Biochemical and functional characterizationoftriosephosphateisomerase fromMycobacteriumtuberculosis H37RvDivya Mathur, Gunjan Malik & Lalit C. Garg
Gene Regulation Laboratory, National Institute of Immunology, New Delhi, India
Correspondence: Lalit C. Garg, Gene
Regulation Laboratory, National Institute of
Immunology, Aruna Asaf Ali Marg, New Delhi
110067, India. Tel.: 191 11 26703652;
fax: 191 11 26162125; e-mail:
[email protected]; [email protected]
Present address: Gunjan Malik, Department
of Microbiology and Molecular Cell Biology,
Eastern Virginia Medical School, 700 West
Olney Road, Norfolk, VA 23507, USA.
Received 6 April 2006; revised 18 July 2006;
accepted 26 July 2006.
First published online 21 August 2006.
DOI:10.1111/j.1574-6968.2006.00420.x
Editor: Wilfrid Mitchell
Keywords
triosephosphate isomerase; Mycobacterium
tuberculosis ; glycolysis; glyceraldehyde-3-
phosphate.
Abstract
Triosephosphate isomerase (TPI), one of the key enzymes of the glycolytic
pathway, is an attractive drug target against Mycobacterium tuberculosis as
glycolysis provides the majority of the organism’s energy requirements inside
macrophages. To carry out biochemical and biophysical characterization, purified
recombinant M. tuberculosis TPI produced in Escherichia coli was used. Mass
spectrum analysis showed M. tuberculosis rTPI to be of 28 213 Da. The biologically
active enzyme is a homodimer as determined by gel filtration chromatography.
The M. tuberculosis TPI had a pH optimum in the range of 6–8 and a temperature
optimum around 37 1C. Circular dichroism spectra analysis revealed that loss of
secondary structure of rTPI occurs around 60 1C. Metal cations were not required
for M. tuberculosis TPI activity. The kcat was 4.1� 106 min�1. Importantly, the
apparent Km value of M. tuberculosis rTPI for the substrate glyceraldehyde-3-
phosphate is 84 mM which is sevenfold higher than the value reported for human
TPI. The difference in Km is indicative of the difference in the active site of the
human and M. tuberculosis TPI, which can be exploited for drug designing
specifically targeting M. tuberculosis TPI.
Introduction
Tuberculosis is a major infectious disease that accounts
for over 2 million deaths every year. Currently, one-third of
the world’s population is infected with tubercle bacilli
(Murray & Salomon, 1998). Incidences of tuberculosis have
increased globally due to the progressive multidrug resis-
tance seen among clinical isolates and the emergence of
tuberculosis as an opportunist infection in immunocom-
promised subjects.
Mycobacterium tuberculosis, the causative agent of tuber-
culosis, enters the human host by inhalation of infectious
aerosols. Once inside the alveolar tissue, it is engulfed by
macrophages where it can remain in a quiescent state for a
long period. To adapt to the hypoxic environment inside
macrophages, M. tuberculosis metabolism shifts from an
aerobic to an anaerobic mode and expression of genes
encoding enzymes of the glycolytic pathway is upregulated.
In this quiescent or ‘persistent’ state of M. tuberculosis, 70%
of the organism’s energy requirement is provided by glyco-
lysis (Bai et al., 1975). Thus, glycolysis is central to the
mycobacterium’s survival inside the host tissue.
The search for newer drug targets against pathogens has
led to the development of inhibitors designed to specifically
inactivate key pathogen enzymes. Genome sequencing of M.
tuberculosis has identified probable genes involved in glucose
metabolism by homology search. They are expected to aid
the process of characterization of the pathway, and this may
further facilitate in deciphering species-specific enzyme
differences. Specific differences in the biochemical proper-
ties of metabolic enzymes between the host and the patho-
gen have been exploited to develop drugs targeting the
pathogen.
