Characterization of CpdC, a large-ring lactone hydrolyzing...
Transcript of Characterization of CpdC, a large-ring lactone hydrolyzing...
![Page 1: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/1.jpg)
1
Characterization of CpdC, a large-ring lactone hydrolyzing enzyme 1
from Pseudomonas sp. strain HI-70, and its use as a fusion tag 2
facilitating overproduction of proteins in Escherichia coli 3
4
Yali Xu1, Stephan Grosse
1, Hiroaki Iwaki
2, Yoshie Hasegawa
2 and Peter C.K. Lau
1,3* 5
6
1Aquatic and Crop Resource Development, National Research Council Canada, 7
Montreal, Quebec H4P 2R2, Canada, 2Department of Life Science & Biotechnology and 8
ORDIST, Kansai University, Suita, Osaka, 564-8680, Japan; 3McGill University, 9
Departments of Chemistry and Microbiology & Immunology, Montreal, Quebec H3A 10
2B4, Canada; and FQRNT Centre in Green Chemistry and Catalysis, Montreal, Quebec, 11
Canada 12
13
14
15
*Corresponding author 16
Mailing address: National Research Council Canada, 6100 Royalmount Avenue, 17
Montreal, Quebec H4P 2R2, Canada. 18
Phone: (514) 496-6325. Fax: (514) 496-6265. 19
E-mail: [email protected]. 20
21
AEM Accepts, published online ahead of print on 13 September 2013Appl. Environ. Microbiol. doi:10.1128/AEM.02435-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 2: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/2.jpg)
2
Abstract 22
23
There are few entries of carbon-carbon bond hydrolases (EC 3.7.1.-) in the ExPASy 24
database. In microbes, these enzymes play an essential role in the metabolism of alicyclic 25
or aromatic compounds as part of the global carbon cycle. CpdC is a の-pentadecalactone 26
hydrolase derived from the degradation pathway of cyclopentadecanol or 27
cyclopentadecanone by Pseudomonas sp. strain HI-70. CpdC was purified to 28
homogeneity and characterized. It is active as a dimer of 56,000 daltons with a subunit 29
molecular mass of 33,349. Although CpdC has the highest activity and reaction rate (kcat) 30
toward の-pentadecalactone, its catalytic efficiency favors lauryl lactone as a substrate. 31
The melting temperature (Tm) of CpdC was estimated to be 50.9 ± 0.1 °C. The half life of 32
CpdC at 35 °C is several days. By virtue of its high level of expression in Escherichia 33
coli, the intact CpdC-encoding gene and progressive 3’-end deletions were employed in 34
the construction of a series of fusion plasmid system. Although found in inclusion bodies, 35
proof-of-concept of overproduction of three microbial cutinases of which the genes were 36
otherwise expressed poorly or not at all in E. coli was demonstrated. On the other hand, 37
two antigenic proteins, azurin and MPT63, were readily produced in soluble form. 38
(201 words) 39
40
41
Keywords: 42
g/く fold hydrolase; HSL family; lactones; fusion tag; Pseudomonas; BVMO; inclusion 43
bodies; gene expression 44
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 3: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/3.jpg)
3
Introduction 45
A common theme that runs through the metabolic pathway of the degradation of alicyclic 46
alcohols of various carbon-ring sizes (C5 – C15) by both Gram-negative and Gram-47
positive bacteria is a five-step biochemical reaction that transforms an alicyclic alcohol to 48
a linear dicarboxylic acid before undergoing く-oxidation to generate the energy for 49
growth [1-8]. In these pathways, the most studied biochemical step is the conversion of a 50
cyclic ketone to a lactone catalyzed by an NADPH-dependent flavoprotein, better known 51
as a type 1 Baeyer-Villiger monooxygenase (BVMO). Lactone formation, especially 52
those that are regio-, chemo- or enantiospecific including the so-called “normal” or 53
abnormal” lactones, represents a green production route [9, 10] that is otherwise 54
unmatched by the chemical Baeyer-Villiger oxidation route [11]. 55
In contrast to the ring-expansion reaction of BVMOs, C – C breakage of the lactones 56
by a hydrolase that effectively opens the alicyclic ring to produce a hydroxy acid (5-57
hydroxyvaleric acid, 6-hydroxyhexanoic acid or 12-hydroxylauric acid in the case of 5-58
valerolactone, caprolactone or lauryl lactone, respectively) is hardly studied beyond the 59
initial gene localization and identification [3, 6, 12]. These hydrolases are members of the 60
g/く- hydrolase fold superfamily [13, 14]. As a possible alternative route to chiral lactone 61
synthesis, Onakunle et al [15] reported that h-valerolactone hydrolase derived 62
Comamonas (previously Pseudomonas) sp. NCIMB 9872 may be useful for the 63
resolution of racemic lactones based on the enantioselectivity of the enzyme for the R-64
enantiomer of the racemic h-lactones tested. 65
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 4: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/4.jpg)
4
In this study, we characterize a new and highly expressed lactonase (CpdC) originally 66
derived from Pseudomonas sp. strain HI-70 that is involved in the degradation of large-67
ring (C11 – C15) cyclic ketones [7]. A partial cpdC gene was initially noted downstream of 68
cpdB encoding the cyclopentadecanone monooxygenase (CPDMO) that has various 69
synthetic potential [7, 16]. Prompted by the high level of protein production in E. coli, we 70
explored the possibility of using CpdC-encoding gene as a new fusion tag to create a 71
series of plasmid vector system to promote protein production. Results of overproduction 72
of five target proteins are reported. 73
74
75
MATERIALS AND METHODS 76
77
Chemicals and reagents. Lactones used in this study were of analytical grade and they 78
were purchased from Sigma-Aldrich Canada (Oakville, Ontario). 79
Bacterial strains, culture conditions and plasmids. The bacterial strains and 80
plasmids used in this study are listed in Table 1. Pseudomonas sp. strain HI-70 was 81
maintained in a minimal salts medium containing 50 % glycerol at –80 °C. The growth 82
temperature for Pseudomonas and E. coli was 30 °C and 37 °C, respectively. The latter 83
was routinely cultured on standard Luria-Bertani (LB) medium [17] containing ampicillin 84
(100 たg/ml). 85
Cloning of the lactonase-encoding (cpdC) gene and analysis. A partial CpdC-86
encoding gene of strain HI-70 was previously found in a 4.2-kb BclI fragment cloned in 87
an E. coli recombinant plasmid, pCD200 ([7]; Fig. 1). To clone the complete cpdC gene, 88
a 1.2-kb SalI fragment was labeled by the dioxigenin-11-UTP system and used to probe a 89
