Copyright © 2014, American Society for Microbiology. All...
Transcript of Copyright © 2014, American Society for Microbiology. All...
1
Elucidation of insertion elements encoded on plasmids and in vitro construction of 1
shuttle vectors from the toxic cyanobacterium Planktothrix 2
Guntram Christiansen1, Alexander Goesmann2, Rainer Kurmayer1* 3
1 University of Innsbruck, Research Institute for Limnology, Mondseestrasse 9, 5310 4
Mondsee, Austria 5
2 Bielefeld University, Computational Genomics, CeBiTec/BRF, 33594 Bielefeld, Germany 6
7
Running title: Shuttle vectors from the cyanobacterium Planktothrix 8
9
Keywords: mobile elements, cyanotoxins, mutagenisation, recombination, whole genome 10
sequencing 11
12
13
*Corresponding author: 14
Rainer Kurmayer 15
University of Innsbruck 16
Research Institute for Limnology 17
Mondseestrasse 9 18
A-5310 Mondsee 19
20
Tel.: 0043-512-507-50242 21
E-mail: [email protected] 22
23
AEM Accepts, published online ahead of print on 6 June 2014Appl. Environ. Microbiol. doi:10.1128/AEM.01188-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
2
Abstract 24
Several gene clusters that are responsible for toxin synthesis in bloom-forming cyanobacteria 25
have been found to be associated with transposable elements (TEs). In particular, insertion 26
(IS) elements were shown to play a role in the inactivation or recombination of the genes 27
responsible for cyanotoxin synthesis. Plasmids have been considered as important vectors of 28
IS element distribution to the host. In this study, we aimed to elucidate the IS elements 29
propagated on the plasmids and the chromosome of the toxic cyanobacterium Planktothrix 30
agardhii NIVA-CYA126/8 by means of high throughput sequencing. In total, five plasmids 31
(pPA5.5, 14, 50, 79, 115 kbp) were elucidated and two plasmids (pPA5.5, 115 kb) were found 32
to propagate full IS element copies. Large stretches of shared DNA information between 33
plasmids were constituted of TEs. Two plasmids (pPA5.5, 14 kbp) were used as candidates 34
for engineering shuttle vectors (named pPA5SV, pPA14SV) in vitro by PCR amplification 35
and the subsequent transposition of the Tn5 cat transposon, including the R6Kγ origin of 36
replication of E. coli. While pPA5SV was found fully segregated, pPA14SV consistently co-37
occurred with its wild type plasmid even under the highest selective pressure. Interestingly, 38
the Tn5 cat transposon became transferred by homologous recombination into another 39
plasmid pPA50. The availability of shuttle vectors is considered to be of relevance in 40
investigating the genome plasticity as a consequence of homologous recombination events. 41
Combining the potential of high throughout sequencing and in vitro production of shuttle 42
vectors makes it simple to produce species-specific shuttle vectors for many cultivable 43
prokaryotes. 44
45
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
3
Introduction 46
Harmful algal blooms (HABs) formed by freshwater cyanobacteria have been frequently 47
linked to the occurrence of diseases in humans and livestock. The best characterized HAB-48
toxin is the hepatotoxin microcystin (MC). In addition, the peptides nodularin, the alkaloids 49
cylindrospermopsin and (homo)anatoxin-a, and the saxitoxins are reported frequently (1). The 50
genus Planktothrix is of quantitative importance in lakes and reservoirs and frequently 51
involved in bloom formation. Notably, Europe red-pigmented Planktothrix is always toxic 52
due to MC production (2), while the production of homoanatoxin-a (3), (4), and saxitoxin (5) 53
has been reported only occasionally. The reasons leading to the sudden appearance of certain 54
toxin producers are unclear. 55
High throughput sequencing has enabled the exploration of the genetic information of 56
prokaryotes from both isolates and communities at an unprecedented scale e.g. (6). 57
Consequently, it is hoped that genome wide comparisons can reveal the interdependence of 58
toxin production and other ecophysiological adaptations, e.g. (7). For a long time, it has been 59
shown that, in prokaryotes, plasmids are a major source of genetic variation and novel 60
ecophysiological adaptations, such as resistance to antibiotics and heavy metals, toxin 61
production, and gas vesicles, e.g. (8), (9). Surprisingly, up to date, none of the gene clusters 62
encoding toxin synthesis in cyanobacteria has been found on a plasmid. Indeed, the vast 63
majority of plasmids elucidated among cyanobacteria are considered cryptic. Only for a few 64
plasmids could the biological role of their genetic information, such as pANL, the large 65
plasmid of Synechococcus elongatus PCC7942, be elucidated (10). 66
Within cyanobacteria, the majority of the investigated plasmids is found to contain genes 67
encoding transposable elements (TEs), so-called insertion (IS) elements ranging from 1-2 kbp 68
in size and typically consisting of 1-3 ORFs, including a transposase (11), (12). It is striking 69
that the percentage of the genetic information devoted to TEs on a particular plasmid is higher 70
when compared with the chromosome, (e.g. (12), Table 2). Already during the time prior to 71
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
4
the era of genome sequencing, plasmids have been considered essential in the dissemination 72
of TE to individual E. coli strains (13), (14). Using a branching-process model, it could be 73
shown that correlations among unrelated TEs can result from the dissemination of TEs by 74
infectious plasmids (15). Those plasmids would accumulate TEs through time, and when they 75
are transferred they would infect the host simultaneously with two or more unrelated TEs. 76
This hypothesis has been confirmed by genome sequencing, e.g. for Rhizobium etli 77
populations (16). 78
In previous work, we described different recombinations and TEs affecting the production of 79
MC in Planktothrix. For example, the TE called ISPlr1 has inactivated MC synthesis 80
repeatedly when it was inserted into the genes of the MC synthetase (mcy) gene cluster (2). It 81
is interesting to note that only ISPlr1 could be found regularly among the red-pigmented 82
strains of Planktothrix, while among the green-pigmented strains the occurrence of ISPlr1 was 83
variable (R. Kurmayer, unpublished). A second type of TE (ISPlag1) has been shown to 84
induce the loss of the entire 50 kbp mcy gene cluster via site specific recombination (17). 85
Analogously, TEs or their remainders have been observed in association with the loss or the 86
inactivation of the mcy gene cluster in Microcystis (18), (19) or in Anabaena (20). 87
In this study, we aimed to elucidate the TEs propagated on the plasmids of the toxic 88
cyanobacterium Planktothrix agardhii NIVA-CYA126/8 by means of high throughput 89
sequencing. This strain has been repeatedly found to be amenable to genetic manipulation by 90
electroporation in several laboratories and has been of significance in the elucidation of gene 91
clusters encoding the synthesis of various toxic and bioactive peptides [(17), (21), (22), (23), 92
(24)]. From two of the plasmids, shuttle vectors were constructed in vitro by PCR 93
amplification and the subsequent transposition of a DNA fragment encoding the Tn5 94
