Biochemical and functional characterization of triosephosphate isomerase from Mycobacterium...

Biochemical and functional characterizationoftriosephosphateisomerase fromMycobacteriumtuberculosis H37RvDivya Mathur, Gunjan Malik & Lalit C. Garg

Gene Regulation Laboratory, National Institute of Immunology, New Delhi, India

Correspondence: Lalit C. Garg, Gene

Regulation Laboratory, National Institute of

Immunology, Aruna Asaf Ali Marg, New Delhi

110067, India. Tel.: 191 11 26703652;

fax: 191 11 26162125; e-mail:

[email protected]; [email protected]

Present address: Gunjan Malik, Department

of Microbiology and Molecular Cell Biology,

Eastern Virginia Medical School, 700 West

Olney Road, Norfolk, VA 23507, USA.

Received 6 April 2006; revised 18 July 2006;

accepted 26 July 2006.

First published online 21 August 2006.

DOI:10.1111/j.1574-6968.2006.00420.x

Editor: Wilfrid Mitchell

Keywords

triosephosphate isomerase; Mycobacterium

tuberculosis ; glycolysis; glyceraldehyde-3-

phosphate.

Abstract

Triosephosphate isomerase (TPI), one of the key enzymes of the glycolytic

pathway, is an attractive drug target against Mycobacterium tuberculosis as

glycolysis provides the majority of the organism’s energy requirements inside

macrophages. To carry out biochemical and biophysical characterization, purified

recombinant M. tuberculosis TPI produced in Escherichia coli was used. Mass

spectrum analysis showed M. tuberculosis rTPI to be of 28 213 Da. The biologically

active enzyme is a homodimer as determined by gel filtration chromatography.

The M. tuberculosis TPI had a pH optimum in the range of 6–8 and a temperature

optimum around 37 1C. Circular dichroism spectra analysis revealed that loss of

secondary structure of rTPI occurs around 60 1C. Metal cations were not required

for M. tuberculosis TPI activity. The kcat was 4.1� 106 min�1. Importantly, the

apparent Km value of M. tuberculosis rTPI for the substrate glyceraldehyde-3-

phosphate is 84 mM which is sevenfold higher than the value reported for human

TPI. The difference in Km is indicative of the difference in the active site of the

human and M. tuberculosis TPI, which can be exploited for drug designing

specifically targeting M. tuberculosis TPI.

Introduction

Tuberculosis is a major infectious disease that accounts

for over 2 million deaths every year. Currently, one-third of

the world’s population is infected with tubercle bacilli

(Murray & Salomon, 1998). Incidences of tuberculosis have

increased globally due to the progressive multidrug resis-

tance seen among clinical isolates and the emergence of

tuberculosis as an opportunist infection in immunocom-

promised subjects.

Mycobacterium tuberculosis, the causative agent of tuber-

culosis, enters the human host by inhalation of infectious

aerosols. Once inside the alveolar tissue, it is engulfed by

macrophages where it can remain in a quiescent state for a

long period. To adapt to the hypoxic environment inside

macrophages, M. tuberculosis metabolism shifts from an

aerobic to an anaerobic mode and expression of genes

encoding enzymes of the glycolytic pathway is upregulated.

In this quiescent or ‘persistent’ state of M. tuberculosis, 70%

of the organism’s energy requirement is provided by glyco-

lysis (Bai et al., 1975). Thus, glycolysis is central to the

mycobacterium’s survival inside the host tissue.

The search for newer drug targets against pathogens has

led to the development of inhibitors designed to specifically

inactivate key pathogen enzymes. Genome sequencing of M.

tuberculosis has identified probable genes involved in glucose

metabolism by homology search. They are expected to aid

the process of characterization of the pathway, and this may

further facilitate in deciphering species-specific enzyme

differences. Specific differences in the biochemical proper-

ties of metabolic enzymes between the host and the patho-

gen have been exploited to develop drugs targeting the

pathogen.