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 5: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/5.jpg)
5
Southern hybridization of BamHI–SalI double digested genomic DNA prepared from 90
strain HI-70. As a result, an 8.2-kb BamHI-SalI fragment that was probed positive was 91
cloned in pUC19 vector and transformed into E. coli XL-1 Blue. This plasmid was 92
designated pCD400. The DNA sequence of the recombinant insert was determined on 93
both strands and analyzed by various BLAST programs of NCBI [18]. 94
For phylogenetic analysis of CpdC, sequence alignment was performed using 95
ClustalW. Phylogenetic tree was constructed with Poisson model with bootstrap 1000, 96
paired deletion by using MEGA 5.1 [19]. 97
Overexpression of cpdC gene in E. coli. The DNA fragment carrying cpdC was 98
amplified by KOD DNA polymerase (Toyobo) with the following pairs of PCR primers 99
containing the built-in restriction sites (EcoRI and PstI underlined sequences): 5'- 100
CGGAATTCATGAGTGATGCAGGAA -3', and 5'- 101
AAACTGCAGGTAGTCGGATTGTTGG -3', and cloned in the isopropyl-く-D-102
thiogalactopyranoside (IPTG)-inducible plasmid pSD80 [20]. The resultant plasmid in E. 103
coli BL21 cells containing cpdC was designated pSD80cpdC. 104
Protein purification and analysis. E. coli BL 21 harboring the pSD80cpdC plasmid 105
was grown at 37 °C on LB medium containing ampicillin (100 µg/ml) and cells were 106
induced by addition of 1 mM IPTG (OD600 = 0.4) using standard procedure. Cells were 107
harvested 3.5 hours after induction by centrifugation and washed twice in ice cold buffer 108
A (20 mM Na-phosphate, pH 7.0, containing 2mM DTT). Crude extract was obtained by 109
passing the cell suspension through a French pressure cell (20,000 psi, two times) 110
followed by centrifugation (20,000 xg, 4 °C, 30 min). 111
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 6: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/6.jpg)
6
The crude extract was applied onto a DEAE-Sepharose FF column (26/10) 112
equilibrated with buffer A and washed until no protein could be detected in the flow 113
through. CpdC was eluted using a linear gradient of 0-0.3 M NaCl in buffer A (10 x 114
column volume). Active fractions were collected, pooled and concentrated by 115
ultrafiltration using a stirring cell (Amicon, YM 10 membrane) and applied to a HiLoad 116
Superdex 75 pg (16/60) column, equilibrated with 150 mM NaCl in phosphate buffer (pH 117
7.0). Protein was eluted using the same buffer and active fractions were pooled and 118
concentrated. 119
Molecular mass (Mr) of the denatured enzyme was determined by conventional 120
sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-12 % PAGE) 121
containing 0.1 % SDS. The SDS-PAGE gel was silver-stained. The native Mr was 122
determined by gel filtration on a HiLoad Superdex 75 pg (16/60) column with reference 123
to standard proteins (GE Healthcare, Mississauga, ON). 124
Enzyme assays and kinetics. For quantification of the enzyme activity, a reaction 125
mixture of 10 ml was prepared containing Tris-HCl buffer (2 mM, pH 9.0) and 1 mM 126
lauryl lactone. The reaction was started using an appropriate amount of enzyme and the 127
pH was maintained by adding 0.1 M NaOH using an automated pH titration system 128
(Titrator TTT80, Autoburette ABU80, Titrigraph module REA160, pH stat unit REA 129
270; Radiometer, Copenhagen, Denmark). Specific activity was defined as µmole NaOH 130
per minute (U) used for neutralization of released acid per mg of protein (U/mg). 131
To monitor enzyme activity during purification, a modified enzyme assay allowing 132
high-throughput screening (200 µl in 96 wells microtiter plates) was used essentially as 133
reported previously [21]. The reaction mixture containing Tris-HCl buffer (2 mM, pH 134
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 7: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/7.jpg)
7
8.0), 4 µl of phenol red (0.5 % in ethanol) and an appropriate amount of enzyme was 135
started by adding 1 mM lauryl lactone as substrate. As the result of esterase activity and 136
release of acid, a color change from red to yellow (drop of pH) was monitored. This test 137
was also used for quantification of the enzyme activity by measuring increasing 138
absorbance at 555 nm. Results were compared to a standard curve using HCl (linear 139
between 0-0.4 µmol). 140
Kinetic parameters (Km and kcat) of CpdC were determined by using the double-141
reciprocal transformation (Lineweaver-Burk plot) of the Michaelis-Menten equation 142
under steady-state conditions, and they were verified by Eisenthal-Cornish-Bowden 143
direct plots. Initial reaction rates were measured at 25 °C in Tris-HCl buffer (2 mM, pH 144
9.0) by using substrate concentrations between 0.1 mM and 10 mM. All assays were 145
conducted in triplicate with appropriate controls. 146
Esterase activity was also assayed using p-nitrophenol (pNP) esters of various chain 147
lengths (C2 – C16). Substrates were dissolved in isopropanol (8 mM) and added to 50 mM 148
Na-phosphate buffer, pH 8.0, giving a final concentration of 0.8 mM. The reaction (1 ml) 149
was started with an appropriate amount of enzyme and the release of pNP was measured 150
at 410 nm (i = 15 mM-1
cm-1
) using a Beckman UV-visual recording spectrophotometer 151
(model DU 640). One enzyme unit (U) was defined as the amount of enzyme that 152
produced 1µmol of product per min; specific activity was expressed as U/mg protein. 153
Circular dichrosim (CD) spectroscopy and determination of the melting point 154
(Tm). The CD spectrum of CpdC was recorded on a Jasco J-815 spectrometer operating 155
with Spectra Manager software. Temperature was controlled with a Jasco PFD-452S 156
peltier unit. Purified protein solutions were desalted using a HiPrep Desalting column 157
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 8: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/8.jpg)
8
(26/10; GE Healthcare) previously equilibrated with 20 mM Na-phosphate buffer (pH 158
7.0). The final protein concentration was adjusted to about 0.1 mg/ml (~ 2µM) and the 159
CD spectrum was recorded between 190 and 260 nm using a Quartz cuvette (ID = 0.1 160
cm). Blanks containing buffer only were prepared and used as baseline. Temperature-161
dependent protein unfolding was monitored at 222 nm from 20 to 80 °C (2 °C min-1
). 162
Samples were maintained for 2 min at 80 °C and potential protein refolding was 163
monitored using the same conditions as above, reversing the thermal profile. 164
