ars.els-cdn.com · Web viewmyxovirus (influenza virus) resistance 1, interferon-inducible protein...

Supplementary materials

Supplementary materials and methods

Immunophenotypic analysis

Antibodies against the human antigens CD14, CD34, CD45, CD73, CD90, CD105, CD166, and HLA-DR were

purchased from BD Biosciences. To examine the immunophenotype of cells isolated from tissues, 5 × 105

cells were resuspended in 0.2 mL of PBS and incubated with fluorescein isothiocyanate (FITC)- or

phycoerythrin (PE)-conjugated antibodies for 30 min at room temperature. The fluorescence intensity of cells

was evaluated by flow cytometry (FACScan, BD Biosciences), and the data were analyzed with CELLQUEST

software (BD Biosciences).

Differentiation assays

Osteogenic induction. Upon reaching 50% confluency, cells were cultured for 14–21 days in LG-DMEM

containing 10% FBS, 0.1 µM dexamethasone (Sigma-Aldrich), 10 mM β-glycerophosphate (Sigma-Aldrich),

and 100 µM ascorbate-2-phosphate (Sigma-Aldrich). The medium was changed every 3 days. Osteogenic

differentiation was confirmed by examining the expression of alkaline phosphatase.

Adipogenic induction. Upon reaching 100% confluency, cells were cultured for 14–21 days in LG-DMEM

containing 10% FBS, 1 µM dexamethasone, 0.5 mM isobutyl methylxanthine (Sigma-Aldrich), 100 µM

indomethacin (Sigma-Aldrich), and 10 µg/mL insulin (Sigma-Aldrich). Adipogenic differentiation was evaluated

by the cellular accumulation of neutral lipid vacuoles that were stained with Oil Red O (Sigma-Aldrich).

Chondrogenic induction. Upon reaching 80% confluency, cells were trypsinized with 0.05% trypsin-EDTA

and resuspended in LG-DMEM containing 1× insulin-transferrin-selenium (ITS; Invitrogen-Gibco), 1 mM

sodium pyruvate (Invitrogen-Gibco), 0.1 µM dexamethasone, 397 µg/mL ascorbate-2-phosphate, and 10

ng/mL transforming growth factor-β1 (R&D Systems). Viable cells were counted and seeded at a density of 2 ×

1 / 43

105 cells per tube in 15 cm3 conical tubes. Cells were collected at the bottom of the tubes by centrifugation.

Compact cell pellets were allowed to form in a humidified atmosphere at 37°C with 5% CO2. After 14–21 days

of culture, chondrogenic differentiation was detected by the extracellular accumulation of chondrocyte matrix

that was stained with toluidine blue (Sigma-Aldrich).

Transwell assay

Two chambers were separated by a semi-permeable membrane with a pore size of 0.4 µm (BD Biosciences).

In total, 1 × 105 hPBMCs were cultured in the upper chamber of the transwell inserts. The lower chamber

contained medium alone as a control or medium containing each type of MSCs. Cultures were incubated for 3

days before the addition of BrdU. After 18 h, proliferation was assessed using a BrdU incorporation assay kit

according to the manufacturer’s protocol.

Flow cytometry

Antibodies against the human antigens CD3 and CD8 were purchased from BD Biosciences. PHA-activated

hPBMCs were cultured on MSCs for 3 days. Following this, hPBMCs were incubated with FITC- or PE-

conjugated antibodies for 30 min at room temperature. The fluorescence intensity of cells was evaluated by

flow cytometry (FACScan), and the data were analyzed with CELLQUEST software.

T-cell proliferation: CFSE staining

For flow cytometric analysis of T-cell proliferation, hPBMCs were incubated in PBS containing 5 µM CFSE

(carboxyfluorescein succinimidyl ester, Invitrogen-Gibco) and 0.1% bovine serum albumin (Invitrogen-Gibco)

for 10 min at 37°C. PHA-activated hPBMCs were then cultured on MSCs for 3-4 days. Following this,

hPBMCs were incubated with a PE-conjugated anti-CD3 antibody (BD Biosciences) for 20 min at room

temperature. The intensity of CFSE staining of PHA-induced proliferating CD3+ T-cells was evaluated by flow

2 / 43

cytometry (FACScan). Data were analyzed using CELLQUEST software.

Immunohistochemistry

MSCs were stained with CM-DiI (Invitrogen-Gibco) so that they could be detected in tissues. Briefly, MSCs

were trypsinized and incubated with 1 µM CM-DiI for 5 min at 37°C, and then for an additional 15 min at 4°C.

After labeling, 1 × 106 MSCs were washed with PBS and intravenously injected along with hPBMCs into mice.

The same number of MSCs was injected again on day 7. After the mice died, or were sacrificed, the skin and

small intestines were carefully dissected using a frozen sectioning technique. Fluorescence imaging of tissues

was performed using a Carl Zeiss LSM 700 confocal microscope system with a 25 mW laser diode tuned to

405 nm to detect DAPI staining of cell nuclei, a 30 mW argon laser tuned to 488 nm for visualization of Alexa

Fluor 488-labeled IDO, and a 10 mW HeNe laser tuned to 555 nm for visualization of CM-DiI-labeled MSCs.

Confocal microscopy results were analyzed using LSM 700 Zen software.

Assessment of GVHD

GVHD was assessed daily by examining a variety of parameters (weight change, posture, activity, fur texture,

and skin integrity). A threshold of 10% weight loss was used to indicate the presence of moderate GVHD, and

mice were sacrificed to harvest organs for histological evaluation of GVHD. Hematoxylin-eosin-stained

sections of skin and small intestines were assessed by a pathologist using a scoring system. The parameters

for skin evaluation included necrotic keratinocytes, lymphoid infiltration of the dermis, exocytosis of

lymphocytes, vacuolar degeneration of the epidermal-dermal junctions, intraepithelial lymphoid infiltration,

deficiency of Langerhans cells, and edema of the intercellular space. To assess GVHD in the small intestine,

parameters such as villous blunting, crypt regeneration, crypt epithelial cell apoptosis, crypt loss, luminal

sloughing of cellular debris, lamina propria inflammatory cell infiltration, and mucosal ulceration were used.

3 / 43

Supplementary figures and legends

Fig. S1. Characteristics of human MSCs. (a) Morphological appearance of human MSCs derived from

different tissues (BM, AT, CB, and WJ). Scale bar: 50 μm. (b) The immunophenotype of MSCs derived from

different tissues was analyzed by flow cytometry. The expression of surface antigens was plotted against the

appropriate IgG isotype controls (gray histogram). MSCs used for the analyses were positive for CD73, CD90,

CD105, and CD166, and negative for CD14, CD34, CD45, and HLA-DR (clear histogram). The histograms

presented are representative of each independent experiment. (c) Differentiation of MSCs derived from

4 / 43

different tissues. Cells were incubated for 14–21 days in the presence of specific agents to allow for

differentiation into osteoblasts, chondrocytes, or adipocytes. The alkaline phosphatase staining shows

mineralization of the extracellular matrix. Differentiation into the adipocyte lineage was demonstrated by

staining with Oil Red O. The toluidine blue staining shows the deposition of proteoglycans and lacunae.

Magnification × 100.

5 / 43

Fig. S2. Immunosuppressive properties of MSCs either in a system with direct cell-to-cell contacts or

in a transwell culture system. PHA-induced proliferation of T-cells in cultures of hPBMCs, in the absence or

presence of MSCs derived from different four tissues, was evaluated on day 3 by microscopy (a) and BrdU

incorporation (b). Data are expressed as the percentage of hPBMC proliferation in the absence of MSCs and

represent the mean ± SD of three separate experiments. (c) T-cell proliferation in cultures of hPBMCs in the

transwell culture system was confirmed by flow cytometry analysis of hCD3+CD8+. (d) Co-culture of hPBMCs

with MSCs derived from different four tissues did not trigger immune cell proliferation in the absence of

6 / 43

additional allogeneic immune cell stimuli. Values represent the mean ± SD of three separate experiments.

