos RCC1105 8 265 8 224
What are the fitness effects of spontaneous mutations in standard subculturing conditions?
=> MA lines are less fit than control culture when osmolarity changes : salinity stress reveals fitness effects of spontaneous mutations
Algicide stress
0.0
0.5
1.0
1.5
2.0
2.5
Diuron (10 µg.L-1 )
0.5
1
1.5
0
2 6
5
8
6 9 7
1 2 3
Irgarol (1 µg.L-1 )
Mea
n fit
ness
rela
tive
to t
he c
ontr
ol 5
2 3 5
3 5
4
3 4 7
0.5
1
1.5
0
mediterraneus
M. pusilla
B. prasinos
O. mediterraneus
5
2 3 5
3 4 7
0.0
0.5
1.0
1.5
2.0
2.5
2.0 2.0
!"#$%&'(")*+,)"-(./*"0*!12'"#%&)3'")4*!"#$%&'&''(" #)($*+&/*&*.&/,*/'$52!"#$%&'()$&*+,$-.%/01',$2%#/'3/454$461'74%* !%8$)91',$4*':4$9"8/*1'';"<.%/';$&*./=+>/4$&6%&1'
?6$#'7@4/+A$)B/4'$&6'CD/&$E)'F%G$&/$0!12%"6,),'(.*#"/('(")A%-.%&'70B$4@"-/9
>4"#'F%G$&/$0'!"#$H1'IJKK,"6%L%/6'L4"#'M"-'!"#$H1'IJKI
7*/(-#%,*.,%%
8&-#%()6*%".&'(")*&)5*.$%'(9&'(")*/',#/*
!"%2-":#1(/-/*.&%%()6*&)5*9&%(5&'(")*#:".,5$:,
8'&'(/'(./ M"&+"0-)%/49 N0-)%/49
%MO'M"&9@&"&@#"09 9/G4/G$-%&G 9%-/9' PK1QRR PPS
&MO'M"&9@&"&@#"09 9%-/9' Q1PJJ1TIJ IU1IRJ
πMO'M"&9@&"&@#"09 &0*)/"-%6/ 6%8/49%-@ JHJJQ JHJJP
%;O';@&"&@#"09 9/G4/G$-%&G 9%-/9' SJ1JRK QKU
&;O';@&"&@#"09 9%-/9' I1KSJ1QUJ KP1KQJ
π;O';@&"&@#"09 &0*)/"-%6/ 6%8/49%-@ JHJJR JHJJR
%QO'Q+L")6'9/G4/G$-%&G 9%-/9' PK1TPS ISR
&QO'Q+L")6'9%-/9' K1QIK1IIS R1VPI
πQO'Q+L")6'&0*)/"-%6/ 6%8/49%-@ JHJJR JHJJVK
%WO'W&-/4G/&%* 9/G4/G$-%&G 9%-/9' PK1IJP SUU
&WO'W&-/4G/&%* 9%-/9' K1KRV1IQJ IV1KTS
πWO'W&-/4G/&%* &0*)/"-%6/ 6%8/49%-@ JHJJT JHJJS
%WO'W&-4"&%* 9/G4/G$-%&G 9%-/9' Q1RIR IQ
&WO'W&-4"&%* 9%-/9' IIP1RPU RSI
πWO'W&-4"&%* &0*)/"-%6/ 6%8/49%-@ JHJJVS JHJJU
9-4$%& X4/$69'Y2KJUZ
X4/$69H&-+K C/&"#/'*"8'Y[\KJ]Z'Y^Z
X;MF9'Y_CZ XW&6/)9'Y_CZ
!``QIIK QK RP TRHJ J J!``KKJR KVR TQU TQHT QPRSU KVSV!``KKKJ VT PKQ TQHS QIURR KUUS!``KKKI KVT UUT TQHV QPUKV KVSQ!``KKKQ SK KTK TQHI PRKVT KQRS!``KKKS UP IUP TQHQ QVSJJ KTKJ!``KKKU UQ ISP TQHS QVSJI KTJV!``KKKV KRJ RQU TSHJ QPUKS KVSI!``KKKR KRQ TUS TQHT QITPS KUPI!``KKIP KVR TKR TSHQ QIVJR KUTJ!``KSSR UP IQS TQHS QKJTU KSUI!``KSST PK KSS TQHQ QTTSQ IJKJ!``KSUK KRR RSR TSHI QPSIQ KVSJ
>4"#'C4%#9)/@ !"#$H1'IJKJ1'
IJJ'9$#<)/9'"&'U'9%-/9'%&'IJJU
KI'*)"&$)'9-4$%&9'"L''()"#*+,
a"-$)'bM?'9/c0/&*%&G'</4L"4#/6'$-'-./'d"%&-'C/&"#/'W&9-%-0-/'09%&G'W))0#%&$'C?'WW
&0*)/%'Y&Z1'*.)"4"<)$9-'Y*Z1'#%-"*."&64%"&'Y#Z1'C")G%'5"6%/9'YGZ1'-./'7&6"<)$9#%*'!/-%*0)0#'Y/4Z1'$&6'G4$&0)/9'YG4ZH';*$)/'bar = 200 &#>4"#'d/&9/&'!"#$(1'IJJV
,/-."69 e$4%$&-9 F")@#"4<.%9#9 ;MF9 WMb7f;
_C KUV1QKV KIS1ITJ KIJ1QSR Q1RPI
3` KVK1VTQ KQK1QRT KPI1JSR T1QPK
C7MN + KJQ1UTS KJI1UTT K1TTU
`.4"#"9"#/ F"9%-%"&9 X';-4$%&9 X'5< ;$&G/4'9/c0/&*/6 aM aF >M >F ;/&9%-%8%-@ ;</*%L%*%-@IJ VU1KSR'-"'VU1UVS KI UJJQ SRJI KTR I I TT^ TTHT^IJ UT1IJJ'-"'UT1RJJ KK SSSS SSKS QJ J J KJJ^ KJJ^IJ KJS1VSJ'-"'KJU1QSJ T SKRS SKSQ PK J J KJJ^ KJJ^IJ KJR1VSJ'-"'KJT1QSJ P KIIT KIKP KS J K KJJ^ TTHT^
W))0#%&$'F$%4/6'7&6'!/$69'L"4'KP'.$<)"%6'*)"&$)'9-4$%&9'"L''()"#*+,
;MF'$&6'9."4-'W&6/)9 f$4G/'Y[KJJ'5<Z'W&6/)9
,$<<%&G'$G$%&9-'-./'4/L/4/&*/'G/&"#/'9/c0/&*/'Y!``QIIKZ
(A?+,7, `!?`
9$#-"")9#<%)/0<
C?a:
W&6/)9 4/$)%G&/4
_&%L%
/6'C
/&"-
@</4
Y_CZ
3$<)
"-@<
/'`$
))/4'
Y3`Z
;&:(&)'/*0(%':&'(")4!/c0%4/'*"8/4$G/O['KJ]g'I'-%#/9'$8/4$G/'</4'9-4$%&e$4%$&-9'90<<"4-'5@''['RJ^'4/$69,$<<%&G'c0$)%-@'['PJ'
b0<)%*$-/9'4/#"8/6'$&6'4/$6'-4%##/6'Y>$-9_&%c $&6'a4%##"#$-%*Z
`$9/9'"L'<$4-%$)'#$<<%&G
W&9/4-%"&'6/-/*-%"&
W&9/4-%"&'$99/#5)@
b/)/-%"&'6/-/*-%"&
e$)%6$-%"&'5@';$&G/4'9/c0/&*%&G'"L'F`!'<4"60*-'"L'B/@'4/G%"&9
'-"+!././/*- "#*+,)%9'$'$)(.,%%$%&:*,$3&:2"'(.*6:,,)*&%6&, "L'-./'*)$99'<&-(,%%"#12.,&,=,$#%/))"<.@*/$/'%9'$'*)$99'5/)"&G%&G'-"'-./'<.@)0#'>1%":"#12'&=?))''()"#*+, 9-4$%&9'*0)-%8$-/6'%&'-./')$5'$4/'1&#%"(5='()"#*+, .$9'$'/(-#%,*?*$-*%&:6,*.,%%*#$6/'"L'$'9%&G)/'*.)"4"<)$9- $&6'#%-"*."&64%"&H
'()"#*+, .$9'$'?@*<A*6,)"-,*#$6/'"L'BC*.1:"-"/"-,/*$&6'<$*B/6'D%-.'DCCC*#:,5(.',5*6,),/HB*"$'%(,:/*.1:"-"/"-,/*<4/9/&-'$')"D/4'C`'*"&-/&-'-.$-'-./'"-./4'YST^Z1'$-@<%*$)'G/&/9'$&6'*"&-$%&'VV^'"L'$))'[QJJ'-4$&9<"9$5)/'/)/#/&-9H
<&-(,%%"#12.,&/'$4/'G4"0<'-"G/-./4'5$9/6'"&'-"%,.$%&:*.:(',:(&H'b/9<%-/'9.$4%&G'$'),&:%2*(5,)'(.&%*?D8:EF7*/,G$,).,1''()"#*+, $&6''()$*/,0#+,1*-)<4"-/"#/9'$4/'"&)@'VJ^'%6/&-%*$)1'$'6%LL/4/&*/'*"#<$4$5)/'-"'.0#$&'$&6'*.%*B/&'6/9<%-/'-./9/'9</*%/9'.$8/'$'.%G./4'6%8/4G/&*/'%&'-./%4'KR;4bM?'9/c0/&*/H
H1&'*(/*'1,*%,9,%*"0*/'&)5()6*6,)"-(.*9&:(&'(")*()*&*?D8:EF7*5,0(),5*/#,.(,/*I
>"-#&:(/")*&.:"//*.&%%()6*-,'1"5/
b/*$@'"L')%&B$G/'6%9/c0%)%54%0#
<&-(,%%"#12.,&,KR;4bM?'-4//
8,G$,).()6*/'&'(/'(./*#,:*/':&()
?))'<")@#"4<.%9#9 (%$))/)%* ;MF9'"&)@
?L-/4'L%)-4$-%"&'"L'$'D$-/4'9$#<)/1'.%")&%*/':&()/*$4/'/9-$5)%9./6'L"4'5"--)/9'.$45"4%&G'$'G4//&'*")"4'*.$4$*-/4%9-%*'"L',$#%/))$)/9H'a./'9</*%/9'%9'-./&'6/L%&/6'5$9/6'"&'-./'?D8:EF7*9/c0/&*/
A%)6'9-4$%&9!/L/4/&*/
J$'%(,:/*1&9,*$#*'"*KDC*3A*L.1BM*&)5*NB3A*L.1?OM*)")P."9,:,5*:,6(")/
f"D'C`
A%)6'9-4$%&9!/L/4/&*/
f"D'C`
;-$&6$46'*.4"#"9"#/9O'KJ'<4/6%*-/6'$&6'*"&L%4#/6')$4G/'6/)/-%"&9'YJHS'-"'KQ'B5Z
b%9-$&*/'YB5Z
f%&B
$G/'
6%9/
c0%)%
54%0
#'Y4
IZ N59/48/672</*-/6'YL"4'$'<$&#%*-%*<"<0)$-%"&Z
7*%&:6,*()5,% #"%2-":#1(/-/*()*'1,*.1%":"#%&/'*&)5*('/*!>Q*9&%(5&'(")
8'&'(/'(./*")*'1,*)$.%,&:*&)5*":6&),%%&: 6,)"-,/ 8'&'(/'(./*&.:"//*/(',/
'()"#*+,)&0*)/"-%6/'6%8/49%-@'2-( "-./4'/0B$4@"-/9
['KJ]g KJ]\'J]
`"8/4$G/
H1"%,*6,)"-,*0,&'$:,/*&)5*#"%2-":#1(/-/*
R(61*"..$::,).,*"0*&5S&.,)'*8F!/
f"D')/8/)'"L'<")@#"4<.%9#'"&'TQ^'"L'-./'G/&"#/'#$B/9'*4@<-%*'9</*%/9'0&)%B/)@
,%&%#0#'L4/c0/&*@'"L'9/20$)'4/<4"60*-%"&'K'#/%"9%9'/8/4@'KJ1JJJ'#%-"9%9'%&''()"#*+,
3%G.'8$4%$-%"&'"L')/8/)'"L'G/&/-%*9'$&6'9-40*-04$)'<")@#"4<.%9#9'5/-D//&'"0-)%/49'$&6'&"4#$)'*.4"#"9"#/9
f$4G/'%&9/4-%"&'YgZ'$&6'6/)/-%"&'Y[Z'<")@#"4<.%9#9Y4/6O'F`!'*"&L%4#/61'G4/@O'F`!'6"'&"-'$G4//1'5)$*BO'&"-'F`!'*./*B/6Z
>").%$/(")C`'*"&-/&- YG4//&'\'UJ^1'5)0/'\'SJ'^Z
F"<0)$-%"&'9*$)/6'4/*"#5%&$-%"&'4$-/'Y</4'B5Z'%&L/44/6'5@'f6.$-OF%hF9'4$-%"'Y*)/$4\')"D1'6$4B'5)0/\'.%G.ZM0*)/"-%6/'6%8/49%-@'YF%Z
�F/48$9%8/'#0)-%+&0*)/"-%6/'#0-$-%"&'/8/&-9
/2</*-/6
"59/48/6
F"<0)$-%"&'9*$)/6'4/*"#5%&$-%"&'4$-/'
W&'."09/'9*4%<-'YC7MNZ
H1&'*T,*"A/,:9,5
>:2#'(.*/#,.(,/*."-#%,U*I !"#$%&'(")*I
F./&"-@<%*'8$4%$-%"&
F")@#"4<.%9#
;-4$%&'9</*%L%*'G/&/9
!/*"#5%&$-%"&
J$'%(,:*.1:"-"/"-,/
8'&)5&:5*.1:"-"/"-,/
®®®
®
H1&'*'"*,U#,.'*I>:2#'(.*/#,.(,/*."-#%,U*I !"#$%&'(")*I
F./&"-@<%*'8$4%$-%"&
F")@#"4<.%9#
;-4$%&'9</*%L%*'G/&/9
!/*"#5%&$-%"&
®®®
®
3%G.'M/f"D'FMhF;;B/D/6';>;
;&%(5&'(") Y5$9/6'"&'Q'.%G.)@'<")@#"4<.%*'4/G%"&9Z
+,)"-, >1%":"#%&/' <('".1")5:(& F$.%,&:M0#5/4'"L'9%-/9 VR'B5 QQ'B5 KKHI',5;@&"&@#"09';MF KKT SS QV TKVF%';@&"&@#"09 JHJJS JHJJP JHJK!/*"#5%&$-%"& i/9 M" i/9
Stable Production of a Lytic Prasinovirus by its Picoalgal Host,Ostreococcus mediterraneus
Sheree Yau1, Marc Krasovec1, Nigel Grimsley1, Evelyne Derelle1, Sophie Sanchez-Ferrandin1, Stephane Rombauts2, Klaas Vandepoele2, Gwenael Piganeau1
1Integrative Biology of Marine Organisms (BIOM)-CNRS UMR7232 - Observatoire Océanologique de Banyuls, FRANCE2Department of Plant Systems Biology, VIB, Ghent, BELGIUM. Correspondence: [email protected]
BackgroundGlobally distributed marine algae of the genus Ostreococcus are among the smallest known free-living eukaryotes (<1 micron diameter) [1]. Ostreococcus genomes possess a "Small Outlier Chromosome" (SOC), so named because it has a lower GC content than the rest of the genome and shares little sequence homology with other species [2]. All Ostreococcus species are infected by prasinoviruses, large DNA viruses thus far all known to be strictly lytic. Surprising, a prasinovirus genome, termed OmV0, was assembled with the genome of the recently described species, O. mediterraneus RCC2590 [3].The culture showed no sign of infection in standard batch culture conditions since its isolationand cloning in 2008.
