Page 1/18

A Proof-of-Concept Study of Maternal ImmuneActivation Mediated Induction of Toll-Like Receptor(TLR) and In�ammasome Pathways Leading ToNeuroprogressive Changes and Schizophrenia-LikeBehaviors in Offspring.Pinku Mani Talukdar 

National Institute of Mental Health and Neurosciences: National Institute of Mental Health and Neuro SciencesFazal Abdul 

National Institute of Mental Health and Neuro SciencesMichael Maes 

Deakin University - Geelong Waterfront CampusMichael Berk 

Deakin University - Geelong Waterfront CampusGanesan Venkatasubramanian 

National Institute of Mental Health and Neurosciences: National Institute of Mental Health and Neuro SciencesBindu M Kutty 

National Institute of Mental Health and Neurosciences: National Institute of Mental Health and Neuro SciencesMONOJIT DEBNATH  ( monozeet@gmail.com )

National Institute of Mental Health and Neuro Sciences https://orcid.org/0000-0002-5843-072X

Research Article

Keywords: Schizophrenia, Maternal Immune Activation, Toll-like Receptor, In�ammasome, apoptosis,neuroprogression.

Posted Date: March 10th, 2021

DOI: https://doi.org/10.21203/rs.3.rs-291482/v1

License: This work is licensed under a Creative Commons Attribution 4.0 International License.   Read FullLicense

Page 2/18

AbstractInfection, particularly prenatal infection leads to an enhanced risk of schizophrenia in the offspring. Interestingly,few data exist on the pathway(s) such as TLR and in�ammasome, primarily involved in sensing themicroorganisms and inducing downstream in�ammatory responses, apoptosis and neuroprogressive changes inthe prenatal infection-induced risk of schizophrenia. Herein, we aimed to discern whether prenatal infection-induced maternal immune activation (MIA) causes schizophrenia-like behaviors through activation of TLR andin�ammasome pathways in the brain of offspring. Sprague Dawley rats (n=15/group) were injected either withpoly (I:C) or LPS or saline at gestational day (GD)-12. Signi�cantly elevated plasma levels of IL-1β, IL-6, TNF-αand IL-17A assessed after 24 hours were observed in poly (I:C) and LPS-treated rats, indicating MIA. Theoffspring rats of poly (I:C)-and LPS-treated dams displayed increased anxiety-like behaviors, de�cits in socialbehaviors and prepulse inhibition. The hippocampus of offspring rats showed increased expression of TLR3,TLR4, NLRP3, IL-1β, and IL-18 of poly (I:C) and TLR3, TLR4, NLRP3, Cas1, IL-1β, and IL-18 of LPS-treated dams.Notably, the expression of these genes showed a positive correlation with apoptotic and a negative correlationwith neuroprotective genes. Furthermore, TLR and in�ammasome genes had signi�cant impact on social de�citsand impaired prepulse inhibition in offspring rats. The results suggest MIA due to prenatal infection perhapstrigger TLR, in�ammasome and apoptotic pathways leading to the induction of schizophrenia-like behaviors inthe later stages of life. Prenatal infections seem to drive neuroprogression and subsequently schizophrenia-likesymptoms through a common central pathway involving TLR, in�ammasome and apoptosis.

IntroductionSchizophrenia is a heterogenous and one of the most debilitating neuropsychiatric disorders with a complexetiopathology. A multitude of risk factors may induce different neurotoxic adverse outcome pathways whichcontribute to the phenome of schizophrenia including neurocognitive impairments and the symptomatome.These include genetic variants and changes in gut permeability leading to increased translocation of amongstother Gram-negative bacteria, coupled with de�cits in innate immune responses [1]. Among the environmentalfactors, microbial infection at various life stages, beginning with prenatal, early postnatal, and adolescence, hasbeen reported to confer a signi�cant risk of schizophrenia [2, 3]. The innate immune system is primarily involvedin recognizing danger molecules derived from the host proteins and microorganisms and subsequently drivingthe downstream signaling processes to mount an appropriate immune response against them. The innateimmune system achieves this function through sensors and receptors present on the cell surface or intracellularvesicles and such as Toll-like receptors (TLRs) and in cytosol like retinoic acid-inducible gene-I (RIG-I)-likereceptors (RLRs) and nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) [4]. A family ofTLRs (TLR1-TLR13) has been identi�ed and these recognize a variety of ligands such as glycans, nucleic acids,proteins, lipids, and lipoproteins [5]. Amongst the NLRs, the NLR family pyrin domain containing 3 (NLRP3)responds to a wide array of endogenous and exogenous stimuli and forms a multi-protein complex called NALP3in�ammasome. This in�ammasome has a sensor protein, in�ammatory caspases, and adapter protein in somecases. In�ammasome activation leads to canonical caspase-1 (cas1), noncanonical caspase-11 (or theequivalent caspase-4 and caspase-5 in humans), or caspase-8; this promotes secretion of IL-1β and IL-18 andsubsequently leads to apoptotic and pyroptotic cell death [6].

It is noteworthy that TLRs and NLRs cross-talk and collaborative actions are instrumental in mediating immune-in�ammatory responses against microbes [7, 8]. Transcriptional activation of pro-IL-1β and pro-IL-18 and their

Page 3/18

processing to an active form by the in�ammasome require TLR signaling, further implying their role indownstream immune signaling processes. An emerging body of research suggests an important role of animpaired TLR-in�ammasome cross-talk in many diseases of immune origin [9]. The activation and cross-talkbetween TLR-in�ammasome in CNS infection and during CNS injury and neurodegeneration are increasinglyevident [10, 11]. The elements of TLR and in�ammasome pathways have a wide expression in the brain andregulate key processes of synaptic plasticity. Uncontrolled activation of TLRs and in�ammasomes in the braininduces microglial activation and promotes neuroin�ammation [12].

