'lb JOURNAL OF BIOUCICAL C m s ~ n v 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 269, No. 9, Issue of March 4, pp. 6874-6877, 1994 Printed in U.S.A.

Protein Disulfide Isomerase Associates with Misfolded Human Lysozyme in Vivo*

(Received for publication, September 1, 1993, and in revised form, November 2, 1993)

Mieko OtsuS, Fumihiko OmuraSB, Tamotsu Yoshimorin, and Masakazu KikuchiSII From the protein Engineering Research Institute, 6-2-3, Furuedai, Suita, Osaka 565, Japan and the %Department of Physiology, Kansai Medical University, Osaka 570, Japan

Wild-type human lysozyme (hLzM) is quantitatively secreted into the media when expressed in mouse fibro- blast cells, but some misfolded hLZMs are retained and rapidly degraded in a pre-Golgi compartment (Omura, F., Otsu, M., Yoshimori, T., Tashiro, Y., and Kikuchi, M. (1992) Eur. J. Biochem. 210,591499). To detect the asso- ciation with misfolded hLZMs of cellular proteins in- volved in their folding, retention, and pre-Golgi degra- dation, a co-precipitation experiment was carried out using anti-hLZM antibody and metabolically labeled cell lysates, which were treated with a membrane-permea- ble cross-linking reagent. Here we report that protein disulfide isomerase associated in vivo with misfolded hLZMs, but not with the wild-type protein, and discuss the possible role of protein disulfide isomerase in the quality control of newly synthesized proteins in the en- doplasmic reticulum.

It has been generally accepted that folding of secretory and membrane proteins occurs in the endoplasmic reticulum (ER)l (1). Intracellular folding of polypeptides is thought to be helped occasionally by several ER resident proteins, such as immuno- globulin heavy chain-binding protein (BiP/GRP78) and protein disulfide isomerase (PDI), which are abundant in the ER (2). When abnormal or unassembled proteins are synthesized, they are offen retained and, in some cases, degraded in the ER (3-7). These processes may be important to control the quality of newly synthesized proteins in the cell.

PDI catalyzes the formation, reduction, and isomerization of disulfide bonds in proteins (8-10). This catalytic function has been confirmed by experiments i n vitro and in vivo (11, 12,271. Recently PDI was found to attack a glutathionylated protein, which may mimic an intermediate in the formation of a disul- fide bond, to dissociate a glutathione molecule (13). However, PDI seems to require a domain distinct from the active sites for thioVdisulfide interchange reactions, for its essential function in yeast cells (14). PDI is also known to be a multi-functional protein that serves as the P-subunit of prolyl 4-hydroxylase (E), glycosylation site-binding protein (161, thyroid hormone- binding protein (17), and the component of the microsomal lipid transfer protein complex (18). Furthermore, PDI may have

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "aduertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

8 Present address: Institute for Fundamental Research, Suntory Lim- ited, Osaka, Japan.

)I To whom correspondence should be addressed. Tel.: 81-6-872-8200;

tein disulfide isomerase; hLZM, human lysozyme; DSP, dithiobis(suc- The abbreviations used are: ER, endoplasmic reticulum; PDI, pro-

cinimidylpropionate); d E M , a-modified Eagle's minimum essential medium; PAGE, polyacrylamide gel electrophoresis.

Fax: 81-6-872-8210.

some chaperone-like function during the biosynthesis of pro- collagen (19), and during the formation of the heteromeric dimer of prolyl4-hydroxylase (20). However, more information on PDI function is still needed.

Human lysozyme (hLZM) is a monomeric secretory protein with four disulfide bonds; C y ~ ~ - C y s ~ ~ ~ , C y ~ ~ ~ - C y s l ' ~ , C y P - Cys", and C y ~ ~ ~ - C y s ~ ~ . The mutant hLZM C128A ( C ~ S ' ~ ~ + Ala) cannot fold correctly because of its inability to form the disulfide bond C y ~ ~ - C y s ' ~ ~ (21,22), and it is retained and rap- idly degraded in a pre-Golgi compartment when expressed in mouse L cells (7). To detect some intracellular protein factors which are involved in the retention, folding, or pre-Golgi deg- radation of secretory proteins, we expressed several mutant hLZMs in mouse L cells and examined the possibility of asso- ciation of some intracellular protein factors with mutant pro- teins. Here we report an apparent association of PDI with misfolded hLZMs in the cell.

