The Role of CCL5/CCR5 Signal Transduction in T cell Function and Breast

Cancer

by

Thomas Tsutomu Murooka

A thesis submitted in conformity with the requirements for the

degree of Doctor of Philosophy

Graduate Department of Immunology

University of Toronto

© Copyright by Thomas Tsutomu Murooka, 2009

ii

The Role of CCL5/CCR5 Signal Transduction in T cell Function and Breast Cancer

Degree of Doctor of Philosophy, 2009

Thomas Tsutomu Murooka

Graduate Department of Immunology

University of Toronto

Chemokines are responsible for directing leukocyte migration and triggering firm

arrest by activating integrins on leukocytes. It is now apparent that chemokines have

critical biological roles beyond chemo-attraction. Throughout this thesis, I describe the

importance of the CCL5/CCR5 axis in the context of the immune response and cancer

biology. Specifically, CCL5 invokes dose-dependent distinct signalling events

downstream of CCR5 activation in T cells. I show that nM concentrations of CCL5

mediate CD4+ T cell migration that is partially dependent on mTOR activation. CCL5

induces phosphorylation and de-activation of the repressor 4E-BP1, resulting in its

dissociation from the eukaryotic initiation factor-4E to initiate protein translation. I

provide evidence that CCL5 initiates rapid translation of cyclin D1 and MMP-9, known

mediators of cell migration. The data demonstrated that up-regulation of chemotaxis-

related proteins may “prime” T cells for efficient migration. During an immune response,

recently recruited T cells are exposed to high CCL5 concentrations. The propensity of

CCL5 to form higher-order aggregates at high, µM concentrations, prompted studies to

investigate their effects on T cell function. I show that at these high doses, CCL5 induces

apoptosis in PM1.CCR5 and MOLT4.CCR5 T cell lines. CCL5-induced cell death

involves the cytosolic release of cytochrome c and caspase-9/-3 activation. Furthermore,

I identified Tyrosine-339 as a critical residue within CCR5, suggesting that tyrosine

iii

phosphorylation signalling events are important in CCL5-mediated apoptosis. Our data

suggest that CCL5-induced cell death, in addition to Fas/FasL mediated events, may

contribute to clonal deletion of T cells during an immunological response. I subsequently

examined the possible pathological consequence of aberrant CCL5/CCR5 signalling in

breast cancer. Exogenous CCL5 enhances MCF-7.CCR5 proliferation, which is

abolished by anti-CCR5 antibody and rapamycin. CCL5 induces the formation of the

eIF4F translation initiation complex, and mediates a rapid up-regulation of cyclin D1, c-

Myc and Dad-1 protein expression. Thus, our data demonstrate the potential for breast

cancer cells to exploit downstream CCL5/CCR5 signalling pathways for their

proliferative and survival advantage. Taken altogether, each of these studies reinforces

the notion that chemokines are not only potent chemotactic mediators, but are key

effectors in diverse developmental, immunological and pathological processes.