Triosephosphate isomerase (TPI; E.C.5.3.1.1.) is an
essential component of the Embden–Meyerhof pathway,
interconverting dihydroxyacetone phosphate and glyceralde-
hyde-3-phosphate. In glycolysis, TPI channels these two
products for the formation of pyruvate, while in gluconeo-
genesis, TPI ensures that both substrates are supplied to
aldolase. TPI is a well-characterized enzyme both structurally
FEMS Microbiol Lett 263 (2006) 229–235 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
and functionally, and represents a prototype of the widely
occurring (a/b)8 TIM barrel fold (Kursula & Wierenga, 2003;
Walden et al., 2004).
TPI is a homodimeric protein, and the folding pathway is
described by its first-order folding to a monomer, followed
by a rate-limiting second-order association reaction. This
two-step process leads to the formation of a structured
monomer before dimer formation (Rietveld & Ferreira,
1998). TPIs from many pathogenic sources such as Plasmo-
dia and Trypanosoma contain a cysteine residue 15 at the
dimer interface that plays an essential role in stability of the
dimer (Gomez-Puyou et al., 1995; Hernandez-Alcantara
et al., 2002). As in humans, this residue is replaced by
methionine, the Cys15 of these pathogens has been a target
of various studies with a view towards developing selective
covalent inhibitors. Chemical modifications and mutations
of this residue result in a drastic reduction of enzymatic
activity, reduced stability to denaturants and an increased
population of monomeric species (Maithal et al., 2002;
Tellez-Valencia et al., 2004). Like in humans, the TPI from
M. tuberculosis H37Rv has methionine instead of the Cys15
found in Plasmodia and Trypanosoma. Therefore, drugs
targeting the Cys15 of TPI of these pathogens cannot be
used for M. tuberculosis TPI. Alternative structural or
biochemical differences that exist between TPI of M. tuber-
culosis, and its host has to be identified to enable design of
specific drug targets. This study was undertaken with the
aim of analyzing such differences. Here we describe, for the
first time, a detailed biochemical and functional character-
ization of triosephosphate isomerase from M. tuberculosis
H37Rv.
Materials and methods
All chemicals were of analytical grade and purchased from
Sigma Chemical Company, USA, unless stated otherwise.
Plasmid pET-22b(1) expression vector was from Novagen,
USA. Escherichia coli DH5a and BL21 (DE3) strains were
obtained from Novagen.
BAC genomic library of M. tuberculosis was obtained
from Prof. Stewart Cole of the Institut Pasteur (Cole et al.,
1998).
Cloning of tpi of M. tuberculosis in expressionvector
The full-length tpi was amplified using gene-specific primers
(forward-50CCAACATATGAGCCGCAAGCCGCTGATAG30
and reverse-5 0CCAACTCGAGCAACGGACCACCGGCCGC
AATC30) designed on the basis of genome sequence infor-
mation of M. tuberculosis H37Rv (Accession No. AL123456).
NdeI and XhoI sites (underlined) were introduced into the
forward and reverse primers, respectively, for convenient
cloning in expression vector pET-22b(1). The tpi was
amplified using genomic DNA isolated from a BAC genomic
library of M. tuberculosis as template and Taq DNA poly-
merase for 30 cycles of denaturation at 94 1C for 1 min,
annealing at 60 1C for 2 min and extension at 72 1C for 1 min
with a final extension at 72 1C for 7 min in GeneAmp PCR
system (Perkin Elmer). The amplified product, purified
using Qiagen mini columns (Qiagen, Germany) as per
manufacturer’s instructions, was digested with NdeI and
XhoI and cloned into plasmid pET-22b(1) digested with the
same enzymes. The ligation mixture was transformed into
E. coli BL21 (DE3) cells (Novagen) and selected on LB agar
plates containing ampicillin (100 mg mL�1). Recombinant
colonies were analyzed by restriction digestion with
XhoI and NdeI for the release of the insert and confirmed
by automated DNA sequencing using Applied Biosystem
Model 393A.