Triosephosphate isomerase (TPI; E.C.5.3.1.1.) is an

essential component of the Embden–Meyerhof pathway,

interconverting dihydroxyacetone phosphate and glyceralde-

hyde-3-phosphate. In glycolysis, TPI channels these two

products for the formation of pyruvate, while in gluconeo-

genesis, TPI ensures that both substrates are supplied to

aldolase. TPI is a well-characterized enzyme both structurally

FEMS Microbiol Lett 263 (2006) 229–235 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

and functionally, and represents a prototype of the widely

occurring (a/b)8 TIM barrel fold (Kursula & Wierenga, 2003;

Walden et al., 2004).

TPI is a homodimeric protein, and the folding pathway is

described by its first-order folding to a monomer, followed

by a rate-limiting second-order association reaction. This

two-step process leads to the formation of a structured

monomer before dimer formation (Rietveld & Ferreira,

1998). TPIs from many pathogenic sources such as Plasmo-

dia and Trypanosoma contain a cysteine residue 15 at the

dimer interface that plays an essential role in stability of the

dimer (Gomez-Puyou et al., 1995; Hernandez-Alcantara

et al., 2002). As in humans, this residue is replaced by

methionine, the Cys15 of these pathogens has been a target

of various studies with a view towards developing selective

covalent inhibitors. Chemical modifications and mutations

of this residue result in a drastic reduction of enzymatic

activity, reduced stability to denaturants and an increased

population of monomeric species (Maithal et al., 2002;

Tellez-Valencia et al., 2004). Like in humans, the TPI from

M. tuberculosis H37Rv has methionine instead of the Cys15

found in Plasmodia and Trypanosoma. Therefore, drugs

targeting the Cys15 of TPI of these pathogens cannot be

used for M. tuberculosis TPI. Alternative structural or

biochemical differences that exist between TPI of M. tuber-

culosis, and its host has to be identified to enable design of

specific drug targets. This study was undertaken with the

aim of analyzing such differences. Here we describe, for the

first time, a detailed biochemical and functional character-

ization of triosephosphate isomerase from M. tuberculosis

H37Rv.

Materials and methods

All chemicals were of analytical grade and purchased from

Sigma Chemical Company, USA, unless stated otherwise.

Plasmid pET-22b(1) expression vector was from Novagen,

USA. Escherichia coli DH5a and BL21 (DE3) strains were

obtained from Novagen.

BAC genomic library of M. tuberculosis was obtained

from Prof. Stewart Cole of the Institut Pasteur (Cole et al.,

1998).

Cloning of tpi of M. tuberculosis in expressionvector

The full-length tpi was amplified using gene-specific primers

(forward-50CCAACATATGAGCCGCAAGCCGCTGATAG30

and reverse-5 0CCAACTCGAGCAACGGACCACCGGCCGC

AATC30) designed on the basis of genome sequence infor-

mation of M. tuberculosis H37Rv (Accession No. AL123456).

NdeI and XhoI sites (underlined) were introduced into the

forward and reverse primers, respectively, for convenient

cloning in expression vector pET-22b(1). The tpi was

amplified using genomic DNA isolated from a BAC genomic

library of M. tuberculosis as template and Taq DNA poly-

merase for 30 cycles of denaturation at 94 1C for 1 min,

annealing at 60 1C for 2 min and extension at 72 1C for 1 min

with a final extension at 72 1C for 7 min in GeneAmp PCR

system (Perkin Elmer). The amplified product, purified

using Qiagen mini columns (Qiagen, Germany) as per

manufacturer’s instructions, was digested with NdeI and

XhoI and cloned into plasmid pET-22b(1) digested with the

same enzymes. The ligation mixture was transformed into

E. coli BL21 (DE3) cells (Novagen) and selected on LB agar

plates containing ampicillin (100 mg mL�1). Recombinant

colonies were analyzed by restriction digestion with

XhoI and NdeI for the release of the insert and confirmed

by automated DNA sequencing using Applied Biosystem

Model 393A.