An activated innate immune system has consistently been reported in patients with schizophrenia. Schizophreniais accompanied by a breakdown of the paracellular and vascular pathways (increased gut permeability) andconsequent translocation of Gram-negative bacteria, which is associated with neurocognitive impairmentsincluding executive functions, sematic and episodic memory, and psychosis, excitation, and negative symptoms[13]. Furthermore, �rst episode schizophrenia is often accompanied by a moderate cytokine-storm with activationof M1 macrophage, T helper (Th)-1 and Th-2 phenotypes, indicating a bacterial or viral infection [14]. Moreover,there is evidence of levels of complement proteins, aberrant expressions of TLR molecules as well as the corecomponents of in�ammasome and altered activity innate immune cells in schizophrenia [15–18]. Alteredexpressions and activity of TLR molecules have been reported in the peripheral blood and postmortem brain ofpatients with schizophrenia [15, 19]. A recent study has demonstrated increased gene expression of CASP1,NLRP3, PYCARD, and IL1β in peripheral blood cells, indicating increased in�ammasome activity in patients withpsychiatric disorders, including schizophrenia [20]. Another postmortem brain study of schizophrenia patientsreported increased expression of caspase 1 and IL-1β [21]. These studies provide empirical evidence of peripheralin�ammation and neuroin�ammation in schizophrenia, driven by TLR and the in�ammasome. Schizophrenia hasbeen proposed to be a neuroprogressive disorder, and immune pathways seem to play a pivotal role inneuroprogression [22]. TLRs and the in�ammasome mediate cell death pathway as well as neurodegeneration[10]. However, a mechanistic link between immune activation and neuroprogression in schizophrenia is yet to bevalidated through clinical and/or pre-clinical studies.

Maternal immune activation (MIA) models of schizophrenia in rodents have been used predominantly todelineate the impact of prenatal infection on immunological and neurobiological sequelae relevant toschizophrenia pathophysiology [23–26]. In a recent study, we have demonstrated the effect of MIA onschizophrenia-like-behaviors through activation of the immuno-in�ammatory, oxidative stress and apoptoticpathways[27]. Acute in utero exposure to LPS increased the expressions of TLR2 and TLR4 in fetal brains andthe postnatal amygdala [28]. Besides, prenatal LPS infection upregulated the expression of in�ammasome andIL-1β in the brain of the offspring mice. Offspring also displayed schizophrenia-like behaviors [29]. However, it isunknown whether MIA leads to schizophrenia-like behavioral abnormalities in the offspring through a concertedaction of TLR and in�ammasome. Further, whether such a concerted action of TLRs and in�ammasome drivesthe neuroprogressive changes in schizophrenia has also not been explored. To address this knowledge gap, weconducted a study to discern the effects of poly (I:C) and LPS induced MIA on TLR and in�ammasome pathwayin the hippocampus of the offspring and their impact on schizophrenia-like behaviors during peri-adolescent andadult periods. Further, the TLR and in�ammasome pathway data were correlated with the signatures of apoptoticpathway to gain insights into the mechanism(s) leading to neuroprogression in schizophrenia. This study for the�rst time provides mechanistic insight into the pathways underlying neuroprogression driven by immuneaberrations in schizophrenia.

Page 4/18

Materials And MethodsAnimals

All experiments were performed on Sprague-Dawley rats (Rattus norvegicus) after obtaining approval from theInstitutional Animal Ethics Committee (AEC/65/389/HG). 13-15 weeks old rats (both sex) weighingapproximately 250-300 gms were housed in standard cages (22.5 × 35.5 × 15 cm) with corncob bedding andmaintained on a 12-hour light/dark cycle with ad libitum access to food and water. Female and male rats werehoused together overnight for mating. Following this, female rats were examined for the presence of a vaginalplug in the morning, and the presence of which was marked as Gestational day 0 (GD0). Additionally, bodyweights of putative pregnant female rats were checked periodically to con�rm pregnancy. The pregnant rats werethen subjected to MIA studies.

Establishment of the MIA model

Three different groups of pregnant rats (n=15 rats / group) received either poly (I:C) (20 mg/kg) or LPS (1.5mg/kg) or an equivalent volume of saline (0.9%) injections intraperitoneally on GD12. Both the poly (I:C) and LPSmodels were used to compare the effects of viral and bacterial agonists speci�c to the TLRs (TLR3-virus-speci�cand TLR2/LTR4-bacteria -speci�c) on behavioral de�cits. After 24 hours of injection, maternal blood wascollected from each group of rats (n=5/group) by cardiac puncture. Plasma was separated and stored at -800C.Plasma levels of proin�ammatory cytokines, namely IL-1β, IL-6, TNF-α, and IL-17A, were analyzed by multiplexsuspension assay in a Bio-plex 200 platform using commercially available rat Milliplex map kit (RECYTMAG-65K) following the manufacturer’s guidelines (RECYTMAG-65K, Millipore, France). 

The remaining pregnant rats from each group (n=10/group) could have a normal delivery. Offspring were weanedat postnatal day 21 (PD21); male and female pups were housed separately, 3 pups per cage. The offspringobtained from poly (I:C) (n=12-14), LPS (n=12-14) and saline (n=12-14)-treated dams were allowed to grow innormal conditions and subjected to various behavioral assessments such as open �eld test (OFT), socialinteraction test (SIT) and prepulse inhibition (PPI) during the peri-adolescent (39-44 days) and adult (60-70 days)periods. After the completion of behavioral assessments during the adult period, hippocampal tissues werecollected from these offspring for the quanti�cation of gene expression. 

Assessments in the Offspring rats

Three behavioral tests, the Open Field Test (OFT), Social Interaction Test (SIT), and Prepulse Inhibition (PPI) test,were carried out on three different sets of offspring rats, each set comprising 12-14 rats. In the present study, wehave used 12-14 offspring rats for each behavioral test, and this was calculated based on our previous researchon similar behavioral assessments [30]. The sample size required for gene expression studies was 5, based on astudy that examined the expression of cerebellar cytokines in the offspring of poly (I:C) treated mice [18]. Thebehavioral and molecular experiments were performed on the same number of both the male and femaleoffspring.

Behavioral assessments in the offspring rats

Schizophrenia-like behavioral assessments such as anxiety-like and exploratory behaviors, social behaviors, andprepulse inhibition (PPI) tests were carried out in the offspring during peri-adolescent and adult periods. Rats

Page 5/18

(n=12-14/group) were subject to i) open �eld test (OFT) to assess anxiety-like and exploratory behaviors, ii)social interaction test (SIT) to examine social behaviors (both the sociability and social novelty), as described ina previous study [30] and iii) prepulse inhibition (PPI) using the Coulbourn instruments startle apparatus(Holliston, Massachusetts) during the peri-adolescent (39-44 days) and adult (60-70 days) periods. The details ofthe methods followed for assessing behavioural abnormalities in the offspring are available in our recentlypublished paper [27].