7 / 43

Fig. S3. Expression of CXCL9, CXCL10, and CCL8 mRNAs in IFN-γ-primed MSCs. IFN-γ was added to

the MSCs as indicated, and they were cultured for 24 h prior to harvest. Quantitative real-time (qRT)-PCR

analysis of CXCL9, CXCL10, and CCL8 mRNA, which were all up-regulated in IFN-γ-primed BM-MSCs.

GAPDH was used for normalization

8 / 43

Fig. S4. T-cell proliferation assay using CFSE-labeled hPBMCs co-cultured with BM-, AT-, CB-, or WJ-

MSCs primed by IFN-γ. T-cell proliferation assays were performed using CFSE-labeled hPBMCs activated

with PHA and co-cultured with MSCs. (a) hPBMCs were cultured with PBS-treated or IFN-γ-primed BM-MSCs

at a ratio of 1:4 (MSCs:PBMCs) for 4 days. (b) hPBMCs were cultured with IFN-γ-primed AT-, CB-, or WJ-

MSCs at a ratio of 1:4 (MSCs:PBMCs) for 4 days. The stimulant was PHA in the positive control and the

negative control was medium alone. Cell proliferation was determined by measuring the percentage of 9 / 43

CFSElow hCD3+ cells in a flow cytometry histogram. The percentage of CFSElow hCD3+ cells was lower in co-

cultures with IFN-γ-primed MSCs than in co-cultures with PBS-treated MSCs.

10 / 43

Fig. S5. Expression of IDO mRNA in IFN-γ-primed MSCs. 200 IU/mL IFN-γ and/or 10 ng/mL TNF-α was

added to cultures of the four MSCs, and the cultures were incubated for 24 h prior to harvest. Expression of

IDO mRNA in IFN-γ and/or TNF-α-primed MSCs was examined by semi-quantitative RT-PCR. GAPDH was

used for normalization.

11 / 43

Fig. S6. IFN-γ priming induces IDO expression in MSCs. When MSCs derived from BM (a) or AT (b) were

treated with 200 IU/mL IFN-γ for 24 h, the expression levels of the IDO protein, assessed by western blotting,

increased substantially, and this effect could be completely blocked by pretreatment with an anti-IFN-γ

antibody (#2, twice) before IFN-γ priming. β-Actin was used as a loading control.

12 / 43

Fig. S7. Histological improvement in GVHD after IFN-γ-primed MSC transplantation. GVHD was

histologically evaluated in the skin and small intestine, with individual criteria according to the specific tissue,

in GVHD mice and in GVHD mice administered IFN-γ-primed MSCs at 14 days after hPBMC transplantation.

Mice injected with hPBMCs showed severe lymphocyte infiltration in their organs. (a) Infusion of IFN-γ-primed

BM-MSCs reduced lymphocyte infiltration and tissue damage compared to mice administered hPBMCs only

or PBS-treated MSCs. Pretreatment with AG490 reduced the therapeutic effect of the IFN-γ-primed MSCs. (b)

Infusion of IFN-γ-primed AT-, CB-, or WJ-MSCs significantly reduced lymphocyte infiltration and tissue

damage compared with mice administered hPBMCs only (magnification × 200).

13 / 43

Fig. S8. Immunofluorescence images showing the presence of IDO in MSCs in tissues obtained from

GVHD mice infused with IFN-γ-primed MSCs. MSCs derived from BM, AT, CB, and WJ were labeled with

CM-DiI and intravenously administered twice, with a 7-day interval, into GVHD mice. Tissues were obtained at

14 days after hPBMC injection. Shown are immunofluorescence images of the small intestine (a) and skin (b)

14 / 43

after administration of PBS or IFN-γ-primed BM-MSCs, and of the small intestine (c) and skin (d) after

administration of AT-, CB-, and WJ-MSCs primed with IFN-γ. IFN-γ-primed MSCs showed induction of IDO,

whereas BM-MSCs treated with AG490 and IFN-γ showed only a low level of IDO expression. Scale bar: 20

μm.

15 / 43

Fig. S9. Immunofluorescence images showing the presence of IDO-overexpressing MSCs in tissues

obtained from GVHD mice. A lentiviral vector carrying IDO was transduced into BM-MSCs. BM-MSCs with

stable IDO expression were then labeled with CM-DiI and intravenously administered twice, with a 7-day

interval, into GVHD mice, and small intestine and skin were obtained at 14 days after hPBMC injection.

Immunohistochemistry showing the expression of IDO in IDO-overexpressing MSCs. Scale bar: 20 μm.

16 / 43

Fig. S10. Immunofluorescence images showing the presence of IDO-down-regulated MSCs in tissues

obtained from GVHD mice. BM-MSCs were transduced with lentiviral particles expressing an IDO shRNA or

a scrambled shRNA. IDO-down-regulated MSCs were labeled with CM-DiI and intravenously administered

twice, with a 7-day interval, into GVHD mice, and the small intestine and skin were obtained at 14 days after

hPBMC injection. Immunohistochemistry showing the expression of IDO in IDO-down-regulated MSCs. Scale

bar: 20 μm.

Supplementary tables17 / 43

Table S1. Primer sequences used for RT-PCR.

Target Primer Sequence* Cycle Number Tm Product Size (bp)

IFN-βF

R

5’- ACTGCCTCAAGGACAGGATG -3’

5’- AGCCAGGAGGTTCTCAACAA -3’35 63 179

IL6F

R

5’- TACCCCCAGGAGAAGATTCC -3’

5’- GCCATCTTTGGAAGGTTCAG -3’28 57 199

IL8F

R

5’- GTGCAGTTTTGCCAAGGAGT -3’

5’- CTCTGCACCCAGTTTTCCTT -3’28 57 196

TLR3F

R

5’- AGCCTTCAACGACTGATGCT -3’

5’- TTTCCAGAGCCGTGCTAAGT -3’29 56 201

TLR4F

R

5’- CCTGTGCAATTTGACCATTG -3’

5’- AAGCATTCCCACCTTTGTTG -3’29 56 263

CXCL9F

R

5’- GAGAAAGGGTCGCTGTTCCT -3’

5’- TTTGGCTGACCTGTTTCTCC -3’29 57 209

CXCL10F

R

5’- CTGTACGCTGTACCTGCATCA -3’

5’- TTCTTGATGGCCTTCGATTC -3’29 58 172

IDOF

R

5’- GCGCTGTTGGAAATAGCTTC -3’

5’- CAGGACGTCAAAGCACTGAA -3’24 56 234

IFN-γF

R

5’- TTGGCTTTTCAGCTCTGCATC -3’

5’- GGAGACAATTTGGCTCTGCATT -3’32 58 201

GAPDHF

R

5’- TCAACGGATTTGGTCGTATTGGG -3’

5’- TGATTTTGGAGGGATCTCGC -3’25 60 234

IFN-β, interferon-β; IL6, interleukin-6; IL8, interleukin-8; TLR3, Toll-like receptor 3; TLR4, Toll-like receptor 4;

CXCL9, chemokine (C-X-C motif) ligand 9; CXCL10, chemokine (C-X-C motif) ligand 10; IDO, indoleamine-

2,3-dioxygenase; IFN-γ, interferon-γ; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. *Forward (F) and

reverse (R) primers used to detect mRNA expression of the indicated targets.

Table S2. List of genes that were differentially expressed between IFN-γ-treated and untreated MSCs.