[1] Courties et al. (1994) Smallest eukaryotic organism. Nature. 370:255.[2] Moreau et al. (2012) Gene funtionalities and genome structure in Bathycoccus prasinos reflect cellular specializations at the base of the green lineage. Genome Biology. 13: R74.[3] Subirana et al. (2013) Morphology, genome plasticity and phylogeny in the genus Ostreococcus reveal a cryptic species, O. mediterraneus sp. nov. (Mamiellales, Mamiellophyceae). Protist. 164: 643–659.[4] Thyrhaug et al. (2003) Stable coexistence in marine algal host–virus systems. Mar. Ecol. Prog. Ser. 254:27-35.
Methods
Results
ReferencesConclusions and Perspectives
Fig 7. Hybridisation of SOC-specific probes to thePFGE gel of "wild type" OmV0-producing RCC2590and the OmV0-susceptible MA3, MA23, and MA24 lines shows a decrease in SOC size. MAlines that were not lysed by OmV0 showed nochange in SOC size as assessed by PFGE (not shown) suggesting a strong correlation betweendeletion in the SOC with susceptibility to lysis byOmV0. The estimated SOC sizes vary between OmV0-susceptible MA lines confirming the deletions occurred independently.
MA3
infected non-infected
Ancestor line
MA24MA23infected non-infected
infected non-infected infected non-infected
Fig 6. Three independnent MA culture lines (MA3, MA23, MA24) of 24 (40 total lines) visibly lysed upon addition of OmV0 producedby the "wild type" O. mediterraneus RCC2590 indicating OmV0 is capable of lytic reproduction. Neither the Ancestor line, nor the otherindependent MA lines were lysed by OmV0.
A) Pulse-field Gel Electrophoresis (PFGE) and hybridisation * Chromosomes were separated by PFGE. * Radiolabelled probes specific to OmV0 and the host genes were hybridised to the chromosomes in the gel.
B) Fig 2. Test for production of OmV0 virions
"wild type" RCC2590
Centrifuge 8,000 g20 mins
Filter <0.8 micron
cell-free filtrate
PCR for major capsid protein
gene
Infection of MAlines D) Determination of genomic changes
in MA lines by single molecule PACBIO sequencing
C) Mutation Accumulation (MA) Experiment and infection of MA lines* A virus-free clone was obtained by limiting dilution that was used as the ancestor to the MA experiment (Fig 3.)* Culture medium filtrate from the RCC2590 "wild-type" strain was added to the MA lines and lysis observed
Fig 3. Mutation Accumulation Experiment Design
* O. mediterraneus stably produces an infectious lytic prasinovirus, OmV0.* Spontaneous mutation leading to susceptibility to OmV0 lysis occurs in ~12% of independent MA lines. * Coexistence of OmV0 and O. mediterraneus in culture is linked to the presence of a genomic region located on the SOC. * The OmV0-O. mediterraneus system is, as far as we know, the first report of this type of virus-host interaction to be isolated directly from the environment. A similar phenomenon is observed in diverse marine algal host-virus systems in culture [4], whose significance in the environment is yet to be explored.
200
Fig 1. Electronmicrograph of O. mediterraneus0.5 micron
1
2
3
4
OmV0 is not integrated into the O. mediterraneus RCC2590 genome
RCC2590
Fig 4. Hybridisation of OmV0 and 18S rRNA specific probes to the PFGE-separated chromosomes of "wild type" O. mediterraneusRCC2590 culture.The 18S rRNA probe hybridised to the chromosomal band corresponding to the size predicted from the assembled genome.Both OmV0 probes, unique to two separate genomic regions, hybridised to the same physicallocation on the gel corresponding to the predicted size of the complete linear OmV0 genome (200 kb).
Mutant O. mediterraneus lines are lysed by OmV0produced by the parent strain, RCC2590
Mutant OmV0-susceptibleO. mediterraneus lines have decreasedSOC size
A 58 kb region is deleted in the SOC of mutant line MA3
(24 independent)
O. mediterraneus RCC2590 culture medium filtrate contains OmV0
2 31M Fig 5. PCR amplification of the OmV0 major capsid protein gene in the culture medium filtrate.M) 1 Kb molecular ladder1) No DNA template control2) Genomic DNA preparation3) Culture medium filtrate
5RCC2590 SOC: 644 kb
MA3 - SOC: 590 kb
58 kb
Fig 8. Alignment of theSOC from O. mediterraneusRCC2590 to the SOCof the MA3 line shows a 58 kb deletion at one end of the MA3 SOC. This deleted region contains primarily repeated sequences found elsewhere in the genomebut also at least 6 unique ORFs of unknown function.
AIM: Determine how OmV0 reproduces and the genetic basis for its stable coexistence with its host.
!"#$"%"&'"()*&)+,,)-."+&%)-/)'0")1,-2"3)'0")#*.-"45+$6-7.)1$""&)+,1+")8%*9"):);)<=>)/$-=)'0")?+=*",,-#06."+").,+%%)+$")"%%"&7+,)+.'-$%)-/)#,+&5'-&*.).-==4&*7"%)-/)'0")?"(*'"$$+&"+&)@"+A)B0")!"#$%&'&''(")1"&4%)C+%)-$*1*&+,,6)("%.$*2"()/$-=)+)%'$+*&)(*%.-D"E$"()*&)'0")B0+4),+1--&);F)6"+$%)+1-3)!"#$%&''&'(")#*($+3)5&-C&))+%)'0")%=+,,"%')"45+$6-7.)/$""E,*D*&1).",,)8FAG)<=>)'-)(+'")8H>A))
@-#0*")@+&.0"9EI"$+&(*&3)?+$.)J$+%-D".3)KC"&+",)L*1+&"+4)
!"#"$"%&"'(E!8H>)M-4$7"%)M3)N+O4"$)P3)B$-4%%",,*"$)?3)Q+47"$)R3)M0$S7"&&-'ET*&"')?R3)U"D"4V)R3)?+.0+(-)M3)M,+4%'$")WA)HXXYA)@=+,,"%')"45+$6-7.)-$1+&*%=A)U+'4$")Z[F\;]]A)E!8;>)^,+&.E?+'0*"4)!A3)@+&.0"9EI"$+&(*&)@A3)_6$"E`+,5"$)PA)+&()L*1+&"+4)KA3);FHZA)a$1+&",,"%)b&0"$*'+&.")*&)'0")K$""&)Q*&"+1"\)b&%*10'%)I$-=)!"#$%&'&''(")#*($+A)K"&-=")^*-,A)_D-,A3)]8G>\H]FZEHHA)E8Z>)Tc-4+&*)_AE^A3)M0$*%7")RA3)@+&.0"9EI"$+&(*&)@A3)@+&.0"9)IA3)^-41"')IAEdA3)M-$",,-4)IA3);FHHA)P)"45+$6-7.)QaNE0*%7(*&")5*&+%")$"14,+'"%).*$.+(*+&).,-.5)/4&.7-&)*&)'0")#*.-+,1+)!"#$%&'&''("A)B0")L,+&')R-4$&+,3)e]8Y>\][GE]GGA))E8Y>)@+&.0"9EI"$+&(*&)@A3)Q"$-6)IA3)^-41"')IEd)+&()R-4V)IA3);FHZA)P)U"C3)@"&%*7D")?+$*&")?*.$-+,1+,)!".-=2*&+&')^*-%"&%-$)4%*&1)Q4=*&"%."&.")?-&*'-$*&1)/-$)'0")B-V*.*'6)B"%7&1)-/)P&7/-4,*&1)^*-.*("%A)P##,*"()_&D*$-&="&'+,)?*.$-2*-,-163)[X\eZHEeZGA)
L06'-#,+&5'-&)%#".*"%)/$-=)?+=*",,+,"%)-$("$)+')'0").$-%%$-+(%)-/)1"&"7.%3)".-,-163)"V#"$*="&'+,)2*-,-16))
+&()2*-*&/-$=+7.%\)'0")LWdBU_@@)#$-c".'A)
)
f?!)[;Z;)^*-,-1*")b&'S1$+7D")("%)a$1+&*%="%)?+$*&%),-.!/0)
)
KS&-=*O4")_D-,47D")"')_&D*$-&&"="&'+,")(4)L06'-#,+&.'-&)
,123!4560))
a2%"$D+'-*$")a.S+&-,-1*O4"3)eee]F)^+&64,%E%4$E="$)
))
B0")LWdBU_@@)#$-c".')+*=%)'-)g,,)=+c-$)1+#%)*&)-4$)2+%*.)4&("$%'+&(*&1)-/)'0")#$-."%%"%)4&("$,6*&1)1"&-=")"D-,47-&)*&)'0"%")=*.$-+,1+")26)+)=4'+7-&)+..4=4,+7-&)8?P>)+##$-+.0A))
)*("+,"$-."%/(-&)YF)*&("#"&(+&')%'$+*&%)8%'+$7&1)/$-=)-&").",,>)0"12"%&-%3)-/)+,,)(+410'"$)%'$+*&%)+h"$)'0-4%+&(%)-/)1"&"$+7-&%)4-5-%#5$.67&')+##$-+.0)'-)"%7=+'")'0")=4'+7-&)$+'")26)$"#,*.+E)7-&)"$$-$3)<)i)=4'+7-&)$+'")#"$)&4.,"-7(")#"$).",,)(*D*%*-&)
2+%*.)4&("$%'+&(*&1)-/)'0")#$-."%%"%)4&("$,6*&1)1"&-=")"D-,47-&) @*=#,").",,4,+$)-$1+&*9+7-&)C*'0)-&")=*'-.0-&($*+)+&()-&").0,-$-#,+%')+&()+)HZ)?2#)0+#,-*()&4.,"+$)1"&-="A)@4.."%%/4,,6)4%"()'-)1+*&)5&-C,"(1")*&'-)/4&(+="&'+,).",,4,+$)#$-."%%"%)%4.0)+%)-$1+&",,+$)*&0"$*'+&."))8;>3)).",,)(*D*%*-&3).*$.+(*+&).,-.5)8Z>3),*#*()+&()%'+$.0)%6&'0"%*%A))
L06%*-,-1*.+,)"V#"$*="&'+7-&%)C*,,)"&+2,")'-)"%7=+'")'0")#0"&-'6#*.)(*D"$%*'6)+&()'0"),*&5)C*'0)1"&"7.)(*D"$%*'6)26)g&(*&1)1"&-=")C*(")+%%-.*+7-&%)2"'C""&)%-=")0+#,-'6#"%)+&()(*%.$"'")#0"&-'6#"%A))
B-).-&.,4("3)"%7=+7-&%)-/)'0")=4'+7-&)$+'"%)-/)'0"%")(*j"$"&')=*.$-+,1+")C*,,)2$*&1)&"C)4&("$%'+&(*&1)'-)'0")=-(")+&()'"=#-)-/)"D-,47-&)-/)'0"%")"&*1=+7.)"45+$6-'"%)'0+')($*D")'0")-."+&k%)".-%6%'"=A))
!"#"$"%&"('/$6-%(
)2/675%(
!(.2/6%/('/$6-%'(
M-&'"V')
P\)!7)8%9+#%$$*:%("l)^\)/+'$&8&:*")%#Al)M\)-*#;<'&''(")%#A)
.:#%$%"=:>)#&):&='%?)*&)+((*7-&)'-)'0"*$)".-,-1*.+,)*=#-$'+&."3)'0"%")=*.$-+,1+").-4,()-j"$)&"C)2*-'".0&-,-1*.+,)#-'"&7+,)+%)#-%%*2,")%-4$."%)-/)2*-/4",%)+&()(*"'+$6)m-="1+EZn),*#*()/--()%4##,"="&'%3)+&()'0"6)0+D")/-%'"$"()%"D"$+,)*&'"$&+7-&+,)*&*7+7D"%)*&)'0")f@)8R-*&')K"&-=")b&*7+7D">3)+&()=-$")$"."&',6)*&)_4$-#")8BP!PEa."+&%>)'-)1+*&)5&-C,"(1")*&'-)'0"*$)(*D"$%*'6)+&()="'+2-,*.)#-'"&7+,A)
M)^)P)
Henderson et al., 2007
"#$%&'()8(/9"(:3$""%(;"6'/:(#5$(,<6%/(=-5<53-'/'((
@*=*,+$)#0"&-'6#*.)%.$""&*&1)0+%)#$"D*-4%,6)2""&)(-&")+')'0"),+2-$+'-$6)26).-=#+$*&1)1$-C'0)$+'"%)4&("$)(*j"$"&')"&D*$-&="&'+,)%'$"%%"%)8Y>)
>%&2=675%(-%((?-@"$"%/(&5%?-75%'(
A/9"$()6.-"<<5,9;&"6"(2'"?(-%(/9-'('/2?;(
Marinobacter dominates the bacterial community of the Ostreococcus tauri phycosphere in culture
Josselin Lupette1,2, Raphaël Lami3, Marc Krasovec2, Nigel H. Grimsley2, Hervé
Moreau2, Gwenael Piganeau2, Sophie Sanchez-Ferandin2* 1 CEA / CNRS / INRA / Université Grenoble Alpes UMR 5168, France, 2UMR 7232 Biologie
Intégrative desOrganismes Marins, BIOM, Observatoire Océanologique, France, 2 Observatoire Océanologique, UMR 7232 Biologie Intégrative des Organismes Marins, BIOM,
France, 3 Observatoire Océanologique, USR3579 Laboratoire de Biodiversité et Biotechnologies
Microbiennes, LBBM, France,
Keywords: Ostreococcus tauri, Marinobacter sp., Picoalgae, Bacteria, interactions,
Phytoplankton
ABSTRACT Microalgal-bacterial interactions are commonly found in marine environments and
are well known in diatom cultures maintained in laboratory. These interactions also
exert strong effects on bacterial and algal diversity in the oceans. Small green
eukaryote algae of the class Mamiellophyceae (Chlorophyta) are ubiquitous and
some species, such as Ostreococcus spp., are particularly important in
Mediterranean coastal lagoons, and are observed as dominant species during
phytoplankton blooms in open sea. Despite this, little is known about the diversity of
bacteria that might facilitate or hinder O. tauri growth. We show, using rDNA 16S
sequences, that the bacterial community found in O. tauri RCC4221 laboratory
cultures is dominated by γ-‐‑proteobacteria from the Marinobacter genus, regardless
of the growth phase of O. tauri RCC4221, the photoperiod used, or the nutrient
conditions (limited in nitrogen or phosphorous) tested. Several strains of M. algicola
were detected, all closely related to strains found in association with taxonomically
distinct organisms, particularly with dinoflagellates and coccolithophorids. These
sequences were more distantly related to M. adhaerens, M. aquaeoli and bacteria
usually associated to euglenoids. This is the first time, to our knowledge, that distinct
Marinobacter strains have been found to be associated with a green alga in culture.