Expression, purification and immunoblotanalysis of recombinant TPI

His-tagged M. tuberculosis TPI was produced by inducing

E. coli BL21 (DE3) cells harbouring the M. tuberculosis

tpi gene in pET-22b(1) expression vector essentially as

described previously (Mathur et al., 2005). Cells were grown

to A600 nm = 0.5 at 37 1C. rTPI expression was induced by

the addition of 1 mM isopropyl-b-D-thiogalactopyrano-

side (IPTG), and the induced culture was grown further

for 8 h.

All purification procedures were performed at 4 1C. The

induced cells from 250 mL culture were harvested by cen-

trifugation at 5000 g for 10 min and suspended in 12.5 mL

sonication buffer (50 mM NaH2PO4, 300 mM NaCl, pH

7.8). Cells were lysed by sonication (1 min pulse on followed

by 30 s pulse off for 30 cycles; MISONIX). The lysate was

centrifuged at 12 000 g for 20 min at 4 1C. The His-tagged

rTPI was purified from the soluble fraction of the induced

cells using Ni-NTA (Qiagen) affinity chromatography

(Mukhija et al., 1994). Ni-NTA agarose beads were added

to the sonication supernatant (1 mL L�1 of culture) and

allowed to bind for 1 h with end-to-end shaking. Following

the addition of Ni-NTA agarose beads, all centrifugation

steps were performed at 1200 g in a swing out rotor for

2 min. Flow through was discarded and nonspecifically

bound proteins were removed by washing the beads twice

in 15 mL of Tris-phosphate buffer (0.01 M Tris, 0.1 M

sodium dihydrogen phosphate, pH 8.0). The recombinant

protein was eluted in 12.5 mL of 250 mM imidazole (in Tris-

phosphate buffer).

For Western blotting, purified rTPI was electrophoresed

in a 12% polyacrylamide gel and transferred onto a nitro-

cellulose membrane. The blot was probed with Ni-NTA

HRPO conjugate (Qiagen) and developed with 3,30-diami-

nobenzidine (DAB).

FEMS Microbiol Lett 263 (2006) 229–235c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

230 D. Mathur et al.

Gel filtration chromatography of rTPI

Purified rTPI (500mg) was loaded on a Superdex-75 10/300

GL gel filtration FPLC column (Amersham Pharmacia

Biotech, UK) pre-equilibrated with 10 mM Tris-phosphate

buffer, pH 7.6 and eluted in the same buffer.

UV cross-linking of rTPI

The rTPI (50mg, 1 mgmL�1) in 10 mM Tris-phosphate buffer,

pH 7.6, was irradiated using a UV transilluminator

(312 nm) on ice for 15 min and analyed by sodium dodecyl

sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Determination of protein concentration andenzyme activity

A BCA protein assay kit (Pierce) was used for protein

estimation using bovine serum albumin (BSA) as standard.

rTPI activity was determined spectrophotometrically

(Gracy, 1975). The assay mixture in a total volume of 1 mL

contained 0.1 mM triethanolamine buffer (pH 7.6), 2 mM

EDTA, 0.5 mM b-NADH, 1 U a-glycerophosphate dehydro-

genase, 2 mM glyceraldehyde-3-phosphate and an aliquot of

purified recombinant enzyme. The reaction was initiated by

the addition of the enzyme and was followed for 5 min at

room temperature, i.e. 25 1C, unless otherwise stated. The

activity was measured by monitoring the change in the

absorbance at 340 nm using a Lambda25 spectrophotometer

(Perkin Elmer). One unit of rTPI was defined as the amount

of protein that oxidizes 1 mmoL of b-NADH in 1 min.