Thermodynamic parameters (Tm, ∆H, ∆S) for the folding process were calculated using 165
the Spectra Manager software. 166
Thermostability of CpdC. Active enzyme was incubated at various temperatures in 167
incremental steps of 5 °C (30-55 °C) for a fixed period (2, 5, 10, 30, 60, and 120 min) 168
and then chilled on ice. Enzyme activity was measured using the quantitative phenol red 169
test as described above using ε-caprolactone as substrate. 170
CpdC fusion tag construction. To construct the full length cpdC tag, designated 171
pSDcpdC_1 (Table 1), the stop codon of cpdC was deleted and PstI restriction site was 172
introduced by PCR using primer pair (F1/R1; Supplemental material Table S1), and Pfu 173
DNA polymerase under experimental conditions of: 95 °C/2 min, 30 cycles of (95 °C/30 174
s, Tm – 5 °C/30 s, 72 °C/1 min per 1000 bp), and 72 °C/7 min. pSD80cpdC was used as 175
template. The EcoRI and PstI digested PCR product was ligated to the same restriction 176
sites of pSD80 to form pSDcpdC_1 (Fig. 2). 177
Additional tags consisting of 3’-end truncated cpdC of various sizes (cpdC_2 to 5; 178
179, 151, 80, 38 amino acids, respectively; Fig. 2; Table 1) were constructed by PCR 179
using pSDcpdC_1 as template, and primer pairs FEcoRI and R2 to R5, respectively (Table 180
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 9: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/9.jpg)
9
S1). In these constructs, a Factor Xa cleavage site was included to facilitate any desirable 181
release of the tag portion. 182
Target proteins for expression in this study are the following: Aspergillus oryzae 183
cutinase (AoCut, 179 amino acids; Genbank XP_001817153); cutinase from 184
Cellulomonas flavigena DSM (CfCut, 271 amino acids; Genbank ZP_04367703.1); 185
cutinase from Rhodococcus RHA1 (RHA1, 204 amino acids; Genbank gi 111017650); 186
MPT63 antigen from Mycobacterium bovis (MPT63, 130 amino acids; Genbank 187
EU683937.1); and azurin protein (APA4922 from Pseudomonas aeruginosa, 128 amino 188
acids). All of the genes encoding the respective proteins were synthesized by GenScript 189
(Piscataway, NJ) in pUC57 with optimized codon usage for E. coli expression. 190
In the construction of pSDcpdC-gene_1 to 5, the respective passenger gene was 191
purified from pUC57 derivative, digested with PstI and HindIII and then ligated to the 192
same restriction sites of pSDcpdC_1 to 5. 193
Analyses and processing of fusion proteins. A specified culture in a shake flask 194
containing 10 ml of LB medium supplemented with 50 たg/ml ampicillin was incubated in 195
a rotary shaker at 30 °C and 200 rpm. When the cell density reached approximately 0.5 196
OD600, the culture was supplemented with 0.1 mM IPTG for induction. After induction, 197
the flask was further incubated for 4h at 30 °C. All cultivations were conducted in 198
duplicate. 199
The culture sample was appropriately diluted with saline solution for measuring cell 200
density at OD600 with a spectrophotometer (DU 800; Beckman Coulter USA). To prepare 201
cell extracts, approximately 20 OD600 ml were centrifuged at 4 °C and 3000 xg (Allegra 202
6R centrifuge, Beckman Coulter, USA) for 15 min. The cell pellet was resuspended in 1 203
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 10: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/10.jpg)
10
ml of Na-phosphate buffer (PB, 0.05 M, pH 7.5). The cell suspension was sonicated for 4 204
min (0.5 s/0.5 s pulse on/off) using an ultrasonic processor (S-4000, USA) and then 205
centrifuged at 4 °C and 3000 xg for 15 min. The supernatant containing soluble proteins 206
was assayed for enzyme activity. The esterase activity of fusion proteins was tested using 207
pNP substrates for CpdC-AoCut_1 to 5, cpdC-CfCut_1 to 5, and cpdC-RHA1_1 to 5. The 208
pellet containing insoluble proteins and cell debris was washed with PB buffer, 209
resuspended in 1 ml of TE-SDS buffer (10 mM Tris HCl, pH 8.0, 1 mM EDTA, 1 % 210
SDS), and heated to 100 °C for 5 min. The supernatant and the protein content of the 211
pellet were analyzed as the soluble and insoluble fractions, respectively. 212
SDS-PAGE was performed in a Mini-PROTEIN®
electrophoresis cell (Bio-Rad) using 213
a 15 % or 17 % PA separating gel stacked with a 4 % PA stacking gel. Samples of cell 214
extracts loaded for the analysis of protein expression in 10-well of gel stained by 215
Coomassie Blue were 0.0625 OD600 ml of the soluble and 0.0250 OD600 ml of the 216
insoluble fractions, respectively. The amount of samples loaded on the gel by silver 217
staining were 0.0125 OD600 ml of the soluble and 0.0050 OD600 ml of the insoluble 218
fractions if 15-well gel was used, or 0.00625 OD600 ml of the soluble and 0.0025 OD600 219
ml of the insoluble fractions if 10-well gel was used. The protein standard (Catalog #161-220
0363, Precision plus proteinTM
unstained standards, Bio-Rad) was loaded 6 µl onto 221
Coomassie blue gel, and 1 µl onto siliver staining gel. Electrophoresis was conducted at a 222
constant voltage of 200 V for 45 min. 223
Nucleotide sequence accession number. The full length cpdC gene sequence within 224
the 8.2-kb SalI-BamHI DNA together with the associated predicted open reading frames 225
have been deposited in the GenBank under accession number AB823648. 226
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 11: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/11.jpg)
11
RESULTS 227
Sequence characteristics of CpdC-encoding gene and context. A summary of the 228
established and predicted gene organization within the ~ 11-kb gene locus of strain HI-70 229
is shown in Fig. 1 and supplemental information in Table S2. The complete CpdC amino 230
acid sequence is predicted to consist of 307 residues, the N-terminal 200 amino acids 231
were previously established in a BclI clone in pCD200 that contains the CPDMO-232
encoding gene (cpdB) upstream of the partial cpdC [7] The open reading frames, labeled 233
as orf 2 – 5, downstream of cpdC are all in the same direction as those of cpdB and cpdC. 234
The intergenic spaces with respect to the various genes are all relatively short (94-, 33-, 235
23-, 103- and 4-bp, respectively, not including the divergent cpdR-cpdB intergenic 236
sequence). 237
In the Protein Data Bank (PDB) the closest structural homolog of CpdC is that of an 238
esterase/lipase (PDB code 3V9A; showing 43 % sequence identity) derived from an 239
uncultured bacterium. In the BLAST search, the most identical sequence (48.3 %) came 240