175
LISTES DES FIGURES ET DES TABLEAUX
176
CHAPITRE 1: INTRODUCTION Figure 1. Processus de mutations. 13 Figure 2. Schéma d’une expérience d’accumulation de mutations. 16 Figure 3. Representation du fitness landscape selon Fisher. 21 Figure 4. Changement de fitness d’un genotype entre environnements. 21 Figure 5. Relation entre le taux de mutation et la taille du génome. 26 Figure 6. La barrière de dérive et le coût de la réplication. 27 Figure 7. Relation entre taille efficace et taux de mutations. 28 Figure 8. Photographies en microscopie électronique des espèces utilisées pour les expériences d’accumulation de mutations. 39 Figure 9. Arbre phylogénétique des Chlorophyta. 40 Figure 10. Migration par PFGE de l’ADN complet des 4 espèces de Mamiellophyceae. 41 Tableau 1. Les taux de mutations spontanées estimés par des expériences d'accumulation de mutations. 25 Tableau 2. Corrélation entre le temps de génération et le taux de mutation. 29 Tableau 3. Le biais de GC vers AT. 34 Tableau 4. Diversité génomique des espèces utilisées pour les expériences d’accumulation de mutations. 37
177
CHAPITRE 2: EFFETS DES MUTATIONS SUR LA FITNESS Figure 1. Mutation accumulation (MA) experiments in pico-algae. 53 Figure 2. Selection coefficients, ST, in Irgarol 1051 or Diuron. 56 Figure 3. Selection coefficients in five salinity conditions. 57 Table 1. Summary of mutation accumulation experiments for four species. 54 Table 2. Statistical probabilities of line loss. 55 CHAPITRE 3: LE TAUX DE MUTATION CHEZ LES MAMIELLOPHYCEAE Figure 1. The GC to AT and AT to GC mutations in the four species. 73 Figure 2. Correlation of the base substitution mutation rate and the effective population size. 74 Figure 3. Correlation of the base substitution mutation rate. 75 Figure 4. Correlation between mutation rate and gap from GC equilibrium. 76 Table 1. Summary of spontaneous mutation rates in four Mamiellophyceae species. 71 Table 2. Mutation rate variation between coding and non-coding sequences. 72 CHAPITRE 4: LES TRANSFERTS HORIZONTAUX DE GENES: LE CAS DE PICOCHLORUM RCC4223 Figure 1. Phylogenetic and phenotypic analysis of Picochlorum RCC4223. 90 Figure 2. PFGE migration of Picochlorum RCC4223. 91
178
Figure 3. Open Read Frame (ORF) lengths comparison between Picochlorum species. 94 Figure 4. Gene family extensions in Picochlorum RCC4223. 94 CHAPITRE 5: IMPACT DU TAUX DE MUTATION POUR LES BIOTECHNOLOGIES Figure 1. Number of base-substitution mutations observed in MA lines of Picochlorum RCC4223. 106 Table 1. Distribution of the mutations between MA lines. 107 Table 2. The distribution of the mutations in the genome, with the predicted effects from SnpEFF. 107 Table 3. Available direct spontaneous mutation rate estimations in Chlorophyta. 109 CHAPITRE 6: DISCUSSION ET CONCLUSION Figure 1. Migration PFGE chez les lignées issue de l’EAM d’O. mediterraneus. 120 Figure 2. Présentation des différents facteurs qui influencent le taux de mutation. 121
179
ANNEXES CHAPITRE 2: EFFETS DES MUTATIONS SUR LA FITNESS Table S1. Normalized Gr from Micromonas pusilla. 137 Table S2. Normalized Gr Ostreococcus mediterraneus. 138 Table S3. Normalized Gr from Bathycoccus prasinos. 139 Table S4. Normalized Gr from Ostreococcus tauri. 140 Table S5. Average of G of MA lines and control of Micromonas pusilla for each environmental test. 141 Table S6. Average of G of MA lines and control of Bathycoccus prasinos for each environmental test. 141 Table S7. Average of G of MA lines and control of Ostreococcus mediterraneus for each environmental test. 142 CHAPITRE 3: LE TAUX DE MUTATION CHEZ LES MAMIELLOPHYCEAE Figure S1. The distribution of the base-substitution mutations. 152 Figure S2. Correlation between the strength of the GC bias (R1/R2) and the nucleotide mutation rate. 155 Figure S3. Mutational context of base-substitution mutations. 155 Table S1. Summary of mutation accumulation experiments. 143 Table S2. The part of the genome usable (G*) for mutations calling. 143 Table S3. Base-substitution mutations in O. tauri. 143 Table S4. Base-substitution mutations in O. mediterraneus. 146
180
Table S5. Base-substitution mutations in B. prasinos. 147 Table S6. Base-substitution mutations in M. pusilla. 148 Table S7. Insertions in the four species. 150 Table S8. Deletions in the four species. 150 Table S9: RNAseq coverage of exons and other sequences in mutated and no mutated sites. 151 Table S10. Spontaneous base-substitution mutation rates estimated by mutation accumulation. 153 Table S11. Effect of GC gap from equilibrium in base substitution mutation rate. 154 CHAPITRE 4: LES TRANSFERTS HORIZONTAUX DE GENES: LE CAS DE PICOCHLORUM RCC4223 Table S1. Draw statistical results from Pacbio RS II sequencing and polished step. 156 Table S2. Statistical best results from ABySS assembly. 156 Table S3. SGA results with MiSeq reads mappings in HGAP assembly. 157 Table S4. Total final genome assembly. 157 CHAPITRE 6: DISCUSSION ET CONCLUSION Tableau A1. Mutations des lignées d’O. tauri qui montrent une baisse significative de fitness. 159 Tableau A2. Délétions et insertions identifiées chez les lignées utilisées pour les essais de fitness. 159 Tableau A3. Substitutions identifiées chez les lignées utilisées pour les essais de fitness. 160
181
BIBLIOGRAPHIE
182
Abby, S.S., Touchon, M., De Jode, A., Grimsley, N., Piganeau, G., 2014. Bacteria in
Ostreococcus tauri cultures - friends, foes or hitchhikers? Front. Microbiol. 5,
505.
Abecasis GR, Altshuler D, Auton A, Brooks LD, Durbin RM, 1000 Genomes Project Consortium, 2010. Nature 467(7319): 1061–1073. Adewoye, A.B., Lindsay, S.J., Dubrova, Y.E., Hurles, M.E., 2015. The genome-wide
effects of ionizing radiation on mutation induction in the mammalian germline.
Nat. Commun. 6, 6684.
Aggarwala, V., Voight, B.F., 2016. An expanded sequence context model broadly
explains variability in polymorphism levels across the human genome. Nat.
Genet. 48, 349–355.
Agrawal, A.F., Whitlock, M.C., 2012. Mutation Load: The Fitness of Individuals in
Populations Where Deleterious Alleles Are Abundant. Annu. Rev. Ecol. Evol.
Syst. 43, 115–135.
Ajie, B.C., Estes, S., Lynch, M., Phillips, P.C., 2005. Behavioral Degradation Under
Mutation Accumulation in Caenorhabditis elegans. Genetics 170, 655–660.
Alavi, M., Miller, T., Erlandson, K., Schneider, R., Belas, R., 2001. Bacterial
community associated with Pfiesteria-like dinoflagellate cultures. Environ.
Microbiol. 3, 380–396.
Amin, S.A., Green, D.H., Hart, M.C., Küpper, F.C., Sunda, W.G., Carrano, C.J.,
2009. Photolysis of iron–siderophore chelates promotes bacterial–algal
mutualism. Proc. Natl. Acad. Sci. U. S. A. 106, 17071–17076.
Andrew, J.R., Dossey, M.M., Garza, V.O., Keller-Pearson, M., Baer, C.F., Joyner-
Matos, J., 2015. Abiotic stress does not magnify the deleterious effects of
spontaneous mutations. Heredity.
Backström, N., Sætre, G.-P., Ellegren, H., 2013. Inferring the demographic history of
European Ficedula flycatcher populations. BMC Evol. Biol. 13, 2.
Baer, C.F., Miyamoto, M.M., Denver, D.R., 2007. Mutation rate variation in
multicellular eukaryotes: causes and consequences. Nat. Rev. Genet. 8, 619–
631.
Baer, C.F., Phillips, N., Ostrow, D., Avalos, A., Blanton, D., Boggs, A., Keller, T.,
Levy, L., Mezerhane, E., 2006. Cumulative Effects of Spontaneous Mutations
for Fitness in Caenorhabditis: Role of Genotype, Environment and Stress.
Genetics 174, 1387–1395.
183
Barrett, R.D.H., Schluter, D., 2008. Adaptation from standing genetic variation.
Trends Ecol. Evol. 23, 38–44.
Becker, E.W., 2007. Micro-algae as a source of protein. Biotechnol. Adv. 25, 207–
210.
Behringer, M.G., Hall, D.W., 2016. The repeatability of genome-wide mutation rate
and spectrum estimates. Curr. Genet. 1–6.
Behringer, M.G., Hall, D.W., 2015. Genome-Wide Estimates of Mutation Rates and
Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly
Mutagenic Despite the Absence of DNA Methylation. G3
GenesGenomesGenetics 6, 149–160.
Beletskii, A., Bhagwat, A.S., 1996. Transcription-induced mutations: Increase in C to
T mutations in the nontranscribed strand during transcription in
Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 93, 13919–13924.
Bird, A.P., 1986. CpG-rich islands and the function of DNA methylation. Nature 321,
209–213.
Black, C.K., Mihai, D.M., Washington, I., 2014. The Photosynthetic Eukaryote
Nannochloris eukaryotum as an Intracellular Machine To Control and Expand
Functionality of Human Cells. Nano Lett. 14, 2720–2725.
Blanc, G., Agarkova, I., Grimwood, J., Kuo, A., Brueggeman, A et al., 2012. The
genome of the polar eukaryotic microalga Coccomyxa subellipsoidea reveals
traits of cold adaptation. Genome Biol. 13, R39.
Blanc, G., Duncan, G., Agarkova, I., Borodovsky, M., Gurnon, J et al., 2010. The
Chlorella variabilis NC64A genome reveals adaptation to photosymbiosis,
coevolution with viruses, and cryptic sex. Plant Cell 22, 2943–2955.
doi:10.1105/tpc.110.076406
Blanc-Mathieu, R., Sanchez-Ferandin, S., Eyre-Walker, A., Piganeau, G., 2013.
Organellar inheritance in the green lineage: insights from Ostreococcus tauri.
Genome Biol. Evol. 5, 1503–1511.
Blanc-Mathieu, R., Verhelst, B., Derelle, E., Rombauts, S., Bouget, F.-Y., Carré, I.,
Château, A., Eyre-Walker, A., Grimsley, N., Moreau, H., Piégu, B., Rivals, E.,
Schackwitz, W., Van de Peer, Y., Piganeau, G., 2014. An improved genome
of the model marine alga Ostreococcus tauri unfolds by assessing Illumina de
novo assemblies. BMC Genomics 15, 1103.
184
Boetzer, M., Henkel, C.V., Jansen, H.J., Butler, D., Pirovano, W., 2011. Scaffolding
pre-assembled contigs using SSPACE. Bioinformatics 27, 578–579.
Bousquet, J., Strauss, S.H., Doerksen, A.H., Price, R.A., 1992. Extensive variation in
evolutionary rate of rbcL gene sequences among seed plants. Proc. Natl.
Acad. Sci. U. S. A. 89, 7844–7848.
Bowler, C., Allen, A.E., Badger, J.H., Grimwood, J., Jabbari, K et al., 2008. The
Phaeodactylum genome reveals the evolutionary history of diatom genomes.
Nature 456, 239–244.
Boyd, P., Newton, P., 1995. Evidence of the potential influence of planktonic
community structure on the interannual variability of particulate organic
carbon flux. Deep Sea Res. Part Oceanogr. Res. Pap. 42, 619–639.
Boyd, P.W., Newton, P.P., 1999. Does planktonic community structure determine
downward particulate organic carbon flux in different oceanic provinces?
Deep Sea Res. Part Oceanogr. Res. Pap. 46, 63–91.
Brennan, L., Owende, P., 2010. Biofuels from microalgae-A review of technologies
for production, processing, and extractions of biofuels and co-products.
Renew. Sustain. Energy Rev. 14, 557–577.
Brito, P.H., Guilherme, E., Soares, H., Gordo, I., 2010. Mutation accumulation in
Tetrahymena. BMC Evol. Biol. 10, 354.
Britten, R.J., 1986. Rates of DNA sequence evolution differ between taxonomic
groups. Science 231, 1393–1398.
Bromham, L., 2009. Why do species vary in their rate of molecular evolution? Biol.
Lett. 5, 401–404.
Bromham, L., Penny, D., 2003. The modern molecular clock. Nat. Rev. Genet. 4,
216–224.
Bromham, L., Rambaut, A., Harvey, P.H., 1996. Determinants of rate variation in
mammalian DNA sequence evolution. J. Mol. Evol. 43, 610–621.
Buesseler, K.O., 1998. The decoupling of production and particulate export in the
surface ocean. Glob. Biogeochem. Cycles 12, 297–310.
Cao, H., Butler, K., Hossain, M., Lewis, J.D., 2014. Variation in the fitness effects of
mutations with population density and size in Escherichia coli. PloS One 9,
e105369.
Cao, J., Schneeberger, K., Ossowski, S., Günther, T., Bender, S., Fitz, J., Koenig,
D., Lanz, C., Stegle, O., Lippert, C., Wang, X., Ott, F., Müller, J., Alonso-
185
Blanco, C., Borgwardt, K., Schmid, K.J., Weigel, D., 2011. Whole-genome
sequencing of multiple Arabidopsis thaliana populations. Nat. Genet. 43, 956–
963.