Quanti�cation of expressions of genes of TLR and in�ammasome pathways in the hippocampal tissue ofoffspring rats

Hippocampal tissue (approximately 100 mg) was collected from offspring rats (n = 5) during the adult periodand stored in RNAlater solution to quantify the expression of TLR2, TLR3 and TLR4, and in�ammasome (NLRP3,caspase-1, IL-1β, and IL-18) pathway-related genes. Hippocampal brain tissue was homogenized and the totalRNA was extracted using a commercially available RNeasy lipid tissue mini-Kit (Qiagen, Germantown, Maryland).The mRNA was converted to cDNA using a high-capacity cDNA reverse transcription kit with RNase inhibitor(Applied Biosystems, USA), and the cDNA was diluted to a �nal concentration of 10 ng/µl. The quantitative PCR(qPCR) was performed in a Quant Studio 6 platform (Applied Biosystems, USA) using SYBR Green assays. Thedetails of the primer sequences and their accession IDs are provided in Table-1. PCR cycling conditions for all thegenes were as follows: 95°C for 15 sec, followed by 40 cycles consisting of 95°C for 5 sec and 60°C for 30 sec.This was followed by melt curve stage consisting 95°C for 15 sec, 60°C for 1 min and 95°C for 15 sec. Sampleswere run in triplicate for each target gene. The qPCR reaction was performed with a commercially available SYBRGreen master mix (TB Green® Premix Ex Taq™ II, Takara, CA, USA). Reactions were performed in a �nal volume of10 μl containing SYBR green Master Mix, and primers of each gene as well as 1μl of cDNA. All ampli�cationbatches included no template control (NTC), and cDNA of a control rat (not from the treatment groups) was usedas a calibrator (reference sample). It was run in each plate to assess intra- and inter-assay variability, which was<0.5 Ct. The 2−ΔΔCt method of relative quanti�cation was used. The result is presented as the fold change oftarget gene expression relative to a reference sample, normalized to the endogenous control (GAPDH).

Statistical Analyses

GraphPad Prism 8.0.1 (Graphpad Software, La Jolla, CA, USA) was used for statistical analyses. For analyzingSIT and PPI data, two-way ANOVA was used to �nd the effect of treatment vs. chambers and treatment vs trialsacross the whole session, followed by Dunnett’s multiple comparison tests. For the analysis of the behavioraltests and gene expression data, one-way ANOVA followed by Dunnett’s multiple comparison tests wereperformed. Pearson’s correlation matrix was used to assess the association of behavioral parameters with geneexpression data.

ResultsPoly (I:C) and LPS treatment induce MIA

Signi�cantly higher levels of IL-6, IL-17A and TNF-α were observed in both the poly (I:C) and LPS-treated pregnantrats, the levels of IL-1β were greater only in LPS-treated rats. The details of the MIA assessments in the pregnantrats are described in our previous study [27].

Page 6/18

Behavioral abnormalities in the MIA offspring

The details of the results of three behavioral tests like anxiety-like behaviors, social behaviors and PPI in theoffspring of poly (I:C) and LPS-treated dams were described in our previous paper [27] and are summarizedbelow.

Poly (I:C) and LPS-treated offspring exhibit anxiety-like behaviors

The rats born to the poly (I:C) and LPS-treated dams showed signi�cant anxiety-like behaviors in the OFT. Theyspent more time in the periphery and not in the center of the chamber compared to rats born to saline-treateddams during both the peri-adolescent and adult periods. The ambulatory behaviors, especially the ambulationrate were comparable across all three groups indicating normal locomotor behaviors.

Poly(I:C) and LPS-treated offspring rats display de�cits in social behaviors

Offspring of both the poly (I:C) and LPS-treated dams displayed signi�cant social behavioral de�cits in terms ofboth sociability and social novelty aspects of social cognition during peri-adolescent and adult periods.

MIA offspring exhibits altered prepulse inhibition

There was no signi�cant difference in percentage PPI in offspring of both the treated and control groups duringthe peri-adolescent period. However, LPS offspring had a decreased percentage of PPI at both 80 dB and 85 dB,but poly (I:C) offspring showed diminished PPI only at 85dB during the adult period.

Assessments of TLR and in�ammasome pathways in MIA offspring

Among the TLR pathway genes, signi�cantly elevated expression of TLR3 was observed in offspring of only poly(I:C) (MD of 0.43 with 95% CI 0.074 to 0.78; P=0.02) and TLR4 in both the poly (I:C) (MD of 0.92 with 95% CI 0.14to 1.4; P=0.002) and LPS (MD of 0.66 with 95% CI 0.14 to 1.2 P=0.01) treated rats, while the expression of TLR2did not vary across the offspring of the treated and control groups (Fig. 1a). Besides this, hippocampal geneexpressions of IL-1β, IL-18 and NLRP3 were signi�cantly upregulated in the offspring of both the poly (I:C) andLPS treated dams. In contrast, the expression of Cas1 was signi�cantly elevated only in the offspring of the LPStreated dams (Fig. 1b).

Correlation between TLR, in�ammasome pathway-related genes, and apoptotic pathway-related moleculesexpressions in the offspring:

Pearson correlation was performed to determine the relationship between the hippocampal TLR gene expressionand in�ammasome pathway-related parameters in offspring rats. As TLR and in�ammasome pathway activationleads to apoptotic changes, a correlation analysis among the markers of these three pathways was performed.The gene expression data of the apoptotic pathway were taken from our previous study on the samehippocampal tissue samples [27]. The �ndings from correlations among TLR, in�ammasome and apoptoticpathway related genes have been summarized in Table-2.

The TLR2 gene expression was found to show positive correlation with the expressions of IL-1β (r= 0.96), (95%CI= 0.54 to 0.99)], IL-18 (r= 0.95), (95% CI= 0.45 to 0.99)], NLRP3 (r= 0.98), (95% CI= 0.78 to 0.99)], and Cas3 (r=0.93), (95% CI= 0.29 to 0.99)] in the offspring of poly (I:C) , while with IL-18 (r= 0.99), (95% CI= 0.81 to 0.99)],

Page 7/18

NLRP3 (r= 0.92), (95% CI= 0.18 to 0.99)], Cas1 (r= 0.96), (95% CI= 0.54 to 0.99)] and Cas3 (r= 0.96), (95% CI= 0.54to 0.99)] in offspring of LPS- treated dams. Conversely, there was a negative correlation between the expressionof TLR2 gene and BCl2 (r= -0.93), (95% CI= 0.28 to 0.99)] gene in offspring of only poly (I:C) treated dams.