Expression, purification and immunoblotanalysis of recombinant TPI
His-tagged M. tuberculosis TPI was produced by inducing
E. coli BL21 (DE3) cells harbouring the M. tuberculosis
tpi gene in pET-22b(1) expression vector essentially as
described previously (Mathur et al., 2005). Cells were grown
to A600 nm = 0.5 at 37 1C. rTPI expression was induced by
the addition of 1 mM isopropyl-b-D-thiogalactopyrano-
side (IPTG), and the induced culture was grown further
for 8 h.
All purification procedures were performed at 4 1C. The
induced cells from 250 mL culture were harvested by cen-
trifugation at 5000 g for 10 min and suspended in 12.5 mL
sonication buffer (50 mM NaH2PO4, 300 mM NaCl, pH
7.8). Cells were lysed by sonication (1 min pulse on followed
by 30 s pulse off for 30 cycles; MISONIX). The lysate was
centrifuged at 12 000 g for 20 min at 4 1C. The His-tagged
rTPI was purified from the soluble fraction of the induced
cells using Ni-NTA (Qiagen) affinity chromatography
(Mukhija et al., 1994). Ni-NTA agarose beads were added
to the sonication supernatant (1 mL L�1 of culture) and
allowed to bind for 1 h with end-to-end shaking. Following
the addition of Ni-NTA agarose beads, all centrifugation
steps were performed at 1200 g in a swing out rotor for
2 min. Flow through was discarded and nonspecifically
bound proteins were removed by washing the beads twice
in 15 mL of Tris-phosphate buffer (0.01 M Tris, 0.1 M
sodium dihydrogen phosphate, pH 8.0). The recombinant
protein was eluted in 12.5 mL of 250 mM imidazole (in Tris-
phosphate buffer).
For Western blotting, purified rTPI was electrophoresed
in a 12% polyacrylamide gel and transferred onto a nitro-
cellulose membrane. The blot was probed with Ni-NTA
HRPO conjugate (Qiagen) and developed with 3,30-diami-
nobenzidine (DAB).
FEMS Microbiol Lett 263 (2006) 229–235c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
230 D. Mathur et al.
Gel filtration chromatography of rTPI
Purified rTPI (500mg) was loaded on a Superdex-75 10/300
GL gel filtration FPLC column (Amersham Pharmacia
Biotech, UK) pre-equilibrated with 10 mM Tris-phosphate
buffer, pH 7.6 and eluted in the same buffer.
UV cross-linking of rTPI
The rTPI (50mg, 1 mgmL�1) in 10 mM Tris-phosphate buffer,
pH 7.6, was irradiated using a UV transilluminator
(312 nm) on ice for 15 min and analyed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Determination of protein concentration andenzyme activity
A BCA protein assay kit (Pierce) was used for protein
estimation using bovine serum albumin (BSA) as standard.
rTPI activity was determined spectrophotometrically
(Gracy, 1975). The assay mixture in a total volume of 1 mL
contained 0.1 mM triethanolamine buffer (pH 7.6), 2 mM
EDTA, 0.5 mM b-NADH, 1 U a-glycerophosphate dehydro-
genase, 2 mM glyceraldehyde-3-phosphate and an aliquot of
purified recombinant enzyme. The reaction was initiated by
the addition of the enzyme and was followed for 5 min at
room temperature, i.e. 25 1C, unless otherwise stated. The
activity was measured by monitoring the change in the
absorbance at 340 nm using a Lambda25 spectrophotometer
(Perkin Elmer). One unit of rTPI was defined as the amount
of protein that oxidizes 1 mmoL of b-NADH in 1 min.
Effect of metal ions on rTPI activity
Recombinant TPI was checked for its dependence on cations
as cofactors by the addition of different amounts of various
cations in the assay mixture.