Carreras, C.W., Pieper, R., Khosla, C., 1997. The chemistry and biology of fatty acid,
polyketide, and nonribosomal peptide biosynthesis 85–126.
Carroll, S.P., Jørgensen, P.S., Kinnison, M.T., Bergstrom, C.T., Denison, R.F.,
Gluckman, P., Smith, T.B., Strauss, S.Y., Tabashnik, B.E., 2014. Applying
evolutionary biology to address global challenges. Science 346, 1245993.
Cazzaniga, S., Dall’Osto, L., Szaub, J., Scibilia, L., Ballottari, M., Purton, S., Bassi,
R., 2014. Domestication of the green alga Chlorella sorokiniana: reduction of
antenna size improves light-use efficiency in a photobioreactor. Biotechnol.
Biofuels 7, 157.
Chang, S.-M., Shaw, R.G., 2003. The contribution of spontaneous mutation to
variation in environmental response in Arabidopsis thaliana: responses to
nutrients. Evol. Int. J. Org. Evol. 57, 984–994.
Charlesworth, B., 2009. Effective population size and patterns of molecular evolution
and variation. Nat. Rev. Genet. 10, 195–205.
Charlesworth, B., Charlesworth, D., 1998. Some evolutionary consequences of
deleterious mutations. Genetica 102–103, 3–19.
Charlesworth, B., Charlesworth, D., Morgan, M.T., 1990. Genetic loads and
estimates of mutation rates in highly inbred plant populations. Nature 347,
380–382.
Chen, C.-L., Rappailles, A., Duquenne, L., Huvet, M., Guilbaud, G., Farinelli, L.,
Audit, B., d’Aubenton-Carafa, Y., Arneodo, A., Hyrien, O., Thermes, C., 2010.
Impact of replication timing on non-CpG and CpG substitution rates in
mammalian genomes. Genome Res. 20, 447–457.
Chen, J.-M., Cooper, D.N., Chuzhanova, N., Férec, C., Patrinos, G.P., 2007. Gene
conversion: mechanisms, evolution and human disease. Nat. Rev. Genet. 8,
762–775.
Chen, T.-Y., Lin, H.-Y., Lin, C.-C., Lu, C.-K., Chen, Y.-M., 2012. Picochlorum as an
alternative to Nannochloropsis for grouper larval rearing. Aquaculture 338–
341, 82–88.
Chen, X., Zhang, J., 2013. No Gene-Specific Optimization of Mutation Rate in
Escherichia coli. Mol. Biol. Evol. 30, 1559–1562.
186
Chevin, L.-M., 2011. On measuring selection in experimental evolution. Biol. Lett. 7,
210–213.
Chin, C.-S., Alexander, D.H., Marks, P., Klammer, A.A., Drake, J., Heiner, C., Clum,
A., Copeland, A., Huddleston, J., Eichler, E.E., Turner, S.W., Korlach, J.,
2013. Nonhybrid, finished microbial genome assemblies from long-read
SMRT sequencing data. Nat. Methods 10, 563–569.
Chisti, Y., 2007. Biodiesel from microalgae. Biotechnol. Adv. 25, 294–306.
Cingolani, P., Platts, A., Wang, L.L., Coon, M., Nguyen, T., Wang, L., Land, S.J., Lu,
X., Ruden, D.M., 2012. A program for annotating and predicting the effects of
single nucleotide polymorphisms, SnpEff. Fly (Austin) 6, 80–92.
Cohen, N.M., Kenigsberg, E., Tanay, A., 2011. Primate CpG Islands Are Maintained
by Heterogeneous Evolutionary Regimes Involving Minimal Selection. Cell
145, 773–786.
Cole, J.J., 1982. Interactions Between Bacteria and Algae in Aquatic Ecosystems.
Annu. Rev. Ecol. Syst. 13, 291–314.
Collins, S., Rost, B., Rynearson, T.A., 2014. Evolutionary potential of marine
phytoplankton under ocean acidification. Evol. Appl. 7, 140–155.
Conrad, DF., Keebler, JE., DePristo, MA., Lindsay, SJ., Zhang, Y et al., 2011. Variation in genome-wide mutation rates within and between human families. Nat Genet. 43(7): 712–714. Consortium, T. 1000 G.P., 2010. A map of human genome variation from population-
scale sequencing. Nature 467, 1061–1073.
Consortium, T.C.S. and A., 2005. Initial sequence of the chimpanzee genome and
comparison with the human genome. Nature 437, 69–87.
Cooke, M.S., Evans, M.D., Dizdaroglu, M., Lunec, J., 2003. Oxidative DNA damage:
mechanisms, mutation, and disease. FASEB J. Off. Publ. Fed. Am. Soc. Exp.
Biol. 17, 1195–1214.
Couce, A., Guelfo, J.R., Blázquez, J., 2013. Mutational spectrum drives the rise of
mutator bacteria. PLoS Genet. 9, e1003167.
Coulondre, C., Miller, J.H., Farabaugh, P.J., Gilbert, W., 1978. Molecular basis of
base substitution hotspots in Escherichia coli. Nature 274, 775–780.
Courties, C., Vaquer, A., Troussellier, M., Lautier, J., Chrétiennot-Dinet, M.J.,
Neveux, J., Machado, C., Claustre, H., 1994. Smallest eukaryotic organism.
Nature 370, 255–255.
187
Cowin, P.A., Anglesio, M., Etemadmoghadam, D., Bowtell, D.D.L., 2010. Profiling
the Cancer Genome. Annu. Rev. Genomics Hum. Genet. 11, 133–159.
Croft, M.T., Lawrence, A.D., Raux-Deery, E., Warren, M.J., Smith, A.G., 2005. Algae
acquire vitamin B12 through a symbiotic relationship with bacteria. Nature
438, 90–93.
Crow, J.F., Abrahamson, S., 1997. Seventy Years Ago: Mutation Becomes
Experimental. Genetics 147, 1491–1496.
Cutter, A.D., 2006. Nucleotide polymorphism and linkage disequilibrium in wild
populations of the partial selfer Caenorhabditis elegans. Genetics 172, 171–
184.
Cutter, A.D., Félix, M.-A., Barrière, A., Charlesworth, D., 2006. Patterns of
Nucleotide Polymorphism Distinguish Temperate and Tropical Wild Isolates of
Caenorhabditis briggsae. Genetics 173, 2021–2031.
Dassey, A.J., Theegala, C.S., 2013. Reducing electrocoagulation harvesting costs
for practical microalgal biodiesel production. Environ. Technol. 35, 691–697.
Davies, E.K., Peters, A.D., Keightley, P.D., 1999. High Frequency of Cryptic
Deleterious Mutations in Caenorhabditis elegans. Science 1748.
De Clerck, O., Bogaert, K.A., Leliaert, F., 2012. Diversity and Evolution of Algae:
Primary Endosymbiosis. Adv. Bot. Res. 64, 55–86.
de la Vega, M., Díaz, E., Vila, M., León, R., 2011. Isolation of a new strain of
Picochlorum sp and characterization of its potential biotechnological
applications. Biotechnol. Prog. 27, 1535–1543.
De Vargas, C., Audic, S., Henry, N., Decelle, J., Mahé, F et al., 2015. Ocean
plankton. Eukaryotic plankton diversity in the sunlit ocean. Science 348,
1261605.
Demir-Hilton, E., Sudek, S., Cuvelier, M.L., Gentemann, C.L., Zehr, J.P., Worden,
A.Z., 2011. Global distribution patterns of distinct clades of the photosynthetic
picoeukaryote Ostreococcus. ISME J. 5, 1095–1107.
Deng, H.-W., Gao, G., Li, J.-L., 2002. Estimation of deleterious genomic mutation
parameters in natural populations by accounting for variable mutation effects
across loci. Genetics 162, 1487–1500.
Deng, H.W., Lynch, M., 1997. Inbreeding depression and inferred deleterious-
mutation parameters in Daphnia. Genetics 147, 147–155.
188
Deng, H.W., Lynch, M., 1996. Estimation of Deleterious-Mutation Parameters in
Natural Populations. Genetics 144, 349–360.
Denver, D.R., Dolan, P.C., Wilhelm, L.J., Sung, W., Lucas-Lledó, J.I., Howe, D.K.,
Lewis, S.C., Okamoto, K., Thomas, W.K., Lynch, M., Baer, C.F., 2009. A
genome-wide view of Caenorhabditis elegans base-substitution mutation
processes. Proc. Natl. Acad. Sci. U. S. A. 106, 16310–16314.
Denver, D.R., Feinberg, S., Estes, S., Thomas, W.K., Lynch, M., 2005. Mutation
Rates, Spectra and Hotspots in Mismatch Repair-Deficient Caenorhabditis
elegans. Genetics 170, 107–113.
Denver, D.R., Morris, K., Lynch, M., Thomas, W.K., 2004. High mutation rate and
predominance of insertions in the Caenorhabditis elegans nuclear genome.
Nature 430, 679–682.
Denver, D.R., Morris, K., Lynch, M., Vassilieva, L.L., Thomas, W.K., 2000. High
direct estimate of the mutation rate in the mitochondrial genome of
Caenorhabditis elegans. Science 289, 2342–2344.
Denver, D.R., Wilhelm, L.J., Howe, D.K., Gafner, K., Dolan, P.C., Baer, C.F., 2012.
Variation in base-substitution mutation in experimental and natural lineages of
Caenorhabditis nematodes. Genome Biol. Evol. 4, 513–522.
DePristo, M.A., Banks, E., Poplin, R., Garimella, K.V., Maguire, J.R., Hartl, C.,
Philippakis, A.A., del Angel, G., Rivas, M.A., Hanna, M., McKenna, A.,
Fennell, T.J., Kernytsky, A.M., Sivachenko, A.Y., Cibulskis, K., Gabriel, S.B.,
Altshuler, D., Daly, M.J., 2011. A framework for variation discovery and
genotyping using next-generation DNA sequencing data. Nat. Genet. 43,
491–498.
Derelle, E., Ferraz, C., Escande, M.-L., Eychenié, S., Cooke, R., Piganeau, G.,
Desdevises, Y., Bellec, L., Moreau, H., Grimsley, N., 2008. Life-cycle and
genome of OtV5, a large DNA virus of the pelagic marine unicellular green
alga Ostreococcus tauri. PloS One 3, e2250.
Derelle, E., Ferraz, C., Rombauts, S., Rouzé, P., Worden, A.Z et al., 2006. Genome
analysis of the smallest free-living eukaryote Ostreococcus tauri unveils many
unique features. Proc. Natl. Acad. Sci. U. S. A. 103, 11647–11652.
Dettman, J.R., Sztepanacz, J.L., Kassen, R., 2016. The properties of spontaneous
mutations in the opportunistic pathogen Pseudomonas aeruginosa. BMC
Genomics 17.
189
Dillon, M.M., Sung, W., Lynch, M., Cooper, V.S., 2015. The Rate and Molecular
Spectrum of Spontaneous Mutations in the GC-Rich Multi-Chromosome
Genome of Burkholderia cenocepacia. Genetics.
Ding, J., McConechy, M.K., Horlings, H.M., Ha, G., Chun Chan, F., Funnell, T.,
Mullaly, S.C., Reimand, J., Bashashati, A., Bader, G.D., Huntsman, D.,
Aparicio, S., Condon, A., Shah, S.P., 2015. Systematic analysis of somatic
mutations impacting gene expression in 12 tumour types. Nat. Commun. 6,
8554.
Dizdaroglu, M., 1992. Oxidative damage to DNA in mammalian chromatin. Mutat.
Res. 275, 331–342.
Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P.,
Chaisson, M., Gingeras, T.R., 2013. STAR: ultrafast universal RNA-seq
aligner. Bioinforma. Oxf. Engl. 29, 15–21.
Drake, J.W., 1991. A constant rate of spontaneous mutation in DNA-based
microbes. Proc. Natl. Acad. Sci. U. S. A. 88, 7160–7164.
Drake, J.W., Charlesworth, B., Charlesworth, D., Crow, J.F., 1998. Rates of
spontaneous mutation. Genetics 148, 1667–1686.
Duret, L., Arndt, P.F., 2008. The Impact of Recombination on Nucleotide
Substitutions in the Human Genome. PLOS Genet 4, e1000071.
Duret, L., Galtier, N., 2009. Biased Gene Conversion and the Evolution of
Mammalian Genomic Landscapes. Annu. Rev. Genomics Hum. Genet. 10,
285–311.
Ebersberger, I., Metzler, D., Schwarz, C., Pääbo, S., 2002. Genomewide
Comparison of DNA Sequences between Humans and Chimpanzees. Am. J.
Hum. Genet. 70, 1490–1497.
Edwards, A.W.F., 2000. The Genetical Theory of Natural Selection. Genetics 154,
1419–1426.
Elango, N., Kim, S.-H., Vigoda, E., Yi, S.V., 2008. Mutations of different molecular
origins exhibit contrasting patterns of regional substitution rate variation. PLoS
Comput. Biol. 4, e1000015.
Elena, S.F., de Visser, J.A.G., 2003. Environmental stress and the effects of
mutation. J. Biol. 2, 12.
Elena, S.F., Lenski, R.E., 2003. Evolution experiments with microorganisms: the
dynamics and genetic bases of adaptation. Nat. Rev. Genet. 4, 457–469.
190
Ellegren, H., Galtier, N., 2016. Determinants of genetic diversity. Nat. Rev. Genet.
17, 422–433.
Estes, S., Phillips, P.C., Denver, D.R., Thomas, W.K., Lynch, M., 2004. Mutation
Accumulation in Populations of Varying Size: The Distribution of Mutational
Effects for Fitness Correlates in Caenorhabditis elegans. Genetics 166, 1269–
1279.
Eyre-Walker, A., Bulmer, M., 1995. Synonymous substitution rates in enterobacteria.
Genetics 140, 1407–1412.
Eyre-Walker, A., Keightley, P.D., 2007. The distribution of fitness effects of new
mutations. Nat. Rev. Genet. 8, 610–618.
Eyre-Walker, A., Keightley, P.D., Smith, N.G.C., Gaffney, D., 2002. Quantifying the
Slightly Deleterious Mutation Model of Molecular Evolution. Mol. Biol. Evol.
19, 2142–2149.
Farlow, A., Long, H., Arnoux, S., Sung, W., Doak, T.G., Nordborg, M., Lynch, M.,
2015. The Spontaneous Mutation Rate in the Fission Yeast
Schizosaccharomyces pombe. Genetics genetics.115.177329.
Fernández, J., López-Fanjul, C., 1996. Spontaneous mutational variances and
covariances for fitness-related traits in Drosophila melanogaster. Genetics
143, 829–837.
Field, null, Behrenfeld, null, Randerson, null, Falkowski, null, 1998. Primary
production of the biosphere: integrating terrestrial and oceanic components.
Science 281, 237–240.