Similarly, positive correlations between the expression of TLR3 gene and the expressions of IL-1β (r= 0.99), (95%CI= 0.81 to 0.99)], IL-18 (r= 0.98), (95% CI= 0.76 to 0.99)], NLRP3 (r= 0.99), (95% CI= 0.88 to 0.99)], and Cas3 (r=0.97), (95% CI= 0.59 to 0.99)] in the offspring of poly (I:C) and with IL-18 (r= 0.96), (95% CI= 0.49 to 0.99)], NLRP3(r= 0.90), (95% CI= 0.10 to 0.99)], Cas1 (r= 0.98), (95% CI= 0.74 to 0.99), Cas3 (r= 0.97), (95% CI= 0.66 to 0.99)] inthe offspring of LPS-treated dams were observed. Conversely, there was a negative correlation between theexpression of TLR3 gene and BCl2 (r= -0.94), (95% CI= 0.32 to 0.99)] gene in offspring of only poly(I:C) treateddams.

The expression of TLR4 gene was positively correlated with the expressions of IL-18 (r= 0.88), (95% CI= 0.004 to0.99)], and Cas3 (r= 0.91), (95% CI= 0.12 to 0.99)] in the offspring of poly(I:C) and with Cas9 (r= 0.89), (95% CI=0.04 to 0.99)] in the offspring of LPS-treated dams.

Besides this, we also observed a positive correlation between the expression of the IL-1β gene and the expressionof Cas3 (r= 0.99), (95% CI= 0.88 to 0.99)], and Bax (r= 0.98), (95% CI= 0.73 to 0.99)] and a negative correlationbetween the expression of IL-1β gene and BCl2 (r= -0.94), (95% CI= 0.30 to 0.99)] gene in offspring of poly(I:C)treated dams. A positive correlation between the expression of IL-18 gene and the expression of Bax (r= 0.98),(95% CI= 0.68 to 0.99)] and a negative correlation between the expression of IL-18 gene and BCl2 (r= -0.92), (95%CI= 0.18 to 0.99)] gene were also observed in offspring of poly (I:C) treated dams. However, a positive correlationbetween the expressions of IL-18 and Cas1 (r= 0.94), (95% CI= 0.36 to 0.99)], Cas3 [(r= 0.94), (95% CI= 0.31 to0.99)], Bax (r= 0.89), (95% CI= 0.06 to 0.99)] and a negative correlation between the expression of IL-18 gene andBDNF (r= -0.89), (95% CI= 0.06 to 0.99)] gene were seen in offspring of LPS-treated dams.

Correlation between TLR and in�ammasome pathway-related genes expression, and schizophrenia-like behaviorde�cits in the offspring:

Pearson correlation was performed to determine the relationship between hippocampal gene expression andbehavioral parameters in offspring rats. None of the studied genes showed correlation with anxiety-likebehaviors; however, signi�cant correlations were observed with social behaviors and PPI de�cits.

Correlation between behavioral de�cits and gene expression in the offspring of poly (I:C) treated dams:

We observed a negative correlation in the offspring between the expressions of TLR2[(r= -0.89), (95% CI= 0.00039to 0.99)] (Fig. 2a), TLR3[(r= -0.88), (95% CI= 0.01 to 0.99)] (Fig. 2b), and IL-1β genes [(r= -0.98), (95% CI= 0.71 to0.99)] (Fig. 2c) and sociability index. In addition, a negative correlation was also observed between IL-1β geneexpression and prepulse inhibition at 80dB [(r= -0.91), (95% CI= 0.12 to 0.99)] (Fig. 2d), TLR4 gene expression andprepulse inhibition at 85dB [(r= -0.96), (95% CI= 0.48 to 0.99)] (Fig. 2e) and expression of IL-18 gene and prepulseinhibition at 85dB [(r= -0.88), (95% CI= 0.02 to 0.99)] (Fig. 2f).

Correlation between behavioral de�cits and gene expression in the offspring of LPS treated dams:

We observed a negative correlation between the expressions of TLR2 [(r= -0.99), (95% CI= 0.80 to 0.99)] (Fig. 3a),IL-1β [(r= -0.95), (95% CI= 0.42 to 0.99)] (Fig. 3b), cas1 gene and sociability index [(r= -0.98), (95% CI= 0.71 to

Page 8/18

0.99)] (Fig. 3c). A negative correlation was also observed between the expressions of TLR2 gene [(r= -0.92), (95%CI= 0.18 to 0.99)] (Fig. 3d), TLR3 (r= -0.90), (95% CI= 0.10 to 0.99)] (Fig. 3e), IL-1β genes and [(r= -0.95), (95% CI=0.38 to 0.99)] (Fig. 3f) the novelty index. Further, negative correlation was observed between the expression ofTLR2 [(r= -0.89), (95% CI= 0.08 to 0.99)] (Fig. 3g) and IL-18 genes and prepulse inhibition at 80dB [(r= -0.95), (95%CI= 0.45 to 0.99)] (Fig. 3h), and between the TLR4 gene [(r= -0.92), (95% CI= 0.19 to 0.99)] (Fig.3i) and IL- 18genes and prepulse inhibition at 85dB [(r= -0.94), (95% CI= 0.31 to 0.99)] (Fig. 3j) in LPS MIA offspring.

DiscussionIn this study, the MIA status was established by injecting the rats with poly (I:C) and LPS on GD12 and indexed byheightened levels of in�ammatory cytokines, such as IL-1β, IL-6, IL-17A and TNF-α in the maternal plasma,twenty-four hours after injection. In the offspring, the MIA signi�cantly altered anxiety-like, social interactions andsensorimotor gating as measured by examining prepulse inhibition, which are models of human schizophreniasymptoms. Anxiety-like behaviors and socio-cognitive de�cits were observed in the offspring of both the poly(I:C) and LPS-treated dams during the adolescent and adult periods. Reduced PPI during the adult period wasalso observed in the offspring of both the poly (I:C) and LPS-treated dams. Sex was not found to have any effecton the behavioral measures studied here.