iv

ACKNOWLEDGEMENTS

This thesis is dedicated to everyone who supported me throughout my doctorate studies. Such a feat is never a work of one individual, and could not have been achieved without the support of everyone through the years. I have not only grown as a scientist, but also as an individual throughout this journey, and I now leave here with the confidence to tackle a new set of challenges. Thank you, Eleanor, for being so supportive of me through the years. You always guided me in the right direction, and gave me words of encouragement through the lean times. Thank you for always being accessible, and taking the time to discuss my research plans. I am especially thankful for taking me to multiple international meetings, more than any laboratory in the department. You encouraged me to give oral presentations, and by doing so, I now have the confidence and experience to speak in front of an audience. Your continued commitment to your family and the scientific community is contagious, and look forward to working with you in the near future. To all past and present Fish Pond members, thank you for all your scientific and emotional support through the years. Beata, you were there for me from the very beginning, and took this skinny (well, skinnier) and bewildered student from Vancouver under your wing. Thank you for teaching me everything I know and for being such a great friend. Jiabing, thank you for teaching me the art of molecular biology, and for being such a calm influence in the lab. Jyothi, Raj, Anna, Joanna, Celeste and Melissa, it was such a privilege to work with all of you, and I enjoyed being the only guy in the lab (at the time). Thanks for making me feel like a part of the team and giving me a crash course on female psychology (I listened attentively but forgot most of it). Sham, I enjoyed working with you and I wish you luck with your medical career. Ramtin, I’m glad you decided to join the Fish lab, and I knew we would get along from the moment we shook hands. Friends usually encourage you, but only true friends challenge you and point out your flaws, and that’s exactly what you did. I wouldn’t have been as successful without your support, and I leave here, but never leave behind, my true friend, confidant, and scientific partner. Carole, I’m going to miss all your unanswerable questions, but I’m always a phone call away! Thank you for being such a great mentor and friend, and will definitely miss Kaycee and Kip. Behnam, I enjoyed working with you, but more so our time outside the lab. I wish you all the luck with your studies and your backhand. Danlin, thank you for all your input and help throughout my studies, and I look forward to working with you in the future. Just make sure you don’t develop a drinking habit. Daniel, I really enjoyed working with you also, and our many discussions on protein translation. I think you’re well on your way towards obtaining your Ph.D., as long as Tim Horton’s doesn’t file for Chapter 11. Cole, thank you for all your help in the lab, but telling me you’re CCR5Δ32 homozygous AFTER leaving the lab didn’t help. Erin, it’s been a short time, but a blast! I hear the CBS ghosts don’t bother you if you keep smiling. Joanne, you’re like a rainbow on a rainy day, and I wish you luck with your future studies. Olivia, I enjoyed our short time working together, and am confident that you will take this project to new heights.

v

To my mom, dad and Arnold, thank you for all your emotional and financial support over the years. Knowing that I could fly back to Vancouver and get some TLC (tender love and care) from my family was all the motivation I needed during my studies. Mom, you are an incredibly courageous woman, and even with all the pain you continue to suffer, you always manage to give me encouragement and comfort. Dad, you always put a smile on my face and I thank you for all your support. Your stock tips, however, is at best 50/50, equivalent to a coin toss. Arnold, thank you for taking care of the family back home, and I see tremendous growth in you while I was away. Yes, I will practice my golf game more, but I rather cheat to beat you. Ada, you held my hand through the tougher stretches of my studies, and for that I will be eternally grateful. Knowing that I can count on your at any time means the world to me, and we have a lifetime of pillow talks to look forward to. I do hope your carpal tunnel on your left wrist can handle some more extra weight on your finger. Mr. and Mrs. Man, I am truly grateful for feeding me and supporting me over the course of my studies. I look forward for more discussions and meals with you, but I’ll treat this time. I want to thank the “1002” boys, Jeff and Cliff for their friendship during our Toronto days, and I wish you two nothing but the best. See you guys at the top! I also thank “turtle” and my late cat, Tama, for many good times. Finally, I would like to thank the chair, all faculty members, graduate coordinators and fellow students in the Immunology department for all their support and friendship, and look forward to working with all of you again in the future. Playing left field for the Immunology softball team was truly a blast!

vi

TABLE OF CONTENTS

Title Page ……………………………………………………………………………...…..i Abstract …………………………………………………………………………………..ii Acknowledgements …………………………………………………………...………….iv Table of Contents …………………………………………………………………….….vi List of Figures ……………………………………………………………………...…….x List of Tables ……………………………………………………………………..……..xii List of Abbreviations ………………………………………………………….……...xiii CHAPTER 1: Introduction ……………………………………………..………..…1-69