Fijalkowska, I.J., Jonczyk, P., Tkaczyk, M.M., Bialoskorska, M., Schaaper, R.M.,
1998. Unequal fidelity of leading strand and lagging strand DNA replication on
the Escherichia coli chromosome. Proc. Natl. Acad. Sci. U. S. A. 95, 10020–
10025.
Foflonker, F., Ananyev, G., Qiu, H., Morrison, A., Palenik, B., Dismukes, G.C.,
Bhattacharya, D., 2016. The unexpected extremophile: Tolerance to
fluctuating salinity in the green alga Picochlorum. Algal Res. 16, 465–472.
Foflonker, F., Price, D.C., Qiu, H., Palenik, B., Wang, S., Bhattacharya, D., 2015.
Genome of the halotolerant green alga Picochlorum sp. reveals strategies for
thriving under fluctuating environmental conditions. Environ. Microbiol. 17,
412–426.
191
Ford, C.B., Lin, P.L., Chase, M.R., Shah, R.R., Iartchouk, O., Galagan, J.,
Mohaideen, N., Ioerger, T.R., Sacchettini, J.C., Lipsitch, M., Flynn, J.L.,
Fortune, S.M., 2011. Use of whole genome sequencing to estimate the
mutation rate of Mycobacterium tuberculosis during latent infection. Nat.
Genet. 43, 482–486.
Foster, P.L., Hanson, A.J., Lee, H., Popodi, E.M., Tang, H., 2013. On the mutational
topology of the bacterial genome. G3 Bethesda Md 3, 399–407.
Foster, P.L., Lee, H., Popodi, E., Townes, J.P., Tang, H., 2015. Determinants of
spontaneous mutation in the bacterium Escherichia coli as revealed by whole-
genome sequencing. Proc. Natl. Acad. Sci. U. S. A. 112, E5990-5999.
Friedl, T., 1995. Inferring Taxonomic Positions and Testing Genus Level
Assignments in Coccoid Green Lichen Algae: A Phylogenetic Analysis of 18s
Ribosomal Rna Sequences from Dictyochloropsis Reticulata and from
Members of the Genus Myrmecia (chlorophyta, Trebouxiophyceae Cl. Nov.)1.
J. Phycol. 31, 632–639.
Friedl, T., Rybalka, N., 2012. Systematics of the Green Algae: A Brief Introduction to
the Current Status. Prog. Bot. 73 259.
Fry, J.D., 2004. On the rate and linearity of viability declines in Drosophila mutation-
accumulation experiments: genomic mutation rates and synergistic epistasis
revisited. Genetics 166, 797–806.
Fry, J.D., 2001. Rapid mutational declines of viability in Drosophila. Genet. Res. 77,
53–60.
Fry, J.D., Heinsohn, S.L., 2002. Environment dependence of mutational parameters
for viability in Drosophila melanogaster. Genetics 161, 1155–1167.
Fry, J.D., Heinsohn, S.L., Mackay, T.F.C., 1996. The Contribution of New Mutations
to Genotype-Environment Interaction for Fitness in Drosophila melanogaster.
Evolution 50, 2316–2327.
Fry, J.D., Keightley, P.D., Heinsohn, S.L., Nuzhdin, S.V., 1999. New estimates of the
rates and effects of mildly deleterious mutation in Drosophila melanogaster.
Proc. Natl. Acad. Sci. U. S. A. 96, 574–579.
Fryxell, K.J., Zuckerkandl, E., 2000. Cytosine deamination plays a primary role in the
evolution of mammalian isochores. Mol. Biol. Evol. 17, 1371–1383.
192
Fukui, K., Fukui, K., 2010. DNA Mismatch Repair in Eukaryotes and Bacteria, DNA
Mismatch Repair in Eukaryotes and Bacteria. J. Nucleic Acids J. Nucleic
Acids 2010, 2010, e260512.
Galtier, N., Piganeau, G., Mouchiroud, D., Duret, L., 2001. GC-content evolution in
mammalian genomes: the biased gene conversion hypothesis. Genetics 159,
907–911.
Gao, C., Wang, Y., Shen, Y., Yan, D., He, X., Dai, J., Wu, Q., 2014. Oil accumulation
mechanisms of the oleaginous microalga Chlorella protothecoides revealed
through its genome, transcriptomes, and proteomes. BMC Genomics 15, 582.
Gao, Z., Wyman, M.J., Sella, G., Przeworski, M., 2016. Interpreting the Dependence
of Mutation Rates on Age and Time. PLoS Biol. 14, e1002355.
Garzon-Sanabria, A.J., Davis, R.T., Nikolov, Z.L., 2012. Harvesting Nannochloris
oculata by inorganic electrolyte flocculation: effect of initial cell density, ionic
strength, coagulant dosage, and media pH. Bioresour. Technol. 118, 418–
424.
Gavrilets, S., 1997. Evolution and speciation on holey adaptive landscapes. Trends
Ecol. Evol. 12, 307–312.
Gerken, H.G., Donohoe, B., Knoshaug, E.P., 2013. Enzymatic cell wall degradation
of Chlorella vulgaris and other microalgae for biofuels production. Planta 237,
239–253.
Gillman, L.N., Keeling, D.J., Gardner, R.C., Wright, S.D., 2010. Faster evolution of
highly conserved DNA in tropical plants. J. Evol. Biol. 23, 1327–1330.
Giraud, A., Matic, I., Tenaillon, O., Clara, A., Radman, M., Fons, M., Taddei, F.,
2001. Costs and benefits of high mutation rates: adaptive evolution of bacteria
in the mouse gut. Science 291, 2606–2608.
Glémin, S., 2010. Surprising Fitness Consequences of GC-Biased Gene Conversion:
I. Mutation Load and Inbreeding Depression. Genetics 185, 939–959.
Glémin, S., Arndt, P.F., Messer, P.W., Petrov, D., Galtier, N., Duret, L., 2015.
Quantification of GC-biased gene conversion in the human genome. Genome
Res.
Gojobori, T., Li, W.-H., Graur, D., n.d. Patterns of nucleotide substitution in
pseudogenes and functional genes. J. Mol. Evol. 18, 360–369.
193
Gossmann, T.I., Keightley, P.D., Eyre-Walker, A., 2012. The Effect of Variation in the
Effective Population Size on the Rate of Adaptive Molecular Evolution in
Eukaryotes. Genome Biol. Evol. 4, 658–667.
Grimsley, N., Péquin, B., Bachy, C., Moreau, H., Piganeau, G., 2010. Cryptic sex in
the smallest eukaryotic marine green alga. Mol. Biol. Evol. 27, 47–54.
Guillard, R.R.L., Hargraves, P.E., 1993. Stichochrysis immobilis is a diatom, not a
chrysophyte. Phycologia 32, 234–236.
Haag-Liautard, C., Coffey, N., Houle, D., Lynch, M., Charlesworth, B., Keightley,
P.D., 2008. Direct estimation of the mitochondrial DNA mutation rate in
Drosophila melanogaster. PLoS Biol. 6, e204.
Haag-Liautard, C., Dorris, M., Maside, X., Macaskill, S., Halligan, D.L., Houle, D.,
Charlesworth, B., Keightley, P.D., 2007. Direct estimation of per nucleotide
and genomic deleterious mutation rates in Drosophila. Nature 445, 82–85.
Haldane, J.B.S., 1949. The Rate of Mutation of Human Genes. Hereditas 35, 267–
273.
Haldane, J.B.S., 1937. The Effect of Variation of Fitness. Am. Nat. 71, 337–349.
Hall, D.W., Fox, S., Kuzdzal-Fick, J.J., Strassmann, J.E., Queller, D.C., 2013. The
Rate and Effects of Spontaneous Mutation on Fitness Traits in the Social
Amoeba, Dictyostelium discoideum. G3 GenesGenomesGenetics 3, 1115–
1127.
Hall, D.W., Mahmoudizad, R., Hurd, A.W., Joseph, S.B., 2008. Spontaneous
mutations in diploid Saccharomyces cerevisiae: another thousand cell
generations. Genet. Res. 90, 229–241.
Halligan, D.L., Keightley, P.D., 2009. Spontaneous Mutation Accumulation Studies in
Evolutionary Genetics. Annu. Rev. Ecol. Evol. Syst. 40, 151–172.
Hanawalt, P.C., Spivak, G., 2008. Transcription-coupled DNA repair: two decades of
progress and surprises. Nat. Rev. Mol. Cell Biol. 9, 958–970.
Hannon, M., Gimpel, J., Tran, M., Rasala, B., Mayfield, S., 2010. Biofuels from
algae: challenges and potential. Biofuels 1, 763–784.
Harrison, R.J., Charlesworth, B., 2011. Biased Gene Conversion Affects Patterns of
Codon Usage and Amino Acid Usage in the Saccharomyces sensu stricto
Group of Yeasts. Mol. Biol. Evol. 28, 117–129.
Henley, W.J., Hironaka, J.L., Guillou, L., Buchheim, M.A., Buchheim, J.A., Fawley,
M.W., Fawley, K.P., 2004. Phylogenetic analysis of the “Nannochloris-like”
194
algae and diagnoses of Picochlorum oklahomensis gen. et sp. nov.
(Trebouxiophyceae, Chlorophyta). Phycologia 43, 641–652.
Henley, W.J., Major, K.M., Hironaka, J.L., 2002. Response to Salinity and Heat
Stress in Two Halotolerant Chlorophyte Algae1. J. Phycol. 38, 757–766.
Henry, L., Schwander, T., Crespi, B.J., 2012. Deleterious Mutation Accumulation in
Asexual Timema Stick Insects. Mol. Biol. Evol. 29, 401–408.
Hermisson, J., Pennings, P.S., 2005. Soft Sweeps Molecular Population Genetics of
Adaptation From Standing Genetic Variation. Genetics 169, 2335–2352.
Hershberg, R., Petrov, D.A., 2010. Evidence That Mutation Is Universally Biased
towards AT in Bacteria. PLoS Genet 6, e1001115.
Hestand, M.S., Houdt, J.V., Cristofoli, F., Vermeesch, J.R., 2016. Polymerase
specific error rates and profiles identified by single molecule sequencing.
Mutat. Res. Mol. Mech. Mutagen. 784–785, 39–45.
Higgins, K., Lynch, M., 2001. Metapopulation extinction caused by mutation
accumulation. Proc. Natl. Acad. Sci. U. S. A. 98, 2928–2933.
Hildebrand, F., Meyer, A., Eyre-Walker, A., 2010. Evidence of Selection upon
Genomic GC-Content in Bacteria. PLoS Genet. 6.
Hodgkinson, A., Eyre-Walker, A., 2011. Variation in the mutation rate across
mammalian genomes. Nat. Rev. Genet. 12, 756–766.
Hold, G.L., Smith, E.A., Rappé, M.S., Maas, E.W., Moore, E.R.., Stroempl, C.,
Stephen, J.R., Prosser, J.I., Birkbeck, T.H., Gallacher, S., 2001.
Characterisation of bacterial communities associated with toxic and non-toxic
dinoflagellates: Alexandrium spp. and Scrippsiella trochoidea. FEMS
Microbiol. Ecol. 37, 161–173.
Hopwood, D.A., 1997. Genetic Contributions to Understanding Polyketide
Synthases. Chem. Rev. 97, 2465–2498.
Houle, D., 1992. Comparing Evolvability and Variability of Quantitative Traits.
Genetics 130, 195–204.
Houle, D., Hoffmaster, D.K., Assimacopoulos, S., Charlesworth, B., 1992. The
genomic mutation rate for fitness in Drosophila. Nature 359, 58–60.
Hubscher, U., Maga, G., Spadari, S., 2002. Eukaryotic DNA polymerases. Annu.
Rev. Biochem. 71, 133–163.
Hudson, R.E., Bergthorsson, U., Roth, J.R., Ochman, H., 2002. Effect of
chromosome location on bacterial mutation rates. Mol. Biol. Evol. 19, 85–92.
195
Huey, R.B., Gilchrist, G.W., Ward, K., Maves, L., Pepin, D., Houle, D., 2003.
Mutation Accumulation, Performance, Fitness. Integr. Comp. Biol. 43, 387–
395.
Hurst, L.D., Williams, E.J., 2000. Covariation of GC content and the silent site
substitution rate in rodents: implications for methodology and for the evolution
of isochores. Gene 261, 107–114.
Ikemura, T., 1981. Correlation between the abundance of Escherichia coli transfer
RNAs and the occurrence of the respective codons in its protein genes: a
proposal for a synonymous codon choice that is optimal for the E. coli
translational system. J. Mol. Biol. 151, 389–409.
Jancek, S., Gourbière, S., Moreau, H., Piganeau, G., 2008. Clues about the genetic
basis of adaptation emerge from comparing the proteomes of two
Ostreococcus ecotypes (Chlorophyta, Prasinophyceae). Mol. Biol. Evol. 25,
2293–2300.
Jardillier, L., Zubkov, M.V., Pearman, J., Scanlan, D.J., 2010. Significant CO2
fixation by small prymnesiophytes in the subtropical and tropical northeast
Atlantic Ocean. ISME J. 4, 1180–1192.
Jiang, C., Mithani, A., Belfield, E.J., Mott, R., Hurst, L.D., Harberd, N.P., 2014.
Environmentally responsive genome-wide accumulation of de novo
Arabidopsis thaliana mutations and epimutations. Genome Res. 24, 1821–
1829.
Jiricny, J., 2006. The multifaceted mismatch-repair system. Nat. Rev. Mol. Cell Biol.
7, 335–346.
Jones, P.A., 2012. Functions of DNA methylation: islands, start sites, gene bodies
and beyond. Nat. Rev. Genet. 13, 484–492.
Joseph, S.B., Hall, D.W., 2004. Spontaneous Mutations in Diploid Saccharomyces
cerevisiae. Genetics 168, 1817–1825.
Kaity, A., Ashmore, S.E., Drew, R.A., Dulloo, M.E., 2008. Assessment of genetic and
epigenetic changes following cryopreservation in papaya. Plant Cell Rep. 27,
1529–1539.
Katju, V., Packard, L.B., Bu, L., Keightley, P.D., Bergthorsson, U., 2014. Fitness
decline in spontaneous mutation accumulation lines of Caenorhabditis
elegans with varying effective population sizes. Evol. Int. J. Org. Evol.
196
Kavanaugh, C.M., Shaw, R.G., 2005. The contribution of spontaneous mutation to
variation in environmental responses of Arabidopsis thaliana: responses to
light. Evol. Int. J. Org. Evol. 59, 266–275.
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S.,
Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B.,
Meintjes, P., Drummond, A., 2012. Geneious Basic: an integrated and
extendable desktop software platform for the organization and analysis of
sequence data. Bioinforma. Oxf. Engl. 28, 1647–1649.
Keightley, P.D., 1994. The Distribution of Mutation Effects on Viability in Drosophila
melanogaster. Genetics 138, 1315–1322.