transposase including the R6Kγ origin of replication of E. coli. This new technique is 95
considered to be of potential for enabling genetic manipulation methods for non-model 96
organisms such as bloom-forming cyanobacteria. This is a significant advance, since 97
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
5
cyanobacteria forming HABs have so far been mostly elusive to genetic manipulation 98
techniques, e.g. (25). 99
100
Materials and Methods 101
Organisms and growth conditions. The green pigmented cyanobacterium P. agardhii 102
NIVA-CYA126/8 was isolated by Olav Skulberg (Norwegian Institute of Water Research, 103
Oslo) from Lake Langsjön in 1984. Cells were grown in BG11 (26) under 30 µmol m-2 s-1 at 104
20°C under sterile conditions. The filaments of NIVA-CYA126/8 were purified according to 105
Rippka (26). The status of microbial purity was tested prior to sequencing by (i) selective 106
media in the dark (27), (ii) DAPI staining of contaminant bacteria on membrane filters, (iii) 107
16S rRNA gene amplification using general primers (27F, 1492R of E. coli, (28) and cloning 108
and RFLP analysis of 16S rRNA products. None of the tests revealed any evidence of 109
bacterial contamination. Transformed P. agardhii (see below) was grown in BG11 as 110
indicated above and supplemented with 1 µg ml-1 chloramphenicol (Cm). In general, 111
Planktothrix is sensitive to Cm and this concentration of Cm has previously been used for 112
genetic manipulation and growing genetically modified strains (21). In order to quantify 113
copies of plasmids as well as the transformed shuttle vectors (see below) cultures of wildtype 114
and transformants were grown in BG11 supplemented with 0-10 µg ml-1 of Cm at 20°C under 115
16:8 h light:dark conditions (10 µmol m-2 s-1). 116
117
Genome sequencing. The axenic strain P. agardhii NIVA-CYA126/8 was harvested by 118
centrifugation and high molecular weight DNA was extracted and sequenced using 454 119
pyrosequencing (GS20) by Roche (Penzberg, Germany) and assembled using the Newbler 120
Metrics software (23× coverage, estimated genome size 5 Mbp, Version v. 1.1.02.09). The 121
sequencing resulted in 805 contigs that were reduced to 23 scaffolds by paired end 122
sequencing. The construction of a fosmid genome library (CopyControl™ Fosmid Library 123
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
6
Production Kit, Epicentre, Biozym, Vienna) was critical for finally combining the 23 124
scaffolds to one scaffold. By fosmid end sequencing (475 fosmids) and long-range PCR the 125
integrity of the assembled chromosome was confirmed (99.6% of the total chromosome). 126
During this process, five plasmids (5, 5.9, 50, 70, 115 kbp) were elucidated and confirmed by 127
overlapping PCR amplification using the Phusion High-Fidelity DNA Polymerse (Finnzymes, 128
Thermo Scientific, Vienna, Austria), (Suppl. Table 1). This polymerase has a high 129
processivity and proofreading accuracy resulting in the ability to amplify long templates (> 10 130
kbp) following the conditions of the manufacturer. The sequences of the chromosome and 131
plasmids were submitted to NCBI (PRJNA163669). The Whole Genome Shotgun project has 132
been deposited at DDBJ/EMBL/GenBank under the accession number ASAK00000000. The 133
version described in this paper is the first version, ASAK01000000. 134
135
Genome annotation. The annotation of the genome was performed using the automatic 136
annotation by the gene prediction tools Glimmer + Critica (GenDB), (29). The automatic 137
genome annotation was corrected using manual annotation with regard to the plausibility of 138
the proposed ORFs. In general, the annotation of ORFs was not approved when (i) the amino 139
acid sequence was < 33, (ii) no conserved domains were found by homology searches using 140
Psi-BLAST against COG and BlastP, (iii) it appeared to be part of a larger ORF. The 141
individual plasmids were analyzed using the Vector NTI software package (Invitrogen, 142
Germany). TEs were classified using the IS finder database http://www-is.biotoul.fr/is.html 143
using an e-value (< 1e-30), (30). The inverse repeats (IR) were either identified from the 144
closest homologs (< 1e-30) or by means of the EINVERTED program with default settings on 145
the bioinformatics portal Mobyle (http://mobyle.pasteur.fr/cgi-bin/portal.py). 146
147
Shuttle vector construction. From the genomic DNA, two of the five plasmids were 148
amplified by PCR using the Phusion High-Fidelity Polymerase and the amplicons were used 149
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
7
for self-ligation. The PCR products of the correct sizes were isolated using a gel extraction kit 150
(Qiagen, Hilden, Germany). The PCR products were 5’ prime-phosphorylated using T4 151
polynucleotide kinase (Thermo Scientific, MBI Fermentas, St. Leon-Rot, Germany) under 152
standard conditions, column purified, and diluted to 5 ng µl-1 for self-ligation. Self-ligation 153
was performed using T4 DNA ligase (MBI Fermentas) at 22°C for 1 h in a total volume of 154
500 µl reaction mix (containing 1× ligase buffer, 5% polyethylenglycol 4000, 50 units of 155
enzyme). After column purification (Qiagen), an equimolar amount of plasmid (pPA5.5, 156
pPA14) and the constructed transposon (0.0025 pmol µl-1) were used in 10 µl containing 1× 157
reaction buffer and 1 unit of EZ-Tn5 Transposase (Epicentre) following the manufacturer’s 158
instructions. The transposon was constructed by the insertion of a cat (chloramphenicol acetyl 159
transferase) resistance marker gene isolated from the pACYA184 vector (NEB, Frankfurt am 160
Main, Germany) into the SmaI restriction site of the multi-cloning site of the pMOD5 vector 161
(Epicentre). After successful integration, the transposon containing the R6Kγ origin of 162
replication of E. coli was isolated from the pMOD vector by PCR using the manufacturer’s 163
primers (Epicentre). The PCR product was purified and subsequently used for in vitro 164
transposition as outlined above. 165
One µl of the in vitro transposition mix was used for electroporation into Transformax 166
EC100D pir+ electrocompetent E. coli (Epicentre). After overnight incubation (37°C) on LB 167
agar (12.5 µg ml-1 Cm), approx. 250 colonies were obtained. Plasmids were purified from 168
twelve randomly chosen colonies and used for DNA sequencing using the SqFP (5´-169
GCCAACGACTACGCACTAGCCAAC-3´) and SqRP (5´-170
GAGCCAATATGCGAGAACACCCGAGAA-3´) primers (Epicentre) to elucidate the 171
insertion site of the transposon into the plasmid pPA5.5 or pPA14. The sequences of the 172
pPA5.5 and pPA14 shuttle vectors were submitted to Genbank/NCBI/DDBJ (Access. No. 173
JX134573, JX134574). 174
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
8
For the transformation of P. agardhii 30 ml of a mid-log phase culture (culture conditions as 175
above, OD880nm = 0.4) was treated using the “Hammer, Cork, and Bottle" method (31) to 176
destroy the gas vesicles and enable sedimentation during centrifugation (10,000 g, 10 min, 177
RT). The pellet was washed five times with 1 mM sterile HEPES (Sigma, Vienna, Austria) 178
and finally resuspended in 100 µl of 1 mM HEPES. Ten µg of the shuttle vector plasmid 179
DNA were added, and vigorously mixed with the cell suspension by vortexing under sterile 180