18 / 43

Gene Symbol Gene Description Fold Change

CXCL9 chemokine (C-X-C motif) ligand 9 312.27


CCL8 chemokine (C-C motif) ligand 8 204.78

IDO indoleamine-pyrrole 2,3 dioxygenase 203.53

HLA-DRA major histocompatibility complex, class II, DR alpha 185.75

GBP5 guanylate binding protein 5 112.25

CD74 CD74 molecule, major histocompatibility complex, class II invariant chain 103.64

IL18BP interleukin 18 binding protein 87.22

IFIT2 interferon-induced protein with tetratricopeptide repeats 2 74.67

GBP4 guanylate binding protein 4 68.47

HLA-DMB major histocompatibility complex, class II, DM beta 65.83


UBD ubiquitin D 41.50

HLA-DPA1 major histocompatibility complex, class II, DP alpha 1 41.39

TF Transferring 37.97

HLA-DRB3 major histocompatibility complex, class II, DR beta 3 33.49

RARRES3 retinoic acid receptor responder (tazarotene induced) 3 31.05

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b 30.40

BST2 bone marrow stromal cell antigen 2 30.18

TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 29.88

HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 28.79

ISG20 interferon stimulated exonuclease gene 20kDa 27.32

OAS1 2,5-oligoadenylate synthetase 1 26.85

IFI27 interferon, alpha-inducible protein 27 24.71

CEACAM1 carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) 24.46

OASL 2-5-oligoadenylate synthetase-like 23.79

MX1 myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 23.13

KCTD14 potassium channel tetramerisation domain containing 14 21.85


PLA1A phospholipase A1 member A 20.66

CENTA1 centaurin, alpha 1 20.41

HLA-DMA major histocompatibility complex, class II, DM alpha 19.65

SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 18.78

HLA-DOA major histocompatibility complex, class II, DO alpha 18.37

HLA-DRB6 major histocompatibility complex, class II, DR beta 6 (pseudogene) 18.12

RSAD2 radical S-adenosyl methionine domain containing 2 18.05

MX2 myxovirus (influenza virus) resistance 2 (mouse) 17.53

GBP1 guanylate binding protein 1, interferon-inducible 17.04

Table S2. Continued


19 / 43

ECGF1 endothelial cell growth factor 1 (platelet-derived) 17.03

IFIH1 interferon induced with helicase C domain 1 16.98

APOL3 apolipoprotein L, 3 16.64

IRF1 interferon regulatory factor 1 16.44


GADD45G growth arrest and DNA-damage-inducible, gamma 15.79

ISG15 ISG15 ubiquitin-like modifier 15.75

HERC5 hect domain and RLD 5 15.47

KYNU kynureninase (L-kynurenine hydrolase) 15.28

OAS2 2-5-oligoadenylate synthetase 2 14.79

GCH1 GTP cyclohydrolase 1 14.32

IFI35 interferon-induced protein 35 13.76

IFI6 interferon, alpha-inducible protein 6 13.76

IFITM1 interferon induced transmembrane protein 1 13.25

BATF2 basic leucine zipper transcription factor, ATF-like 2 13.22

HERC6 hect domain and RLD 6 13.04

C15orf48 chromosome 15 open reading frame 48 12.66

IL32 interleukin 32 12.55

PSMB9 proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) 12.50


SLC15A3 solute carrier family 15, member 3 12.37

WARS tryptophanyl-tRNA synthetase 11.56

TAP1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) 11.51

LAP3 leucine aminopeptidase 3 11.30

GBP2 guanylate binding protein 2, interferon-inducible 11.08

LGALS9 lectin, galactoside-binding, soluble, 9 10.70

CX3CL1 chemokine (C-X3-C motif) ligand 1 10.62

CFB complement factor B 10.30

EPSTI1 epithelial stromal interaction 1 (breast) 10.17

SAMD9L sterile alpha motif domain containing 9-like 10.01

CMPK2 cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial 9.94

TAP2 transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) 9.83

CD40 CD40 molecule, TNF receptor superfamily member 5 9.75

SERPING1 serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 9.57

PARP12 poly (ADP-ribose) polymerase family, member 12 9.13

ACSL5 acyl-CoA synthetase long-chain family member 5 9.10

RTP4 receptor (chemosensory) transporter protein 4 9.04

CH25H cholesterol 25-hydroxylase 8.97

PRIC285 peroxisomal proliferator-activated receptor A interacting complex 285 8.81