EXPERIMENTAL PROCEDURES Materials-~-[~~SlMethionine was purchased from American Radio-

labeled Chemicals Inc. (St. Louis, MO), and an in vitro mutagenesis kit was from Amersham International (Buckinghamshire, UK). Protein A-Sepharose-CL-4B was obtained from Pharmacia LKB Biotechnology Inc. Dithiobis(succinimidy1propionate) (DSP) was purchased from Pierce Chemical Co.; the neomycin analogue G418 was from Life Tech- nologies, Inc.; brefeldin A, dithiothreitol, and (p-amidinopheny1)meth- ylsulfonyl fluoride were from Wako Pure Chemical Industries (Osaka, Japan); and soybean trypsin inhibitor was from Sigma. All other chemi- cals were of the best grade available.

Rabbit anti-hLZM antibody was raised by immunization with hLZM and purified by ammonium sulfate, followed by ion-exchange chroma- tography and affinity chromatography. Rabbit anti-bovine PDI antibody was raised by immunization with authentic bovine PDI and purified by fractionation with ammonium sulfate, followed by ion-exchange chro- matography. It was confirmed that this antibody reacted with mouse PDI.

DNA Manipulations-Construction of the expression plasmid used in this study, paLl25-ne0, was described previously (23). Site-directed mutagenesis for mutant lysozymes was camed out using the Amer- sham kit. The following mutagenic oligonucleotides were used, in which mismatches are indicated by underlines: P71V (Pro'l --j Val), 5'-

(Leu15 - Gly-yl6 + Asp, MeV7 - Ser), 5'-GAAC'ITTGAAGA- GAGGGGATTCGGACGGCTACCG-3'. Construction of other cysteine- related mutants was the same as described in a previous report (21).

Cell Culture and Establishment of Dansfectants-Mouse L cells de- ficient in thymidine kinase activity were obtained from the Institute for Molecular and Cellular Biology (Osaka, Japan). L cells were maintained in a-modified Eagle's minimum essential medium (aMEM) supple- mented with 10% fetal calf serum. Transfection of L cells and isolation of permanent transfectants were camed out as previously described (23). L cell transfectants were obtained after a 10-day selection for growth in the presence of the neomycin analogue G418 (300 pglml of the active form).

Metabolic Labeling and Cross-linking-The cells were incubated for 20 h in 60-mm diameter dishes (1.0 x lo6 cellddish) in aMEM with 10% fetal calf serum and washed three times with methionine-free medium.

GGCAAGACTGTCGGTGCCGT&CGCCTGT-3'; L15G/G16D/M17S

6874

Association of PDI with Misfolded Human Lysozyme 6875 In the case of pulse-chase experiments, the cells were pulse-labeled with 100 mCi/ml ~-["~S]methionine for 5 min and then incubated in the complete culture medium containing 20 rn unlabeled methionine. The chase was terminated by placing the cells on ice. Labeled cells were washed three times with ice-cold phosphate-buffered saline and solubi- lized in lysis buffer containing 1% Nonidet P-40, 150 m~ NaCl, 50 rn TridHCI (pH7.5), 2 m~ (p-amidinophenyl)methylsulfonyl fluoride, and 0.2 mg/ml soybean trypsin inhibitor. After removing cell debris by cen- trifugation at 95,000 rpm for 30 min, the lysates were processed for immunoprecipitation. For experiments with the cross-linker, the cells were labeled with 100 mCi/ml ~-["S]methionine for 1 h. The labeled cells were washed twice with ice-cold phosphate-buffered saline, then treated with or without 1 rn DSP in phosphate-buffered saline a t 0 "C for 30 min. Excess cross-linker was inactivated with 2 rn glycine and removed, and labeled cells were solubilized in the lysis buffer described above.

Immunoprecipitation and Electrophoresis-Immunoprecipitation with rabbit anti-hLZM antibody was performed as described elsewhere

(23). In the experiments to identify PDI, the cross-linked samples were immunoprecipitated twice, first with anti-hLZM antibody and then with anti-PDI antibody. After the first immunoprecipitation was camed out, immunoprecipitates were washed four times in 'kis-buffered saline containing 0.05% Tween 20 to remove nonspecifically adsorbed pro- teins. The precipitates were boiled for 10 min in 2% SDS and 0.4 M dithiothreitol. Under these conditions, the DSP was cleaved, and the anti-hLZM antibody was denatured. After boiling, 50 rn N-ethyl- maleimide was added to the precipitates to block free sulfhydryl groups. The samples were diluted 50-fold with 20 rn borate-buffer (pH 8.0) containing 150 rn NaCl and were immunoprecipitated with anti-PDI antibody adsorbed to Protein A-Sepharose-CG4B. The precipitates were boiled for 10 min in SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer supplemented with 100 rn dithiothreitol. The samples were analyzed by electrophoresis on 13% SDS-polyacrylamide gels according to Laemmli (24).