conditions. Electroporation conditions using a gene pulser Xcell (Biorad, Vienna, Austria) 181
were identical as published previously (21). 182
Ten ml of the P. agardhii transformant culture (OD = 0.4) were used for plasmid prep 183
(Thermo Scientific, MBI Fermentas) following alkaline lysis (32). Only a small amount of the 184
total plasmid DNA was isolated (2 ng µl-1) subsequent to column elution. One µl was used for 185
the electroporation of Transformax EC100D pir+ electrocompetent E. coli cells and after 186
overnight incubation (37°C) on LB agar (12.5 µg ml-1 Cm) >1,000 colonies were obtained. In 187
order to elucidate the potential recombination events that could have happened during 188
propagation in Planktothrix, plasmids were isolated from twelve randomly chosen colonies 189
and used for RFLP analysis (TruII). Only one restriction type was found. 190
191
Quantification of the copy number of plasmids and the stability of shuttle vectors 192
To investigate the stability of the shuttle vectors, transformants were grown under a gradient 193
of Cm concentrations ranging from 0-10 µg Cm ml-1. Cultures were harvested by filtering on 194
glass fiber filters and DNA was quantitatively extracted as described previously (33). Aliquots 195
were filtered onto membrane filters in parallel, stained with DAPI, and enumerated using 196
epifluorescence microscopy as described (34). The chromosome and all five plasmids were 197
quantified using the established qPCR protocols (35). Briefly, 100 ng of DNA template were 198
added to Sybr Green qPCR master mix (Thermo Scientific, Fermentas) and primer pairs 199
specifically amplifying the loci of the chromosome, and the five plasmids were added (Suppl. 200
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
9
Table 2). All of the measurements were performed in triplicate in a total reaction volume of 201
12 µl using an Eppendorf Master Cycler Ep Realplex system. The initial denaturation of 10 202
min at 95°C was followed by 40 cycles of a three-step PCR with denaturating, annealing, and 203
elongation temperature of 95°C (15 s), 60°C (15 s), and 72°C (20 s), respectively, followed by 204
a standard melting curve protocol (95°C, 15 s, 60°C, 15 s, 60-95°C, 20 min). For each gene 205
locus, the fluorescence threshold values (Ct) were calibrated using a plasmid carrying the gene 206
fragment of interest (approx. 100 bp, which was ligated into a standard cloning vector) and 207
relating the template DNA concentration (0.1 pg–1 ng) to the obtained Ct value using 208
regression curves (Suppl. Table 2). 209
210
Rescue cloning 211
In order to find out whether the Tn5 cat transposon has been transferred by homologous 212
recombination into other plasmids that share identical sequence regions (pPA14 and pPA50 or 213
pPA79), genomic DNA was isolated from both pPA5.5SV and pPA14SV transformant 214
cultures (see above). Three µg of isolated DNA were incubated with PacI following the 215
guidelines of the manufacturer (NEB). After digestion, the sample was precipitated and the 216
DNA pellet was washed three times with 70% EtOH. After all the liquids have been 217
evaporated the pellet was resuspended in 50µl water. 500 ng of the digested DNA was used 218
for self-ligation and precipitated (see above). 100 ng of the self-ligated DNA was used to 219
transform electrocompetent pir+ cells. The obtained colonies were screened by PCR using 220
pMOD based primer pair SqFP and SqRP to amplify DNA sequences flanking the transposon 221
Tn5. Obtained PCR products were screened by RFLP (DraI) and colonies representing 222
different restriction patterns were cultivated overnight and used for plasmid isolation 223
procedures. Isolated plasmid DNA was sequenced according to standard conditions. 224
225
Results 226
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
10
Identification of plasmids. In total, five plasmids (pPA5.5, 14, 50, 79, 115) were elucidated 227
(Table 1). The plasmids pPA5.5 + 14 and the plasmids pPA50 + 79 were previously 228
misassembled and incorrectly fused into scaffolds using the Newbler Metrics software. The 229
reason for the mis-assemblage was either due to a TE shared by pPA5.5 + 14 or a plasmid 230
partitioning protein (parA) shared by pPA50 + 79. In order to prove the physical existence of 231
each of the plasmids, DNA fragments of 10,000 bp were amplified by designing 232
forward/reverse primer pairs in overlapping position and allowing for the amplification of the 233
whole plasmid without interruption. For all the plasmids pPA50, 79, 115, all of the primer 234
sites (Suppl. Table 1) revealed PCR products in the expected size (Fig. 1). For plasmids 235
pPA5.5 and pPA14, the expected smaller sized PCR products (3 kbp) were obtained. It is 236
concluded that the DNA molecules were indeed circular. 237
Aligning the DNA sequences of the plasmids with each other revealed large stretches of 238
shared DNA (> 80% similarity). For example, 55% and 38% of the DNA sequence 239
information found in pPA14 were also found in pPA50 and pPA79 (Table 2). Forty percent of 240
the DNA of pPA5.5 was also contained in pPA115 and in the chromosome. Consequently, 241
based on the shared DNA sequence, two groups of DNA molecules were observed: pPA14, 242
50, 79 were more closely related to each other when compared with pPA5.5, pPA115, and the 243
chromosome. 244
245
Annotation of plasmids. The five plasmids contained 4-102 ORFs (Table 1, Fig. 2). Except 246
for pPA14, the GC dinucleotide content per ORF on plasmids was higher and the AC 247
dinucleotide content per ORF on plasmids was lower than when compared with the ORFs 248
located on the chromosome (GC dinucleotide content: p = 0.2, not significant, AC 249
dinucleotide content: p < 0.001, nonparametric Kruskal Wallis ANOVA on ranks). In total, 95 250
(46%) of the 208 ORFs located on the plasmids were of an unknown function. The majority 251
of the ORFs located on all the plasmids had cyanobacterial homologs (78% cyanobacteria, 252
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
11
11% bacteria, 12% no match). Within cyanobacteria, the most abundant closest homologs 253
were from Oscillatoria PCC6506 (28%), Cyanothece PCC7822 (18%), Nostoc PCC7120 254
(10%), and Lyngbya PCC8106 (9%). 255
In total, 2,932 ORFs (68%) were assigned to COG categories (36). Except for pPA14, the 256
plasmids showed a higher proportion of ORFs assigned to replication, recombination, and 257
repair (COG category L, 33-50%) than to the chromosome (7%). The other COG categories 258
did not differ significantly in proportion between the plasmids and chromosome (data not 259
shown). The largest ORFs were encoding polyketide synthases located on pPA79 (pPA79_30: 260
7.6 kbp, pPA79_37: 8.4 kbp). Those genes encoded two complete PKS type I modules each 261
including a keto-synthase, acyl-transferase, dehydrogenase, enoylreductase, ketoreductase, 262
and acyl carrier domain. The ORF pPA79_37 contained a second acyl carrier domain. 263
Associated genes included a putative glycosyltransferase (pPA79_33), putative oligoketide 264
cyclase (pPA79_34), and putative free standing ketosynthase (pPA79_35). 265
266
Transposable elements. Including the chromosome and the plasmids, a total of 91 ORFs 267