Table S2. Continued


20 / 43

SOD2 superoxide dismutase 2, mitochondrial 8.74

CASP1 caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) 8.68

TMEM140 transmembrane protein 140 8.18

IL7R interleukin 7 receptor 8.08

IFI30 interferon, gamma-inducible protein 30 8.01

IFI44L interferon-induced protein 44-like 8.00

BATF3 basic leucine zipper transcription factor, ATF-like 3 7.99

HLA-F major histocompatibility complex, class I, F 7.88

IL4I1 interleukin 4 induced 1 7.85

SOCS1 suppressor of cytokine signaling 1 7.81

STX11 syntaxin 11 7.80

NFS1 NFS1 nitrogen fixation 1 homolog (S. cerevisiae) 7.74

KIAA1618 KIAA1618 7.64


CIITA class II, major histocompatibility complex, transactivator 7.12

XAF1 XIAP associated factor 1 7.08

IL15RA interleukin 15 receptor, alpha 7.04

ITK IL2-inducible T-cell kinase 7.03

GJD3 gap junction protein, delta 3 6.95


HLA-DPB1 major histocompatibility complex, class II, DP beta 1 6.81

FRZB frizzled-related protein 6.78


MLKL mixed lineage kinase domain-like 6.71

DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 6.58

RSPO3 R-spondin 3 homolog (Xenopus laevis) 6.58

HIST2H2AA3 histone cluster 2, H2aa3 6.49

CD38 CD38 molecule 6.43

SP110 SP110 nuclear body protein 6.42

MAFA v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) 6.33


CLDN23 claudin 23 6.11

PLSCR1 phospholipid scramblase 1 6.09


HCP5 HLA complex P5 6.03

LAG3 lymphocyte-activation gene 3 6.02

DUSP19 dual specificity phosphatase 19 6.01

SEPT4 septin 4 5.82

OLFML1 olfactomedin-like 1 5.82

Table S2. Continued


21 / 43

HLA-H major histocompatibility complex, class I, H (pseudogene) 5.72



BTN3A1 butyrophilin, subfamily 3, member A1 5.65

ZMYND15 zinc finger, MYND-type containing 15 5.64

DHX58 DEXH (Asp-Glu-X-His) box polypeptide 58 5.49

PSMB8 proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7) 5.48

HLA-E major histocompatibility complex, class I, E 5.47

IL18R1 interleukin 18 receptor 1 5.46

TAPBPL TAP binding protein-like 5.39

CLIC3 chloride intracellular channel 3 5.34

CSF1 colony stimulating factor 1 (macrophage) 5.34

TMTC1 transmembrane and tetratricopeptide repeat containing 1 5.33

HIST2H2AC histone cluster 2, H2ac 5.30

ZNFX1 zinc finger, NFX1-type containing 1 5.24

TRIM21 tripartite motif-containing 21 5.19

ZC3H12A zinc finger CCCH-type containing 12A 5.17

MT1M metallothionein 1M 5.11

APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G 5.10


VMO1 vitelline membrane outer layer 1 homolog 5.07

PSME2 proteasome (prosome, macropain) activator subunit 2 (PA28 beta) 5.04

VAMP5 vesicle-associated membrane protein 5 (myobrevin) 5.00


TNFRSF14 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) 4.90

SAMD9 sterile alpha motif domain containing 9 4.88

FST Follistatin 4.86

PSMB10 proteasome (prosome, macropain) subunit, beta type, 10 4.85

BTBD14A BTB (POZ) domain containing 14A 4.84

SEMA3F sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F 4.80

LY6E lymphocyte antigen 6 complex, locus E 4.77

PTGDS prostaglandin D2 synthase 21kDa (brain) 4.77

RHBDF2 rhomboid 5 homolog 2 (Drosophila) 4.68


DUSP5 dual specificity phosphatase 5 4.65

IFI44 interferon-induced protein 44 4.62

C2 complement component 2 4.62

FAM20A family with sequence similarity 20, member A 4.62

Table S2. Continued


22 / 43

CDCP1 CUB domain containing protein 1 4.58

CDA cytidine deaminase 4.57

INSIG1 insulin induced gene 1 4.56



GOLM1 golgi membrane protein 1 4.54

ZC3HAV1 zinc finger CCCH-type, antiviral 1 4.50


UBE2L6 ubiquitin-conjugating enzyme E2L 6 4.48

PHF15 PHD finger protein 15 4.47

CTSS cathepsin S 4.47

PSME1 proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) 4.45

ZNF394 zinc finger protein 394 4.44

DRAM damage-regulated autophagy modulator 4.44

MICB MHC class I polypeptide-related sequence B 4.40

SUSD2 sushi domain containing 2 4.32

STAT1 signal transducer and activator of transcription 1 4.32

CHRNA1 cholinergic receptor, nicotinic, alpha 1 (muscle) 4.31

SECTM1 secreted and transmembrane 1 4.30

SLC31A2 solute carrier family 31 (copper transporters), member 2 4.29

MYBPH myosin binding protein H 4.25

RENBP renin binding protein 4.23

CTSC cathepsin C 4.23

ABCC3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 4.18

FBXO6 F-box protein 6 4.17

MT1G metallothionein 1G 4.17

GMPR guanosine monophosphate reductase 4.17

ANXA10 annexin A10 4.17

SQRDL sulfide quinone reductase-like (yeast) 4.16


ACP5 acid phosphatase 5, tartrate resistant 4.11

NMI N-myc (and STAT) interactor 4.10

MDK midkine (neurite growth-promoting factor 2) 4.10

HLA-DQB1 major histocompatibility complex, class II, DQ beta 1 4.09

STAMBPL1 STAM binding protein-like 1 4.02

CHI3L2 chitinase 3-like 2 4.02

TNFAIP2 tumor necrosis factor, alpha-induced protein 2 3.92

FGL2 fibrinogen-like 2 3.88

Table S2. Continued


TNFAIP3 tumor necrosis factor, alpha-induced protein 3 3.87

23 / 43


MME membrane metallo-endopeptidase 3.84

DTX3L deltex 3-like (Drosophila) 3.83


SAMHD1 SAM domain and HD domain 1 3.82

KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 3.78


APOBEC3F apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F 3.73




RIPK2 receptor-interacting serine-threonine kinase 2 3.67

BANK1 B-cell scaffold protein with ankyrin repeats 1 3.66

ATP8B4 ATPase, class I, type 8B, member 4 3.63

BDKRB1 bradykinin receptor B1 3.61


TDRD7 tudor domain containing 7 3.57


HLA-A29.1 major histocompatibility complex class I HLA-A29.1 3.52

HIST1H2BD histone cluster 1, H2bd 3.50

IL12A interleukin 12A (natural killer cell stimulatory factor 1) 3.50

ICAM2 intercellular adhesion molecule 2 3.48

UNC93B1 unc-93 homolog B1 (C. elegans) 3.47

STOM stomatin 3.46

MUC1 mucin 1, cell surface associated 3.44

TRAFD1 TRAF-type zinc finger domain containing 1 3.44

MR1 major histocompatibility complex, class I-related 3.43

UBA7 ubiquitin-like modifier activating enzyme 7 3.42

MT1H metallothionein 1H 3.40

CYP26A1 cytochrome P450, family 26, subfamily A, polypeptide 1 3.40




NFE2L3 nuclear factor (erythroid-derived 2)-like 3 3.30



RNF19B ring finger protein 19B 3.28

Table S2. Continued


BATF basic leucine zipper transcription factor, ATF-like 3.27

NAMPT nicotinamide phosphoribosyltransferase 3.24

24 / 43


MOBKL2C MOB1, Mps One Binder kinase activator-like 2C (yeast) 3.23


C1R complement component 1, r subcomponent 3.22

IL12RB1 interleukin 12 receptor, beta 1 3.19

MTE metallothionein E 3.18

IL6 interleukin 6 (interferon, beta 2) 3.18

SLIT2 slit homolog 2 (Drosophila) 3.18

RFX5 regulatory factor X, 5 (influences HLA class II expression) 3.17

NPC1 Niemann-Pick disease, type C1 3.15

EGFL6 EGF-like-domain, multiple 6 3.15

CASP4 caspase 4, apoptosis-related cysteine peptidase 3.15

LBP lipopolysaccharide binding protein 3.15

KIAA1751 KIAA1751 3.14

EDEM2 ER degradation enhancer, mannosidase alpha-like 2 3.13

PLAC8 placenta-specific 8 3.13

MBP myelin basic protein 3.12

XRN1 5-3 exoribonuclease 1 3.10

C1S complement component 1, s subcomponent 3.08

PSG4 pregnancy specific beta-1-glycoprotein 4 3.07

ART3 ADP-ribosyltransferase 3 3.05

HLA-G HLA-G histocompatibility antigen, class I, G 3.05

DENND1A DENN/MADD domain containing 1A 3.04

ATF3 activating transcription factor 3 3.01

MCOLN2 mucolipin 2 3.01

ASCL2 achaete-scute complex homolog 2 3.00


TCEA3 transcription elongation factor A (SII), 3 3.00

SP100 SP100 nuclear antigen 2.98

FLJ21986 hypothetical protein FLJ21986 2.96

JAK2 Janus kinase 2 (a protein tyrosine kinase) 2.96

SYTL3 synaptotagmin-like 3 2.96

ANGPTL5 angiopoietin-like 5 2.95

MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 2.94

SERPINB2 serpin peptidase inhibitor, clade B (ovalbumin), member 2 2.91

ARL9 ADP-ribosylation factor-like 9 2.89

Table S2. Continued


P2RX4 purinergic receptor P2X, ligand-gated ion channel, 4 2.89

ARHGAP20 Rho GTPase activating protein 20 2.89

FLT3LG fms-related tyrosine kinase 3 ligand 2.88

25 / 43

NINJ1 ninjurin 1 2.84

RAB20 RAB20, member RAS oncogene family 2.83

SVEP1 sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 2.83

GLRX glutaredoxin (thioltransferase) 2.83

PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2.83


SLAMF8 SLAM family member 8 2.82

CDC25B cell division cycle 25 homolog B (S. pombe) 2.80