RESULTS AND DISCUSSION The mutant hLZM, C128A, and its derivatives, G48SfC128A

and M29T/C128A, are not secreted and are rapidly degraded in a pre-Golgi compartment when expressed in mammalian cells (7). To obtain some clue as to the retention and degradation mechanisms of misfolded proteins, these mutant hLZMs and the following mutant hLZMs, which were not secreted by yeast cells, were chosen for further experiments: C ~ ~ A ( C ~ S ~ ~ + Ala), C6/30/65/77/81/95/116/128A (all cysteine residues were re- placed by alanine), P71V (Pro71 -+ Val), and L15G/G16D/M17S (Leu15 + Gly, Gly16 + Asp, Met17 + Ser). The mutations in the latter two Droteins were not related to cysteine residues. Mouse

TABLE I Characteristics of wild-twe and mutant hLZMs

Secretion Half-life of Association with level" degradationb 57-kDa protein

% rnin Wild-type 47 - C77195A 66 - C128A 5 88 + G48SIC128A 7 64d + M29TlC128A 0 80d + C65A 0 128 +

- -

C6/30/65/77/81/95/116/128A 0 <5 P7 1V 2 153 L15G/G16D/M17S 5 208

- L cells were transfected with the plasmids carrying these mu- tant hLZM genes. The secretion efficiency and the degradation rate of each mutant protein were examined and are summa-

hLZMs to all the synthesized hLZMs during the labeling period (100%) was measured after a 1-h chase period. P71V, L15G/G16D/M17S, and C6/30/65/77/81/95/116/128A pro-

The half-life for the ure-Golei dee-radation was determined in the teins were not secreted in mouse L cells, which is consistent in

+ +

a Determined pulse-chase experiments. The ratio of the secreted in Table 1. The C128A, G48S/C128A, M29T/C128A, C65A,

presence of brefeldin A Cy). than 5 h in the presence of brefeldin A (23).

lag periods of 60 and 20 min, respectively (7). proteins failed to fold into an as compact state as wild-type

- . ,

the case of yeast cells. All of these non-secretable proteins e Wild-type and C77195A proteins stably remain in the cells for more showed a reduced mobility in non-reducing SDS-PAGE as

The degradation of G48S/C128A and M29T/C128A is preceded by pared to hLZM, strongly suggesting that the mutant

E f a

v) b) H

5 0

w F ' - + -

s Y

\ PC PC 0

- + UM -

F n PC

- + - 5 - F w - +

i, - - + 0

- + - "

DSP - 93- 69- - .

46- .I

- + - + i ui t.a

93- 69 -

93 69

93

69 4

46 46

30- - 30- 30 30

r

M 1 2 3 4 5 6 ~ 7 8 9 1 0 1 1 1 2 M 13 14 15 16 M l 7 18 19 20 FIG. 1. Cross-linking of cellular proteins with hLZMs. Cells expressing wild-type (WT) and various mutant hLZMs were labeled for 1 h with

[35Slmethionine, treated with (euen numbered lanes) or without (odd numbered lanes) 1 mM DSP, and lysed. Lysates were immunoprecipitated with an anti-hLZM antibody, and the precipitated proteins were examined by 13% SDS-PAGE. Lanes 5 and 6 show the L cells with no plasmid encoding hLZM. Arrowheads indicate specifically co-precipitated proteins. The arrows show hLZMs, and the star shows the N-glycosylated form of the hLZMs. The numbers to the left indicate molecular mass (in m a ) .

6876 Association of PDI with Misfolded Human Lysozyme

L15G/G16D/M17S WT C “

93- -

69 -

_.

r;5

30-

14-

1 2 3 4 5

4

c

6 7

and anti-PDI antibodies. Labeled cells expressing the L15GIG16DI FIG. 2. Analysis of cross-linked complexes using anti-hLZM

M17S protein were treated with DSP, lysed, and immunoprecipitated with anti-hLZM antibody (lane 1 ). After the precipitates were boiled with 2% SDS and 0.4 M D’IT, the sample was immunoprecipitated with

cross-linked 57-kDa protein reacted with the anti-PDI antibody. The anti-PDI antibody (lane 2) or non-immune rabbit serum (lane 4) . The

reactivity of the 57-kDa protein to the anti-PDI antibody was inhibited by the addition of an excess of unlabeled bovine PDI (lane 3). Lune 5 shows the precipitates obtained from the first and second immunore- actions and differs from lane 2 only in that the first immunoprecipita- tion is carried out using anti-PDI antibody. Lunes 6 and 7 are the same as lane 2 except that the wild-type hLZM-expressing cells and the parental L cells without plasmid were lysed, respectively. The arrow- head indicates the 57-kDa protein (i.e., PDI) and the arrow shows hLZM. The numbers to the left indicate molecular mass (in m a ) .