could be unequivocally assigned to TE constituting 1.4% of the genome. All of the plasmids 268
were found to contain at least the remainders of TEs. Except for pPA14, the percentage of the 269
genetic information attributable to TE was higher on the plasmids than on the chromosome 270
(Table 1). Furthermore, the GC dinucleotide content and the AC dinucleotide content of the 271
91 ORFs assigned to TEs was significantly different from the rest of the ORFs located on 272
both plasmids and the chromosome, i.e. a GC dinucleotide content of 35.6 (33.9, 38) within 273
TEs vs. 39.6 (36.6, 43.4) within non TEs (p < 0.001, Mann-Whitney U test) or a AC 274
dinucleotide content of 52.4 (50.8, 53.9) within TEs vs. 49.5 (47.2, 51.6) within non TEs (p < 275
0.001, Mann-Whitney U test). Consequently, the differences in the dinucleotide content 276
between TEs and non-TEs ORFs in combination with the higher proportion of TEs on 277
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
12
plasmids can explain the dinucleotide differences as observed between plasmids and the 278
chromosome. 279
TEs significantly contributed to the DNA sequence information shared between the plasmids. 280
Between pPA5.5, pPA115, and the chromosome, 88-100% of the shared information was 281
attributable to TEs. Between pPA14, pPA50, and pPA79, 0-83% of the shared information 282
consisted of TEs (Table 2). Out of the 91 ORFs assigned to TEs, 29 ORFs (32%) were 283
identified as full copies of IS elements. Among these, seven ORFs (32%) were located on two 284
of the plasmids (pPA5.5, pPA115). The plasmids contained 13 (27%) of all the partial TE 285
copies. The TEs were classified into eleven groups comprising 2-16 copies (Table 3). Only 286
the IS element groups I, II, and IV showed the lowest genetic variability on the nucleotide 287
level (< 2.1%) and more than two full copies suggesting a relatively recent insertion activity, 288
e.g. (11), (16). The IS element (group I) that is flanking the mcy gene cluster at the 289
downstream end (21) occurred in seven full copies that are all located on the chromosome. 290
The IS element ISPlag1 (group II) that caused the deletion of the mcy gene cluster resulting in 291
nontoxic Planktothrix (17) occurred in five copies (located on pPA115 and the chromosome) 292
and seven nonfunctional remainders. Group IV (located on pPA5.5, pPA115, and the 293
chromosome) contained six full copies that are highly identical to a transposase (anaH) 294
associated with the gene cluster encoding (homo)anatoxin-a synthesis in Oscillatoria 295
PCC6506 (37). In summary, two plasmids (pPA5.5, pPA115) carried putatively active TEs 296
(groups II, IV) while four plasmids carried partial TE copies from IS element groups I, II, IX, 297
X, and unassigned residues. 298
299
Application of shuttle vectors. Two of the five isolated plasmids (pPA5.5, pPA14) were 300
produced in vitro and subsequently used for shuttle vector construction (pPA5SV, pPA14SV). 301
Both shuttle vectors were successfully shuttled back and forth between E. coli and P. 302
agardhii. In both cases, the PCR experiments using primer pairs (pPA5SV: TpmChk+/-, 303
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
13
pPA14SV: TpmChkN+/-) binding in the proximity of the inserted Tn5 region (1295 bp) 304
revealed the expected PCR product in P. agardhii (pPA5SV: 1697 bp; pPA14SV: 1921 bp) 305
when compared with the product size obtained directly from the shuttle vector DNA (Fig. 3). 306
However, for pPA14SV, the amplification of the Tn5 insertion site revealed two PCR 307
products (626 bp, 1921 bp) indicating the coexistence of both wildtype and modified plasmid 308
in P. agardhii (Fig. 3). The sequencing of these PCR products for both shuttle vectors 309
revealed an insertion of the complete Tn5 region (pPA5SV: at nt 112, pPA14SV: at nt 4339, 310
1295 bp) with left and right inverse repeat sequences (5’-CTGTCTCTTATACACATCT-3’) 311
and a 9-bp direct repeat sequence (pPA5SV: 5’- GCTCTACTG-3’, pPA14SV: 5’- 312
GCAATAAAC-3’), resulting from the DNA repair after Tn5 insertion (Suppl. Fig. 1). 313
Moreover, it became apparent that in pPA5SV the Tn5 transposon inserted at nt 112, which 314
was a sequence region unique to pPA5.5 (< nt 1097, > nt 3160). In contrast, in pPA14SV the 315
insertion site at nt 4339 (> nt 3508, < nt 850) was identical to a gene region that is also 316
located in pPA50 (Suppl. Fig. 2), with 44% identity to a hypothetical protein Osc7112_6402 317
of Oscillatoria nigro-viridis PCC7112 possibly related to the TOPRIM (topoisomerase-318
primase) domain. 319
320
Copy number of plasmids and the stability of shuttle vectors. In order to investigate the 321
stability of shuttle vectors, both plasmids and shuttle vectors were quantified and compared in 322
numbers with the chromosome. On average, one WT cell contained 4.2 ± 0.4 (SD) 323
chromosome copies, and plasmids pPA5, 14, 50, 79, 115 occurred with a frequency of 8.2 ± 324
0.4, 4.5 ± 1, 5.6 ± 0.3, 2.2 ± 0.6, and 5.6 ± 0.1 fold the chromosome copy, respectively (Fig. 325
4). 326
In order to eliminate the WT plasmid from the transformant culture of the pPA14SV, the Cm 327
selection pressure was raised and the ratio of each SV molecule to the chromosome was again 328
monitored by qPCR. For pPA5SV, the ratio of pPA5.5/chromosome and Cm-resistance 329
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
14
gene/chromosome remained stable and the transformant grew up to 10 µg Cm ml-1 (Suppl. 330
Fig. 3). The pPA14SV transformant was less resistant to Cm and did not grow above 7 µg Cm 331
ml-1. The lower resistance of the pPA14SV transformant could be explained by the lower 332
copy number and the observation that the pPA14SV transformation culture could not be fully 333
segregated. Surprisingly, however, pPA14SV also showed rather unaltered ratios of 334
pPA14SV/chromosome and Cm-resistance gene/chromosome under increasing Cm selective 335
pressure. Even the long-term cultivation of pPA14SV transformant under 7 µg Cm ml-1 did 336
not lead to a complete segregation. 337
338
Rescue cloning. Since plasmids pPA5.5 and pPA14 both contained large stretches of DNA 339
information shared with other plasmids/chromosome (see above), we were interested to see 340
whether the Tn5 cat transposon has been translocated by homologous recombination. In most 341
cases, the DNA sequences obtained through rescue cloning represented the shuttle vector 342
pPA14SV. In one case, however, the DNA sequence also showed identity to the native 343
plasmid pPA50 indicating the occurrence of a homologous recombination event between 344
pPA14SV and plasmid pPA50 (Suppl. Fig. 5). The flanking regions of the Tn5 cat transposon 345
were amplified and sequenced using the pPA50 specific primer pairs pPA50reco+/pMOD+ 346
and pPA50reco-/pMOD-. In both cases, the amplicons of the expected sizes were detected: 347
2.6 kbp (pPA50reco+/pMOD+) and 0.8 kbp (pPA50reco-/pMOD-), (Fig. 5). Unspecific 348
amplification products were visible for the primer pair pPA50reco+/pMOD+ indicating the 349
repetitive occurrence of the pPA50reco+ primer binding sites. Thus, we could show a 350
dynamic homologous recombination activity between two genetic elements. 351
352
Discussion 353