GSDMD gasdermin D 2.80

B3GALT4 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 2.80

CTNNBL1 catenin, beta like 1 2.77

ABI3BP ABI gene family, member 3 (NESH) binding protein 2.77

TAPBP TAP binding protein (tapasin) 2.77

RRAD Ras-related associated with diabetes 2.76

CGNL1 cingulin-like 1 2.76


SCO2 SCO cytochrome oxidase deficient homolog 2 (yeast) 2.76

OPTN optineurin 2.75

NLRC5 NLR family, CARD domain containing 5 2.75

NRXN2 neurexin 2 2.74

PML promyelocytic leukemia 2.73

LGALS9B lectin, galactoside-binding, soluble, 9B 2.72

SCPEP1 serine carboxypeptidase 1 2.71

ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 2.70

KLHL3 kelch-like 3 (Drosophila) 2.69

MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 2.68

ADAR adenosine deaminase, RNA-specific 2.68

CEP72 centrosomal protein 72kDa 2.68

`ANPEP alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M) 2.67

RNF213 ring finger protein 213 2.66

QSOX1 quiescin Q6 sulfhydryl oxidase 1 2.65

GYPC glycophorin C (Gerbich blood group) 2.64

C3 complement component 3 2.63

GSTK1 glutathione S-transferase kappa 1 2.63

IFI16 interferon, gamma-inducible protein 16 2.63

Table S2. Continued


DPYD dihydropyrimidine dehydrogenase 2.62

LAYN layilin 2.62

STAT2 signal transducer and activator of transcription 2 2.62


26 / 43

LOC729603 calcium binding protein P22 pseudogene 2.61

TRPV2 transient receptor potential cation channel, subfamily V, member 2 2.60

PDE4DIP phosphodiesterase 4D interacting protein (myomegalin) 2.59

ADM adrenomedullin 2.59

PHLDA1 pleckstrin homology-like domain, family A, member 1 2.59

HIST1H2BK histone cluster 1, H2bk 2.58


HLA-DOB major histocompatibility complex, class II, DO beta 2.57

TNFRSF1B tumor necrosis factor receptor superfamily, member 1B 2.57

FAM20C family with sequence similarity 20, member C 2.55

LYSMD2 LysM, putative peptidoglycan-binding, domain containing 2 2.55

PDE4D phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) 2.54

LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 2.54

SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 2.54

RGMB RGM domain family, member B 2.53

AOX1 aldehyde oxidase 1 2.53

CTSO cathepsin O 2.52

NT5E 5-nucleotidase, ecto 2.52

ADAMDEC1 ADAM-like, decysin 1 2.52

TNS3 tensin 3 2.51

GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 2.51

PRDM1 PR domain containing 1, with ZNF domain 2.51

ALPK1 alpha-kinase 1 2.50

KIAA0644 KIAA0644 gene product 2.50

GGT5 gamma-glutamyltransferase 5 2.50

TGFBR3 transforming growth factor, beta receptor III 2.49

HTATIP2 HIV-1 Tat interactive protein 2 2.49

BCAP29 B-cell receptor-associated protein 29 2.49

HLA-A major histocompatibility complex, class I, A 2.49

ADRA1D adrenergic, alpha-1D-, receptor 2.49

HIST2H2BE histone cluster 2, H2be 2.49

BIRC3 baculoviral IAP repeat-containing 3 2.48

VAMP8 vesicle-associated membrane protein 8 (endobrevin) 2.48

B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 2.47

Table S2. Continued




CXorf38 chromosome X open reading frame 38 2.46

IRX6 iroquois homeobox 6 2.45

ANGPT1 angiopoietin 1 2.45

27 / 43

RND3 Rho family GTPase 3 2.45

MYD88 myeloid differentiation primary response gene (88) 2.44

CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 2.44

CFH complement factor H 2.44

CAMK2N1 calcium/calmodulin-dependent protein kinase II inhibitor 1 2.43

PHF11 PHD finger protein 11 2.43

OGFR opioid growth factor receptor 2.43

CYB5A cytochrome b5 type A (microsomal) 2.41

PLEKHA4 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 2.41


SOX18 SRY (sex determining region Y)-box 18 2.41

ENDOGL1 endonuclease G-like 1 2.41

FAM65B family with sequence similarity 65, member B 2.41

SNAP25 synaptosomal-associated protein, 25kDa 2.40


NUAK2 NUAK family, SNF1-like kinase, 2 2.39

THSD1 thrombospondin, type I, domain containing 1 2.39

SCML1 sex comb on midleg-like 1 (Drosophila) 2.39

MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2.39

CCDC109B coiled-coil domain containing 109B 2.38

PLA2G4C phospholipase A2, group IVC (cytosolic, calcium-independent) 2.38

HIST1H2AC histone cluster 1, H2ac 2.37

MELK maternal embryonic leucine zipper kinase 2.37


S1PR3 sphingosine-1-phosphate receptor 3 2.36

GM2A GM2 ganglioside activator 2.36

SORBS3 sorbin and SH3 domain containing 3 2.36

FAM125B family with sequence similarity 125, member B 2.36

PPARG peroxisome proliferator-activated receptor gamma 2.36

TGFBR2 transforming growth factor, beta receptor II 2.36

A4GALT alpha 1,4-galactosyltransferase 2.35

MARCH3 membrane-associated ring finger (C3HC4) 3 2.35

ADCY3 adenylate cyclase 3 2.35

Table S2. Continued


NHLRC3 NHL repeat containing 3 2.34

PTPN2 protein tyrosine phosphatase, non-receptor type 2 2.34

SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 2.34

CXCL1 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) 2.33

ERO1L ERO1-like (S. cerevisiae) 2.33

28 / 43

CDT1 chromatin licensing and DNA replication factor 1 2.32

HAVCR2 hepatitis A virus cellular receptor 2 2.31

HPS3 Hermansky-Pudlak syndrome 3 2.31


LRCH2 leucine-rich repeats and calponin homology (CH) domain containing 2 2.30


ACSL1 acyl-CoA synthetase long-chain family member 1 2.29

VCAM1 vascular cell adhesion molecule 1 2.29

CDC42EP4 CDC42 effector protein (Rho GTPase binding) 4 2.29

FAM8A1 family with sequence similarity 8, member A1 2.28

E2F2 E2F transcription factor 2 2.28

NR1H3 nuclear receptor subfamily 1, group H, member 3 2.28

SAT1 spermidine/spermine N1-acetyltransferase 1 2.27

EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 2.26

GAST gastrin 2.26

CFLAR CASP8 and FADD-like apoptosis regulator 2.26

UHMK1 U2AF homology motif (UHM) kinase 1 2.25

HK2 hexokinase 2 2.25

STC1 stanniocalcin 1 2.25


CCBE1 collagen and calcium binding EGF domains 1 2.24

PRKCD protein kinase C, delta 2.24

BAT5 HLA-B associated transcript 5 2.23

DOCK2 dedicator of cytokinesis 2 2.22


SSTR2 somatostatin receptor 2 2.22

H1F0 H1 histone family, member 0 2.22

OGFRL1 opioid growth factor receptor-like 1 2.22

BLVRA biliverdin reductase A 2.21

LRAP leukocyte-derived arginine aminopeptidase 2.21

PLEK2 pleckstrin 2 2.21

XPR1 xenotropic and polytropic retrovirus receptor 2.20

EDARADD EDAR-associated death domain 2.20

Table S2. Continued


SCARA3 scavenger receptor class A, member 3 2.20

SLC22A4 solute carrier family 22 (organic cation/ergothioneine transporter), member 4 2.19

TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 2.19

RAB8B RAB8B, member RAS oncogene family 2.19

MAPK13 mitogen-activated protein kinase 13 2.19

RBCK1 RanBP-type and C3HC4-type zinc finger containing 1 2.19

29 / 43

ACP2 acid phosphatase 2, lysosomal 2.19

ABHD12 abhydrolase domain containing 12 2.19

TNFRSF11B tumor necrosis factor receptor superfamily, member 11b 2.19

LZTS1 leucine zipper, putative tumor suppressor 1 2.19

MT1A metallothionein 1A 2.19

PSEN2 presenilin 2 (Alzheimer disease 4) 2.18

PTTG1 pituitary tumor-transforming 1 2.18

TM4SF4 transmembrane 4 L six family member 4 2.18


TMBIM1 transmembrane BAX inhibitor motif containing 1 2.17

CTSL1 cathepsin L1 2.16


FOSL1 FOS-like antigen 1 2.16

COP1 caspase-1 dominant-negative inhibitor pseudo-ICE 2.16

HCG2P7 HLA complex group 2 pseudogene 7 2.15

CDO1 cysteine dioxygenase, type I 2.15



ADRA1B adrenergic, alpha-1B-, receptor 2.15

ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif, 5 (aggrecanase-2) 2.15

HSPA1B heat shock 70kDa protein 1B 2.15

ADFP adipose differentiation-related protein 2.14

AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 2.14

STRA13 stimulated by retinoic acid 13 homolog (mouse) 2.14

DYNLT1 dynein, light chain, Tctex-type 1 2.14


TRAF3IP2 TRAF3 interacting protein 2 2.13

PDK3 pyruvate dehydrogenase kinase, isozyme 3 2.13


PCDH18 protocadherin 18 2.13

SLC16A4 solute carrier family 16, member 4 (monocarboxylic acid transporter 5) 2.12

GCA grancalcin, EF-hand calcium binding protein 2.12

Table S2. Continued


CEBPB CCAAT/enhancer binding protein (C/EBP), beta 2.12


AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) 2.12

C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 2.11

FLJ45224 FLJ45224 protein 2.10

SLC37A1 solute carrier family 37 (glycerol-3-phosphate transporter), member 1 2.10