protein (data not shown). The wild-type and C77195A proteins can fold correctly (22, 251, but the non-secretable mutants tested here were misfolded and degraded independently of the transport from the ER to the Golgi apparatus. With the idea that some cellular proteins might be involved in the folding, retention, and/or degradation of these mutant proteins, we tried to detect their association with mutant proteins by a chemical cross-linking technique using the membrane perme- able cross-linker, DSP.

The cells expressing mutant hLZMs were labeled metaboli- cally and treated with DSP. The lysates were immunoprecipi- tated with an anti-hLZM antibody, and the precipitates were separated by reducing SDS-PAGE. Under reducing conditions, DSP is cleaved at its internal disulfide bond, and the actual size of the associated molecules can be observed by electrophoresis. In the presence of DSP, a 57-kDa protein was found associated with the misfolded mutant hLZMs C128A, G48S/C128A, C65A, P71V, and L15G/G16D/M17S specifically, but not with the wild- type protein or C77195A (Fig. 1 and Table I). P71V and LEG/ G16D/M17S, with mutations unrelated to cysteine residues, were also associated with the 57-kDa protein. This result seems

to indicate that the association does not always depend on the lack of one of the cysteine partners forming a native disulfide bond, although this does not rule out the possibility that cys- teine-related abnormalities are indirectly caused by the pri- mary mutation. The association was not observed in the wild- type and C77195A proteins, even when they were retained intracellularly in the presence of brefeldin A, which blocks the anterograde transport but promotes the retrograde transport between the ER and the Golgi apparatus (data not shown). This result suggests that the retention in the pre-Golgi compart- ment is not necessarily sufficient for hLZMs to associate with the 57-kDa protein. The association of the 57-kDa protein with the C6/30/65/77/81/95/116/128A protein was not detected under these experimental conditions. However, it is not clear whether the association actually occurred or not, because the rapid deg- radation of this mutant protein in the cells made detection difficult.

Electrophoretic analysis indicated that the molecular weight of the cross-linked protein was quite close to that of PDI, an abundant protein in the ER. The identification of the 57-kDa protein was carried out by the immunological method described under “Experimental Procedures.” The mutant L15GIG16Dl M17S was chosen as a representative in the experiment, be- cause the association of the 57-kDa protein was detected most clearly with this protein. The 57-kDa protein, precipitated as a complex with hLZM, was found to react with an anti-PDI an- tibody (Fig. 2). From this result, we concluded that this cross- linked protein is identical to PDI. The 57-kDa proteins associ- ated with other mutant proteins (C128A, G48S/C128A, M29T/ C128A, C65A, and P71V) were also identified as PDI by the same procedure (data not shown). I t might be noteworthy that an apparent band in the vicinity of 78 kDa was found to appear in the lanes where PDI was detected in Fig. 1. The molecular weight and behavior of this 78-kDa protein resemble that in- volved in the interaction of BiPlGRP78 with mutant hLZMs. The identification of this protein, however, has been unsuccess- ful thus far.

PDI has been known to catalyze thiovdisulfide interchange reactions (8-10). Our observation demonstrates that PDI asso- ciates with degradative misfolded mutant hLZMs but not the wild-type hLZM in vivo during and/or after their synthesis. The association of PDI with misfolded hLZMs, which may occur based on structural abnormalities, seemed relatively unstable as compared to the case of its association with immunoglobulin M (12) and with bunyavirus glycoproteins (26) during the fold- ing process. I t is conceivable that PDI plays a role in editing the structure, including disulfide bonds, of newly synthesized h L ZMs during association. On the other hand, PDI has been oc- casionally implicated in some chaperone-like functions (19,201, and recent studies on PDI have been focused on its ability to interact with unstructured synthetic peptides (27,28). Further- more, some other members of the PDI-related protein family have been found to have various roles other than thiovdisulfide interchange reactions (29-31). Our results suggest that PDI could retain misfolded hLZMs transiently until they acquire secretion competence to be transported out to the Golgi appa- ratus, or they are finally degraded. PDI is one of the abundant proteins in the ER, where some quality control for secretory proteins occurs. The involvement of PDI in the fate (i.e., reten- tion, secretion, and degradation) of secretory proteins will be clarified by further studies using the reported system.