Effect of metal ions on rTPI activity

Recombinant TPI was checked for its dependence on cations

as cofactors by the addition of different amounts of various

cations in the assay mixture.

Determination of thermal stability, temperatureand pH optima for rTPI

Thermal stability of rTPI was determined by measuring the

residual activity of purified rTPI that had been incubated at

various temperatures for 30 min. The optimum temperature

for rTPI function was studied by assaying enzyme activity at

different temperatures. To determine the pH optimum for

rTPI, enzyme activity was measured in 50 mM buffer of

various pH values from 3 to 12 (pH 3.0–5.0, sodium acetate

buffer; pH 6.0–7.0, imidazole buffer; pH 8.0–12.0, Tris-HCl

buffer).

Determination of secondary structure by circulardichroism (CD)

CD measurements of the M. tuberculosis rTPI (0.15 mg mL�1

in 5 mM Tris-phosphate buffer, pH 7.6) were performed

at different temperatures using a JASCO-J710 spectropolari-

meter (Easton, MO), in a 0.1 cm path length cell. The

temperature was controlled with a JASCO PTC-348W

temperature controller. The spectra in the near and far

ultraviolet (190–320 nm) were recorded at a scanning speed

of 20 nm min�1. Ten spectra were accumulated in each case

and averaged followed by baseline correction by subtraction

of the buffer spectrum. Mean residue weight ellipticities

were calculated and expressed in units of degree cm2 dmol�1.

Kinetic properties of rTPI

The kinetic parameters of purified rTPI were determined. The

Michaelis–Menten constant was determined in the reverse

reaction using different concentrations of glyceraldehyde-

3-phosphate and �9.5 pmol of the purified rTPI at room

temperature in 1 mM Tris-phosphate buffer, pH 7.6. Km and

kcat (Vmax/molar concentration of the enzyme) were deter-

mined using Lineweaver–Burk plots. It is to be noted that

glyceraldehyde-3-phosphate exists in neutral aqueous solu-

tions as a mixture of keto, gem-diol and enolic forms.

However, the true substrates of the TPI are only the free

carbonyl forms of glyceraldehyde-3-phosphate and not the

corresponding hydrated gem-diol forms (Trentham et al.,

1969; Reynolds et al., 1971). It has been shown that the

substrate for TPI exists in aqueous solution as a mixture of

free aldehyde and gem-diol in the ratio of 1 : 29 (Trentham

et al., 1969). Therefore, to obtain the actual Km, the apparent

Km was corrected with this factor (Hartman & Norton, 1975).

Results and discussion

Sequence analysis of M. tuberculosis TPI

To identify the amino acid residues conserved within

triosephosphate isomerases from different enzymes, the

protein data bank was searched for TPI from other enzymes.

The deduced amino acid sequence of the M. tuberculosis tpi

clone was subjected to alignment with other TPIs using

CLUSTALW (Thompson et al., 1994). Considerable variations

in amino acid sequence were found between species. Myco-

bacterium tuberculosis TPI shares only 37% identity to

human TPI (data not shown). Phylogenetic analysis revealed

that eukaryotic TPI’s are closely related to those from

Alphaproteobacteria, but only distantly related to those from

archaebacteria. This suggests that the TPI genes present in

the modern eukaryotic genomes may have been derived

from an Alphaproteobacterial genome after the divergence

of Archaea and Eukarya (Keeling & Doolittle, 1997).

Purification of recombinant M. tuberculosis TPI

For expression purposes, a XhoI–NdeI fragment harbouring

the full length tpi encoding a protein of 261 residues was


231M. tuberculosis triosephosphate isomerase

cloned into the pET-22b(1) expression vector and ex-

pressed in E. coli BL21 (DE3) cells. The purified protein

obtained through one step Ni-NTA affinity purification

from the soluble fraction appeared to be free of any

detectable impurities when analysed by SDS-PAGE

(Fig. 1a). This was further confirmed by immunoblot

analysis of the purified rTPI using Ni-NTA HRPO conjugate

(Fig. 1b). The rTPI thus purified was used for detailed

biochemical and biophysical characterization. The rTPI was

stable in Tris-phosphate buffer as no aggregation, degrada-

tion, or loss of the enzyme activity, were observed even when

the purified rTPI was stored at 4 1C for 6 months.