ODF3L2 outer dense fiber of sperm tails 3-like 2 2.10

30 / 43


GK glycerol kinase 2.09

SLC9A7 solute carrier family 9 (sodium/hydrogen exchanger), member 7 2.09

ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 2.09

DOPEY1 dopey family member 1 2.09

DBC1 deleted in bladder cancer 1 2.09

PYCARD PYD and CARD domain containing 2.08

FAS Fas (TNF receptor superfamily, member 6) 2.08

PPP2R1B protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform 2.08

CKS2 CDC28 protein kinase regulatory subunit 2 2.08

ADPRHL2 ADP-ribosylhydrolase like 2 2.08


MSX1 msh homeobox 1 2.07

MGLL monoglyceride lipase 2.07

PEX11B peroxisomal biogenesis factor 11 beta 2.07

NOD2 nucleotide-binding oligomerization domain containing 2 2.07

ANKRD29 ankyrin repeat domain 29 2.07

VEGFC vascular endothelial growth factor C 2.07

STARD8 StAR-related lipid transfer (START) domain containing 8 2.07

CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 2.06

CHMP5 chromatin modifying protein 5 2.06

FAM26C family with sequence similarity 26, member C 2.06

ARL5B ADP-ribosylation factor-like 5B 2.06

BCAR1 breast cancer anti-estrogen resistance 1 2.05

HRASLS2 HRAS-like suppressor 2 2.04

ASAM adipocyte-specific adhesion molecule 2.04

BDKRB2 bradykinin receptor B2 2.04

MT1E metallothionein 1E 2.04

DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 2.04

BAIAP2L2 BAI1-associated protein 2-like 2 2.03

B2M beta-2-microglobulin 2.03

Table S2. Continued


CREG1 cellular repressor of E1A-stimulated genes 1 2.03

FZD5 frizzled homolog 5 (Drosophila) 2.03

HLX H2.0-like homeobox 2.03

FTHL3P ferritin, heavy polypeptide-like 3 pseudogene 2.03

IGFBP5 insulin-like growth factor binding protein 5 2.03

APBB1IP amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein 2.03

OBFC2A oligonucleotide/oligosaccharide-binding fold containing 2A 2.03


31 / 43

GUK1 guanylate kinase 1 2.02


CTSK cathepsin K 2.01


IRAK2 interleukin-1 receptor-associated kinase 2 2.01

FES feline sarcoma oncogene 2.01

CPNE8 copine VIII 2.00


EPHB4 EPH receptor B4 -2.00

SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 -2.00

EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma -2.00

NET1 neuroepithelial cell transforming 1 -2.00

RPL29 ribosomal protein L29 -2.00

MATN2 matrilin 2 -2.00

POP5 processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) -2.00

DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 -2.01

UBL3 ubiquitin-like 3 -2.01

BZW2 basic leucine zipper and W2 domains 2 -2.01

SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) -2.01

CYBASC3 cytochrome b, ascorbate dependent 3 -2.01

SYNJ2 synaptojanin 2 -2.01

ZNF362 zinc finger protein 362 -2.01

FOXD1 forkhead box D1 -2.01

POL3S polyserase 3 -2.01

C20orf11 chromosome 20 open reading frame 11 -2.01

CACNA1H calcium channel, voltage-dependent, T type, alpha 1H subunit -2.02


ZSWIM4 zinc finger, SWIM-type containing 4 -2.02

TGFB1I1 transforming growth factor beta 1 induced transcript 1 -2.02

JPH2 junctophilin 2 -2.02

Table S2. Continued


CTPS CTP synthase -2.03

ZSCAN2 zinc finger and SCAN domain containing 2 -2.03

ITM2C integral membrane protein 2C -2.03

MGC12966 hypothetical protein LOC84792 -2.03

TMEM117 transmembrane protein 117 -2.03

PRPS1 phosphoribosyl pyrophosphate synthetase 1 -2.03

DDIT4L DNA-damage-inducible transcript 4-like -2.03

CSRP2 cysteine and glycine-rich protein 2 -2.03

SHROOM2 shroom family member 2 -2.03

32 / 43

SORBS2 sorbin and SH3 domain containing 2 -2.04

PALM2 paralemmin 2 -2.04

RAB40B RAB40B, member RAS oncogene family -2.04

GPR162 G protein-coupled receptor 162 -2.05

RPS6KA2 ribosomal protein S6 kinase, 90kDa, polypeptide 2 -2.05

FILIP1L filamin A interacting protein 1-like -2.05

IL1B interleukin 1, beta -2.05

TEAD2 TEA domain family member 2 -2.05

SEZ6L2 seizure related 6 homolog (mouse)-like 2 -2.05

PHF20 PHD finger protein 20 -2.05

CCNB1IP1 cyclin B1 interacting protein 1 -2.05

ACTC1 actin, alpha, cardiac muscle 1 -2.06

VHL von Hippel-Lindau tumor suppressor -2.06

KRT7 keratin 7 -2.06

ULBP1 UL16 binding protein 1 -2.06

ARL4A ADP-ribosylation factor-like 4A -2.06

PARD6G par-6 partitioning defective 6 homolog gamma (C. elegans) -2.06

ACCN2 amiloride-sensitive cation channel 2, neuronal -2.07

NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 -2.07

HAS1 hyaluronan synthase 1 -2.07

COL7A1 collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive) -2.07

TP53I3 tumor protein p53 inducible protein 3 -2.08

MUM1 melanoma associated antigen (mutated) 1 -2.08

KCTD20 potassium channel tetramerisation domain containing 20 -2.08

DUSP2 dual specificity phosphatase 2 -2.08

PRSS12 protease, serine, 12 (neurotrypsin, motopsin) -2.08

MTMR2 myotubularin related protein 2 -2.09

PLAU plasminogen activator, urokinase -2.09

PHLDB1 pleckstrin homology-like domain, family B, member 1 -2.09

Table S2. Continued



IL11RA interleukin 11 receptor, alpha -2.09

GALNT10 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) -2.10

ACACA acetyl-Coenzyme A carboxylase alpha -2.10

IL17D interleukin 17D -2.10

EXTL1 exostoses (multiple)-like 1 -2.10

EEF1G eukaryotic translation elongation factor 1 gamma -2.10

OXTR oxytocin receptor -2.10

MPRIP myosin phosphatase Rho interacting protein -2.10

33 / 43

ULK1 unc-51-like kinase 1 (C. elegans) -2.11

STON1 stonin 1 -2.11

CSRP1 cysteine and glycine-rich protein 1 -2.11

UNC5B unc-5 homolog B (C. elegans) -2.11


KDELR3 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 -2.11

POLR1E polymerase (RNA) I polypeptide E -2.12

SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 -2.12

CDH2 cadherin 2, type 1, N-cadherin (neuronal) -2.12

TGFB2 transforming growth factor, beta 2 -2.12

DSTN destrin (actin depolymerizing factor) -2.12

EMX2 empty spiracles homeobox 2 -2.13

FASN fatty acid synthase -2.13

LIMCH1 LIM and calponin homology domains 1 -2.13

ICAM3 intercellular adhesion molecule 3 -2.13

ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) -2.13

TXNDC5 thioredoxin domain containing 5 -2.14

VASH2 vasohibin 2 -2.14

TAGLN transgelin -2.14

CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) -2.14

FBLN7 fibulin 7 -2.14

DCLK2 doublecortin-like kinase 2 -2.15

RPS3 ribosomal protein S3 -2.15

KLF12 Kruppel-like factor 12 -2.15


PRR6 proline rich 6 -2.16

SOX4 SRY (sex determining region Y)-box 4 -2.16

HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 -2.16

COL6A1 collagen, type VI, alpha 1 -2.17

Table S2. Continued


DIXDC1 DIX domain containing -2.17

EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 -2.18

LPP LIM domain containing preferred translocation partner in lipoma -2.18

MAGED1 melanoma antigen family D, 1 -2.18


HEY2 hairy/enhancer-of-split related with YRPW motif 2 -2.19

SHISA2 shisa homolog 2 (Xenopus laevis) -2.19

PXDN peroxidasin homolog (Drosophila) -2.19

TPD52L1 tumor protein D52-like 1 -2.19

TRAF5 TNF receptor-associated factor 5 -2.20

34 / 43

CREB3L2 cAMP responsive element binding protein 3-like 2 -2.20

RAMP1 receptor (G protein-coupled) activity modifying protein 1 -2.21



LARP6 La ribonucleoprotein domain family, member 6 -2.23

DBN1 drebrin 1 -2.23

FAM89B family with sequence similarity 89, member B -2.23

CERK ceramide kinase -2.23

FLJ40504 hypothetical protein FLJ40504 -2.24

PCDHB2 protocadherin beta 2 -2.24

SIAH1 seven in absentia homolog 1 (Drosophila) -2.24

BCAT1 branched chain aminotransferase 1, cytosolic -2.24

COL4A2 collagen, type IV, alpha 2 -2.24

GLIPR1 GLI pathogenesis-related 1 -2.24

TPM2 tropomyosin 2 (beta) -2.25

GSTA4 glutathione S-transferase A4 -2.25

RBP1 retinol binding protein 1, cellular -2.25

ODC1 ornithine decarboxylase 1 -2.26

DNAJC12 DnaJ (Hsp40) homolog, subfamily C, member 12 -2.26

STS-1 Cbl-interacting protein Sts-1 -2.27

HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 -2.27

GPRC5C G protein-coupled receptor, family C, group 5, member C -2.27

SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) -2.27

ITGAE integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) -2.28

PSPH phosphoserine phosphatase -2.28

INHBE inhibin, beta E -2.28

ADAMTS7 ADAM metallopeptidase with thrombospondin type 1 motif, 7 -2.29

HBEGF heparin-binding EGF-like growth factor -2.29

Table S2. Continued


OLFML2A olfactomedin-like 2A -2.29

TUFT1 tuftelin 1 -2.31


KIAA0355 KIAA0355 -2.33


GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 -2.33

BMP1 bone morphogenetic protein 1 -2.34

RASSF2 Ras association (RalGDS/AF-6) domain family 2 -2.34

EEF1B2 eukaryotic translation elongation factor 1 beta 2 -2.35

SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 -2.35

35 / 43

SETBP1 SET binding protein 1 -2.35

LIMS2 LIM and senescent cell antigen-like domains 2 -2.36


ZHX3 zinc fingers and homeoboxes 3 -2.36

NAV1 neuron navigator 1 -2.37

KAL1 Kallmann syndrome 1 sequence -2.37

FHL1 four and a half LIM domains 1 -2.37

GALNTL1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1 -2.37

ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) -2.38

HES1 hairy and enhancer of split 1, (Drosophila) -2.38

NAP1L3 nucleosome assembly protein 1-like 3 -2.38

MEF2D myocyte enhancer factor 2D -2.39

THY1 Thy-1 cell surface antigen -2.39

ZAK sterile alpha motif and leucine zipper containing kinase AZK -2.40

SMOC1 SPARC related modular calcium binding 1 -2.40

NTN4 netrin 4 -2.40

HTRA1 HtrA serine peptidase 1 -2.40

TSC22D3 TSC22 domain family, member 3 -2.40

NEXN nexilin (F actin binding protein) -2.41

EIF3EIP eukaryotic translation initiation factor 3, subunit E interacting protein -2.41