1.1. Chemokine Superfamily ……………………………………………….…….2

1.1.1. Classification …………………………………………………..….2 1.1.2. Chemokine Structure ……………………………………………..7 1.1.3. Glycosaminoglycan (GAG) Binding …………………….……….9 1.1.4. Chemokine-mediated Signal Transduction ………………...……11

1.1.4.1.Jak-Stat Pathway ……………………………….………..12

1.2. Chemokine Receptors ………………………………………………...…….14 1.2.1. Classification ……………………………………………….……14 1.2.2. Atypical Chemokine Receptor Family ……………………..……17 1.2.3. Receptor Structure ……………………………………..………..20 1.2.4. Chemokine Ligand Binding Domains …………………………..21 1.2.5. Receptor Internalization …………………………..……………..22 1.2.6. Receptor Homo- and Hetero- Dimerization …………….……….24

1.3. Chemokine/Chemokine Receptor Function and the Immune Response …....27

1.3.1. Chemotaxis …………………………………………………...…27 1.3.1.1. Cell Proliferation ……………………………………..…27 1.3.1.2. Activation of the PI-3’K Pathway ………………………28 1.3.1.3. Recruitment of Rho Family GTPases ………………..…31 1.3.1.4. MAPK Signalling and Cytoskeletal Dynamics …………33

1.3.2. Role in Cell Death and Survival ……………………………...…36 1.3.3. T cell Co-stimulation …………………………………………....39 1.3.4. The mTOR/4E-BP1 Pathway and Chemotaxis ………………….41

1.4. Chemokine/Chemokine Receptors and Disease …………………………....52

1.4.1. Rheumatoid Arthritis ……………………………………………52 1.4.2. Cancer …………………………………………………………...55

1.4.2.1. Chemokines Influence Leukocyte Tumour Infiltration…55 1.4.2.2. Chemokines and Tumour Growth …………….………...59 1.4.2.3. Chemokines in Angiogenesis/Angiostasis ………..…….61 1.4.2.4. Chemokines in Metastasis ………………………………63

vii

1.4.3. Human Immunodeficiency Virus (HIV) Infection …………..….66

1.5. Hypothesis and Objectives …………………………………………….……69

CHAPTER 2: CCL5-CCR5 Mediated Apoptosis in T cells: Requirement for Glycosaminoglycan Binding and CCL5 Aggregation …………70-154

2.1. Abstract ………………………………………………………………..……71 2.2. Introduction …………………………………………………………………72 2.3. Materials and Methods

2.3.1. Cells and Reagents ………………………………………………75 2.3.2. Preparation of primary T cells ……………………….………….76 2.3.3. Chondroitinase ABC treatment …………………………………76 2.3.4. MTT, Annexin V/7-ADD staining ………………………...…….76 2.3.5. JC-1 staining for mitochondrial membrane potential ……..…….77 2.3.6. Subcellular Fractionation …………………………………..……77 2.3.7. Western Blot Analysis ……………………………………..……77 2.3.8. Flow Cytometric Analysis …………………………………..…..78 2.3.9. CCR5 site-directed mutagenesis and PM1 transfection ………....78 2.3.10. Statistical Analysis …………………………………………..….79

2.4. Results

2.4.1. µM concentrations of CCL5 induce apoptosis in CCR5 expressing T cells ………………………………………………………………80 2.4.2. CCL5 induced cell death is mediated by the mitochondrial and

apoptosome pathway ………………………………………...…..80 2.4.3. µM concentrations of CCL5 induce apoptosis in CCR5 expressing

primary T cells ……………………………………………..……92 2.4.4. Expression of intact CCR5, but not CCR5Y339F, renders PM1 cells

susceptible to CCL5-inducible apoptosis …………………..……92 2.4.5. CCL5-induced cell death is dependent on GAG interactions ….…95 2.4.6. Aggregation of CCL5 is required for CCL5-induced cell death .104

2.5. Discussion …………………………………………………………………107

CHAPTER 3: CCL5-mediated T cell Chemotaxis Involves the Initiation of mRNA Translation through mTOR/4E-BP1 ………………………….113-154