Keightley, P.D., Bataillon, T.M., 2000. Multigeneration maximum-likelihood analysis
applied to mutation-accumulation experiments in Caenorhabditis elegans.
Genetics 154, 1193–1201.
Keightley, P.D., Caballero, A., 1997. Genomic mutation rates for lifetime reproductive
output and lifespan in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A.
94, 3823–3827.
Keightley, P.D., Eyre-Walker, A., 1999. Terumi Mukai and the Riddle of Deleterious
Mutation Rates. Genetics 153, 515–523.
Keightley, P.D., Ness, R.W., Halligan, D.L., Haddrill, P.R., 2014a. Estimation of the
spontaneous mutation rate per nucleotide site in a Drosophila melanogaster
full-sib family. Genetics 196, 313–320.
Keightley, P.D., Pinharanda, A., Ness, R.W., Simpson, F., Dasmahapatra, K.K.,
Mallet, J., Davey, J.W., Jiggins, C.D., 2014b. Estimation of the spontaneous
mutation rate in Heliconius melpomene. Mol. Biol. Evol.
Keightley, P.D., Trivedi, U., Thomson, M., Oliver, F., Kumar, S., Blaxter, M.L., 2009.
Analysis of the genome sequences of three Drosophila melanogaster
spontaneous mutation accumulation lines. Genome Res. 19, 1195–1201.
Kibota, T.T., Lynch, M., 1996. Estimate of the genomic mutation rate deleterious to
overall fitness in E. coll. Nature 381, 694–696.
Kim, N., Jinks-Robertson, S., 2012. Transcription as a source of genome instability.
Nat. Rev. Genet. 13, 204–214.
Kimura, M., 1991. The neutral theory of molecular evolution: a review of recent
evidence. Idengaku Zasshi 66, 367–386.
197
Kimura, M., 1987. Molecular evolutionary clock and the neutral theory. J. Mol. Evol.
26, 24–33.
Kimura, M., 1968. Evolutionary rate at the molecular level. Nature 217, 624–626.
Kishony, R., Leibler, S., 2003. Environmental stresses can alleviate the average
deleterious effect of mutations. J. Biol. 2, 14.
Klapacz, J., Bhagwat, A.S., 2002. Transcription-dependent increase in multiple
classes of base substitution mutations in Escherichia coli. J. Bacteriol. 184,
6866–6872.
Knudson, A.G., 2000. Chasing the Cancer Demon. Annu. Rev. Genet. 34, 1–19.
Kondrashov, A.S., 1995. Contamination of the genome by very slightly deleterious
mutations: why have we not died 100 times over? J. Theor. Biol. 175, 583–
594.
Kondrashov, A.S., 1988. Deleterious mutations and the evolution of sexual
reproduction. Nature 336, 435–440.
Kondrashov, A.S., Houle, D., 1994. Genotype-environment interactions and the
estimation of the genomic mutation rate in Drosophila melanogaster. Proc.
Biol. Sci. 258, 221–227.
Korona, R., 1999. Genetic Load of the Yeast Saccharomyces cerevisiae under
Diverse Environmental Conditions. Evolution 53, 1966–1971.
Kraemer, S.A., Morgan, A.D., Ness, R.W., Keightley, P.D., Colegrave, N., 2015.
Fitness effects of new mutations in Chlamydomonas reinhardtii across two
stress gradients. J. Evol. Biol. n/a-n/a.
Krasovec, M., Eyre-Walker, A., Grimsley, N., Salmeron, C., Pecqueur, D., Piganeau,
G., Sanchez-Ferandin, S., 2016. Fitness Effects of Spontaneous Mutations in
Picoeukaryotic Marine Green Algae. G3 GenesGenomesGenetics 6, 2063–
2071.
Kucukyildirim, S., Long, H., Sung, W., Miller, S.F., Doak, T.G., Lynch, M., 2016. The
Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis,
a Bacterium Naturally Devoid of the Post-replicative Mismatch Repair
Pathway. G3 GenesGenomesGenetics g3.116.030130.
Kunkel, T.A., Bebenek, and K., 2000. DNA Replication Fidelity. Annu. Rev.
Biochem. 69, 497–529.
Kunkel, T.A., Erie, D.A., 2015. Eukaryotic Mismatch Repair in Relation to DNA
Replication. Annu. Rev. Genet. 49, null.
198
Kuo, C.-H., Ochman, H., 2009. Deletional Bias across the Three Domains of Life.
Genome Biol. Evol. 1, 145–152.
Laird, C.D., McConaughy, B.L., McCarthy, B.J., 1969. Rate of Fixation of Nucleotide
Substitutions in Evolution. Nature 224, 149–154.
Laity, J.H., Lee, B.M., Wright, P.E., 2001. Zinc finger proteins: new insights into
structural and functional diversity. Curr. Opin. Struct. Biol. 11, 39–46.
Lande, R., 1998. Risk of population extinction from fixation of deleterious and
reverse mutations. Genetica 102–103, 21–27.
Lande, R., 1994. Risk of Population Extinction from Fixation of New Deleterious
Mutations. Evolution 48, 1460–1469.
Lande, R., 1988. Genetics and demography in biological conservation. Science 241,
1455–1460.
Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C et al., 2001. Initial
sequencing and analysis of the human genome. Nature 409, 860–921.
Lanfear, R., Kokko, H., Eyre-Walker, A., 2014. Population size and the rate of
evolution. Trends Ecol. Evol. 29, 33–41.
Lang, G.I., Murray, A.W., 2008. Estimating the per-base-pair mutation rate in the
yeast Saccharomyces cerevisiae. Genetics 178, 67–82.
Lang, G.I., Parsons, L., Gammie, A.E., 2013. Mutation rates, spectra, and genome-
wide distribution of spontaneous mutations in mismatch repair deficient yeast.
G3 Bethesda Md 3, 1453–1465.
Laroche, J., Li, P., Maggia, L., Bousquet, J., 1997. Molecular evolution of
angiosperm mitochondrial introns and exons. Proc. Natl. Acad. Sci. U. S. A.
94, 5722–5727.
Lassalle, F., Périan, S., Bataillon, T., Nesme, X., Duret, L., Daubin, V., 2015. GC-
Content Evolution in Bacterial Genomes: The Biased Gene Conversion
Hypothesis Expands. PLoS Genet 11, e1004941.
Latta, L.C., Morgan, K.K., Weaver, C.S., Allen, D., Schaack, S., Lynch, M., 2013.
Genomic background and generation time influence deleterious mutation
rates in Daphnia. Genetics 193, 539–544.
Laughlin, D.C., Messier, J., 2015. Fitness of multidimensional phenotypes in
dynamic adaptive landscapes. Trends Ecol. Evol. 30, 487–496.
199
Lee, H., Popodi, E., Tang, H., Foster, P.L., 2012. Rate and molecular spectrum of
spontaneous mutations in the bacterium Escherichia coli as determined by
whole-genome sequencing. Proc. Natl. Acad. Sci. U. S. A. 109, E2774-2783.
Leliaert, F., Smith, D.R., Moreau, H., Herron, M.D., Verbruggen, H., Delwiche, C.F.,
Clerck, O.D., 2012. Phylogeny and Molecular Evolution of the Green Algae.
Crit. Rev. Plant Sci. 31, 1–46.
Lesecque, Y., Mouchiroud, D., Duret, L., 2013. GC-Biased Gene Conversion in
Yeast Is Specifically Associated with Crossovers: Molecular Mechanisms and
Evolutionary Significance. Mol. Biol. Evol. 30, 1409–1419.
Lewis, C.A., Crayle, J., Zhou, S., Swanstrom, R., Wolfenden, R., 2016. Cytosine
deamination and the precipitous decline of spontaneous mutation during
Earth’s history. Proc. Natl. Acad. Sci. U. S. A. 113, 8194–8199.
Lewis, L.A., McCourt, R.M., 2004. Green algae and the origin of land plants. Am. J.
Bot. 91, 1535–1556.
Li, G.-M., 2008. Mechanisms and functions of DNA mismatch repair. Cell Res. 18,
85–98.
Li, H., Durbin, R., 2010. Fast and accurate long-read alignment with Burrows–
Wheeler transform. Bioinformatics 26, 589–595.
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G.,
Abecasis, G., Durbin, R., 1000 Genome Project Data Processing Subgroup,
2009. The Sequence Alignment/Map format and SAMtools. Bioinforma. Oxf.
Engl. 25, 2078–2079.
Li, J., Deng, H.-W., 2005. Estimation of the rate and effects of deleterious genomic
mutations in finite populations with linkage disequilibrium. Heredity 95, 59–68.
Li, W.K.W., 1994. Primary production of prochlorophytes, cyanobacteria, and
eucaryotic ultraphytoplankton: Measurements from flow cytometric sorting.
Limnol. Oceanogr. 39, 169–175.
Lind, P.A., Andersson, D.I., 2008. Whole-genome mutational biases in bacteria.
Proc. Natl. Acad. Sci. U. S. A. 105, 17878–17883.
Long, H., Kucukyildirim, S., Sung, W., Williams, E., Lee, H., Ackerman, M., Doak,
T.G., Tang, H., Lynch, M., 2015a. Background Mutational Features of the
Radiation-Resistant Bacterium Deinococcus radiodurans. Mol. Biol. Evol. 32,
2383–2392.
200
Long, H., Sung, W., Miller, S.F., Ackerman, M.S., Doak, T.G., Lynch, M., 2015b.
Mutation rate, spectrum, topology, and context-dependency in the DNA
mismatch repair-deficient Pseudomonas fluorescens ATCC948. Genome Biol.
Evol. 7, 262–271.
Lujan, S.A., Clausen, A.R., Clark, A.B., MacAlpine, H.K., MacAlpine, D.M., Malc,
E.P., Mieczkowski, P.A., Burkholder, A.B., Fargo, D.C., Gordenin, D.A.,
Kunkel, T.A., 2014. Heterogeneous polymerase fidelity and mismatch repair
bias genome variation and composition. Genome Res. 24, 1751–1764.
Lynch, M., 2010a. Evolution of the mutation rate. Trends Genet. TIG 26, 345–352.
Lynch, M., 2010b. Rate, molecular spectrum, and consequences of human mutation.
Proc. Natl. Acad. Sci. 107, 961–968.
Lynch, M., 2008. The Cellular, Developmental and Population-Genetic Determinants
of Mutation-Rate Evolution. Genetics 180, 933–943.
Lynch, M., Blanchard, J., Houle, D., Kibota, T., Schultz, S., Vassilieva, L., Willis, J.,
1999. Perspective: Spontaneous Deleterious Mutation. Evolution 53, 645–
663.
Lynch, M., Conery, J., Burger, R., 1995. Mutation Accumulation and the Extinction of
Small Populations. Am. Nat. 146, 489–518.
Lynch, M., Gabriel, W., 1990. Mutation Load and the Survival of Small Populations.
Evolution 44, 1725–1737.
Lynch, M., Hagner, K., 2015. Evolutionary meandering of intermolecular interactions
along the drift barrier. Proc. Natl. Acad. Sci. 112, E30–E38.
Lynch, M., Sung, W., Morris, K., Coffey, N., Landry, C.R., Dopman, E.B., Dickinson,
W.J., Okamoto, K., Kulkarni, S., Hartl, D.L., Thomas, W.K., 2008. A genome-
wide view of the spectrum of spontaneous mutations in yeast. Proc. Natl.
Acad. Sci. U. S. A. 105, 9272–9277.
Ma, X., Rogacheva, M.V., Nishant, K.T., Zanders, S., Bustamante, C.D., Alani, E.,
2012. Mutation hotspots in yeast caused by long-range clustering of
homopolymeric sequences. Cell Rep. 1, 36–42.
Maki, H., 2002. Origins of Spontaneous Mutations: Specificity and Directionality of
Base-Substitution, Frameshift, and Sequence-Substitution Mutageneses.
Annu. Rev. Genet. 36, 279–303.
201
Marin, B., Melkonian, M., 2010. Molecular phylogeny and classification of the
Mamiellophyceae class. nov. (Chlorophyta) based on sequence comparisons
of the nuclear- and plastid-encoded rRNA operons. Protist 161, 304–336.
Martin, A.P., Palumbi, S.R., 1993. Body size, metabolic rate, generation time, and
the molecular clock. Proc. Natl. Acad. Sci. U. S. A. 90, 4087–4091.
Martin, C.H., Wainwright, P.C., 2013. Multiple Fitness Peaks on the Adaptive
Landscape Drive Adaptive Radiation in the Wild. Science 339, 208–211.
Martin, G., Lenormand, T., 2006. The fitness effect of mutations across
environments: a survey in light of fitness landscape models. Evol. Int. J. Org.
Evol. 60, 2413–2427.
Martincorena, I., Luscombe, N.M., 2013. Non-random mutation: the evolution of
targeted hypermutation and hypomutation. BioEssays News Rev. Mol. Cell.
Dev. Biol. 35, 123–130.
Martincorena, I., Seshasayee, A.S.N., Luscombe, N.M., 2012. Evidence of non-
random mutation rates suggests an evolutionary risk management strategy.
Nature 485, 95–98.
Martinez, J.S., Carter-Franklin, J.N., Mann, E.L., Martin, J.D., Haygood, M.G., Butler,
A., 2003. Structure and membrane affinity of a suite of amphiphilic
siderophores produced by a marine bacterium. Proc. Natl. Acad. Sci. 100,
3754–3759.
Martinez, J.S., Zhang, G.P., Holt, P.D., Jung, H.T., Carrano, C.J., Haygood, M.G.,
Butler, A., 2000. Self-assembling amphiphilic siderophores from marine
bacteria. Science 287, 1245–1247.
Massana, R., 2011. Eukaryotic picoplankton in surface oceans. Annu. Rev.
Microbiol. 65, 91–110.
Mata, T.M., Martins, A.A., Caetano, N.S., 2010. Microalgae for biodiesel production
and other applications: A review. Renew. Sustain. Energy Rev. 14, 217–232.
Mateyak, M.K., Zakian, V.A., 2006. Human PIF helicase is cell cycle regulated and
associates with telomerase. Cell Cycle Georget. Tex 5, 2796–2804.
Matsuba, C., Ostrow, D.G., Salomon, M.P., Tolani, A., Baer, C.F., 2013.
Temperature, stress and spontaneous mutation in Caenorhabditis briggsae
and Caenorhabditis elegans. Biol. Lett. 9, 20120334.
Matuszewski, S., Hermisson, J., Kopp, M., 2014. Fisher’s geometric model with a
moving optimum. Evol. Int. J. Org. Evol. 68, 2571–2588.
202
Mittelbach, G.G., Schemske, D.W., Cornell, H.V., Allen, A.P., Brown, J.M et al.,
2007. Evolution and the latitudinal diversity gradient: speciation, extinction
and biogeography. Ecol. Lett. 10, 315–331.