Genome copy numbers. The copy number of the chromosome was estimated as 4.2 ± 0.4 per 354
cell, which might be at odds with the expectation of one copy per cell. Following the 355
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
15
terminology of Griese et al. (38), P. agardhii NIVA-CYA126/8 would be classified as 356
oligoploid. The maintenance of several genome copies might be a more common feature in 357
cyanobacteria (38). Typically, in cyanobacteria, the estimates of copy numbers vary between 358
1 and 10, while a few strains even have higher copy numbers, e.g. Microcystis strain HUB524 359
(39) or Synechocystis PCC6803 (38). Griese et al. (38) concluded that polyploid 360
cyanobacteria exist not only under laboratory conditions but also in nature. 361
An alternative explanation to the observed variation in copy number within cyanobacteria is 362
the physiologically induced variability. For example, during the transfer from the exponential 363
to the stationary phase in batch culture, Microcystis strain HUB524 showed a tenfold 364
variation in the genome copy number (35). Under general (batch) culture conditions, cell 365
growth is only rarely synchronized and, consequently, it is the variation in physiological state 366
of the cells that might contribute to the observed variability. The ratio of the plasmid copy 367
numbers to the chromosome, however, should not be affected by such physiological 368
variability on the cellular level. 369
370
Whole genome sequencing. Up to date, very few harmful algal bloom-forming species such 371
as toxic cyanobacteria have been totally sequenced. Only the Kazusa DNA sequencing 372
institute in Japan succeeded to form one contiguous DNA molecule of the toxin-producing 373
cyanobacterium Microcystis (40). The large insert genome library sequencing efforts 374
performed during this study were essential to test for the integrity of the automatically 375
assembled genome. Indeed, it could be shown by fosmid end sequencing that multiple copies 376
of IS elements and the parA gene led to incorrect assemblies such as those of pPA5.5 + 377
pPA14 and pPA50 + pPA79. This approach has been emphasized, as automatic assemblies 378
are frequently insufficient and error prone (41), (42). Total genomes are invaluable for 379
emerging fields such as “ecogenomics”, when the plasticity of microorganisms to changing 380
environmental conditions needs to be investigated. So far, it has been speculated that TEs in 381
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
16
general are an important source of physiological plasticity in bloom-forming cyanobacteria 382
such as M. aeruginosa (43), (44). The influence of TEs on the restructuring of genomes and 383
the inactivation/rearrangement of genes can only be investigated when completely assembled 384
genome information is available. For example, Bickhart et al. (45) used a 250 kb-sliding 385
window analysis in order to identify those gene regions indicative of (potential) genome 386
flexibility. The TE frequency of occurrence and the occurrence of genome 387
rearrangements/deletion events was then compared statistically by plotting the number of TEs 388
against the variable genome regions as identified by genome comparison. This approach has 389
thus far not been possible for bloom-forming cyanobacteria. It is hoped that the P. agardhii 390
NIVA-CYA126/8 genome sequence will form a suitable reference for this type of genomic 391
variability analysis. 392
393
Plasmid encoded IS elements and toxin synthesis. In this study, we show that P. agardhii 394
contains only relatively few groups of IS elements occurring with more than two copies: 395
Groups I, II, IV. Notably, full copy representatives or residues of each of these groups were 396
associated with cyanotoxin synthesis previously: Group I was associated with the mcy gene 397
cluster of P. agardhii (21), Group II was associated with the loss of the mcy gene cluster (17), 398
and group IV was associated with the (homo) anatoxin gene cluster in the closely related 399
Oscillatoria PCC6506 (37). In contrast, any IS element ISPlr1 that has been shown to 400
inactivate MC synthesis by insertion into the mcy gene cluster in numerous red-pigmented 401
Planktothrix strains (2) was detected in the P. agardhii NIVA-CYA126/8 chromosome or in 402
the plasmids. We could show earlier by multi locus sequence typing (MLST) that the red-403
pigmented Planktothrix strains occurring in European lakes are relatively distantly related to 404
P. agardhii NIVA-CYA126/8 (17). Consequently, the elucidation of the TEs propagated on 405
plasmids from both red- and green pigmented strains can in accordance with phylogenetic 406
analysis (e.g. by MLST) help to explain the distribution of putatively active IS elements. For 407
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
17
P. agardhii NIVA-CYA126/8, the three IS element groups I, II, IV differ in their frequency of 408
occurrence among plasmids and the chromosome (Table 3). While full copies of group I were 409
located on the chromosome, full copies and residues of groups II and IV were located on 410
plasmids and the chromosome. Consequently, groups II and IV should have a wider 411
distribution when compared with group I. Accordingly, anaH described from the 412
(homo)anatoxin that a gene cluster in Oscillatoria (37) is almost identical (74-78% similarity 413
on nucleotide level, 515 bp) to group IV described in this study. In total, one full copy [78-414
82% similarity on the nucleotide (1924 bp) and protein level (554 aa)] and two partial copies 415
of group IV can be found in the Oscillatoria PCC6506 draft genome (46). In only a few cases 416
has Planktothrix been reported to produce (homo)anatoxin a (3), (4). In contrast, numerous 417
Oscillatoria strains have been reported to produce anatoxin-a (47). Given the close genetic 418
and ecological relationship between benthic Oscillatoria sp and both benthic and planktonic 419
Planktothrix, e.g. (48), it is possible that the IS elements part of group IV are involved in the 420
translocation of (homo)anatoxin-a synthesis gene cluster among these two genera in certain 421
habitats. 422
423
Applicability of shuttle vectors. Shuttle vectors propagate in two different species allowing 424
all the DNA manipulation steps in one model organism like E. coli and subsequent transfer 425
into the organism of interest. As cyanobacteria from section III are typically motile, the 426
transformation efficiency cannot be determined by counting CFUs. Therefore, the 427
applicability of the shuttle vector pPA5.5 and pPA14 was confirmed by the amplification of 428
the cat gene in both E. coli and Planktothrix under chloramphenicol pressure. Typically for 429
the construction of shuttle vectors, high amounts of plasmids are required, which is a process 430
that is often laborious, including mass-cultivation, caesium-chloride ultra-centrifugation, 431
cloning, and sequencing processes, e.g. (49), (50). With the dawn of second generation whole 432
genome sequencing, it became a fast and inexpensive standard tool. Usually a part of the 433
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
18
sequence data represents plasmids that can be identified by careful annotation. Combining the 434