from a potential g/く hydrolase fold protein from Bradyrhizobium sp. STM 3843. CpdC is 241
classified as belonging to the hormone-sensitive lipase like-1 family (HSL; [13]). A 242
multiple sequence alignment (Fig. S1a) showed the conserved HGGG motif near the N-243
terminus at positions 79-82. The catalytic triad of CpdC is predicted to consist of the 244
invariant amino acids S149, E243 and H273. Conserved sequence around S149 is the 245
motif G(D/E)SAGG that is an extension of the conserved pentapeptide GXSXG (where X 246
denotes any residue) among g/く-fold hydrolases [13]. 247
Interestingly, a probable lauryl lactone esterase, named CddB from Rhodococcus 248
ruber SC1 [3] shares only 11 % sequence identity (22 % similarity) to CpdC. Evidently, 249
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 12: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/12.jpg)
12
this sequence does not cluster with CpdC in a phylogenetic analysis but closer to け-250
valerolactone hydrolase (CpnC) of Comamonas sp. NCIMB 9872 or ChnC2 of 251
Brevibacterium sp. HCN (Fig. 3). In general, sequence identity of CpdC to functionally 252
equivalent hydrolases in the various cycloalkanol pathways is in the range of 33 – 37 % 253
(data not shown). The phylogenetic relationship among these hydrolases is shown here 254
for the first time. 255
Protein purification and molecular properties. CpdC is readily produced in E. coli 256
in the IPTG-inducible vector pSD80 with yield estimated to reach up to 50 % of the total 257
soluble protein in relation to other visible protein bands in silver-stained SDS-PAGE gel 258
(Fig. 4). Enzyme yield in a 1-l fermentor was estimated to be 1.5 g/l or 750,000 U/l. A 259
two-fold purification to electrophoretic homogeneity was achieved by using first an 260
anion-exchange chromatography (DEAE-Sepharose FF) and then size exclusion 261
chromatography (Superdex 75pg). Purified CpdC showed a single band in SDS-PAGE at 262
about 33 kDa (Fig. 4), corresponding well to the theoretical Mr of 33,349. Gel filtration 263
on a Superdex 75 column gave a native mass of ~ 56,000, indicating a homodimeric 264
nature of CpdC (data not shown). CpdC purity (> 99 %) and molar mass (single peak at 265
about 53,000) were confirmed by dynamic light scattering (data not shown). 266
A pH 9 was established to be optimal for the CpdC activity. Its optimum temperature 267
was at 40 °C (data not shown). 268
Substrate spectrum and enzyme kinetics. Among C5 – C15 lactones, CpdC shows a 269
clear preference for large ring lactones, the highest specific activity and kcat were obtained 270
with ω-pentadecalactone, followed by lauryl lactone (Table 2). However, in terms of 271
catalytic efficiency (kcat/Km), CpdC favors lauryl lactone over pentadecalactone by virtue 272
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 13: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/13.jpg)
13
of an order of magnitude higher affinity toward the former substrate (0.2 mM vs 2 mM 273
for lauryl lactone and pentadecalactone, respectively). CpdC has a substantial activity 274
toward i-caprolactone but about 6 times less toward h-valerolactone. Interestingly, a 275
sulfur-substituted γ-valerolactone (γ-thiobutyrolactone) showed just as high an activity as 276
toward h-valerolactone (Table 2). Low to measurable activity was found for the longer 277
chain substituted γ-octanoic lactone, γ-dodecalactone and bicyclononalactone (Table 2). 278
In contrast, no enzymatic activity was found toward pantolactone, 2-acetyl 279
butyrolactone, 1,8,8-trimethyl-2-oxabicyclo[3.2.1]octane-3-one (camphor lactone) and 280
the quorum sensing L-homoserine lactones such as N-hexanoyl and N-octanoyl 281
homoserine lactones (data not shown). 282
Linear pNP-esters which are commonly used as model substrates for esterases 283
showed a clear dependency on the chain length of the esterified carboxylic acid (Fig. S2). 284
The highest activity was observed with pNP-acetate (65 U/mg) that declined rapidly with 285
increasing chain length (pNP-butyrate, 8U/mg; pNP-caprylate and pNP-myristate, < 1 286
U/mg) to no measurable activity for pNP-palmitate. 287
Circular dichroism (CD) analysis and thermostability of CpdC. CpdC exhibits the 288
typical CD spectrum of proteins with α-helices as the predominant form of secondary 289
structure showing minima at 222 nm and 208 nm which is the typical esterase structure 290
and was also confirmed in the psi-pred prediction (Fig S1b). Monitoring the CD at a fixed 291
wavelength of 222 nm while varying temperature allowed for the visualization of the 292
protein unfolding process (Fig. S1c). Melting temperature (Tm, the temperature where 293
folded and unfolded protein are in equilibrium) of CpdC was estimated to be 50.9 ± 0.1 294
°C (Fig. 5). 295
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 14: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/14.jpg)
14
CpdC is very stable up to 35 °C with a calculated half-life of several days. Starting at 296
about 40 °C which is in good agreement with the results obtained at variable 297
temperatures in CD spectroscopy (protein unfolding), the half-life of CpdC decreased to 298
about 4.5 h at 40 °C, and to about 8 min at 50 °C. At 55 °C, enzyme activity dropped 299
rapidly resulting in a half-life below 1 min (Fig. 5). 300
Construction of cpdC tags and production of fusion proteins. A series of pSD80-301
derived plasmid constructs containing the entire cpdC gene or its 3’-end deletion 302
derivatives (pSDcpdC_1 to _5) were constructed as per Materials and methods to test the 303
utility of CpdC in facilitating protein overproduction in a fusion format. 304
AoCut was found to be readily overproduced in all the fusion format containing 305
varying length of the CpdC-encoding tag with the expected Mr(s) as analyzed by SDS-306
PAGE, except pSDcpdC-AoCut_2 (Fig. 6a). However, the fusion proteins were in the 307
insoluble fraction, ie. in inclusion bodies. The same situation was encountered for CfCut 308
and RHA1 (Fig. S3a and S3b). The Mr(s) of the fusion tag proteins are summarized in 309
Table S3. 310
Lowering the incubation temperature from 30 °C to 25 °C, or varying time of IPTG 311
induction and change of host strain did not alleviate the solubility problem (data not 312
shown). 313
On the other hand, azurin, a 14-kDa copper and redox protein produced by P. 314
aeruginosa, and MPT63, a 14-kDa antigenic protein from Mycobacterium (M. bovis and 315
M. tuberculosis) were readily synthesized as soluble fusion proteins (Fig. 6b). In this 316