HEYL hairy/enhancer-of-split related with YRPW motif-like -2.42

GPAM glycerol-3-phosphate acyltransferase, mitochondrial -2.43

SNX25 sorting nexin 25 -2.43

EYA2 eyes absent homolog 2 (Drosophila) -2.43

NOX4 NADPH oxidase 4 -2.43

MARCKSL1 MARCKS-like 1 -2.43


IQWD1 IQ motif and WD repeats 1 -2.44

Table S2. Continued


WFDC1 WAP four-disulfide core domain 1 -2.45

FAM129A family with sequence similarity 129, member A -2.46

SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 -2.47

LAMA5 laminin, alpha 5 -2.47

CRTAP cartilage associated protein -2.48

PLAT plasminogen activator, tissue -2.49

CDH13 cadherin 13, H-cadherin (heart) -2.49

ALDH1B1 aldehyde dehydrogenase 1 family, member B1 -2.50

IMPDH2 IMP (inosine monophosphate) dehydrogenase 2 -2.51

SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 -2.51

GADD45A growth arrest and DNA-damage-inducible, alpha -2.52

36 / 43

ESM1 endothelial cell-specific molecule 1 -2.52

C1QTNF5 C1q and tumor necrosis factor related protein 5 -2.52

HOXA10 homeobox A10 -2.53

PRICKLE1 prickle homolog 1 (Drosophila) -2.54

LMCD1 LIM and cysteine-rich domains 1 -2.54

EFHD1 EF-hand domain family, member D1 -2.54

COL11A1 collagen, type XI, alpha 1 -2.55

XPOT exportin, tRNA (nuclear export receptor for tRNAs) -2.56

GARS glycyl-tRNA synthetase -2.56

FOXK1 forkhead box K1 -2.56

SGK serum/glucocorticoid regulated kinase -2.58

HNRPA1L-2 heterogeneous nuclear ribonucleoprotein A1 pseudogene -2.59

HSD17B6 hydroxysteroid (17-beta) dehydrogenase 6 homolog -2.59

SGCD sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) -2.60

DPYSL3 dihydropyrimidinase-like 3 -2.61

TMEM119 transmembrane protein 119 -2.62

MXRA5 matrix-remodelling associated 5 -2.62


GREM2 gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) -2.62

CRLF1 cytokine receptor-like factor 1 -2.62

COL6A3 collagen, type VI, alpha 3 -2.64

DACT3 dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) -2.64

ENC1 ectodermal-neural cortex (with BTB-like domain) -2.65

RPLP0 ribosomal protein, large, P0 -2.65

NPAS1 neuronal PAS domain protein 1 -2.65

ERRFI1 ERBB receptor feedback inhibitor 1 -2.65

TPM1 tropomyosin 1 (alpha) -2.66

Table S2. Continued


MN1 meningioma (disrupted in balanced translocation) 1 -2.66

SORCS2 sortilin-related VPS10 domain containing receptor 2 -2.67

COL18A1 collagen, type XVIII, alpha 1 -2.68

ENAH enabled homolog (Drosophila) -2.68

CCDC80 coiled-coil domain containing 80 -2.68

SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) -2.69

EIF4B eukaryotic translation initiation factor 4B -2.71

DHCR7 7-dehydrocholesterol reductase -2.72

COL5A1 collagen, type V, alpha 1 -2.73

FAM43A family with sequence similarity 43, member A -2.73

ANKRD37 ankyrin repeat domain 37 -2.75

CDK6 cyclin-dependent kinase 6 -2.76

37 / 43

UGCGL2 UDP-glucose ceramide glucosyltransferase-like 2 -2.76

PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) -2.76

GCAT glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) -2.77

TRO trophinin -2.77

RDH5 retinol dehydrogenase 5 (11-cis/9-cis) -2.78

PELI2 pellino homolog 2 (Drosophila) -2.78

ROR1 receptor tyrosine kinase-like orphan receptor 1 -2.79


FOS v-fos FBJ murine osteosarcoma viral oncogene homolog -2.82

KCTD15 potassium channel tetramerisation domain containing 15 -2.82

SC65 synaptonemal complex protein SC65 -2.82

SPOCK1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 -2.83

ADM2 adrenomedullin 2 -2.84


THBS1 thrombospondin 1 -2.86

CALB2 calbindin 2 -2.88

NUAK1 NUAK family, SNF1-like kinase, 1 -2.89

SULF2 sulfatase 2 -2.90


IER3 immediate early response 3 -2.92

IARS isoleucyl-tRNA synthetase -2.94

PPP1R3C protein phosphatase 1, regulatory (inhibitor) subunit 3C -2.94


MYH11 myosin, heavy chain 11, smooth muscle -2.95

COMP cartilage oligomeric matrix protein -2.95

NPM3 nucleophosmin/nucleoplasmin, 3 -2.95

Table S2. Continued


PI16 peptidase inhibitor 16 -2.97

HSPA12A heat shock 70kDa protein 12A -2.99

KRT10 keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) -2.99

HSPB7 heat shock 27kDa protein family, member 7 (cardiovascular) -3.00

COL4A1 collagen, type IV, alpha 1 -3.01

ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) -3.03

LXN latexin -3.03

LTC4S leukotriene C4 synthase -3.04

FOSB FBJ murine osteosarcoma viral oncogene homolog B -3.05

PALM paralemmin -3.07

GLT8D2 glycosyltransferase 8 domain containing 2 -3.11

FBN2 fibrillin 2 (congenital contractural arachnodactyly) -3.12

MGP matrix Gla protein -3.13

38 / 43

PAPPA pregnancy-associated plasma protein A, pappalysin 1 -3.13

DEPDC6 DEP domain containing 6 -3.14

MEX3B mex-3 homolog B (C. elegans) -3.24

LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase -3.24

RPS23 ribosomal protein S23 -3.26

TNFRSF10D tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain -3.28

RASD2 RASD family, member 2 -3.32

MICAL2 microtubule associated monoxygenase, calponin and LIM domain containing 2 -3.35

THRA thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) -3.38

MMP11 matrix metallopeptidase 11 (stromelysin 3) -3.38

PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) -3.39