Determination of molecular weight andoligomerization of rTPI

On SDS-PAGE, the purified rTPI runs as a single band and

the monomer molecular weight of rTPI was estimated to be

�30 kDa (Fig. 1a). The accurate molecular mass of the

purified rTPI by mass spectrum analysis was determined to

be 28 213 Da. It is established that TPI from all known

species is homodimeric except for the enzymes in Thermo-

toga maritima and Pyrococcus woesei that are tetrameric

(Maes et al., 1999; Walden et al., 2001).

Gel filtration of rTPI was, therefore, carried out to

investigate whether M. tuberculosis rTPI forms an oligomer.

Upon gel filtration chromatography, rTPI eluted at 9.41 mL

(Fig. 2a). The molecular weight of the protein in the peak

was calculated to be �60.25 kDa. SDS-PAGE analysis

showed only a single band of �30 kDa (inset of Fig. 2a),

suggesting that the rTPI is a homodimer. As cross-linking is

routinely used to study interaction between protein mono-

mers (Gottfried et al., 2004), UV cross-linking of the rTPI

was performed to further confirm the dimerization of rTPI

(Fig. 2b). A band at �66 kDa, in addition to the monomeric

protein band at �30 kDa, can be seen in the UV-crosslinked

sample (lane 2), whereas untreated sample gave only a single

band at �30 kDa. The band at the 30 kDa position in the

cross-linked sample represents the noncrosslinked popula-

tion of rTPI molecules. The mass of the UV-crosslinked

undissociated protein appears to be greater than the

2� mass of the monomer. This happens when the dimer-

ization does not take place in a head-to-tail fashion. It

appears that the cross-linked dimer attains a conformation

which migrates more slowly than the two monomers linked

in head to tail fashion. These data collectively suggest that

like TPI from most other species, M. tuberculosis rTPI also

forms a homodimer. In some preparations, a small fraction

of the rTPI eluted as a monomer in gel filtration (data not

shown). It is of interest to note that in such preparations, the

enzyme activity was observed only in the peak fractions

corresponding to the dimeric form of the enzyme. Our data

are in agreement with earlier observations, where only the

dimeric form of the enzyme has been found to be active,

even though each monomer has its own catalytic site

(Zomosa-Signoret et al., 2003). The disruption of the

dimeric form of the enzyme has thus been the focus for

selective drug designing (Jackson & Phillips, 2002).

Catalytic and kinetic properties of rTPI

Purified rTPI enzyme exhibited very high specific activity

and, therefore, assays were performed using enzyme dilu-

tions in the reaction mixture. The specific activity of

purified rTPI was 5700 U mg�1 protein. The optimum pH

and temperature for the recombinant TPI were determined

kDa66

45

30

20

6645

30

20

M 1 kDa M 1(a) (b)

Fig. 1. (a) SDS-PAGE (12%) of rTPI. Lane 1 shows the purified rTPI

stained with Coomassie brilliant blue. kDa denotes the migration of

protein molecular weight markers in lane M. (b) Immunoblot analysis of

purified Mycobacterium tuberculosis rTPI with Ni-NTA HRPO conjugate.

Lane 1, rTPI. Lane M, Protein molecular weight markers.