case, the shortest CpdC tag in vector pSD80cpdC_5 was used giving the expected Mr(s) 317
of 18 kDa and 17.8 kDa, respectively on an SDS-17 % PAGE analysis. Cytotoxicity 318
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 15: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/15.jpg)
15
assay of azurin involving human melanoma cells for example [22] or serological assay of 319
MPT63 demonstrating humoral immune responses in guinea pig or other infected host 320
[23] will require future evaluation. 321
Perhaps noteworthy was the observation that when MPT63 encoding-gene was cloned 322
with its original signal peptide of 29 amino acids, there was no apparent expression in the 323
pSD80 vector or in the commonly used pET22 vector that is under T7 promoter (Fig. 324
S3c). On the other hand, the cloned azurin-encoding gene in pET22 gave rise to its 325
expression in inclusion bodies, whereas there was no apparent expression in the pSD80 326
vector in either soluble or insoluble fraction (Fig. S3c). These expression characteristics 327
would argue against the possibility that the fusion proteins may be attributed to some 328
unknown intrinsic property of the pSD80 vector instead of a direct result of the CpdC 329
fusion. 330
331
DISCUSSION 332
In Pseudomonas sp. strain HI-70, the coupled gene arrangement of cpdC with its cognate 333
CPDMO-encoding gene (cpdB) upstream mirrors that of cddA-cddB of the 334
cyclododecanone oxidation pathway in Rhodococcus ruber SC1 that encodes the 335
respective cyclododecanone monooxygenase (CDMO) and the probable lauryl lactone 336
hydrolase (CddB) [3] In the majority of the characterized cycloalkanol/cycloalkanone 337
degradation pathways of various origin, the BVMO-encoding gene is downstream of the 338
hydrolase (Fig S4). Interestingly, exceptions to this coupled gene arrangement are those 339
provided by two prototypical microorganisms of cycloalkanol degradatiion, viz. 340
Acinetobacter sp. NCIMB 9871 and Comamonas (formerly Pseudomonas) sp. NCIMB 341
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 16: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/16.jpg)
16
9872. There, the respective hydrolase (chnC or cpnC) and the BVMO-encoding genes 342
(chnB or cpnB) are not only distally located but divergently transcribed [5, 6, 12]. In at 343
least two organisms, Brevibacterium sp. HCU and Rhodococcus sp. HI-31, duplication of 344
the chnC and BVMO-encoding genes has been reported [24, 25]. In Pseudomonas strain 345
HI-70 and Rhodococcus SC1, the identity of the genes or orfs beyond cddB and cpdC is 346
considerably different (Fig. S4). All in all, there is a great deal of conservation of gene 347
order or clustering effect in the pathway of cycloakanol/cycloalkanone degradation. 348
The substrate specificity of CpdC includes C5, C6, C12 and C15 lactones, although there 349
is a 30 times spread in apparent specific activity toward the lowest and the largest ring 350
size compounds (Table 2). Previously, i-caprolactone hydrolase of Acinetobacter sp. 351
NCIMB 9871 and h-valerolactone hydrolase of Comamonas (Pseudomonas) sp. NCIMB 352
9872 [15] were each shown to have 10 % activity toward the other substrate. Notably, the 353
Acinetobacter ChnC hydrolase was found to have 80 % activity toward i-decanolactone, 354
a substituted i-caprolactone with C4H9 side chain. 355
The possible significance of CpdC activity toward け-thiobutyrolactone is not known 356
when a methy-substituted け-valerolactone is not as active and such compounds like け-357
octanoic lactone and け-dodecalactone of increasing side chain. The same applies to CpdC 358
preferential hydrolysis of pNP acetate over longer-chain ester compounds. Interestingly, 359
this property appears to be shared by the EstE5 structural homolog (PDB code 3FAK; 360
[26]) Like EstE5, the catalytic triad of CpdC contains Glu (E243) instead of Asp as a 361
charge relay besides the conserved S149 as nucleophile and H243 as a proton carrier. To 362
gain an understanding of how CpdC hydrolyzes its substrates of varying ring sizes, it will 363
be interesting to compare the active sites of the HSL subfamily of enzymes for possible 364
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 17: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/17.jpg)
17
structural differences. This knowledge will possibly serve as a guide for rational protein 365
engineering of this hydrolytic protein for diverse applications. 366
For every bioprocess there is inevitably a protein production and preferably an 367
overproduction system. Fusion tags have been widely used for improving production 368
and/or purification of recombinant proteins in E. coli since they can overcome challenges 369
such as low translation rate, proteolytic degradation of target proteins, protein misfolding, 370
or poor solubility [27-30]. In a separate research project we were interested in another 371
subfamily of g/く fold hydrolases, namely cutinases that have numerous industrial 372
applications including the fibre/textile and biopolymer industry [31-34]. As secreted 373
proteins, the cutinase-encoding genes are generally not easily expressed in E.coli without 374
invoking a secretion system either in E. coli (e.g., g-hemolysin) or in yeast such as Pichia 375
[35-37]. 376
Overexpression of three new cutinase-encoding sequences of bacterial origin (AoCut, 377
RHA1 and CfCut) were attempted in several plasmid vector systems including an E. coli 378
YebF secretory system [38] but met with limited success (data not shown). On the 379
contrary, all genetic constructs in the CpdC tag system of various lengths gave rise to 380
overproduced proteins although associated with the insoluble fraction of inclusion bodies. 381
It is not known at this time if the number of cysteines (6 in AoCut, 4 in RHA1 and 6 in 382
CfCut) and the possible S-S bonds needed for the protein contribute to the misfolding of 383
the respective protein in the cytoplasm. Three disulfide bonds are present in the 3D 384
structure of AoCut, the protein being produced in Pichia [36]. 385
Azurin and MPT63 are proteins of therapeutic interest and as possible cancer drugs 386
[23, 39]. Unlike the tried cutinases, production of both proteins in a soluble form using 387
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 18: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/18.jpg)
18
the same CpdC tag system reiterated the fact that protein overproduction is very much an 388