EVL Enah/Vasp-like -3.39

ASB1 ankyrin repeat and SOCS box-containing 1 -3.41

VLDLR very low density lipoprotein receptor -3.43

APPL2 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 -3.43

DCLK1 doublecortin-like kinase 1 -3.44


LEPRE1 leucine proline-enriched proteoglycan (leprecan) 1 -3.46

KRT17 keratin 17 -3.47

TXNDC12 thioredoxin domain containing 12 (endoplasmic reticulum) -3.48

IGFBP2 insulin-like growth factor binding protein 2 -3.49

SCG2 secretogranin II (chromogranin C) -3.50

TUBB2B tubulin, beta 2B -3.52

PDLIM3 PDZ and LIM domain 3 -3.53

KLF9 Kruppel-like factor 9 -3.58

Table S2. Continued


TTC3 tetratricopeptide repeat domain 3 -3.58


DEXI dexamethasone-induced transcript -3.71

SLIT3 slit homolog 3 (Drosophila) -3.88

KCNG1 potassium voltage-gated channel, subfamily G, member 1 -3.91

PPP1R14A protein phosphatase 1, regulatory (inhibitor) subunit 14A -3.95

SCD stearoyl-CoA desaturase (delta-9-desaturase) -3.97

LRRC17 leucine rich repeat containing 17 -4.03

ITGA11 integrin, alpha 11 -4.04

TSPAN18 tetraspanin 18 -4.07

SDC2 syndecan 2 -4.10

PLXDC2 plexin domain containing 2 -4.14

SLC22A3 solute carrier family 22 (extraneuronal monoamine transporter), member 3 -4.17

39 / 43

COL1A2 collagen, type I, alpha 2 -4.23

CBS cystathionine-beta-synthase -4.26

SLC30A3 solute carrier family 30 (zinc transporter), member 3 -4.27

CTXN1 cortexin 1 -4.32

PRSS23 protease, serine, 23 -4.32

EFNB3 ephrin-B3 -4.39

ANKRD38 ankyrin repeat domain 38 -4.47

JAG1 jagged 1 (Alagille syndrome) -4.50

ASNS asparagine synthetase -4.51

TRIB3 tribbles homolog 3 (Drosophila) -4.52

COL16A1 collagen, type XVI, alpha 1 -4.55

PHGDH phosphoglycerate dehydrogenase -4.59

ITGAV integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) -4.61

CMTM4 CKLF-like MARVEL transmembrane domain containing 4 -4.61

SLC38A1 solute carrier family 38, member 1 -4.61

MFAP2 microfibrillar-associated protein 2 -4.73

NOTCH3 Notch homolog 3 (Drosophila) -4.82

IGFBP3 insulin-like growth factor binding protein 3 -5.00

CDKN2B cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) -5.13

SPARC secreted protein, acidic, cysteine-rich (osteonectin) -5.16


SOX11 SRY (sex determining region Y)-box 11 -5.37

SLC7A5 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 -5.52

NT5DC2 5-nucleotidase domain containing 2 -5.92

ITGA10 integrin, alpha 10 -5.95

Table S2. Continued


COL3A1 collagen, type III, alpha 1 -6.00

MFAP4 microfibrillar-associated protein 4 -6.07

KIAA1199 KIAA1199 -6.08

SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 -6.52

RGS4 regulator of G-protein signaling 4 -6.80

SCRG1 scrapie responsive protein 1 -6.90

ACTG2 actin, gamma 2, smooth muscle, enteric -7.29

DACT1 dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) -7.30

CNN1 calponin 1, basic, smooth muscle -7.61

PSAT1 phosphoserine aminotransferase 1 -7.67

HNT neurotrimin -7.74

COL12A1 collagen, type XII, alpha 1 -8.46

PMEPA1 prostate transmembrane protein, androgen induced 1 -8.71

COL1A1 collagen, type I, alpha 1 -9.52

40 / 43



GLS glutaminase -11.39

THBS2 thrombospondin 2 -11.71

MFAP5 microfibrillar associated protein 5 -11.98

ELN elastin -13.74

Fold change represents the comparison between IFN-γ-primed MSCs and PBS-treated MSCs. Positive and

negative values indicate higher and lower expression in IFN-γ-primed MSCs, respectively. P<0.05.

Table S3. GVHD clinical scores after infusion of hPBMCs and MSCs into mice.

Group Weight loss Posture Activity Fur texture Skin integrity Total

No MSC (n = 8) 4 2 2 1 1 10

BM-MSCPBS (n = 5) 3.2 1.4 1 1 1 7.6

BM-MSCIFN-γ (n = 6) 1.3 0.5 0.4 0.3 0.2 2.9

BM-MSCAG490 + IFN-γ (n = 5) 3 1.3 1 1 1 7.3

AT-MSCIFN-γ (n = 6) 1.2 0.5 0.3 0.3 0.3 2.6

CB-MSCIFN-γ (n = 6) 1.3 0.6 0.5 0.4 0.2 3

WJ-MSCIFN-γ (n = 6) 1.4 0.5 0.5 0.4 0.3 3.1

The GVHD clinical score was based on weight loss (1, 1–10%; 2, 11–20%; 3, 21–30%; and 4, 31–40%),

posture, activity, fur texture, and skin integrity (0, normal; 1, mildly abnormal; and 2, severely abnormal). All

groups were evaluated every 5 days at days 15–35. The scores shown in the table represent the average

41 / 43

values at day 35.

Table S4. GVHD histological scores after infusion of hPBMCs and MSCs into mice.

GVHD histological scores

Skin Small intestine

No MSC (n = 4) 3 3

BM-MSCPBS (n = 4) 2 1

BM-MSCIFN-γ (n = 5) 0.5 0.5

BM-MSCAG490 + IFN-γ (n = 4) 1 1

AT-MSCIFN-γ (n = 5) 0.5 0.5

CB-MSCIFN-γ (n = 5) 0.5 1

WJ-MSCIFN-γ (n = 5) 1 1

The histological GVHD scores in the skin and small intestine of mice were evaluated at 2–3 weeks after

transplantation, with individual criteria according to specific tissues. The scoring system for each parameter

denoted 0 as normal, 0.5 as focal and rare, 1 as focal and mild, 2 as diffuse and mild, 3 as diffuse and

42 / 43

moderate, and 4 as diffuse and severe, in accordance with previously published GVHD histology.

43 / 43

ars.els-cdn.com · Web viewmyxovirus (influenza virus) resistance 1, interferon-inducible protein...

Documents

Transcript of ars.els-cdn.com · Web viewmyxovirus (influenza virus) resistance 1, interferon-inducible protein...