Determination of thermal stability, temperatureand pH optima for rTPI
Thermal stability of rTPI was determined by measuring the
residual activity of purified rTPI that had been incubated at
various temperatures for 30 min. The optimum temperature
for rTPI function was studied by assaying enzyme activity at
different temperatures. To determine the pH optimum for
rTPI, enzyme activity was measured in 50 mM buffer of
various pH values from 3 to 12 (pH 3.0–5.0, sodium acetate
buffer; pH 6.0–7.0, imidazole buffer; pH 8.0–12.0, Tris-HCl
buffer).
Determination of secondary structure by circulardichroism (CD)
CD measurements of the M. tuberculosis rTPI (0.15 mg mL�1
in 5 mM Tris-phosphate buffer, pH 7.6) were performed
at different temperatures using a JASCO-J710 spectropolari-
meter (Easton, MO), in a 0.1 cm path length cell. The
temperature was controlled with a JASCO PTC-348W
temperature controller. The spectra in the near and far
ultraviolet (190–320 nm) were recorded at a scanning speed
of 20 nm min�1. Ten spectra were accumulated in each case
and averaged followed by baseline correction by subtraction
of the buffer spectrum. Mean residue weight ellipticities
were calculated and expressed in units of degree cm2 dmol�1.
Kinetic properties of rTPI
The kinetic parameters of purified rTPI were determined. The
Michaelis–Menten constant was determined in the reverse
reaction using different concentrations of glyceraldehyde-
3-phosphate and �9.5 pmol of the purified rTPI at room
temperature in 1 mM Tris-phosphate buffer, pH 7.6. Km and
kcat (Vmax/molar concentration of the enzyme) were deter-
mined using Lineweaver–Burk plots. It is to be noted that
glyceraldehyde-3-phosphate exists in neutral aqueous solu-
tions as a mixture of keto, gem-diol and enolic forms.
However, the true substrates of the TPI are only the free
carbonyl forms of glyceraldehyde-3-phosphate and not the
corresponding hydrated gem-diol forms (Trentham et al.,
1969; Reynolds et al., 1971). It has been shown that the
substrate for TPI exists in aqueous solution as a mixture of
free aldehyde and gem-diol in the ratio of 1 : 29 (Trentham
et al., 1969). Therefore, to obtain the actual Km, the apparent
Km was corrected with this factor (Hartman & Norton, 1975).
Results and discussion
Sequence analysis of M. tuberculosis TPI
To identify the amino acid residues conserved within
triosephosphate isomerases from different enzymes, the
protein data bank was searched for TPI from other enzymes.
The deduced amino acid sequence of the M. tuberculosis tpi
clone was subjected to alignment with other TPIs using
CLUSTALW (Thompson et al., 1994). Considerable variations
in amino acid sequence were found between species. Myco-
bacterium tuberculosis TPI shares only 37% identity to
human TPI (data not shown). Phylogenetic analysis revealed
that eukaryotic TPI’s are closely related to those from
Alphaproteobacteria, but only distantly related to those from
archaebacteria. This suggests that the TPI genes present in
the modern eukaryotic genomes may have been derived
from an Alphaproteobacterial genome after the divergence
of Archaea and Eukarya (Keeling & Doolittle, 1997).
Purification of recombinant M. tuberculosis TPI
For expression purposes, a XhoI–NdeI fragment harbouring
the full length tpi encoding a protein of 261 residues was
FEMS Microbiol Lett 263 (2006) 229–235 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
231M. tuberculosis triosephosphate isomerase
cloned into the pET-22b(1) expression vector and ex-
pressed in E. coli BL21 (DE3) cells. The purified protein
obtained through one step Ni-NTA affinity purification
from the soluble fraction appeared to be free of any
detectable impurities when analysed by SDS-PAGE
(Fig. 1a). This was further confirmed by immunoblot
analysis of the purified rTPI using Ni-NTA HRPO conjugate
(Fig. 1b). The rTPI thus purified was used for detailed
biochemical and biophysical characterization. The rTPI was
stable in Tris-phosphate buffer as no aggregation, degrada-
tion, or loss of the enzyme activity, were observed even when
the purified rTPI was stored at 4 1C for 6 months.