potential of next generation sequencing and in vitro production of vectors makes it simple to 435
produce species-specific shuttle vectors for many cultivable prokaryotes. Consequently, this 436
technique is considered of high potential to enable genetic manipulation methods for non-437
model organisms. 438
We were able to observe recombination activity in vivo using the Tn5 cat transposon as a 439
tracer. In general, double recombination events of linearized plasmids have been observed in 440
unicellular or filamentous cyanobacteria (using linearized plasmids) while the single 441
recombination of circular plasmids have been observed during conjugation (25). The 442
recombination system utilizes sequence similarity within two DNA molecules, and in E. coli, 443
does not discriminate between perfect and imperfect matches of sequence until a fraction of 444
mismatch of 10% (51). Thus, all the repeated sequences within the genome constitute 445
potential sites of site-specific recombination that can be visualized using the rescue cloning 446
experiments applied in this study. It is interesting to note that plasmids pPA5.5 and pPA115 447
showed the highest sequence similarity with each other (40%) and with the chromosome 448
(pPA5.5: 40%; pPA115: 15%), while pPA14 showed the highest similarity with pPA50 (55%) 449
and pPA79 (39%), (Table 2). Thus, there is some likelihood that there are genes located on 450
plasmids pPA14, 50, 79 although translocated in-between they become less integrated into the 451
chromosome and vice versa, when compared with the genes located on pPA5.5, pPA115. 452
Accordingly, only pPA5.5 and pPA115 show full copies of TEs group II, IV located on the 453
chromosome. Therefore, constructing SVs from elucidated plasmids and using a tracer during 454
rescue cloning would elucidate the routes of recombination in-between various groups of 455
plasmids and the chromosome both with a strain or between strains representing different 456
phylogenetic lineages (17). 457
458
Acknowledgements 459
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
We are grateful to the comments of the three anonymous reviewers of an earlier draft of the 460
manuscript. We thank Sabine Münch-Gatthof, Andreas Mausolf, Olaf Kaiser (Roche 461
Penzberg), and Peter Hufnagl (Roche Vienna) for performing the GS20 de novo genome 462
sequencing study. The excellent technical assistance of Maria Reischauer, Katharina 463
Moosbrugger, Josef Knoblechner, and Johanna Schmidt is greatly acknowledged. This study 464
was financially supported by grants from the Austrian Science Fund (P20231, P24070) to 465
R.K. 466
467
References 468
1. Hudnell H. 2008. Proceedings of the interagency, international symposium on 469
cyanobacterial harmful algal blooms (ISOC-HAB): State of the science and research 470
needs. Advances in Experimental Medicine & Biology:924pp. 471
2. Kurmayer R, Christiansen G, Fastner J, Börner T. 2004. Abundance of active and 472
inactive microcystin genotypes in populations of the toxic cyanobacterium 473
Planktothrix spp. Environ. Microbiol. 6:831-841. 474
3. Skulberg OM, Carmichael WW, Andersen RA, Matsunaga S, Moore RE, 475
Skulberg R. 1992. Investigations of a neurotoxic oscillatorialean strain 476
(Cyanophyceae) and its toxin. Isolation and characterization of homoanatoxin-a. 477
Environ. Toxicol. Chem. 11:321-329. 478
4. Viaggiu E, Melchiorre S, Volpi F, DiCorcia A, Mancini R, Garibaldi L, Crichigno 479
G, Bruno M. 2004. Anatoxin-A toxin in the cyanobacterium Planktothrix rubescens 480
from a fishing pond in Northern Italy. Environ. Toxicol. 19:191-197. 481
5. Pomati F, Sacchi S, Rossetti C, Giovannardi S, Onodera H, Oshima Y, Neilan 482
BA. 2000. The freshwater cyanobacterium Planktothrix sp. FP1: molecular 483
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
20
identification and detection of paralytic shellfish poisoning toxins. J. Phycol. 36:553-484
562. 485
6. Ma Y, Paulsen IT, Palenik B. 2011. Analysis of two marine metagenomes reveals 486
the diversity of plasmids in oceanic environments. Environ. Microbiol. 14:453-466. 487
7. Gobler CJ, Berry DL, Dyhrman ST, Wilhelm SW, Salamov A, Lobanov AV, 488
Zhang Y, Collier JL, Wurch LL, Kustka AB, Dill BD, Shah M, Verberkmoes NC, 489
Kuo A, Terry A, Pangilinan J, Lindquist EA, Lucas S, Paulsen IT, Hattenrath-490
Lehmann TK, Talmage SC, Walker EA, Koch F, Burson AM, Marcoval MA, 491
Tang YZ, Lecleir GR, Coyne KJ, Berg GM, Bertrand EM, Saito MA, Gladyshev 492
VN, Grigoriev IV. 2011. Niche of harmful alga Aureococcus anophagefferens 493
revealed through ecogenomics. Proc. Natl. Acad. Sci. USA 108:4352-4357. 494
8. Lau RH, Sapienza C, Doolittle WF. 1980. Cyanobacterial plasmids - their 495
widespread occurrence, and the existence of regions of homology between plasmids in 496
the same and different species. Mol. Gen. Genet. 178:203-211. 497
9. Aminov RI, Mackie RI. 2007. Evolution and ecology of antibiotic resistance genes. 498
FEMS Microbiol. Lett. 271:147-161. 499
10. Chen Y, Holtman CK, Magnuson RD, Youderian PA, Golden SS. 2008. The 500
complete sequence and functional analysis of pANL, the large plasmid of the 501
unicellular freshwater cyanobacterium Synechococcus elongatus PCC 7942. Plasmid 502
59:176-192. 503
11. Zhou FF, Olman V, Xu Y. 2008. Insertion Sequences show diverse recent activities 504
in Cyanobacteria and Archaea. BMC Genomics 9:36. 505
12. Lin S, Haas S, Zemojtel T, Xiao P, Vingron M, Li RH. 2011. Genome-wide 506
comparison of cyanobacterial transposable elements, potential genetic diversity 507
indicators. Gene 473:139-149. 508
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
21
13. Sawyer SA, Dykhuizen DE, Dubose RF, Green L, Mutangaduramhlanga T, 509
Wolczyk DF, Hartl DL. 1987. Distribution and abundance of insertion sequences 510
among natural isolates of Escherichia coli. Genetics 115:51-63. 511
14. Lawrence JG, Ochman H, Hartl DL. 1992. The evolution of insertion sequences 512
within enteric bacteria. Genetics 131:9-20. 513
15. Hartl DL, Sawyer SA. 1988. Why do unrelated insertion sequences occur together in 514
the genome of Escherichia coli. Genetics 118:537-541. 515
16. Lozano L, Hernandez-Gonzalez I, Bustos P, Santamaria RI, Souza V, Young 516
JPW, Davila G, Gonzalez V. 2010. Evolutionary dynamics of insertion sequences in 517
relation to the evolutionary histories of the chromosome and symbiotic plasmid genes 518
of Rhizobium etli populations. Appl. Environ. Microbiol. 76:6504-6513. 519
17. Christiansen G, Molitor C, Philmus B, Kurmayer R. 2008. Nontoxic strains of 520
cyanobacteria are the result of major gene deletion events induced by a transposable 521
element. Mol. Biol. Evol. 25:1695-1704. 522
18. Tooming-Klunderud A, Mikalsen B, Kristensen T, Jakobsen KS. 2008. The 523
mosaic structure of the mcyABC operon in Microcystis. Microbiol. 154:1886-1899. 524
19. Noguchi T, Shinohara A, Nishizawa A, Asayama M, Nakano T, Hasegawa M, 525
Harada K, Nishizawa T, Shirai M. 2009. Genetic analysis of the microcystin 526
biosynthesis gene cluster in Microcystis strains from four bodies of eutrophic water in 527
Japan. J. Gen. Appl. Microbiol. 55:111-123. 528
20. Fewer DP, Halinen K, Sipari H, Bernardová K, Mänttäri M, Eronen E, Sivonen 529
K. 2011. Non-autonomous transposable elements associated with inactivation of 530