In a recent study using MIA model, we demonstrated an important role of immune-in�ammatory, oxidative stressand apoptotic pathway in MIA-induced schizophrenia-like behaviors in the offspring [27]. However, there are nostudies pertaining to the role and interactions of immune initiators such as TLR and in�ammasome and theireffect on apoptotic pathway and subsequently to schizophrenia-like behaviors.

Impact of MIA on TLR and in�ammasome and schizophrenia-like behaviors in the offspring

In this study, upregulated expressions of TLR3 in the offspring of poly (I:C) and TLR4 in the offspring of both thepoly (I:C) and LPS-treated dams. Importantly, all three TLRs (TLR2, TLR3 and TLR4) studied here exhibitedassociations with schizophrenia-like behavioral abnormalities in offspring, suggesting a pivotal role of increasedTLR signaling in behavioral de�cits akin to schizophrenia in the offspring. To the best of our knowledge, this isthe �rst study to demonstrate the long-lasting effects of MIA on three TLR molecules in the hippocampus of theoffspring and their impact on schizophrenia-like behaviors, employing both the poly (I:C) and LPS models. In aprevious study, poly (I:C) injection during gestation impaired neonatal locomotor development, inhibited corticalneurogenesis and behavioral disturbances, including abnormal sensorimotor gating in the offspring during theadult period, and these were found to be mediated by TLR3 [31]. Besides poly (I:C), LPS-induced MIA led toupregulation of TLR2 and TLR4 in the fetal brain and the amygdala of the adult offspring; however, the authorsdid not examine their impact on behavioral de�cits [28]. TLR activation seems to induce neuroin�ammation andlead to increased production of reactive oxygen and nitrogen species ROS/RNS) and activates oxidative andnitrosative stress (O&NS) pathway in the brain and subsequently result to schizophrenia psychopathology. Takentogether, ours and other studies suggest important implications of TLRs in the neuronal functions and behavioralde�cits.

The other salient �ndings were upregulated expression of NLRP3, IL-1β, and IL-18 in the hippocampus of theoffspring of both the poly (I:C) and LPS-treated offspring and Cas1 only in the LPS offspring. It is interesting tonote that the elevated levels of the in�ammasome elements had signi�cant impact on schizophrenia-like

Page 9/18

behavioral de�cits in the offspring. There is a lack of data on the role of in�ammasome in MIA inducedschizophrenia-like behaviors. The only study on LPS induced MIA mediated schizophrenia-like behaviors throughin�ammasome activity showed increased expression of NLRP3 in�ammasome and IL-1β in the hippocampus ofthe offspring mice [29]. Our �ndings on four core components of the in�ammasome provide further supporttowards the role of the in�ammasome in MIA induced schizophrenia-like behaviors in the offspring. It isnoteworthy that both poly (I:C) and LPS induced MIA led to similar changes in the behavioral de�cits andhippocampal expressions of TLR and in�ammasome in the offspring rats. However, a previous study reporteddifferential effects of Poly (I:C) and LPS on the in�ammatory responses, based on IL-2, IL-5 and IL-6 levels aswell as behaviors, such as anxiety-like, and sensorimotor development in the offspring [32]. Since the design andconcept of this and our current study are different, the �ndings between these two studies cannot be compared.We suggest that the effect of bacterial infection on the immune and behavioral sequelae could be more than theviral infection. LPS induced activation of TLR molecules, especially TLR4 leads to induction of all the coreelements of in�ammasome pathway (NLLRP3, cas1, IL-1β and IL-18) and this may induce a radical TLR4 cycle.Besides, recent advances in the �eld suggest a moderate cytokine storm in �rst episode schizophrenia patients,indicating a bacterial rather than viral infection. Further studies are required to gain insights into this complexcascade of events.

Collaborative action of TLR and in�ammasome and schizophrenia-like behavior in the offspring

A combined action of the TLR and in�ammasome is increasingly recognized to play a crucial role in triggeringimmune-in�ammatory responses in many diseases, including CNS diseases [9, 11]. There are no studies on thecollaborative action of TLR and in�ammasome in any neuropsychiatric disorders. The most salient �nding ofthis study was the positive correlation between the TLR genes and the components of the in�ammasomepathway. It is noteworthy that NLRP3 acts synergistically with TLR2/TLR4 and TLR3 to modulate in�ammatoryresponses against bacterial and viral pathogens, respectively [8, 33]. The synergistic interactions of TLR andNLRP3 and subsequent activation of IL-1β and induction of neuroin�ammation has been reported inneurodegenerative diseases [11, 34]. The activation of TLRs leads to activation of NLRP3 and Cas1 and thissubsequently leads to induction of IL-1β, and IL-18. The combined action of these molecules may lead topyroptosis, an in�ammatory form of cell death [35]. In the current study, the expressions of both the TLR2 andTLR3 genes were found to signi�cantly correlate with the expressions of the core elements of the in�ammasomepathway, including the effector cytokines such as IL-1β and IL-18. This implies that in the face of viral andbacterial infection, TLRs and in�ammasome activation and interactions lead to neuroin�ammation due toelevated production of IL-1β and IL-18, and in turn, might contribute to schizophrenia pathogenesis. Thisobservation reports for the �rst time synergistic action of TLR and in�ammasome in the hippocampal tissue ofthe offspring rats, showing schizophrenia-like behavior.

5.3 TLR and in�ammasome activation and pyroptosis in the brain of the offspring rats

TLR molecules also showed a positive correlation with the genes of the apoptotic pathway. Another interesting�nding was the positive correlation between the expressions of the effector cytokines (IL-1β and IL-18) ofin�ammasome and genes of the apoptotic pathway in the hippocampus of the offspring rats of the poly (I:C)and LPS-treated dams. Increased expressions of IL-1β and IL-18 are linked with greater expressions of pro-apoptotic markers and decreased expression of neuroprotective genes. It is now well-documented that the NLRP3in�ammasome activates cell death pathways. However, studies showing such a link are currently not available

Page 10/18

for any psychiatric conditions. Our novel �ndings suggest that MIA, through activation of TLR andin�ammasome, might lead to pyroptosis in the brain of the offspring and thus result in schizophrenia-likebehavioral abnormalities. We propose that prenatal infection and subsequent MIA drive schizophrenia-likebehavioral changes through neurodevelopmental aberrations and long-lasting neuroprogressive changes. Thisprocess occurs through a persistent and complex chain of events involving a collaboration of multiple elementsof the innate immune system, especially TLR, and in�ammasome as the primary drivers of the entire process.These data provide direct evidence towards a mechanistic link between MIA and schizophrenia-like behaviors bydriving neuroprogressive changes. These molecules could emerge as the potential targets of pharmacologicaltherapy. In a recent study on the MIA model of schizophrenia, paliperidone was shown to revert activation ofTLR3, elicited by poly (I:C) injection and restore cognitive de�cits [36].