Determination of molecular weight andoligomerization of rTPI
On SDS-PAGE, the purified rTPI runs as a single band and
the monomer molecular weight of rTPI was estimated to be
�30 kDa (Fig. 1a). The accurate molecular mass of the
purified rTPI by mass spectrum analysis was determined to
be 28 213 Da. It is established that TPI from all known
species is homodimeric except for the enzymes in Thermo-
toga maritima and Pyrococcus woesei that are tetrameric
(Maes et al., 1999; Walden et al., 2001).
Gel filtration of rTPI was, therefore, carried out to
investigate whether M. tuberculosis rTPI forms an oligomer.
Upon gel filtration chromatography, rTPI eluted at 9.41 mL
(Fig. 2a). The molecular weight of the protein in the peak
was calculated to be �60.25 kDa. SDS-PAGE analysis
showed only a single band of �30 kDa (inset of Fig. 2a),
suggesting that the rTPI is a homodimer. As cross-linking is
routinely used to study interaction between protein mono-
mers (Gottfried et al., 2004), UV cross-linking of the rTPI
was performed to further confirm the dimerization of rTPI
(Fig. 2b). A band at �66 kDa, in addition to the monomeric
protein band at �30 kDa, can be seen in the UV-crosslinked
sample (lane 2), whereas untreated sample gave only a single
band at �30 kDa. The band at the 30 kDa position in the
cross-linked sample represents the noncrosslinked popula-
tion of rTPI molecules. The mass of the UV-crosslinked
undissociated protein appears to be greater than the
2� mass of the monomer. This happens when the dimer-
ization does not take place in a head-to-tail fashion. It
appears that the cross-linked dimer attains a conformation
which migrates more slowly than the two monomers linked
in head to tail fashion. These data collectively suggest that
like TPI from most other species, M. tuberculosis rTPI also
forms a homodimer. In some preparations, a small fraction
of the rTPI eluted as a monomer in gel filtration (data not
shown). It is of interest to note that in such preparations, the
enzyme activity was observed only in the peak fractions
corresponding to the dimeric form of the enzyme. Our data
are in agreement with earlier observations, where only the
dimeric form of the enzyme has been found to be active,
even though each monomer has its own catalytic site
(Zomosa-Signoret et al., 2003). The disruption of the
dimeric form of the enzyme has thus been the focus for
selective drug designing (Jackson & Phillips, 2002).
Catalytic and kinetic properties of rTPI
Purified rTPI enzyme exhibited very high specific activity
and, therefore, assays were performed using enzyme dilu-
tions in the reaction mixture. The specific activity of
purified rTPI was 5700 U mg�1 protein. The optimum pH
and temperature for the recombinant TPI were determined
kDa66
45
30
20
6645
30
20
M 1 kDa M 1(a) (b)
Fig. 1. (a) SDS-PAGE (12%) of rTPI. Lane 1 shows the purified rTPI
stained with Coomassie brilliant blue. kDa denotes the migration of
protein molecular weight markers in lane M. (b) Immunoblot analysis of
purified Mycobacterium tuberculosis rTPI with Ni-NTA HRPO conjugate.
Lane 1, rTPI. Lane M, Protein molecular weight markers.
Monomer
Log
mol
ecul
ar w
eigh
t
0.0
0.5
1.0
1.5
2.0
−50
0
50
100
150
200
Abs
orba
nce
at 2
80 n
m (
mA
U)
0.0 5.0 10.0 15.0 20.0
Elution Volume (mL)
25.0
BSA
RNase
OvalbuminChymotrypsinogen
(a) (b)kDa M 1 2
20
14
30
45
66
97
Dimer
Fig. 2. (a) Gel filtration chromatography of
purified rTPI: Log of the molecular weights
of the standards – BSA (67 kDa), ovalbumin
(43 kDa), chymotrypsinogen (30 kDa) and
RNase (13.7 kDa) were plotted against their
elution volumes. Inset: SDS-PAGE of the
rTPI peak fraction (lane 1). M corresponds
to the protein molecular weight markers.