individual thing [30] Due to protein specificity, recruitment of different tags for different 389
proteins under varying conditions are apparently needed [40, 41]. Considering the many 390
approaches to refolding the unfolded and/or misfolded proteins in vitro [42], CpdC-fusion 391
is potentially a useful system for the production of both soluble and insoluble proteins. 392
Formation of inclusion bodies is actually not a bad thing but has intrinsic values. On 393
one hand, the aggregated materials can facilitate purification; on the other they can 394
contribute to the making of functional materials [43]. Interestingly, toward this end , a 395
genetic locus that would be responsible for producing more inclusion bodies in E. coli 396
was recently identified to facilitate the production of some desirable bioactive peptides 397
[44]. 398
In conclusion, characterization of CpdC as a new C – C hydrolase paves the way for 399
new opportunities in the diverse applications of hydrolases that include green chemistry 400
and environmental sustainability. The new fusion tag system provides a foundation for a 401
better understanding of molecular mechanism underlying protein productivity and its 402
applications. 403
404
ACKNOWLEDGEMENTS. This work was financially supported in part by the Kansai 405
University Grant-in-Aid for progress of research in graduate course provided to Y.H. and 406
H.I. We thank Allan Matte and Al Chakrabarty for their interest and suggestions on the 407
fusion tag. 408
409
410
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 19: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/19.jpg)
19
REFERENCES 411
1. Trudgill PW. 1986. Terpenoid metabolism by Pseudomonas, in The bacteria, a 412
treatise on structure and function, Sokatch JR, [ed]. Academic Press, Inc., New 413
York.p 483-525. 414
2. Schuacher JDFakoussa RM. 1999. Degradation of alicyclic molecules by 415
Rhodococcus ruber CD4. Appl Microbiol Biotechnol. 52:85-90. 416
3. Kostichka K, Thomas S, Gibson K, Nagarajan V, Cheng Q. 2001. Cloning and 417
characterization of a gene cluster for cyclododecanone oxidation in Rhodooccus 418
ruber SC1. J Bacteriol. 183:6478-6486. 419
4. Iwaki H, Hasegawa Y, Teraoka M, Tokuyama T, Bergeron H, Lau PCK. 420
1999. Identification of a transcriptional activator (ChnR) and a 6-oxohexanoate 421
dehydrogenase (ChnE) in the cyclohexanol catabolic pathway in Acinetobacter 422
sp. Strain NCIMB 9871 and localization of the genes that encode them. Appl 423
Environ Microbiol. 65:5158-5162. 424
5. Iwaki H, Hasegawa Y, Teraoka M, Tokuyama T, Bernard L, Lau PCK. 2003. 425
Cyclohexanol biodegradation genes: A pathway of opportunities, in ACS 426
Symposium Series 840, Gross RA,Cheng HN, [ed]. American Chemical Society: 427
Washington, DC p 80-92. 428
6. Iwaki H, Hasegawa Y, Wang S, Kayser M, Lau PCK. 2002. Cloning and 429
characterization of a gene cluster involved in cyclopentanol metabolism in 430
Comamonas sp. strain NCIMB 9872 and biotransformations effected by 431
Escherichia coli expressed cyclopentanone 1,2-monooxygenase. Appl Environ 432
Microbiol. 68:5671-5684. 433
7. Iwaki H, Wang S, Grosse S, Bergeron H, Nagahashi A, Lertvorachon J, 434
Yang J, Konishi Y, Hasegawa Y, Lau PCK. 2006. Pseudomonad 435
cyclopentadecanone monooxygenase displaying an uncommon spectrum of 436
Baeyer-Villiger oxidations of cyclic ketones. Appl. Environ. Microbiol. 72:2707-437
2720. 438
8. Mirza I, Yachnin BJ, Wang S, Grosse S, Bergeron H, Imura A, Iwaki H, 439
Hasegawa Y, Lau PCK, Berghuis AM. 2009. Crystal structures of 440
cyclohexanone monooxygenase reveal complex domain movements and a sliding 441
cofactor J Am Chem Soc. 131:8848-8854. 442
9. de Gonzalo G, Mihovilovic M, Fraaije M. 2010. Recent developments in the 443
application of Baeyer-Villiger monooxygenases as biocatalysts. ChemBioChem. 444
11:2208-2231. 445
10. Leisch H, Morley K, Lau PCK. 2011. Baeyer-Villiger monooxygenases: more 446
than just green chemistry. Chemical reviews. 111:4165-4222. 447
11. ten Brink GJ, Arends IW, Sheldon RA. 2004. The Baeyer-Villiger reaction: 448
new developments toward greener procedures. Chemical reviews. 104:4105-4124. 449
12. Cheng Q, Thomas S, Kostichka K, Valentine J, V N. 2000. Genetic analysis of 450
a gene cluster for cyclohexanol oxidation in Acinetobacter sp. strain SE19 by in 451
vitro transposition. J Bacteriol. 182:4744-4751. 452
13. Lenfant N, Hotelier T, Velluet E, Bourne Y, Marchot P, Chatonnet A. 2013. 453
ESTHER, the database of the gく-hydrolase fold superfamily of proteins: tools to 454
explore diversity of functions. Nucleic Acids Research. 41:D423-D429. 455
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 20: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/20.jpg)
20
14. Ollis DL, Cheah E, Cygler M, Dijkstra B, Frolow F, Franken SM, Harel M, 456
Remington SJ, Silman I, Schrag J, Sussman JL, Verschueren KHG, 457
Goldman A. 1992. The alpha/beta-hydrolase fold. Protein Engineering. 5:197-458
211. 459
15. Onakunle OA, Knowles CJ, Bunch AW. 1997. The formation and substrate 460
specificity of bacterial lactonases capable of enantioselective resolution of 461
racemic lactones. Enzyme and microbial technology. 21:245-251. 462
16. Fink MJ FT, Rudroff F, Dudek H, Fraaije MW, Mihovilovic MD. 2011. 463
Extensive substrate profiling of cyclopentadecanone monooxygenase as Baeyer-464
Villiger biocatalyst reveals novel regiodivergent oxidations. J Mol Cat B: 465
Enzymatic 73:9-16. 466
17. Sambrook J, Fritsch E, Maniatis T. 1989, Molecular cloning: A laboratory 467
manual. New York, USA: Cold Spring Harbor Laboratory Press. 468
18. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, 469
Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein 470
database search programs. Nucleic Acids Research. 25:3389-3402. 471
19. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. 472
MEGA5: molecular evolutionary genetics analysis using maximum likelihood, 473
evolutionary distance, and maximum parsimony methods. Molecular Biology and 474
Evolution. 28:2731-2739. 475
20. Smith SP, Barber KR, Dunn SD, Shaw GS. 1996. Structural influence of cation 476
binding to recombinant human brain S100b: evidence for calcium-induced 477
exposure of a hydrophobic surface. Biochemistry. 35:8805-8814. 478
21. Grosse S, Bergeron H, Imura A, Boyd J, Wang S, Kubota K, Miyadera A, 479
Sulea T, Lau PCK. 2010. Nature versus nurture in two highly enantioselective 480
esterases from Bacillus cereus and Themoanaerobacter tencongensis. Microbial 481