Mooers, A.O., Harvey, P.H., 1994. Metabolic rate, generation time, and the rate of
molecular evolution in birds. Mol. Phylogenet. Evol. 3, 344–350.
Moreau, H., Verhelst, B., Couloux, A., Derelle, E., Rombauts, S., Grimsley, N., Van
Bel, M., Poulain, J., Katinka, M., Hohmann-Marriott, M.F., Piganeau, G.,
Rouzé, P., Da Silva, C., Wincker, P., Van de Peer, Y., Vandepoele, K., 2012.
Gene functionalities and genome structure in Bathycoccus prasinos reflect
cellular specializations at the base of the green lineage. Genome Biol. 13,
R74.
Morgan, A.D., Ness, R.W., Keightley, P.D., Colegrave, N., 2014. Spontaneous
mutation accumulation in multiple strains of the green alga, Chlamydomonas
reinhardtii. Evolution 68, 2589–2602.
Mousseau, T.A., Roff, D.A., 1987. Natural selection and the heritability of fitness
components. Heredity 59 ( Pt 2), 181–197.
Mugal, C.F., Arndt, P.F., Ellegren, H., 2013. Twisted signatures of GC-biased gene
conversion embedded in an evolutionary stable karyotype. Mol. Biol. Evol. 30,
1700–1712.
Mukai, T., 1964. The Genetic Structure of Natural Populations of Drosophila
melanogaster. I. Spontaneous Mutation Rate of Polygenes Controlling
Viability. Genetics 50, 1–19.
Muller, H.J., 1950. Our load of mutations. Am. J. Hum. Genet. 2, 111–176.
Muller, H.J., 1928. The Measurement of Gene Mutation Rate in Drosophila, Its High
Variability, and Its Dependence upon Temperature. Genetics 13, 279–357.
Muller, H.J., 1927. Artificial Transmutation of the Gene. Science 66, 84–87.
Nahum, J.R., Godfrey-Smith, P., Harding, B.N., Marcus, J.H., Carlson-Stevermer, J.,
Kerr, B., 2015. A tortoise–hare pattern seen in adapting structured and
unstructured populations suggests a rugged fitness landscape in bacteria.
Proc. Natl. Acad. Sci. 112, 7530–7535.
Neiman, M., Hehman, G., Miller, J.T., Logsdon, J.M., Taylor, D.R., 2010. Accelerated
mutation accumulation in asexual lineages of a freshwater snail. Mol. Biol.
Evol. 27, 954–963.
203
Ness, R.W., Kraemer, S.A., Colegrave, N., Keightley, P.D., 2015a. Direct estimate of
the spontaneous mutation rate uncovers the effects of drift and recombination
in the Chlamydomonas reinhardtii plastid genome. Mol. Biol. Evol.
Ness, R.W., Morgan, A.D., Colegrave, N., Keightley, P.D., Ness, R.W., Morgan,
A.D., Colegrave, N., Keightley, P.D., 2012. Estimate of the Spontaneous
Mutation Rate in Chlamydomonas reinhardtii. Genetics 192, 1447–1454.
Ness, R.W., Morgan, A.D., Vasanthakrishnan, R.B., Colegrave, N., Keightley, P.D.,
2015b. Extensive de novo mutation rate variation between individuals and
across the genome of Chlamydomonas reinhardtii. Genome Res. 25, 1739–
1749.
Not, F., Siano, R., Kooistra, W.H.C.F., Simon, N., Vaulot, D., Probert, I., 2012.
Diversity and Ecology of Eukaryotic Marine Phytoplankton. Adv. Bot. Res.
Orr, H.A., 2005. The genetic theory of adaptation: a brief history. Nat. Rev. Genet. 6,
119–127.
Ossowski, S., Schneeberger, K., Lucas-Lledó, J.I., Warthmann, N., Clark, R.M.,
Shaw, R.G., Weigel, D., Lynch, M., 2010. The rate and molecular spectrum of
spontaneous mutations in Arabidopsis thaliana. Science 327, 92–94.
Ota, S., Matsuda, T., Takeshita, T., Yamazaki, T., Kazama, Y., Abe, T., Kawano, S.,
2013. Phenotypic spectrum of Parachlorella kessleri (Chlorophyta) mutants
produced by heavy-ion irradiation. Bioresour. Technol. 149, 432–438.
Palenik, B., Grimwood, J., Aerts, A., Rouzé, P., Salamov, A et al., 2007. The tiny
eukaryote Ostreococcus provides genomic insights into the paradox of
plankton speciation. Proc. Natl. Acad. Sci. U. S. A. 104, 7705–7710.
Park, C., Qian, W., Zhang, J., 2012. Genomic evidence for elevated mutation rates in
highly expressed genes. EMBO Rep. 13, 1123–1129.
Park, S.-J., Choi, Y.-E., Kim, E.J., Park, W.-K., Kim, C.W., Yang, J.-W., 2012. Serial
optimization of biomass production using microalga Nannochloris oculata and
corresponding lipid biosynthesis. Bioprocess Biosyst. Eng. 35, 3–9.
Paul, S., Million-Weaver, S., Chattopadhyay, S., Sokurenko, E., Merrikh, H., 2013.
Accelerated gene evolution through replication-transcription conflicts. Nature
495, 512–515.
Perrineau, M.-M., Gross, J., Zelzion, E., Price, D.C., Levitan, O., Boyd, J.,
Bhattacharya, D., 2014. Using Natural Selection to Explore the Adaptive
Potential of Chlamydomonas reinhardtii. PLOS ONE 9, e92533.
204
Petren, K., 2013. The Evolution of Landscape Genetics. Evolution 67, 3383–3385.
Phifer-Rixey, M., Bonhomme, F., Boursot, P., Churchill, G.A., Piálek, J., Tucker,
P.K., Nachman, M.W., 2012. Adaptive Evolution and Effective Population Size
in Wild House Mice. Mol. Biol. Evol. 29, 2949–2955.
Piganeau, G., Eyre-Walker, A., Jancek, S., Grimsley, N., Moreau, H., 2011a. How
and why DNA barcodes underestimate the diversity of microbial eukaryotes.
PloS One 6, e16342.
Piganeau, G., Grimsley, N., Moreau, H., 2011b. Genome diversity in the smallest
marine photosynthetic eukaryotes. Res. Microbiol. 162, 570–577.
Pinter, S.F., Aubert, S.D., Zakian, V.A., 2008. The Schizosaccharomyces pombe
Pfh1p DNA helicase is essential for the maintenance of nuclear and
mitochondrial DNA. Mol. Cell. Biol. 28, 6594–6608.
Polak, P., Arndt, P.F., 2008. Transcription induces strand-specific mutations at the 5’
end of human genes. Genome Res. 18, 1216–1223.
Pombert, J.-F., Blouin, N.A., Lane, C., Boucias, D., Keeling, P.J., 2014. A lack of
parasitic reduction in the obligate parasitic green alga Helicosporidium. PLoS
Genet. 10, e1004355.
Project, the 1000 G., 2011. Variation in genome-wide mutation rates within and
between human families. Nat. Genet. 43, 712–714.
Qiu, H., Price, D.C., Weber, A.P.M., Reeb, V., Yang, E.C., Lee, J.M., Kim, S.Y.,
Yoon, H.S., Bhattacharya, D., 2013. Adaptation through horizontal gene
transfer in the cryptoendolithic red alga Galdieria phlegrea. Curr. Biol. CB 23,
R865-866.
Raymond, J.A., 2014. The ice-binding proteins of a snow alga, Chloromonas
brevispina: probable acquisition by horizontal gene transfer. Extrem. Life
Extreme Cond. 18, 987–994.
Read, B.A., Kegel, J., Klute, M.J., Kuo, A., Lefebvre, S.C et al., 2013. Pan genome
of the phytoplankton Emiliania underpins its global distribution. Nature 499,
209–213.
Rebolledo-Jaramillo, B., Su, M.S.-W., Stoler, N., McElhoe, J.A., Dickins, B.,
Blankenberg, D., Korneliussen, T.S., Chiaromonte, F., Nielsen, R., Holland,
M.M., Paul, I.M., Nekrutenko, A., Makova, K.D., 2014. Maternal age effect and
severe germ-line bottleneck in the inheritance of human mitochondrial DNA.
Proc. Natl. Acad. Sci. 111, 15474–15479.
205
Rodríguez, F., Derelle, E., Guillou, L., Le Gall, F., Vaulot, D., Moreau, H., 2005.
Ecotype diversity in the marine picoeukaryote Ostreococcus (Chlorophyta,
Prasinophyceae). Environ. Microbiol. 7, 853–859.
Rolland, J., Condamine, F.L., Jiguet, F., Morlon, H., 2014. Faster speciation and
reduced extinction in the tropics contribute to the Mammalian latitudinal
diversity gradient. PLoS Biol. 12, e1001775.
Rozen, D.E., Habets, M.G.J.L., Handel, A., de Visser, J.A.G.M., 2008.
Heterogeneous Adaptive Trajectories of Small Populations on Complex
Fitness Landscapes. PLoS ONE 3, e1715.
Rumin, J., Bonnefond, H., Saint-Jean, B., Rouxel, C., Sciandra, A., Bernard, O.,
Cadoret, J.-P., Bougaran, G., 2015. The use of fluorescent Nile red and
BODIPY for lipid measurement in microalgae. Biotechnol. Biofuels 8, 42.
Rutter, M.T., Roles, A., Conner, J.K., Shaw, R.G., Shaw, F.H., Schneeberger, K.,
Ossowski, S., Weigel, D., Fenster, C.B., 2012. Fitness of Arabidopsis thaliana
mutation accumulation lines whose spontaneous mutations are known. Evol.
Int. J. Org. Evol. 66, 2335–2339.
Salk, J.J., Fox, E.J., Loeb, L.A., 2010. Mutational Heterogeneity in Human Cancers:
Origin and Consequences. Annu. Rev. Pathol. Mech. Dis. 5, 51–75.
Saxer, G., Havlak, P., Fox, S.A., Quance, M.A., Gupta, S., Fofanov, Y., Strassmann,
J.E., Queller, D.C., 2012. Whole genome sequencing of mutation
accumulation lines reveals a low mutation rate in the social amoeba
Dictyostelium discoideum. PloS One 7, e46759.
Schaack, S., Allen, D.E., Latta, L.C., Morgan, K.K., Lynch, M., 2013. The effect of
spontaneous mutations on competitive ability. J. Evol. Biol. 26, 451–456.
Schäfer, H., Abbas, B., Witte, H., Muyzer, G., 2002. Genetic diversity of “satellite”
bacteria present in cultures of marine diatoms. FEMS Microbiol. Ecol. 42, 25–
35.
Schaum, C.E., Collins, S., 2014. Plasticity predicts evolution in a marine alga. Proc.
Biol. Sci. 281.
Schaum, C.-E., Rost, B., Collins, S., 2015. Environmental stability affects phenotypic
evolution in a globally distributed marine picoplankton. ISME J.
Scheinin, M., Riebesell, U., Rynearson, T.A., Lohbeck, K.T., Collins, S., 2015.
Experimental evolution gone wild. J. R. Soc. Interface 12, 20150056.
206
Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B.,
Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres,
B., Thallinger, G.G., Horn, D.J.V., Weber, C.F., 2009. Introducing mothur:
Open-Source, Platform-Independent, Community-Supported Software for
Describing and Comparing Microbial Communities. Appl. Environ. Microbiol.
75, 7537–7541.
Schönknecht, G., Chen, W.-H., Ternes, C.M., Barbier, G.G., Shrestha, R.P., Stanke,
M., Bräutigam, A., Baker, B.J., Banfield, J.F., Garavito, R.M., Carr, K.,
Wilkerson, C., Rensing, S.A., Gagneul, D., Dickenson, N.E., Oesterhelt, C.,
Lercher, M.J., Weber, A.P.M., 2013. Gene Transfer from Bacteria and
Archaea Facilitated Evolution of an Extremophilic Eukaryote. Science 339,
1207–1210.
Schönknecht, G., Weber, A.P.M., Lercher, M.J., 2014. Horizontal gene acquisitions
by eukaryotes as drivers of adaptive evolution. BioEssays 36, 9–20.
Schrider, D.R., Houle, D., Lynch, M., Hahn, M.W., 2013. Rates and genomic
consequences of spontaneous mutational events in Drosophila melanogaster.
Genetics 194, 937–954.
Schrider, D.R., Hourmozdi, J.N., Hahn, M.W., 2011. Pervasive multinucleotide
mutational events in eukaryotes. Curr. Biol. CB 21, 1051–1054.
Schröder, J., Schröder, G., 1990. Stilbene and chalcone synthases: related enzymes
with key functions in plant-specific pathways. Z. Für Naturforschung C J.
Biosci. 45, 1–8.
Schroeder, J.W., Hirst, W.G., Szewczyk, G.A., Simmons, L.A., 2016. The Effect of
Local Sequence Context on Mutational Bias of Genes Encoded on the
Leading and Lagging Strands. Curr. Biol. CB.
Schultz, S.T., Lynch, M., Willis, J.H., 1999. Spontaneous deleterious mutation in
Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 96, 11393–11398.
Schwartz, D.C., Cantor, C.R., 1984. Separation of yeast chromosome-sized DNAs
by pulsed field gradient gel electrophoresis. Cell 37, 67–75.
Shapiro, J.A., Huang, W., Zhang, C., Hubisz, M.J., Lu, J., Turissini, D.A., Fang, S.,
Wang, H.-Y., Hudson, R.R., Nielsen, R., Chen, Z., Wu, C.-I., 2007. Adaptive
genic evolution in the Drosophila genomes. Proc. Natl. Acad. Sci. U. S. A.
104, 2271–2276.
207
Sharp, N.P., Agrawal, A.F., 2012. Evidence for elevated mutation rates in low-quality
genotypes. Proc. Natl. Acad. Sci. U. S. A. 109, 6142–6146.
Shaw, R.G., Byers, D.L., Darmo, E., 2000. Spontaneous Mutational Effects on
Reproductive Traits of Arabidopsis thaliana. Genetics 155, 369–378.
Shor, E., Fox, C.A., Broach, J.R., 2013. The Yeast Environmental Stress Response
Regulates Mutagenesis Induced by Proteotoxic Stress. PLOS Genet 9,
e1003680.
Simpson, J.T., Durbin, R., 2012. Efficient de novo assembly of large genomes using
compressed data structures. Genome Res. 22, 549–556.
Simpson, J.T., Wong, K., Jackman, S.D., Schein, J.E., Jones, S.J.M., Birol, I., 2009.
ABySS: a parallel assembler for short read sequence data. Genome Res. 19,
1117–1123.
Šlapeta, J., López-García, P., Moreira, D., 2006. Global Dispersal and Ancient
Cryptic Species in the Smallest Marine Eukaryotes. Mol. Biol. Evol. 23, 23–29.