(b) SDS-PAGE of UV-crosslinked rTPI. Lanes
1 and 2 correspond to the untreated and
UV-crosslinked rTPI, respectively.
FEMS Microbiol Lett 263 (2006) 229–235c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
232 D. Mathur et al.
to be 7.0 and 37 1C, respectively (data not shown). Depen-
dence of TPI activity on metal cofactors has not been
reported from any source. To test the effect of metal cations
on TPI activity, cations were added to the assay mixture at
various concentrations. Mycobacterium tuberculosis TPI did
not show any preference for metal cations, and no signifi-
cant change in enzyme activity was observed in the presence
of 0–100 mM monovalent (K1) or divalent (Ca21, Mg21)
cations added as chloride salts. However, enzyme activity
was inhibited nonspecifically when 500 mM cations were
used in the reaction mix. No difference in the reaction
profile was observed when assays were performed in the
presence of EDTA (data not shown).
To determine the thermal stability of rTPI, the enzyme
was incubated at different temperatures (0–70 1C) in 1 mM
Tris-phosphate buffer (pH 7.6) for 30 min, and residual
activity was measured at 25 1C. The enzyme was stable up to
50 1C. At 55 1C, the enzyme retained approximately half of
its activity but it was completely inactivated at 60 1C (data
not shown). Loss of enzyme activity was also corroborated
by the CD scan analysis of rTPI. The thermal unfolding
curve of rTPI in the near and far UV regions is shown in
Fig. 3. CD spectrum analysis revealed that up to 50 1C, the
rTPI retained the characteristic a helical and b sheet
structures. At 55 1C, the protein began to lose its well-
defined secondary structure, corroborating with the reduced
enzyme activity (50% of the unheated control) at this
temperature. Appearance of random coil structure at 60 1C
relates well to complete inactivation of the enzyme.
The enzyme followed Michaelis–Menten kinetics for the
substrate glyceraldehyde-3-phosphate, and Km and Vmax
were determined using the Lineweaver–Burk plot (Fig. 4).
At room temperature, the Km of rTPI was determined
to be 84mM for glyceraldehyde-3-phosphate after correction
for the unhydrated form of glyceraldehyde-3-phosphate,
and kcat was 4.1� 106 min�1. Vmax of the reaction was
39 mmol min�1.
The estimated Km of mycobacterial rTPI is similar to the
Km data reported for TPI from other bacterial species
(Krietsch, 1975), but is sevenfold higher than the Km of TPI
from its human counterpart (Gracy, 1975; Repiso et al.,
2002). A higher Km suggests that the mycobacterial enzyme
320
Wavelength (nm)
20
10
0
−10
[θ] ×
10−3
deg
× c
m2
dmol
−1
20�C37�C50�C55�C60�C
300275250225200190
Fig. 3. Effect of temperature on the circular dichroism spectra of rTPI in
the far and near UV regions. CD spectra of Mycobacterium tuberculosis
rTPI at different temperatures were obtained. CD values are expressed as
[y], mean residue mass elipticity in units of degree� cm2 dmol�1.
V0
(mM
ol m
in–1
)
Gly-3-P (mM)
0.04
0.03
0.02
0.01
00 5 10 15 20 25 30
Fig. 4. Kinetic analysis of rTPI of Mycobacterium
tuberculosis. The enzyme assays were conducted
at various glyceraldehyde-3-phosphate (Gly-3-P)
concentrations and with 9.5pmol of the
recombinant enzyme under standard assay
conditions. Michaelis–Menten plot (V0 vs. [S]) of
rTPI is shown. V0 indicates the initial velocity of
the reaction and [S] is substrate concentration.