Monomer

Log

mol

ecul

ar w

eigh

t

0.0

0.5

1.0

1.5

2.0

−50

0

50

100

150

200

Abs

orba

nce

at 2

80 n

m (

mA

U)

0.0 5.0 10.0 15.0 20.0

Elution Volume (mL)

25.0

BSA

RNase

OvalbuminChymotrypsinogen

(a) (b)kDa M 1 2

20

14

30

45

66

97

Dimer

Fig. 2. (a) Gel filtration chromatography of

purified rTPI: Log of the molecular weights

of the standards – BSA (67 kDa), ovalbumin

(43 kDa), chymotrypsinogen (30 kDa) and

RNase (13.7 kDa) were plotted against their

elution volumes. Inset: SDS-PAGE of the

rTPI peak fraction (lane 1). M corresponds

to the protein molecular weight markers.

(b) SDS-PAGE of UV-crosslinked rTPI. Lanes

1 and 2 correspond to the untreated and

UV-crosslinked rTPI, respectively.



to be 7.0 and 37 1C, respectively (data not shown). Depen-

dence of TPI activity on metal cofactors has not been

reported from any source. To test the effect of metal cations

on TPI activity, cations were added to the assay mixture at

various concentrations. Mycobacterium tuberculosis TPI did

not show any preference for metal cations, and no signifi-

cant change in enzyme activity was observed in the presence

of 0–100 mM monovalent (K1) or divalent (Ca21, Mg21)

cations added as chloride salts. However, enzyme activity

was inhibited nonspecifically when 500 mM cations were

used in the reaction mix. No difference in the reaction

profile was observed when assays were performed in the

presence of EDTA (data not shown).

To determine the thermal stability of rTPI, the enzyme

was incubated at different temperatures (0–70 1C) in 1 mM

Tris-phosphate buffer (pH 7.6) for 30 min, and residual

activity was measured at 25 1C. The enzyme was stable up to

50 1C. At 55 1C, the enzyme retained approximately half of

its activity but it was completely inactivated at 60 1C (data

not shown). Loss of enzyme activity was also corroborated

by the CD scan analysis of rTPI. The thermal unfolding

curve of rTPI in the near and far UV regions is shown in

Fig. 3. CD spectrum analysis revealed that up to 50 1C, the

rTPI retained the characteristic a helical and b sheet

structures. At 55 1C, the protein began to lose its well-

defined secondary structure, corroborating with the reduced

enzyme activity (50% of the unheated control) at this

temperature. Appearance of random coil structure at 60 1C

relates well to complete inactivation of the enzyme.

The enzyme followed Michaelis–Menten kinetics for the

substrate glyceraldehyde-3-phosphate, and Km and Vmax

were determined using the Lineweaver–Burk plot (Fig. 4).

At room temperature, the Km of rTPI was determined

to be 84mM for glyceraldehyde-3-phosphate after correction

for the unhydrated form of glyceraldehyde-3-phosphate,

and kcat was 4.1� 106 min�1. Vmax of the reaction was

39 mmol min�1.

The estimated Km of mycobacterial rTPI is similar to the

Km data reported for TPI from other bacterial species

(Krietsch, 1975), but is sevenfold higher than the Km of TPI

from its human counterpart (Gracy, 1975; Repiso et al.,

2002). A higher Km suggests that the mycobacterial enzyme

320

Wavelength (nm)

20

10

0

−10

[θ] ×

10−3

deg

× c

m2

dmol

−1

20�C37�C50�C55�C60�C

300275250225200190

Fig. 3. Effect of temperature on the circular dichroism spectra of rTPI in

the far and near UV regions. CD spectra of Mycobacterium tuberculosis

rTPI at different temperatures were obtained. CD values are expressed as

[y], mean residue mass elipticity in units of degree� cm2 dmol�1.

V0

(mM

ol m

in–1

)

Gly-3-P (mM)

0.04

0.03

0.02

0.01

00 5 10 15 20 25 30

Fig. 4. Kinetic analysis of rTPI of Mycobacterium

tuberculosis. The enzyme assays were conducted

at various glyceraldehyde-3-phosphate (Gly-3-P)

concentrations and with 9.5pmol of the

recombinant enzyme under standard assay

conditions. Michaelis–Menten plot (V0 vs. [S]) of

rTPI is shown. V0 indicates the initial velocity of

the reaction and [S] is substrate concentration.