Smeds, L., Qvarnstrom, A., Ellegren, H., 2016. Direct estimate of the rate of germline
mutation in a bird. Genome Res.
Smith, D.R., 2015. Mutation rates in plastid genomes: they are lower than you might
think. Genome Biol. Evol. 7, 1227–1234.
Sniegowski, P.D., Gerrish, P.J., Lenski, R.E., 1997. Evolution of high mutation rates
in experimental populations of E. coli. Nature 387, 703–705.
Stamatoyannopoulos, J.A., Adzhubei, I., Thurman, R.E., Kryukov, G.V., Mirkin, S.M.,
Sunyaev, S.R., 2009. Human mutation rate associated with DNA replication
timing. Nat. Genet. 41, 393–395.
Steinberg, B., Ostermeier, M., 2016. Environmental changes bridge evolutionary
valleys. Sci. Adv. 2, e1500921.
Sterck, L., Billiau, K., Abeel, T., Rouzé, P., Van de Peer, Y., 2012. ORCAE: online
resource for community annotation of eukaryotes. Nat. Methods 9, 1041.
Subirana, L., Péquin, B., Michely, S., Escande, M.-L., Meilland, J., Derelle, E., Marin,
B., Piganeau, G., Desdevises, Y., Moreau, H., Grimsley, N.H., 2013.
Morphology, Genome Plasticity, and Phylogeny in the Genus Ostreococcus
Reveal a Cryptic Species, O. mediterraneus sp. nov. (Mamiellales,
Mamiellophyceae). Protist 164, 643–659.
Sueoka, N., 1962. On the genetic basis of variation and heterogeneity of DNA base
composition. Proc. Natl. Acad. Sci. U. S. A. 48, 582–592.
208
Sullivan, S., Petersen, J., Blackwood, L., Papanatsiou, M., Christie, J.M., 2015.
Functional characterization of Ostreococcus tauri phototropin. New Phytol.
Sung, W., Ackerman, M.S., Gout, J.-F., Miller, S.F., Williams, E., Foster, P.L., Lynch,
M., 2015. Asymmetric Context-Dependent Mutation Patterns Revealed
through Mutation–Accumulation Experiments. Mol. Biol. Evol. 32, 1672–1683.
Sung, W., Ackerman, M.S., Miller, S.F., Doak, T.G., Lynch, M., 2012a. Drift-barrier
hypothesis and mutation-rate evolution. Proc. Natl. Acad. Sci. U. S. A. 109,
18488–18492.
Sung, W., Tucker, A.E., Doak, T.G., Choi, E., Thomas, W.K., Lynch, M., 2012b.
Extraordinary genome stability in the ciliate Paramecium tetraurelia. Proc.
Natl. Acad. Sci. U. S. A. 109, 19339–19344.
Taddei, F., Radman, M., Maynard-Smith, J., Toupance, B., Gouyon, P.H., Godelle,
B., 1997. Role of mutator alleles in adaptive evolution. Nature 387, 700–702.
Tenaillon, O., Barrick, J.E., Ribeck, N., Deatherage, D.E., Blanchard, J.L., Dasgupta,
A., Wu, G.C., Wielgoss, S., Cruveiller, S., Médigue, C., Schneider, D., Lenski,
R.E., 2016. Tempo and mode of genome evolution in a 50,000-generation
experiment. Nature.
Tenaillon, O., Toupance, B., Le Nagard, H., Taddei, F., Godelle, B., 1999. Mutators,
population size, adaptive landscape and the adaptation of asexual
populations of bacteria. Genetics 152, 485–493.
Tesson, S.V.M., Legrand, C., van Oosterhout, C., Montresor, M., Kooistra, W.H.C.F.,
Procaccini, G., 2013. Mendelian inheritance pattern and high mutation rates of
microsatellite alleles in the diatom Pseudo-nitzschia multistriata. Protist 164,
89–100.
Thomas, J.A., Welch, J.J., Lanfear, R., Bromham, L., 2010. A generation time effect
on the rate of molecular evolution in invertebrates. Mol. Biol. Evol. 27, 1173–
1180.
Tran, D., Giordano, M., Louime, C., Tran, N., Vo, T., Nguyen, D., Hoang, T., 2014.
An Isolated Picochlorum Species for Aquaculture, Food, and Biofuel. North
Am. J. Aquac. 76, 305–311.
Uchimura, A., Higuchi, M., Minakuchi, Y., Ohno, M., Toyoda, A., Fujiyama, A., Miura,
I., Wakana, S., Nishino, J., Yagi, T., 2015. Germline mutation rates and the
long-term phenotypic effects of mutation accumulation in wild-type laboratory
mice and mutator mice. Genome Res.
209
Uphoff, S., Lord, N.D., Okumus, B., Potvin-Trottier, L., Sherratt, D.J., Paulsson, J.,
2016. Stochastic activation of a DNA damage response causes cell-to-cell
mutation rate variation. Science 351, 1094–1097.
Vandepoele, K., Van Bel, M., Richard, G., Van Landeghem, S., Verhelst, B., Moreau,
H., Van de Peer, Y., Grimsley, N., Piganeau, G., 2013. pico-PLAZA, a
genome database of microbial photosynthetic eukaryotes. Environ. Microbiol.
15, 2147–2153.
Vassilieva, L.L., Hook, A.M., Lynch, M., 2000. The fitness effects of spontaneous
mutations in Caenorhabditis elegans. Evol. Int. J. Org. Evol. 54, 1234–1246.
Vassilieva, L.L., Lynch, M., 1999. The rate of spontaneous mutation for life-history
traits in Caenorhabditis elegans. Genetics 151, 119–129.
Von Alvensleben, N., Stookey, K., Magnusson, M., Heimann, K., 2013. Salinity
Tolerance of Picochlorum atomus and the Use of Salinity for Contamination
Control by the Freshwater Cyanobacterium Pseudanabaena limnetica. PLoS
ONE 8, e63569.
Vonlanthen, S., Dauvillée, D., Purton, S., 2015. Evaluation of novel starch-deficient
mutants of Chlorella sorokiniana for hyper-accumulation of lipids. Algal Res.
12, 109–118.
Vos, M., Hesselman, M.C., Beek, T.A. te, Passel, M.W.J. van, Eyre-Walker, A.,
2015. Rates of Lateral Gene Transfer in Prokaryotes: High but Why? Trends
Microbiol. 23, 598–605.
Vraspir, J.M., Butler, A., 2009. Chemistry of marine ligands and siderophores. Annu.
Rev. Mar. Sci. 1, 43–63.
Wang, A.D., Sharp, N.P., Agrawal, A.F., 2014. Sensitivity of the Distribution of
Mutational Fitness Effects to Environment, Genetic Background, and
Adaptedness: A Case Study with Drosophila. Evolution 68, 840–853.
Wang, S., Shi, X., Palenik, B., 2016. Characterization of Picochlorum sp use of
wastewater generated from hydrothermal liquefaction as a nitrogen source.
Algal Res.-Biomass Biofuels Bioprod. 13, 311–317.
Watson, J.D., Crick, F.H.C., 1953. Molecular Structure of Nucleic Acids: A Structure
for Deoxyribose Nucleic Acid. Nature 171, 737–738.
Wei, W., Ning, L.-W., Ye, Y.-N., Li, S.-J., Zhou, H.-Q., Huang, J., Guo, F.-B., 2014.
SMAL: A Resource of Spontaneous Mutation Accumulation Lines. Mol. Biol.
Evol. 31, 1302–1308.
210
Weller, A.M., Rödelsperger, C., Eberhardt, G., Molnar, R.I., Sommer, R.J., 2014.
Opposing Forces of A/T-Biased Mutations and G/C-Biased Gene Conversions
Shape the Genome of the Nematode Pristionchus pacificus. Genetics 196,
1145–1152.
Weller, C., Wu, M., 2015. A generation-time effect on the rate of molecular evolution
in bacteria. Evol. Int. J. Org. Evol. 69, 643–652.
Wielgoss, S., Barrick, J.E., Tenaillon, O., Wiser, M.J., Dittmar, W.J., Cruveiller, S.,
Chane-Woon-Ming, B., Médigue, C., Lenski, R.E., Schneider, D., 2013.
Mutation rate dynamics in a bacterial population reflect tension between
adaptation and genetic load. Proc. Natl. Acad. Sci. U. S. A. 110, 222–227.
Willi, Y., Van Buskirk, J., Hoffmann, A.A., 2006. Limits to the Adaptive Potential of
Small Populations. Annu. Rev. Ecol. Evol. Syst. 37, 433–458.
Winnepenninckx, B., Backeljau, T., De Wachter, R., 1993. Extraction of high
molecular weight DNA from molluscs. Trends Genet. TIG 9, 407.
Wloch, D.M., Szafraniec, K., Borts, R.H., Korona, R., 2001. Direct estimate of the
mutation rate and the distribution of fitness effects in the yeast
Saccharomyces cerevisiae. Genetics 159, 441–452.
Wolfenden, R., 2014. Massive thermal acceleration of the emergence of primordial
chemistry, the incidence of spontaneous mutation, and the evolution of
enzymes. J. Biol. Chem. 289, 30198–30204.
Worden, A.Z., Follows, M.J., Giovannoni, S.J., Wilken, S., Zimmerman, A.E.,
Keeling, P.J., 2015. Rethinking the marine carbon cycle: Factoring in the
multifarious lifestyles of microbes. Science 347, 1257594.
Worden, A.Z., Lee, J.-H., Mock, T., Rouzé, P., Simmons, M.P et al., 2009. Green
evolution and dynamic adaptations revealed by genomes of the marine
picoeukaryotes Micromonas. Science 324, 268–272.
Worden, A.Z., Nolan, J.K., Palenik, B., 2004. Assessing the dynamics and ecology of
marine picophytoplankton: The importance of the eukaryotic component.
Limnol. Oceanogr. 49, 168–179.
Wright, S., 1932. The roles of mutation, inbreeding, crossbreeding, and selection in
evolution. Proc. Sixth Int. Congr. Genet. 1, 356–366.
Wright, S., 1931. Evolution in Mendelian Populations. Genetics 16, 97–159.
Wright, S.D., Gillman, L.N., Ross, H.A., Keeling, D.J., 2010. Energy and the tempo of
evolution in amphibians. Glob. Ecol. Biogeogr. 19, 733–740.
211
Xu, S., Schaack, S., Seyfert, A., Choi, E., Lynch, M., Cristescu, M.E., 2012. High
mutation rates in the mitochondrial genomes of Daphnia pulex. Mol. Biol.
Evol. 29, 763–769.
Yamamoto, M., Nishikawa, T., Kajitani, H., Kawano, S., 2007. Patterns of asexual
reproduction in Nannochloris bacillaris and Marvania geminata (Chlorophyta,
Trebouxiophyceae). Planta 226, 917–927.
Yamamoto, M., Nozaki, H., Kawano, S., 2001. Evolutionary relationships among
multiple modes of cell division in the genus Nannochloris (chlorophyta)
revealed by genome size, actin gene multiplicity, and phylogeny. J. Phycol.
37, 106–120.
Yamamoto, M., Nozaki, H., Miyazawa, Y., Koide, T., Kawano, S., 2003. Relationship
between presence of a mother cell wall and speciation in the unicellular
microalga Nannochloris (Chlorophyta)1. J. Phycol. 39, 172–184.
Yang, F., Xiang, W., Sun, X., Wu, H., Li, T., Long, L., 2014. A novel lipid extraction
method from wet microalga Picochlorum sp. at room temperature. Mar. Drugs
12, 1258–1270.
Yau, S., Grimsley, N., Moreau, H., 2015. Molecular ecology of Mamiellales and their
viruses in the marine environment. Perspect. Phycol. 83–89.
Yoon, H.S., Hackett, J.D., Ciniglia, C., Pinto, G., Bhattacharya, D., 2004. A molecular
timeline for the origin of photosynthetic eukaryotes. Mol. Biol. Evol. 21, 809–
818.
Zeyl, C., DeVisser, J.A., 2001. Estimates of the rate and distribution of fitness effects
of spontaneous mutation in Saccharomyces cerevisiae. Genetics 157, 53–61.
Zhang, X.-S., 2012. Fisher’s Geometrical Model of Fitness Landscape and Variance
in Fitness Within a Changing Environment. Evolution 66, 2350–2368.
Zhu, Y., Dunford, N.T., 2013. Growth and Biomass Characteristics of Picochlorum
oklahomensis and Nannochloropsis oculata. J. Am. Oil Chem. Soc. 90, 841–
849.
Zhu, Y.O., Siegal, M.L., Hall, D.W., Petrov, D.A., 2014. Precise estimates of mutation
rate and spectrum in yeast. Proc. Natl. Acad. Sci. U. S. A. 111, E2310-2318.
212
213
214
Résumé Les mutations sont la principale source de diversité sur laquelle agit la
sélection pour permettre aux espèces de s’adapter. Les études de l’effet des
mutations sur la survie et du taux de mutation sont donc essentielles pour mieux
comprendre l’évolution. Par une approche d’expérience d’accumulation de
mutations, nous étudions ces deux questions chez cinq modèles d’algues vertes
(Ostreococcus tauri, O. mediterraneus, Bathycoccus prasinos, Micromonas pusilla,
et Picochlorum RCC4223). Il est mis en évidence une diminution de la fitness au
cours du temps en raison des mutations délétères, et une importante interaction
génotype-environnement sur l’effet des mutations. Le taux de mutation varie aux
échelles intra-génomique et inter-spécifique, avec deux principaux résultats: une
augmentation du taux de mutation dans les régions non codantes et une
augmentation du taux de mutation avec la taille du génome chez les eucaryotes et
en fonction de l’écart à l’équilibre en GC du génome. Aussi, l’assemblage et
l’annotation d’une picoalgue du genre Picochlorum permettent d’étudier le rôle des
transferts horizontaux de gènes chez les Chlorophytes.
Abstract Mutations are the main source of diversity on which selection acts to allow
species to adapt. Studies of the effect of mutations on survival and estimation of
spontaneous mutation rates are essential to better understand evolution. Using
mutation accumulation experimental approach, we investigated the issues of
mutation effects and mutation rate in five models of green algae (Ostreococcus tauri,
O. mediterraneus, Bathycoccus Prasinos, Micromonas pusilla, and Picochlorum
RCC4223). It highlighted a decline in fitness over time because of deleterious
mutations, and a significant genotype-environment interaction on the fitness effect of
mutations. The mutation rate varies at inter-specific and intra-genomic scales, with
two main results: a raise of the mutation rate in non-coding regions in accordance
with trancriptional-coupled repair, and an increase of the mutation rate with an
increase of the genome size in eukaryotes and the GC content deviation from the
equilibrium. Also, a new Picochlorum genome is provided to investigate the role of
horizontal gene transfer in the Chlorophyta group.
Top Related