Inset: Lineweaver–Burk plot. The values
reported are the average of at least three
independent determinations. The Km calculated
by Lineweaver–Burk plot was adjusted for the
unhydrated form of the substrate.
FEMS Microbiol Lett 263 (2006) 229–235 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
233M. tuberculosis triosephosphate isomerase
probably has a more open active site pocket compared with
that of human TPI. TPI enzymes show a high degree of
conservation of the active site. However, outside the active
site there is considerable sequence variation, which may be
responsible for such structural differences leading to cataly-
tic variations between enzymes from various sources. Thus,
the active site of mycobacterial TPI differs from that of the
human enzyme, and it would be interesting to study the
extent of the variation and its implications for the design of
effective inhibitors that target enzyme activity. Such differ-
ences between the host and pathogen TPIs can be exploited
for designing drugs which specifically target the pathogen.
Therefore, elucidation of the crystal structure of M. tubercu-
losis TPI is necessary to identify the characteristics unique
to M. tuberculosis TPI for effective drug designing.
Crystallization studies are now in progress as a step towards
this aim.
Acknowledgements
Financial support from the Department of Biotechnology,
India, is acknowledged. Authors thank Neha Sharma of the
University of Pennsylvania, USA, for critically reviewing the
manuscript. We thank Ram Bodh, Ved Prakash and K.P.
Pandey for technical assistance.
References
Bai NJ, Pai MR, Murthy PS & Venkitasubramanian TA (1975)
Pathways of carbohydrate metabolism in Mycobacterium
tuberculosis H37Rv. Can J Microbiol 21: 1688–1691.
Cole ST, Brosch R, Parkhill J et al. (1998) Deciphering the biology
of Mycobacterium tuberculosis from the complete genome
sequence. Nature 393: 537–544.
Gomez-Puyou A, Saavedra-Lira E, Becker I, Zubillaga RA, Rojo-
Dominguez A & Perez-Montfort R (1995) Using evolutionary
changes to achieve species-specific inhibition of enzyme
action-studies with triosephosphate isomerase. Chem Biol 2:
847–855.
Gottfried P, Kolot M, Silberstein N & Yagil E (2004)
Protein–protein interaction between monomers of coliphage
HK022 excisionase. FEBS Lett 577: 17–20.
Gracy RW (1975) Triosephosphate isomerase from human
erythrocytes. Methods in Enzymology, Vol. 41 (Colowich
SR & Kaplan NO, eds), pp. 442–447. Academic Press,
London.
Hartman FC & Norton IL (1975) Triosephosphate isomerase
from rabbit muscle. Methods in Enzymology, Vol. 41 (Wood
WA, ed), pp. 447–453. Academic Press, London.
Hernandez-Alcantara G, Garza-Ramos G, Hernandez GM,
Gomez-Puyou A & Perez-Montfort R (2002) Catalysis
and stability of triosephosphate isomerase from
Trypanosoma brucei with different residues at position
14 of the dimer interface. Characterization of a
catalytically competent monomeric enzyme. Biochemistry
41: 4230–4238.
Jackson LK & Phillips MA (2002) Target validation for drug
discovery in parasitic organisms. Curr Top Med Chem 2:
425–438.
Keeling PJ & Doolittle WF (1997) Evidence that eukaryotic
triosephosphate isomerase is of alpha-proteobacterial origin.
Proc Natl Acad Sci USA 94: 1270–1275.
Krietsch WK (1975) Triosephosphate isomerase from yeast and
triosephosphate isomerase from rabbit liver. Methods in
Enzymology, Vol. 41 (Colowich SR & Kaplan NO, eds),
pp. 434–442. Academic Press, London.
Kursula I & Wierenga RK (2003) Crystal structure of
triosephosphate isomerase complexed with 2-
phosphoglycolate at 0.83-A resolution. J Biol Chem 278:
9544–9551.