microcystin gene clusters in strains of the genus Anabaena isolated from the Baltic 531
Sea. Environ. Microbiol. Rep. 3:189-194. 532
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
22
21. Christiansen G, Fastner J, Erhard M, Börner T, Dittmann E. 2003. Microcystin 533
biosynthesis in Planktothrix: genes, evolution, and manipulation. J. Bacteriol. 534
185:564-572. 535
22. Christiansen G, Philmus B, Hemscheidt T, Kurmayer R. 2011. Genetic variation 536
of adenylation domains of the anabaenopeptin synthesis operon and the evolution of 537
substrate promiscuity. J. Bacteriol. 193:3822-3831. 538
23. Ishida K, Christiansen G, Yoshida WY, Kurmayer R, Welker M, Bonjoch J, 539
Hertweck C, Börner T, Hemscheidt T, Dittmann E. 2007. Biosynthetic pathway 540
and structure analysis of aeruginoside 126A and B, cyanobacterial peptide glycosides 541
bearing an unusual 2-carboxy-6-hydroxyoctahydroindole moiety. Chem. Biol. 14:565-542
576. 543
24. Philmus B, Christiansen G, Yoshida W, Hemscheidt T. 2008. Posttranslational 544
modification in microviridin biosynthesis. Chembiochem 9:3066-3073. 545
25. Flores E, Muro-Pastor AM, Meeks JC. 2008. Gene transfer to cyanobacteria in the 546
laboratory and in nature. In: Antonia Herrero and Enrique Flores: The Cyanobacteria: 547
Molecular Biology, Genomics and Evolution. Caister Academic Press, Norfolk, 548
UK.:45-57. 549
26. Rippka R. 1988. Isolation and purification of cyanobacteria. Meth. Enzymol. 167:3-550
27. 551
27. Wu QL, Boenigk J, Hahn MW. 2004. Successful predation of filamentous bacteria 552
by a nanoflagellate challenges current models of flagellate bacterivory. Appl. Environ. 553
Microbiol. 70:332-339. 554
28. Brosius J, Dull TJ, Sleeter DD, Noller HF. 1981. Gene organization and primary 555
structure of a ribosomal RNA operon from Escherichia coli. J. Mol. Biol. 148:107-556
127. 557
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
23
29. Meyer F, Goesmann A, McHardy AC, Bartels D, Bekel T, Clausen J, Kalinowski 558
J, Linke B, Rupp O, Giegerich R, Puhler A. 2003. GenDB--an open source genome 559
annotation system for prokaryote genomes. Nucl. Acids Res. 31:2187-2195. 560
30. Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M. 2006. ISfinder: the 561
reference centre for bacterial insertion sequences. Nucl. Acids Res. 34:D32-D36. 562
31. Klebahn H. 1929. Über die Gasvakuolen der Cyanophyceen. Verh. Internat. Verein. 563
Theoret. Angew. Limnol. 4:408-414. 564
32. Birnboim HC, Doly J. 1979. Rapid alkaline extraction procedure for screening 565
recombinant plasmid DNA. Nucl. Acids Res. 7:1513-1523. 566
33. Kurmayer R, Christiansen G, Chorus I. 2003. The abundance of microcystin-567
producing genotypes correlates positively with colony size in Microcystis and 568
determines its microcystin net production in Lake Wannsee. Appl. Environ. Microbiol. 569
69:787-795. 570
34. Kosol S, Schmidt J, Kurmayer R. 2009. Variation in peptide net production and 571
growth among strains of the toxic cyanobacterium Planktothrix spp. Eur. J. Phycol. 572
44:49-62. 573
35. Kurmayer R, Kutzenberger T. 2003. Application of real-time PCR for 574
quantification of microcystin genotypes in a population of the toxic cyanobacterium 575
Microcystis sp. Appl. Environ. Microbiol. 69:6723-6730. 576
36. Tatusov RL, Galperin MY, Natale DA, Koonin EV. 2000. The COG database: a 577
tool for genome-scale analysis of protein functions and evolution. Nucl. Acids Res. 578
28:33-36. 579
37. Mejean A, Mann S, Maldiney T, Vassiliadis G, Lequin O, Ploux O. 2009. 580
Evidence that biosynthesis of the neurotoxic alkaloids anatoxin-a and homoanatoxin-a 581
in the cyanobacterium Oscillatoria PCC 6506 occurs on a modular polyketide 582
synthase initiated by L-Proline. J. Am. Chem. Soc. 131:7512-7513. 583
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
24
38. Griese M, Lange C, Soppa J. 2011. Ploidy in cyanobacteria. FEMS Microbiol. Lett. 584
323:124-131. 585
39. Schober E, Werndl M, Laakso K, Korschinek I, Sivonen K, Kurmayer R. 2007. 586
Interlaboratory comparison of Taq Nuclease Assays for the quantification of the toxic 587
cyanobacteria Microcystis sp. J. Microbiol. Meth. 69:122-128. 588
40. Kaneko T, Nakajima N, Okamoto S, Suzuki I, Tanabe Y, Tamaoki M, Nakamura 589
Y, Kasai F, Watanabe A, Kawashima K, Kishida Y, Ono A, Shimizu Y, 590
Takahashi C, Minami C, Fujishiro T, Kohara M, Katoh M, Nakazaki N, 591
Nakayama S, Yamada M, Tabata S, Watanabe M. 2007. Complete genomic 592
structure of the bloom-forming toxic cyanobacterium Microcystis aeruginosa NIES-593
843. DNA Res. 14:247-256. 594
41. Birney E. 2011. Assemblies: the good, the bad, the ugly. Nature Meth. 8:59-60. 595
42. Ricker N, Qian H, Fulthorpe RR. 2012. The limitations of draft assemblies for 596
understanding prokaryotic adaptation and evolution. Genomics 100:167-175. 597
43. Frangeul L, Quillardet P, Castets AM, Humbert JF, Matthijs HCP, Cortez D, 598
Tolonen A, Zhang CC, Gribaldo S, Kehr JC, Zilliges Y, Ziemert N, Becker S, 599
Talla E, Latifi A, Billault A, Lepelletier A, Dittmann E, Bouchier C, De Marsac 600
NT. 2008. Highly plastic genome of Microcystis aeruginosa PCC 7806, a ubiquitous 601
toxic freshwater cyanobacterium. BMC Genomics 9:274. 602
44. Kuno S, Yoshida T, Kamikawa R, Hosoda N, Sako Y. 2010. The distribution of a 603
phage-related insertion sequence element in the cyanobacterium, Microcystis 604
aeruginosa. Microb. Environ. 25:295-301. 605
45. Bickhart DM, Gogarten JP, Lapierre P, Tisa LS, Normand P, Benson DR. 2009. 606
Insertion sequence content reflects genome plasticity in strains of the root nodule 607
actinobacterium Frankia. BMC Genomics 10:468. 608
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
25
46. Mejean A, Mazmouz R, Mann S, Calteau A, Medigue C, Ploux O. 2010. The 609
genome sequence of the cyanobacterium Oscillatoria sp. PCC 6506 reveals several 610
gene clusters responsible for the biosynthesis of toxins and secondary metabolites. J. 611
Bacteriol. 192:5264-5265. 612
47. Araoz R, Nghiem HO, Rippka R, Palibroda N, De Marsac NT, Herdman M. 613
2005. Neurotoxins in axenic oscillatorian cyanobacteria: Coexistence of anatoxin-a 614
and homoanatoxin-a determined by ligand-binding assay and GC/MS. Microbiol. 615
151:1263-1273. 616
48. Wood SA, Heath MW, Holland PT, Munday R, Mcgregor GB, Ryan KG. 2010. 617
Identification of a benthic microcystin-producing filamentous cyanobacterium 618
(Oscillatoriales) associated with a dog poisoning in New Zealand. Toxicon 55:897-619
903. 620
49. Van den Hondel C, Verbeek S, Vanderende A, Weisbeek PJ, Borrias WE, 621
Vanarkel GA. 1980. Introduction of transposon TN901 into a plasmid of Anacytis 622
nidulans - preparation for cloning in cyanobacteria. Proc. Natl. Acad. Sci. USA 623
77:1570-1574. 624
50. Wallace MM, Miller DW, Raps S. 2002. Characterization of pMa025, a plasmid 625
from the cyanobacterium Microcystis aeruginosa UV025. Arch. Microbiol. 177:332-626
338. 627
51. Bazemore LR, FoltaStogniew E, Takahashi M, Radding CM. 1997. RecA tests 628
homology at both pairing and strand exchange. Proc. Natl. Acad. Sci. USA 94:11863-629
11868. 630
631
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
26
632
Table 1: Nucleotide characteristics and dinucleotide frequencies (mean, min, max as 633