Inset: Lineweaver–Burk plot. The values

reported are the average of at least three

independent determinations. The Km calculated

by Lineweaver–Burk plot was adjusted for the

unhydrated form of the substrate.



probably has a more open active site pocket compared with

that of human TPI. TPI enzymes show a high degree of

conservation of the active site. However, outside the active

site there is considerable sequence variation, which may be

responsible for such structural differences leading to cataly-

tic variations between enzymes from various sources. Thus,

the active site of mycobacterial TPI differs from that of the

human enzyme, and it would be interesting to study the

extent of the variation and its implications for the design of

effective inhibitors that target enzyme activity. Such differ-

ences between the host and pathogen TPIs can be exploited

for designing drugs which specifically target the pathogen.

Therefore, elucidation of the crystal structure of M. tubercu-

losis TPI is necessary to identify the characteristics unique

to M. tuberculosis TPI for effective drug designing.

Crystallization studies are now in progress as a step towards

this aim.

Acknowledgements

Financial support from the Department of Biotechnology,

India, is acknowledged. Authors thank Neha Sharma of the

University of Pennsylvania, USA, for critically reviewing the

manuscript. We thank Ram Bodh, Ved Prakash and K.P.

Pandey for technical assistance.

References

Bai NJ, Pai MR, Murthy PS & Venkitasubramanian TA (1975)

Pathways of carbohydrate metabolism in Mycobacterium

tuberculosis H37Rv. Can J Microbiol 21: 1688–1691.

Cole ST, Brosch R, Parkhill J et al. (1998) Deciphering the biology

of Mycobacterium tuberculosis from the complete genome

sequence. Nature 393: 537–544.

Gomez-Puyou A, Saavedra-Lira E, Becker I, Zubillaga RA, Rojo-

Dominguez A & Perez-Montfort R (1995) Using evolutionary

changes to achieve species-specific inhibition of enzyme

action-studies with triosephosphate isomerase. Chem Biol 2:

847–855.

Gottfried P, Kolot M, Silberstein N & Yagil E (2004)

Protein–protein interaction between monomers of coliphage

HK022 excisionase. FEBS Lett 577: 17–20.

Gracy RW (1975) Triosephosphate isomerase from human

erythrocytes. Methods in Enzymology, Vol. 41 (Colowich

SR & Kaplan NO, eds), pp. 442–447. Academic Press,

London.

Hartman FC & Norton IL (1975) Triosephosphate isomerase

from rabbit muscle. Methods in Enzymology, Vol. 41 (Wood

WA, ed), pp. 447–453. Academic Press, London.

Hernandez-Alcantara G, Garza-Ramos G, Hernandez GM,

Gomez-Puyou A & Perez-Montfort R (2002) Catalysis

and stability of triosephosphate isomerase from

Trypanosoma brucei with different residues at position

14 of the dimer interface. Characterization of a

catalytically competent monomeric enzyme. Biochemistry

41: 4230–4238.

Jackson LK & Phillips MA (2002) Target validation for drug

discovery in parasitic organisms. Curr Top Med Chem 2:

425–438.

Keeling PJ & Doolittle WF (1997) Evidence that eukaryotic

triosephosphate isomerase is of alpha-proteobacterial origin.

Proc Natl Acad Sci USA 94: 1270–1275.

Krietsch WK (1975) Triosephosphate isomerase from yeast and

triosephosphate isomerase from rabbit liver. Methods in

Enzymology, Vol. 41 (Colowich SR & Kaplan NO, eds),

pp. 434–442. Academic Press, London.

Kursula I & Wierenga RK (2003) Crystal structure of

triosephosphate isomerase complexed with 2-

phosphoglycolate at 0.83-A resolution. J Biol Chem 278:

9544–9551.