Biotechnol. 3:65-73. 482
22. Yamada T, Goto M, Punj V, Zaborina O, Chen ML, Kimbara K, Majumdar 483
D, Cunningham E, Das Gupta TK, Chakrabarty AM. 2002. Bacterial redox 484
protein azurin, tumor suppressor protein p53, and regression of cancer. 485
Proceedings of the National Academy of Sciences. 99:14098-14103. 486
23. Manca C, Lyashechenko K, Wiker HG, Usai D, Colangeli R, Gennaro ML. 487
1997. Molecular cloning, purification, and serological characterization of MPT63, 488
a novel antigen secreted by Mycobacterium tuberculosis. Infection Immunity. 489
65:16-23. 490
24. Bakheit H. 2005, Identification of additional genes in the cyclohexanol 491
degradation pathway in Rhodococcus maris HI-31. McGill University. 492
http://digitool.Library.McGill.CA:80/R/?func=dbin-jump-full&object_id=97899 493
<http://www.libsearch.com/visit/1535895>. 494
25. Brzostowicz P, Blasko M, Rouvière P. 2002. Identification of two gene clusters 495
involved in cyclohexanone oxidation in Brevibacterium epidermidis strain HCU. 496
Appl Microbiol Biotechnol. 58:781-789. 497
26. Nam KH, Kim M-Y, Kim S-J, Priyadarshi A, Lee WH, Hwang KY. 2009. 498
Structural and functional analysis of a novel EstE5 belonging to the subfamiliy of 499
hormone-sensitive lipase. Biochem Biophys Research Comm. 379:553-556. 500
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 21: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/21.jpg)
21
27. Terpe K. 2003. Overview of tag protein fusions: from molecular and biochemical 501
fundamentals to commercial systems. Applied Microbiology and Biotechnology. 502
60:523-533. 503
28. Baneyx FMujacic M. 2004. Recombinant protein folding and misfolding in 504
Escherichia coli. Nat Biotech. 22:1399-1408. 505
29. Chelur D, Unal O, Scholtyssek M, Strickler J. 2008. Fusion tags for protein 506
expression and purification. BioPharm Int. 21( 6 Suppl):38-46. 507
30. Terpe K. 2006. Overview of bacterial expression systems for heterologous 508
protein production: From molecular and biochemical fundamentals to commercial 509
systems. Applied Microbiology and Biotechnology. 72:211-222. 510
31. Dutta K, Sen S, Veeranki V. 2009. Production, characterization and applications 511
of microbial cutinases. Process Biochem 44:127-134. 512
32. Pio TFMacedo GA. 2009. Cutinases: properties and industrial applications. Adv 513
Appl Microbiol. 66:77-95. 514
33. Baker PJ, Poultney C, Liu Z, Gross R, Montclare JK. 2012. Identification and 515
comparison of cutinases for synthetic polyester degradation. Appl Microbiol 516
Biotechnol. 93:229-240. 517
34. Silva C, Da S, Silva N, Matamá T, Araújo R, Martins M, Chen S, Chen J, 518
Wu J, Casal M, Cavaco-Paulo A. 2011. Engineered Thermobifida fusca cutinase 519
with increased activity on polyester substrates. Biotechnol J. 6:1230-1239. 520
35. Chen S, Tong X, Woodard R, Du G, Wu J, Chen J. 2008. Identification and 521
characterization of bacterial cutinase. J Biol Chem. 283:25854-25862. 522
36. Liu Z, Gosser Y, Baker PJ, Ravee Y, Lu Z, Alemu G, Li H, Butterfoss GL, 523
Kong X-P, Gross R, Montclare JK. 2009. Structural and functional studies of 524
Aspergillus oryzae cutinase: Enhanced thermostability and hydrolytic activity of 525
synthetic ester and polyester degradation. Journal of the American Chemical 526
Society. 131:15711-15716. 527
37. Su L, Chen S, Yi L, Woodard R, Chen J, Wu J. 2012. Extracellular 528
overexpression of recombinant Thermobifida fusca cutinase by alpha-hemolysin 529
secretion system in E. coli BL21(DE3). Microbial Cell Factories. 11:8. 530
38. Zhang G, Brokx S, Weiner JH. 2006. Extracellular accumulation of 531
recombinant proteins fused to the carrier protein YebF in Escherichia coli. Nat 532
Biotech. 24:100-104. 533
39. Chakrabarty A. 2012. Bacterial proteins: A new class of cancer therapeutics. J 534
Comm Biotechnol. 18:4-10. 535
40. Xu Y, Yasin A, Tang R, Scharer JM, Moo-Young M, Chou CP. 2008. 536
Heterologous expression of lipase in Escherichia coli is limited by folding and 537
disulfide bond formation. Applied Microbiology and Biotechnology. 8:79-87. 538
41. Xu Y, Yasin A, Wucherpfennig T, Chou CP. 2008. Enhancing functional 539
expression of heterologous lipase in the periplasm of Escherichia coli. World J 540
Microbiol Biotechnol. 24:2827-2835. 541
42. Burgess R. 2009. Refolding solubilized inclusion body proteins. Methods 542
Enzymol. 463:259-282. 543
43. Garcia-Fuitos E, Vazquez E, Diez-Gil C, Corchero J, Seras-Franzoso J, 544
Ratera I, Veciana J, Villaverde A. 2012. Bacterial inclusion bodies: making 545
gold from waste. Trends Biotechnol. 30:65-70. 546
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 22: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/22.jpg)
22
44. Pandey N, Sachan A, Chen Q, Ruebling-Jass K, Bhalla R, Panguluri K, 547
Rouviere PE, Cheng A. 2013. Screening and identification of genetic loci 548
involved in producing more/denser inclusion bodies in Escherichia coli. 549
Microbial Cell Factories. 12:43. 550 551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 23: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/23.jpg)
23
Table 1. Bacterial strains and plasmids used in this study 593
594
Table 2. Substrate specificity and kinetic parameters of CpdC 595
596
597
598
Figure 1. Gene context of cpdC encoding a の-pentadecalactone hydrolase within a 11-kb 599
DNA locus in Pseudomonas sp. strain HI-70. The hydrolytic reaction catalyzed by CpdC 600
is as shown using cyclopentadecanone as substrate. The cpdR gene is a possible LysR-601
type transciptional regulator, and cpdB encodes a cyclopentadecanone monooxygenase 602
(CPDMO) described in [7]. Open reading frames (orf) 1 and 5 are putative methyl-603
accepting chemotaxis transducer and transporter proteins, respectively. Orf 2, 3 and 4 are 604
hypothetical proteins with homologous counterparts described in Table S2. pCD200 and 605
pCD400 are E.coli recombinant plasmids containing the respective DNA fragments. The 606
DNA probe region is as indicated. 607
608
Figure 2. Construction of cpdC fusion tags. pSDcpdC_1 forms the basis for derivative 609
pSDcpdC_2. Numbers 2, 3, 4 and 5 within cpdC indicate the progressive deletion points 610
that give rise to derivatives pSDcpdC_2, 3, _4, and _5, of which the complete plasmid 611
maps are not shown. In the pSDcpdC_2 to _5 series, a Factor Xa gene sequence is 612
included as shown. The IPTG-inducible pSD80 vector forms the skeleton of all plasmid 613
derivatives. The complete sequence of all derivatives are known. 614
615