calculated from all the ORFs per molecule) in the five plasmids and in the chromosome from 634
Planktothrix agardhii NIVA-CYA126/8. 635
636
Plasmid bp ORFs GC (mean,min,max) AC (mean,min,max) IS elements (%)
pPA5.5 4789 4 38.3 36.1 40.5 53.9 42.3 58.8 8
pPA14 5960 4 39.9 36.5 45.0 47.8 39.6 56.3 0.8
pPA50 50852 43 37.8 27.2 50.2 51.1 40.1 58.2 3.5
pPA79 79107 55 40.2 31.4 48.5 49.8 37.4 62.2 4.3
pPA115 119570 102 38.8 30.7 49.6 51.5 37.7 58.9 6.9
Chromosome 4786776 4159 39.6 24.6 69.8 49.5 24.1 80.3 1.1
TOTAL 5047053 4367 39.5 24.6 69.8 49.6 24.1 80.3 1.4
637
* significantly different at p<0.001 (Kruskal Wallis One Way ANOVA) 638
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
27
639
Table 2: Percentage of shared DNA sequence information (> 100 bp) between individual 640
plasmids and the chromosome as determined by BLASTn (min. similarity 80%, e-value < 1 e-641
10), the percentage attributable to TE is given in parentheses. 642
643
Query/subject pPA5.5 pPA14 pPA50 pPA79 pPA115 Chromosome
pPA5.5 _ 0 0 0 40(100) 40(100)pPA14 0 _ 54.8(0) 38.8(0) 0 0pPA50 0 6.4(0) _ 6.3(56) 2.2(24) 2.9(100)pPA79 0 2.9(83) 5.3(83) _ 3.4(95) 5.7(94)pPA115 4.6(100) 0 2.3(89) 4.3(97) _ 15(92)Chromosome 0.2(99) 0 0.2(72) 0.3(73) 0.8(88) _
644
645
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
28
Table 3: List of transposable elements occurring in Planktothrix agardhii NIVA-CYA126/8 on plasmids and the chromosome 646
Gro
up N
o (C
opy
No)
No
copi
es
(ful
l len
gth,
Loc
atio
n (f
ull l
engt
h)
No
of p
arti
al
copi
es
(res
idue
s (a
a)
Loc
atio
n (r
esid
ues)
Clo
sest
ho
mol
ogue
(B
LA
STp)
% id
entit
y
Tot
al le
ngth
4
(bp)
% v
aria
bilit
y O
RF
(ful
l IS
)
IR(L
) 5‘
-3‘
IR(R
) 5‘
-3‘
Dir
ect r
epea
t 5‘
-3‘
IS f
amil
y6
I (16)1 7 (359)
Chr 9 (83-287)
Chr, pPA115
hypothetical protein MC7420_6982 [Microcoleus chthonoplastes PCC 7420]
52 1152 0.4 (1.4)
tatagcagtcctaaatcattatc
gaaaatcatttaggattgctata
- -
II (13)2 5 (337-340)
Chr, pPA115
9 (50-272)
Chr, pPA14, pPA79, pPA50
ISPlag1, transposase, IS4 family protein [Synechococcus sp. PCC 7335]1
59 1305 0.7 (0.8)
caggacttacgcaggcacactatatatagtgtgcagtaagccagcgaacgctgccaat
attggtatgcgatcgcctacttttagtacgctatatatagcgtgcttgcgtaagtcctg
ctctt, tctgt, aaacg
IS701
III (5) 2 (326-461)
Chr 3 (41-142)
Chr Transposase [Nodularia spumigena CCY9414], IS605 family
77 1350 10 (10.4)
catctgggagattgaaaactcagtggctttagaccaccaga
agtagttagaatctcagtgtcttcagacctgagagtgtcaa
- IS200/IS6057
IV (16)3 6 (368-547)
Chr, pPA5.5, pPA115
10 (101-239)
Chr conserved hypothetical protein [Oscillatoria sp. PCC 6506], IS4 family
79 2058 2.1 (6.2)
aacccacattccgcagatatttaagtcaatttaattttcaactaaattgttctaaataaaagc
ggtttctattttttagaattagtggaaaatttgacccctatctgcggaatgtgggtt
- IS1634
V (5) 2 (306)
Chr 3 (161-207)
Chr DDE domain transposase [Lyngbya majuscula 3L], IS4 family
54 1151 0.1 (0.1)
cattagacatctccaaaa
tttcggagatgtctattga
- -
VI (8) 1 (433)
Chr 7 (95-187)
Chr transposase, IS605 OrfB family, central region [Lyngbya majuscula 3L]
73 1805 - aaacctgggaagttctcaacttctgtagtggtcattaactgccc
ttatggatacttgggaagaagccagcgaatatgatgcgatggactttagc
- IS200/IS6058
VII (2) 1 (418)
Chr 1 (264) Chr transposase, IS605 OrfB family [Cyanothece sp. PCC 8801]
81 1854 - ctaaagattctttggt
accacacaatctttag - IS200/IS6059
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
29
VIII (3) 2 (318-390)
Chr 1 (226) Chr transposase [Microcystis aeruginosa NIES-843]
78 1247 28 (26) attcacaaaaagatatactataatgtgagat
tttacggcggtgaggatgtcaa
- IS200/IS6051
0
IX (2) - - 2 (134-223)
pPA79, pPA50
transposase, IS4 family protein [Nostoc punctiforme PCC 73102]
79 - - - - - IS701
X (2) - - 2 (276) Chr, pPA79
conserved hypothetical protein [Microcoleus chthonoplastes PCC 7420]
63 - - - - - -
XI (2) - - 2 (262-269)
Chr hypothetical protein Cyan7822_0488 [Cyanothece sp. PCC 7822]
72 - - - - - -
Ungrouped
A19Y_757 1 (388)
Chr - - transposase, IS605 OrfB family [Cyanothece sp. PCC 7424]
68 1553 - aaaatatcctggttttctcactccaaaggt
aaaaattagaataatattcagtcccttttaatattg
- IS607
A19Y_919 1(460)
Chr - . Transposase, IS605 OrfB [Nodularia spumigena CCY9414]
64 1549 - aacccgtagtggggtgttcaccaaaaaacgagcgg
tcaagaatcccccgcatttatgcgtggggagtgtcaa
- IS200/IS6058
A19Y_3678 1(390)
Chr - - putative transposase [Arthrospira platensis NIES-39]
86 1701 - cgaaaaaatgggtttaaaaccccgtcgttctacgacggcttttcttgatt
agcgtcaacccgtccagcatttcaacaattgtctcctgagtttgtcga
- IS200/IS6051
1
14 (113-307)
Chr, pPA79, pPA50
Unassigned Transposases IS4, IS200/IS605, IS630
647
1 flanking the mcy gene cluster at the downstream end (21) 648 2 caused the deletion of the mcy gene cluster in nontoxic Planktothrix strains (17) 649 3 short TEs (113-212 bp) that are highly identical (81-84%) to a transposon associated with homoanatoxin-a gene cluster (37) 650 4 Full copies (including IRL and IRR) only 651 5 variability between total TEs 652
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
30
6 according to the IS finder database (e value 1e-30), (30) 653 7 has no tandem inverse repeats (11), left end and right end according to the closest homologue ISTosp1 from Tolypothrix (DQ257628) 654 8 Left end and right end according to the closest homologue ISSoc6 from Synechococcus sp. JA-3-3Ab (NC_007775) 655 9 closest homologue ISBce3 from Bacillus cereus (NC_004722) 656 10 Left end and right end according to the closest homologue ISTel3 from Thermosynechococcus elongatus BP-1 (NC_004113) 657 11 Left end and right end according to the closest homologue ISTel2 from Thermosynechococcus elongatus BP-1 (NC_004113) 658
659
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
31
Figure legends 660
Fig. 1: Picture of ethidium-bromide stained agarose gels showing PCR amplicons (ten kbp) 661
obtained from Planktothrix agardhii NIVA-CYA126/8 with primer pairs amplifying the 662
entire plasmid without interruption (pPA5.5, 14, 50, 79, 115). For clarity only the nucleotide 663
pos. of the forward primer according to Genbank Access No. ASAK01000000 are indicated 664
(see also Suppl. Table 1). M, DNA size marker in kbp (0.5 – 10 kbp). The expected PCR 665
product size is marked. A few smaller sized PCR amplification byproducts deviating from the 666
expected size represent unspecific amplification. 667
668
Fig. 2: Schematic representation of annotated plasmids occurring in Planktothrix agardhii 669
NIVA-CYA126/8 and construction of the shuttle vectors pPA5.5 and pPA14. The ORFs 670
marked in grey represent proteins putatively involved in polyketide synthesis. The ORFs 671
marked in black represent transposable elements. Small ORFs (< 650 bp) are marked as black 672
bars (transposable elements) and blue bars (other proteins). MCS, multi cloning site. 673
674
Fig. 3: Amplification of cat transposon Tn5 from Planktothrix agardhii NIVA-CYA126/8 675
transformant using pPA5.5 and pPA14 plasmid specific primer pairs (shuttle vector and 676
transformant). M, DNA size marker in kbp (0.5 – 3 kbp). 677
678
Fig. 4: (A) Absolute and (B) relative quantification (mean ± SD) of copies of Planktothrix 679
agardhii NIVA-CYA126/8 chromosome and plasmids per individual cell. 680
681
Fig. 5: Amplification of cat transposon Tn5 from Planktothrix agardhii NIVA-CYA126/8 682
transformant using pPA50 plasmid specific primer pairs. 1, 2 constitute different harvests at 4 683
µg Cm ml-1. 684
685
on July 6, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from