ConclusionIncreased activation as well as expressions of TLRs and in�ammasome promote in�ammation and drivepathogenetic pathways in many autoin�ammatory diseases of the central nervous system [37]. The �ndings ofthe current study highlight that a collaborative action of TLR and in�ammasome in mediating the effect ofprenatal infection-induced MIA on schizophrenia-like behavioral de�cits. Further, the signatures of thesepathways seem to potentially interact with the mediators of the apoptotic pathway and in�uence their expressionin the hippocampus of the offspring rats. These �ndings provide empirical support towards the implications ofMIA in inducing neuroprogressive changes and schizophrenia-like behaviors. They also offer mechanisticevidence verifying the interactions between the pathways hypothesized as the foundation of neuroprogression[22, 38].

DeclarationsAcknowledgements:

The authors are grateful to Prof. B.S. Shankarnarayana Rao and Prof. Laxmi T. Rao, Department ofNeurophysiology, NIMHANS, Bengaluru for their kind support in conducting the behavioral tests. MB is supportedby a NHMRC Senior Principal Research Fellowship (1059660 and 1156072).

Funding statement:

This study was partially supported by the Women Scientist-A grant from the Department of Science andTechnology (SR/WOS-A/LS-1219/2014(G), Government of India to PMT. The �nancial support received from theDepartment of Science and Technology is acknowledged.

Author contributions:

Monojit Debnath conceived and designed the study as well as drafted the manuscript. Pinku Mani Talukdar andFazal Abdul carried out the experiments. Pinku Mani Talukdar analyzed the data and prepared the �gures andtables. Bindu M. Kutty had supervised the animal behavior experiments and helped in interpretation of the dataobtained from behavioral experiments. Bindu M. Kutty, G. Venkatasubramanian, Michael Berk and Michael Maesmodi�ed the manuscript. All authors read and approved the manuscript.

Page 11/18

Compliance with ethical standards:

All experiments were performed on Sprague-Dawley rats (Rattus norvegicus) in accordance with the guidelines ofCommittee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Government ofIndia and initiated after obtaining approval from the Institutional Animal Ethics Committee (AEC/65/389/HG). 

Consent to participate: Not applicable.

Consent for Publication: Not applicable.

Con�ict of interest:

MB has received Grant/Research Support from the NIH, Cooperative Research Centre, Simons AutismFoundation, Cancer Council of Victoria, Stanley Medical Research Foundation, Medical Bene�ts Fund, NationalHealth and Medical Research Council, Medical Research Futures Fund, Beyond Blue, Rotary Health, A2 milkcompany, Meat and Livestock Board, Woolworths, Avant and the Harry Windsor Foundation, has been a speakerfor Abbot, Astra Zeneca, Janssen and Janssen, Lundbeck and Merck and served as a consultant to Allergan,Astra Zeneca, Bioadvantex, Bionomics, Collaborative Medicinal Development, Janssen and Janssen, LundbeckMerck, P�zer and Servier – all unrelated to this work.

Availability of data and material:

 The datasets generated during and/or analysed during the current study are available from the correspondingauthor on reasonable request.

References1. Maes M, Vojdani A, Galecki P and Kanchanatawan B (2020) How to Construct a Bottom-Up Nomothetic

Network Model and Disclose Novel Nosological Classes by Integrating Risk Resilience and Adverse OutcomePathways with the Phenome of Schizophrenia. Brain Sci 10. doi: 10.3390/brainsci10090645

2. Meyer U, Schwendener S, Feldon J and Yee BK (2006) Prenatal and postnatal maternal contributions in theinfection model of schizophrenia. Exp Brain Res 173:243 − 57. doi: 10.1007/s00221-006-0419-5

3. Hultman CM, Sparen P, Takei N, Murray RM and Cnattingius S (1999) Prenatal and perinatal risk factors forschizophrenia, affective psychosis, and reactive psychosis of early onset: case-control study. BMJ 318:421-6. doi: 10.1136/bmj.318.7181.421

4. Kawai T and Akira S (2009) The roles of TLRs, RLRs and NLRs in pathogen recognition. Int Immunol 21:317 − 37. doi: 10.1093/intimm/dxp017

5. Takeda K and Akira S (2001) Roles of Toll-like receptors in innate immune responses. Genes Cells 6:733 − 42.

�. Zheng D, Liwinski T and Elinav E (2020) In�ammasome activation and regulation: toward a betterunderstanding of complex mechanisms. Cell Discov 6:36. doi: 10.1038/s41421-020-0167-x

7. Kawai T and Akira S (2011) Toll-like receptors and their crosstalk with other innate receptors in infection andimmunity. Immunity 34:637 − 50. doi: 10.1016/j.immuni.2011.05.006

Page 12/18

�. Oviedo-Boyso J, Bravo-Patino A and Baizabal-Aguirre VM (2014) Collaborative action of Toll-like and NOD-like receptors as modulators of the in�ammatory response to pathogenic bacteria. Mediators In�amm2014:432785. doi: 10.1155/2014/432785

9. Grishman EK, White PC and Savani RC (2012) Toll-like receptors, the NLRP3 in�ammasome, and interleukin-1beta in the development and progression of type 1 diabetes. Pediatr Res 71:626 − 32. doi:10.1038/pr.2012.24

10. Hanamsagar R, Hanke ML and Kielian T (2012) Toll-like receptor (TLR) and in�ammasome actions in thecentral nervous system. Trends Immunol 33:333 − 42. doi: 10.1016/j.it.2012.03.001

11. Yang J, Wise L and Fukuchi KI (2020) TLR4 Cross-Talk With NLRP3 In�ammasome and ComplementSignaling Pathways in Alzheimer's Disease. Front Immunol 11:724. doi: 10.3389/�mmu.2020.00724