Maes D, Zeelen JP, Thanki N et al. (1999) The crystal structure

of triosephosphate isomerase (TIM) from Thermotoga

maritima: a comparative thermostability structural

analysis of ten different TIM structures. Proteins 37:

441–453.

Maithal K, Ravindra G, Balaram H & Balaram P (2002)

Inhibition of Plasmodium falciparum triose-phosphate

isomerase by chemical modification of an interface cysteine.

Electrospray ionization mass spectrometric analysis of

differential cysteine reactivities. J Biol Chem 277:

25106–25114.

Mathur D, Ahsan Z, Tiwari M & Garg LC (2005) Biochemical

characterization of recombinant phosphoglucose isomerase of

Mycobacterium tuberculosis. Biochem Biophys Res Commun

337: 626–632.

Mukhija R, Rupa P, Pillai D & Garg LC (1994) High-level

production and one-step purification of biologically active

human growth hormone in Escherichia coli. Gene 165:

303–306.

Murray CJ & Salomon JA (1998) Modeling the impact of global

tuberculosis control strategies. Proc Natl Acad Sci USA 95:

3881–3886.

Repiso A, Boren J, Ortega F, Pujades A, Centelles J, Vives-Corrons

JL, Climent F, Cascante M & Carreras J (2002) Triosephosphate

isomerase deficiency. Genetic, enzymatic and metabolic

characterization of a new case from Spain. Haematologica

87: ECR12.

Reynolds SJ, Yates DW & Pogson CI (1971) Dihydroxyacetone

phosphate. Its structure and reactivity with a-glycerophosphate

dehydrogenase, aldolase and triose phosphate isomerase

and some possible metabolic implications. Biochem J 122:

285–297.

Rietveld AW & Ferreira ST (1998) Kinetics and energetics of

subunit dissociation/unfolding of TIM: the importance of

oligomerization for conformational persistence and chemical

stability of proteins. Biochemistry 37: 933–937.

Tellez-Valencia A, Olivares-Illana V, Hernandez-Santoyo A,

Perez-Montfort R, Costas M, Rodriguez-Romero A, Lopez-

Calahorra F, De Gomez-Puyou MT & Gomez-Puyou A (2004)



Inactivation of triosephosphate isomerase from Trypanosoma

cruzi by an agent that perturbs its dimer interface. J Mol Biol

341: 1355–1365.

Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W:

improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, position-specific gap

penalties and weight matrix choice. Nucleic Acids Res 22:

4673–4680.

Trentham DR, McMurray CH & Pogson CI (1969) The active

chemical state of D-glyceraldehyde 3-phosphate in its

reactions with D-glyceraldehyde 3-phosphate dehydrogenase,

aldolase and triose phosphate isomerase. Biochem J 114:

19–24.

Walden H, Bell GS, Russell RJ, Siebers B, Hensel R & Taylor

GL (2001) Tiny TIM: a small, tetrameric, hyperthermostable

triosephosphate isomerase. J Mol Biol 306: 745–757.

Walden H, Taylor GL, Lorentzen E, Pohl E, Lilie H, Schramm A,

Knura T, Stubbe K, Tjaden B & Hensel R (2004) Structure

and function of a regulated archaeal triosephosphate

isomerase adapted to high temperature. J Mol Biol 342:

861–875.

Zomosa-Signoret V, Hernandez-Alcantara G, Reyes-Vivas H,

Martınez-Martınez E, Garza-Ramos G, Perez-Montfort R,

de Gomez-Puyou MT & Gomez-Puyou A (2003) Control of

the reactivation kinetics of homodimeric triosephosphate

isomerase from unfolded monomers. Biochemistry 42:

3311–3318.



Biochemical and functional characterization of triosephosphate isomerase from Mycobacterium...

Documents

Transcript of Biochemical and functional characterization of triosephosphate isomerase from Mycobacterium...