Maes D, Zeelen JP, Thanki N et al. (1999) The crystal structure
of triosephosphate isomerase (TIM) from Thermotoga
maritima: a comparative thermostability structural
analysis of ten different TIM structures. Proteins 37:
441–453.
Maithal K, Ravindra G, Balaram H & Balaram P (2002)
Inhibition of Plasmodium falciparum triose-phosphate
isomerase by chemical modification of an interface cysteine.
Electrospray ionization mass spectrometric analysis of
differential cysteine reactivities. J Biol Chem 277:
25106–25114.
Mathur D, Ahsan Z, Tiwari M & Garg LC (2005) Biochemical
characterization of recombinant phosphoglucose isomerase of
Mycobacterium tuberculosis. Biochem Biophys Res Commun
337: 626–632.
Mukhija R, Rupa P, Pillai D & Garg LC (1994) High-level
production and one-step purification of biologically active
human growth hormone in Escherichia coli. Gene 165:
303–306.
Murray CJ & Salomon JA (1998) Modeling the impact of global
tuberculosis control strategies. Proc Natl Acad Sci USA 95:
3881–3886.
Repiso A, Boren J, Ortega F, Pujades A, Centelles J, Vives-Corrons
JL, Climent F, Cascante M & Carreras J (2002) Triosephosphate
isomerase deficiency. Genetic, enzymatic and metabolic
characterization of a new case from Spain. Haematologica
87: ECR12.
Reynolds SJ, Yates DW & Pogson CI (1971) Dihydroxyacetone
phosphate. Its structure and reactivity with a-glycerophosphate
dehydrogenase, aldolase and triose phosphate isomerase
and some possible metabolic implications. Biochem J 122:
285–297.
Rietveld AW & Ferreira ST (1998) Kinetics and energetics of
subunit dissociation/unfolding of TIM: the importance of
oligomerization for conformational persistence and chemical
stability of proteins. Biochemistry 37: 933–937.
Tellez-Valencia A, Olivares-Illana V, Hernandez-Santoyo A,
Perez-Montfort R, Costas M, Rodriguez-Romero A, Lopez-
Calahorra F, De Gomez-Puyou MT & Gomez-Puyou A (2004)
FEMS Microbiol Lett 263 (2006) 229–235c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
234 D. Mathur et al.
Inactivation of triosephosphate isomerase from Trypanosoma
cruzi by an agent that perturbs its dimer interface. J Mol Biol
341: 1355–1365.
Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res 22:
4673–4680.
Trentham DR, McMurray CH & Pogson CI (1969) The active
chemical state of D-glyceraldehyde 3-phosphate in its
reactions with D-glyceraldehyde 3-phosphate dehydrogenase,
aldolase and triose phosphate isomerase. Biochem J 114:
19–24.
Walden H, Bell GS, Russell RJ, Siebers B, Hensel R & Taylor
GL (2001) Tiny TIM: a small, tetrameric, hyperthermostable
triosephosphate isomerase. J Mol Biol 306: 745–757.
Walden H, Taylor GL, Lorentzen E, Pohl E, Lilie H, Schramm A,
Knura T, Stubbe K, Tjaden B & Hensel R (2004) Structure
and function of a regulated archaeal triosephosphate
isomerase adapted to high temperature. J Mol Biol 342:
861–875.
Zomosa-Signoret V, Hernandez-Alcantara G, Reyes-Vivas H,
Martınez-Martınez E, Garza-Ramos G, Perez-Montfort R,
de Gomez-Puyou MT & Gomez-Puyou A (2003) Control of
the reactivation kinetics of homodimeric triosephosphate
isomerase from unfolded monomers. Biochemistry 42:
3311–3318.
FEMS Microbiol Lett 263 (2006) 229–235 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
235M. tuberculosis triosephosphate isomerase
Top Related