12. Zhang CJ, Jiang M, Zhou H, Liu W, Wang C, Kang Z, Han B, Zhang Q, Chen X, Xiao J, Fisher A, Kaiser WJ,Murayama MA, Iwakura Y, Gao J, Carman J, Dongre A, Dubyak G, Abbott DW, Shi FD, Ransohoff RM and Li X(2018) TLR-stimulated IRAKM activates caspase-8 in�ammasome in microglia and promotesneuroin�ammation. J Clin Invest 128:5399–5412. doi: 10.1172/JCI121901

13. Maes M, Sirivichayakul S, Kanchanatawan B and Vodjani A (2019) Breakdown of the Paracellular Tight andAdherens Junctions in the Gut and Blood Brain Barrier and Damage to the Vascular Barrier in Patients withDe�cit Schizophrenia. Neurotox Res 36:306–322. doi: 10.1007/s12640-019-00054-6

14. Noto MN, Maes M, Nunes SOV, Ota VK, Rossaneis AC, Verri WA, Jr., Cordeiro Q, Belangero SI, Gadelha A,Bressan RA and Noto C (2019) Activation of the immune-in�ammatory response system and thecompensatory immune-regulatory system in antipsychotic naive �rst episode psychosis. EurNeuropsychopharmacol 29:416–431. doi: 10.1016/j.euroneuro.2018.12.008

15. Balaji R, Subbanna M, Shivakumar V, Abdul F, Venkatasubramanian G and Debnath M (2020) Pattern ofexpression of Toll like receptor (TLR)-3 and − 4 genes in drug-naive and antipsychotic treated patientsdiagnosed with schizophrenia. Psychiatry Res 285:112727. doi: 10.1016/j.psychres.2019.112727

1�. Kirkpatrick B and Miller BJ (2013) In�ammation and schizophrenia. Schizophr Bull 39:1174-9. doi:10.1093/schbul/sbt141

17. Sekar A, Bialas AR, de Rivera H, Davis A, Hammond TR, Kamitaki N, Tooley K, Presumey J, Baum M, VanDoren V, Genovese G, Rose SA, Handsaker RE, Daly MJ, Carroll MC, Stevens B and McCarroll SA (2016)Schizophrenia risk from complex variation of complement component 4. Nature 530:177 − 83. doi:10.1038/nature16549

1�. Steiner J, Frodl T, Schiltz K, Dobrowolny H, Jacobs R, Fernandes BS, Guest PC, Meyer-Lotz G, Borucki K, BahnS, Bogerts B, Falkai P and Bernstein HG (2020) Innate Immune Cells and C-Reactive Protein in Acute First-Episode Psychosis and Schizophrenia: Relationship to Psychopathology and Treatment. Schizophr Bull46:363–373. doi: 10.1093/schbul/sbz068

19. Garcia-Bueno B, Gasso P, MacDowell KS, Callado LF, Mas S, Bernardo M, Lafuente A, Meana JJ and Leza JC(2016) Evidence of activation of the Toll-like receptor-4 proin�ammatory pathway in patients withschizophrenia. J Psychiatry Neurosci 41:E46-55.

20. Hylen U, Eklund D, Humble M, Bartoszek J, Sarndahl E and Bejerot S (2020) Increased in�ammasome activityin markedly ill psychiatric patients: An explorative study. J Neuroimmunol 339:577119. doi:10.1016/j.jneuroim.2019.577119

Page 13/18

21. Kim HK, Andreazza AC, Elmi N, Chen W and Young LT (2016) Nod-like receptor pyrin containing 3 (NLRP3) inthe post-mortem frontal cortex from patients with bipolar disorder: A potential mediator betweenmitochondria and immune-activation. J Psychiatr Res 72:43–50. doi: 10.1016/j.jpsychires.2015.10.015

22. Davis J, Moylan S, Harvey BH, Maes M and Berk M (2014) Neuroprogression in schizophrenia: Pathwaysunderpinning clinical staging and therapeutic corollaries. Aust N Z J Psychiatry 48:512 − 29. doi:10.1177/0004867414533012

23. Bergdolt L and Dunaevsky A (2019) Brain changes in a maternal immune activation model ofneurodevelopmental brain disorders. Prog Neurobiol 175:1–19. doi: 10.1016/j.pneurobio.2018.12.002

24. Purves-Tyson TD, Weber-Stadlbauer U, Richetto J, Rothmond DA, Labouesse MA, Polesel M, Robinson K,Shannon Weickert C and Meyer U (2019) Increased levels of midbrain immune-related transcripts inschizophrenia and in murine offspring after maternal immune activation. Mol Psychiatry. doi:10.1038/s41380-019-0434-0

25. Moller M, Du Preez JL, Viljoen FP, Berk M, Emsley R and Harvey BH (2013) Social isolation rearing inducesmitochondrial, immunological, neurochemical and behavioural de�cits in rats, and is reversed by clozapineor N-acetyl cysteine. Brain Behav Immun 30:156 − 67. doi: 10.1016/j.bbi.2012.12.011

2�. Lotter J, Moller M, Dean O, Berk M and Harvey BH (2020) Studies on Haloperidol and Adjunctive alpha-Mangostin or Raw Garcinia mangostana Linn Pericarp on Bio-Behavioral Markers in an Immune-In�ammatory Model of Schizophrenia in Male Rats. Front Psychiatry 11:121. doi: 10.3389/fpsyt.2020.00121

27. Talukdar PM, Abdul F, Maes M, Binu VS, Venkatasubramanian G, Kutty BM and Debnath M (2020) MaternalImmune Activation Causes Schizophrenia-like Behaviors in the Offspring through Activation of Immune-In�ammatory, Oxidative and Apoptotic Pathways, and Lowered Antioxidant Defenses and Neuroprotection.Mol Neurobiol 57:4345–4361. doi: 10.1007/s12035-020-02028-8

2�. O'Loughlin E, Pakan JMP, Yilmazer-Hanke D and McDermott KW (2017) Acute in utero exposure tolipopolysaccharide induces in�ammation in the pre- and postnatal brain and alters the glial cytoarchitecturein the developing amygdala. J Neuroin�ammation 14:212. doi: 10.1186/s12974-017-0981-8