Figure 3. Phylogenetic analysis of CpdC の-pentadecalactone hydrolase in relation to 616
other lactone hydrolases of the cycloalkanol/cyclohexanol pathways and its PDB 617
structural homologs (3K6K, 3V9A and 3FAK). The top three most identical sequence 618
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 24: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/24.jpg)
24
candidates in a BLAST search (one from Bradyrhizobium and two from uncultured 619
bacteria) are also shown with their GenBank accession numbers. The various ChnC, 620
CddB or CpnC sequences are derived from the following accession numbers: ChnC, 621
Rhodococcus sp. HI-31 (BAH56676); ChnC, Rhodococcus sp. TK6 (AAR27823); ChnC, 622
Rhodococcus sp. Phi2 (AAN37490); ChnC, Arthrobacter sp. BP2 (AAN37478); ChnC, 623
Acinetobacter sp. NCIMB 9871 (BAC80218); ChnC, Polaromonas sp. JS666 624
(YP_552313); ChnC, Brachymonas petroleovorans CHX (AAR99067); ChnC2, 625
Rhodococcus sp. HI-31 (BAH56669); CddB, Rhodococcus ruber SC1 (AAL14234); 626
CpnC, Comamonas sp. NCIMB 9872 (BAC22650); ChnC2, Brevibacterium sp. HCU 627
(AAK73167). ChnC, Nocardia sp. NCIMB 11399 and Brevibacterium oxydans IH-35A 628
are unpublished data from this laboratory. The phylogenetic tree was constructed with 629
Poisson model with bootstrap 1000 using the MEGA 5.1 software [19]. The scale 0.1 is 630
the genetic distance. 631
632
Figure 4. Sodium dodecyl sulfate – 12 % polyacrylamide gel electrophoresis analysis of 633
CpdC purification. Lane 1, E. coli pSD80cpdC crude extract containing CpdC; lane 2, 634
after DEAE-Sepharose; lane 3, after Superdex 75. Marker proteins with indicated 635
molecular masses (Mr) in kilodaltons are indicated alongside. 636
637
Figure 5. Determination of thermostability, thermodenaturation constants and half- life of 638
CpdC. a) Thermostability data measured at the specified temperatures. Enzyme activity 639
was assessed by the phenol red test with caprolactone as substrate. b) Estimated 640
denaturation constants (Kd) and the associated enzyme half lives where t1/2 = ln2 / Kd 641
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 25: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/25.jpg)
25
Figure 6. (a) Fusion protein production of CpdC-AoCut_1 to 5 analyzed on SDS-15 % 642
PAGE and silver-stained. M indicates molecular marker proteins with the indicated Mr(s). 643
S and I indicate soluble and insoluble fractions of the respective crude extracts. Subscript 644
0 indicates no induction by IPTG; 1 and 2 are repeated samples after induction. (b) 645
Production of CpdC-fusion proteins containing azurin or MPT63 analyzed on SDS-17 % 646
PAGE and stained with Coomassie blue. The positions of the fusion proteins are 647
indicated by arrows in the soluble S1 (azurin) and S2 (MPT63) fractions. 648
649
650
Supplemental Information: 651
652
Table S1. 653
Table S2. 654
Table S3. 655
656
Fig S1abc. 657
Fig S2. 658
Fig. S3abc. 659
Fig S4. 660
661 662 663 664 665 666
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 34: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/34.jpg)
Strains Relevant genotype or phenotype Source
Pseudomonas sp. HI-70 Grows on cyclopentadecanol or cyclopentadecanone Iwaki et al., 2006
E. coli
XL1-Blue recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 [F’ lacIq
ZM15 Tn10(Tetr)]
Bullock et al, 1987
BL21StarTM(DE3) F┽ ompT hsdSB (rB-mB-) gal dcm rne131 (DE3) Invitrogen
TOP 10 F┽ mcrA 〉(mrr-hsdRMS-mcrBC) f80lacZ〉M15
〉lacゅ74 recA1 araD139 〉(ara-leu)7697 galU galK
rpsL (StrR) endA1 nupG
Invitrogen
Plasmid
pUC19 Cloning vector with lac promoter; ApR Yanisch-Perron et al.,
1985
pSD80 Expression vector with tac promoter; pBR322 ori, ApR Smith et al., 1996
pCD400 8.2-kb BamHI-SalI fragment from Pseudomonas sp.
strain HI-70 in pUC19; ApR
This study
pSD80cpdC cpdC in pSD80; ApR This study
pETAzurin PT7::NatSig-Azurin, Ori(pBR322), ApR Lab stock
pETMPT63 PT7::NatSig-MPT63, Ori(pBR322), ApR Lab stock
pFlagAoCut Ptac::flagP::AoCut, Ori(pBR322), ApR Lab stock
pSD80Azurin Ptac::NatSig-Azurin, Ori(pBR322), ApR Lab stock
pSD80MPT63 Ptac::NatSig-MPT63, Ori(pBR322), ApR Lab stock
pSD80CfCut Ptac ::CfCut, Ori(pBR322), ApR Lab stock
pSD80RHA1 Ptac ::RHA1, Ori(pBR322), ApR Lab stock
pSDcpdC_1 Ptac::cpdC1, Ori(pBR322), ApR This study
pSDcpdC_2 Ptac::cpdC2, Ori(pBR322), ApR This study
pSDcpdC_3 Ptac::cpdC3, Ori(pBR322), ApR This study
pSDcpdC_4 Ptac::cpdC4, Ori(pBR322), ApR This study
pSDcpdC_5 Ptac::cpdC5, Ori(pBR322), ApR This study
pSDcpdC-AoCut_1 Ptac::cpdC1::AoCut, Ori(pBR322), ApR This study
pSDcpdC-AoCut_2 Ptac::cpdC2::AoCut, Ori(pBR322), ApR This study
pSDcpdC-AoCut_3 Ptac::cpdC3::AoCut, Ori(pBR322), ApR This study
pSDcpdC-AoCut_4 Ptac::cpdC4::AoCut, Ori(pBR322), ApR This study
pSDcpdC-AoCut_5 Ptac::cpdC3::AoCut, Ori(pBR322), ApR This study
pSDcpdC-CfCut_1 Ptac::cpdC1::CfCut, Ori(pBR322), ApR This study
pSDcpdC-CfCut_2 Ptac::cpdC2::CfCut, Ori(pBR322), ApR This study
pSDcpdC-CfCut_3 Ptac::cpdC3::CfCut, Ori(pBR322), ApR This study
pSDcpdC-CfCut_4 Ptac::cpdC4::CfCut, Ori(pBR322), ApR This study
pSDcpdC-CfCut_5 Ptac::cpdC5::CfCut, Ori(pBR322), ApR This study
pSDcpdC-RHA1_1 Ptac::cpdC1::RHA1, Ori(pBR322), ApR This study
pSDcpdC-RHA1_2 Ptac::cpdC2::RHA1, Ori(pBR322), ApR This study
pSDcpdC-RHA1_3 Ptac::cpdC3::RHA1, Ori(pBR322), ApR This study
pSDcpdC-RHA1_4 Ptac::cpdC4::RHA1, Ori(pBR322), ApR This study
pSDcpdC-RHA1_5 Ptac::cpdC5::RHA1, Ori(pBR322), ApR This study
pSDcpdC-MPT63_5 Ptac::cpdC::MPT63, Ori(pBR322), ApR This study
pSDcpdC-Azurin_5 Ptac::cpdC5::Azurin, Ori(pBR322), ApR This study
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 35: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/35.jpg)
Table 2. Substrate specificity and kinetic parameters of CpdC
Substrate Spec.
Act.
(U/mg)
kcat
(s-1
)
Km
(mM)
kcat/Km
(s-1
M-1
)
h-Valerolactone
18.7 - - -
€-Caprolactone 120 112 6.6 1.7x104
Lauryl lactone 283 264 0.2 1.2x106
の-Pentadecalactone
575 537 2.0 2.7x105
く-Butyrolactone
1.6 - - -
け-Valerolactone
0.1 - - -
け-Thiobutyrolactone
10.6 - - -
け-Octanoic lactone
0.1 - - -
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from
![Page 36: Characterization of CpdC, a large-ring lactone hydrolyzing ...aem.asm.org/content/aem/early/2013/09/09/AEM.02435-13.full.pdf · 9/9/2013 · 112 The crude extract was applied onto](https://reader033.fdocuments.in/reader033/viewer/2022060711/6077fa5e745ffc27f0170a35/html5/thumbnails/36.jpg)
け-Dodecalactone 0.9 - - -
Bicyclononalactone <0.1 - - -
-, not determined
on April 15, 2021 by guest
http://aem.asm
.org/D
ownloaded from