Acknowledgments-We are grateful to T. Hayano and T. Doi for use- ful advice. We thank A. Uyeda and E. Kanaya for providing plasmids encoding mutant hLZMs. M. 0. thanks Y. Karaki for expert technical assistance.

Association of PDI with Misfolded Human Lysozyme 6877

REFERENCES

2. Helenius, A, Marquardt, T., and Braakman, I. (19921 !Rends Celt Biol. 2, 1. Hurtley, S. M., and Helenius, A. (1989) Annu. Rev. Cell Bwl. 5,277-307

3. Amara, J. F., Lederkremer, G., and Lodish, H. F. (1989) J. Celt Bid. 10%

4. Klausner, R. D., and Sitia, R. (1990) Cell 82,611-614 5, Taao, Y. S.. Ivessa, N. E. Adesnik, M., Sabatini, D. D., and Kreibich, G. 11992)

227-231

3315-3324

6. Le, A,, Ferrell, G. A., Dishon. D. S., Le, 8.-Q. A,, and Sifers, R. N. (1992)J. Bwl. J. ceu Biol. rrs, 57-67

Chem. 887,1072-1080

Eiochem. 210,591499 7. Omura, F., Otsu, M., Yoshimori, T., Tashim, Y., and Kikuchi, M. (1992) Eur. J.

8. Freedman, R. B. (1989) Cell 67,1069-1072 9. Gething, M. J., and Sambrook, J. (1992) Nature 366,3345 10. Noiva, R., and Lennarz, W.J. (1992) J. Biol. Chem. 267, 3553-3556 11. Bulleid, N. J., and Freedman, R. B. (1988) Nature 955,649451 12. Roth, R. A,, and Pierce, S. B. (1987) Biochemistry 28,41794182 13. Hayano, T., Inaka, K, Otsu, M., Taniyama, Y., Miki, K., Mabushima, M., and

14. LaMantia, M., and Lennartz, W. J. (1993) Cell 74,899-908 15. Koivu, J., Myllyla, R., Helaakoski, T., Pihlajaniemi, T., Tasanen, K, and Ki-

16. Geetha-Habib, M., Noiva, R., Kaplan, H. A., and Lennan, W. J. (1988) Cell 64, virikko, K I. (1987) J. Biol. Chem. Z82,6447-6449

Kikuchi, M. (1993) FEES Lett. 328,203-208

17.

18.

19. 20. 21. 22.

23. 24. 25.

26. 27. 28.

29.

30.

31.

1053-1060

and Pastan, I. (1987) J. Biol. Chem. 282,11221-11227

&hem 2Sa,9800-9807

Cheng, S., Gong, Q., Parkison, C., Robinson, E. A., Apella, E., Merlino, G. T.,

Wetterau, J. R., Combs, K A., Spinner, S. N., and Joiner, B. J. (1940) J. Bid.

Chessler, S. D., and Byers, P. H. (1992) J. Bid. Chum. 267.7751-7757 John, D. C. A., Grant, M. E., and Bulleid, N. J. (1993) EMBO J. 12,1587-1595

Taniyama, X, Yamamota, Y., Nakao, M., Kikuchi, M., and Ikehara, M. (1988) Omura, F., Txniyama,Y., and Kikuchi, M. 11991)Eur. JBzochem. 198,477484

Omura, F., OtElu, M., and Kikuchi, M. (1992) Eur. J Biochem. 206,551-559

Inaka, K7 Taniyama, Y., Kikuchi, M., Morikawa, K, and Matsushima, M. Laemmli, U. K (1970) Nature 227,680-885

(1992) J. Biol. Chem. 268,12599-12603 Persson, R., and Pettersson, R. F. (1991) J. Cell Bwl. 112,257-266 Weissmann, J. S. , and Kim, P. S. (1993) Nature 968, 185-188 Noiva, R., Freedman, R. B., and Lennarz, W. J. (1993) J. Biol. Chem. 268,

Urade, R., Nasu, M., Moriyama, T., Wada, K, and Kito, M. (1992) J. Biol.

Schaiff, W. T., Hruska, K A., Jr., McCourt, D. W., Green, M., and Schwartz, B.

Chaudhuri, M. M., lbnin, P. N., Lewis, W. H., and Srinivasan, P. R. (1992)

Biochem. Bwphys. Res. Commun. 162,962-967

19210-19217

Chem. 267, 15152-15159

D. (1992) J. Exp. Med. 176,657466

Eiochem. J. 281,645-650