29. Ventura L, Freiberger V, Thiesen VB, Dias P, Dutra ML, Silva BB, Schlindwein AD and Comim CM (2020)Involvement of NLRP3 in�ammasome in schizophrenia-like behaviour in young animals after maternalimmune activation. Acta Neuropsychiatr 32:321–327. doi: 10.1017/neu.2020.27

30. Subhadeep D, Srikumar BN, Shankaranarayana Rao BS and Kutty BM (2020) Short photoperiod restoresventral subicular lesion-induced de�cits in affective and socio-cognitive behavior in male Wistar rats. JNeurosci Res. doi: 10.1002/jnr.24601

31. De Miranda J, Yaddanapudi K, Hornig M, Villar G, Serge R and Lipkin WI (2010) Induction of Toll-like receptor3-mediated immunity during gestation inhibits cortical neurogenesis and causes behavioral disturbances.MBio 1. doi: 10.1128/mBio.00176-10

32. Arsenault D, St-Amour I, Cisbani G, Rousseau LS and Cicchetti F (2014) The different effects of LPS and polyI:C prenatal immune challenges on the behavior, development and in�ammatory responses in pregnant miceand their offspring. Brain Behav Immun 38:77–90. doi: 10.1016/j.bbi.2013.12.016

33. Yu M and Levine SJ (2011) Toll-like receptor, RIG-I-like receptors and the NLRP3 in�ammasome: keymodulators of innate immune responses to double-stranded RNA viruses. Cytokine Growth Factor Rev22:63–72. doi: 10.1016/j.cytogfr.2011.02.001

Page 14/18

34. Rapsinski GJ, Wynosky-Dol� MA, Oppong GO, Tursi SA, Wilson RP, Brodsky IE and Tukel C (2015) Toll-likereceptor 2 and NLRP3 cooperate to recognize a functional bacterial amyloid, curli. Infect Immun 83:693–701. doi: 10.1128/IAI.02370-14

35. Tsuchiya K (2020) In�ammasome-associated cell death: Pyroptosis, apoptosis, and physiologicalimplications. Microbiol Immunol 64:252–269. doi: 10.1111/1348-0421.12771

3�. MacDowell KS, Munarriz-Cuezva E, Caso JR, Madrigal JL, Zabala A, Meana JJ, Garcia-Bueno B and Leza JC(2017) Paliperidone reverts Toll-like receptor 3 signaling pathway activation and cognitive de�cits in amaternal immune activation mouse model of schizophrenia. Neuropharmacology 116:196–207. doi:10.1016/j.neuropharm.2016.12.025

37. Guo H, Callaway JB and Ting JP (2015) In�ammasomes: mechanism of action, role in disease, andtherapeutics. Nat Med 21:677 − 87. doi: 10.1038/nm.3893

3�. Berk M, Kapczinski F, Andreazza AC, Dean OM, Giorlando F, Maes M, Yucel M, Gama CS, Dodd S, Dean B,Magalhaes PV, Amminger P, McGorry P and Malhi GS (2011) Pathways underlying neuroprogression inbipolar disorder: focus on in�ammation, oxidative stress and neurotrophic factors. Neurosci Biobehav Rev35:804 − 17. doi: 10.1016/j.neubiorev.2010.10.001

TablesTable-1: Shows the list of the genes, primer sequences and their accession number.

Name ofGene

Forward primer Reverse primer Accessionnumber

GAPDH 5'- CGGCAAGTTCAACGGCACAG − 3' 5'-GAAGACGCCAGTAGACTCCACGAC− 3'

NM_017008

TLR2 5'-TCTGAGTTCCGTGACATAGG-3' 5'-CTTAGACAACGCAATGTAGA-3' NM 198769

TLR3 5'-GATTGGCAAGTTATTCGTC-3' 5'-GCGGAGGCTGTTGTAGG-3' NM_198791

TLR4 5'-GTGAGCATTGATGAGTTCAG-3' 5'-TTAGGAATAGTTAGTAATCTAC-3'

NM 019178

IL-1β 5'-TGCTGTCTGACCCATGTGAG-3' 5'-GTCGTTGCTTGTCTCTCCTTG-3'

NM_031512.2

IL-18 5'-AGGACTGGCTGTGACCCTAT-3' 5'-TCCTGGCACACGTTTCTGAAA-3'

NC_005107.4

Caspase1 5'-GCACAAGACCTCTGACAGCA-3' 5'-TTGGGCAGTTCTTGGTATTC-3' NM_012762.3

NLRP3 5'-GTGGAGATCCTAGGTTTCTCTG-3' 5'-CAGGATCTCATTCTCTTGGATC-3'

NM_001191642.1

Table-2: Showing correlation coe�cients (r) of TLR, in�ammasome and apoptotic pathway- related genes inoffspring of poly (I:C) and LPS-treated dams.

Page 15/18

Genes In�ammasome and apoptoticmarkers

Offspring of poly (I:C)- treateddams

Offspring of LPS-treateddams

Correlationcoe�cient (r)

pvalue

Correlationcoe�cient (r)

pvalue

TLR2 NLRP3Cas1IL-1βIL-18Cas3BCl2

0.98-0.960.950.93-0.93

0.002-0.0080.010.020.02

0.920.96-0.990.96-

0.030.008-0.0020.008-

TLR3 NLRP3Cas1IL-1βIL-18Cas3BCl2

0.99-0.990.980.97-0.94

0.001-0.020.0030.0070.02

0.900.980.96-0.98-

0.040.0030.01-0.005-

TLR4 IL-18Cas3Cas9

0.880.91-

0.050.03-

--0.89

--0.04

IL-1β Cas3BaxBCl2

0.990.98-0.94

0.030.020.0002

---

---

IL-18 Cas1Cas3BaxBCl2BDNF

--0.98-0.92-

--0.0040.03-

0.940.940.89--0.89

0.020.020.04-0.04

Figures

Page 16/18

Figure 1

Gene expression of TLR and in�ammasome pathway-related genes in hippocampal brain tissue in the offspringof poly (I:C) and LPS-treated and control rats.

Page 17/18

Figure 2

Impact of elevated expressions of TLR and in�ammasome pathways related genes on the schizophrenia-likebehavioral correlates in the offspring of Poly (I:C)-treated dams.

Page 18/18

Figure 3

Impact of elevated expressions of TLR and in�ammasome pathways related genes on the schizophrenia-likebehavioral correlates in the offspring of Poly (I:C)-treated dams.