3.1. Abstract ……………………………………………………………………114 3.2. Introduction …………………………………………………………..……115 3.3. Materials and Methods

3.3.1. Cells and Reagents ………………………………………..……119 3.3.2. Immunoblotting and Immunoprecipitation ………………….…120 3.3.3. Flow Cytometric Analysis ………………………………..……121

viii

3.3.4. Chemotaxis Assay …………………………………………...…121 3.3.5. Semi-quantitative RT-PCR ………………………………….…122 3.3.6. Polysome gradients ………………………………………….…122 3.3.7. Statistical Analysis …………………………………………..…123

3.4. Results

3.4.1. CCL5-mediated chemotaxis of activated CD4+ T cells is mTOR dependent ……………………………………………………….124 3.4.2. CCL5 induces phosphorylation of mTOR, p70 S6 kinase and S6

ribosomal protein …………………………………………….…129 3.4.3. CCL5-mediated 4E-BP1 phosphorylation is PI-3’K-, PLD- and

mTOR- dependent …………………………………………...…134 3.4.4. CCL5 initiates protein translation through formation of the eIF4F

complex ……………………………………………………...…134 3.4.5. CCL5-inducible protein translation of cyclin D1 and MMP-9 is

mTOR-dependent ……………………………………………....144

3.5. Discussion ……………………………………………………………...….147

CHAPTER 4: CCL5 Promotes Breast Cancer Progression through mTOR/4E-BP1 dependent mRNA Translation.…………………..………..…155-181

4.1. Abstract ……………………………………………………………………156 4.2. Introduction …………………………………………………………..……157 4.3. Materials and Methods

4.3.1. Cells and Reagents ……………………………………..………160 4.3.2. Plasmid Constructs ……………………………………….……160 4.3.3. Proliferation Assay …………………………………………..…161 4.3.4. Immunoblotting and Immunoprecipitation ……………….……161 4.3.5. Flow Cytometric Analysis ………………………………..……162 4.3.6. Polysome gradients ……………………………………….……163 4.3.7. RT-PCR ……………………………………………………..…164 4.3.8. Statistical Analysis ………………………………………..……164

4.4. Results

4.4.1. CCL5-CCR5 inducible MCF-7 proliferation is dependent on mTOR ……………………………………………………….…165

4.4.2. CCL5 activation of CCR5 leads to the formation of the eIF4F complex through mTOR …………………………………….…168

4.4.3. CCL5 induces protein translation of proliferation and survival proteins …………………………………………………………171

4.4.4. CCL5 facilitates recruitment of a subset of mRNAs to polysomes .………………………………………………..……174

4.5. Discussion ……………………………………………………………..…..177

ix

CHAPTER 5: Discussion and Future Directions …………………………...…182-202

Chemokines and the Immune Response ……………………………………………….183 5.1. mTOR and the Adaptive Immune Response ………………………...……188 5.1.1. mTOR-mediated Nutrient Sensing and Chemotaxis ………….…193

5.2. CCL5 determines T cell fate through AICD ………………………………196 5.3. CCL5 promotes breast cancer proliferation …………………………….…199

5.3.1. CCL5-mediated mTOR Activation and Cellular Metabolism …..200

5.4. Conclusions ………………………………………………………………..203

CHAPTER 6: Dissemination of Work Arising from this Thesis …………………..204

CHAPTER 7: References ………………………………………………………206-267

x

LIST OF FIGURES

CHAPTER 1

Figure 1.1. Chemokines share similar structural elements …………………….…4 Figure 1.2. Two-dimensional diagram of CCR5 depict residues critical for ligand

binding, receptor integrity, internalization and signal transduction ...15 Figure 1.3. The MAPK Signaling Cascade ……………………………………..34 Figure 1.4. Regulation of cap-dependent mRNA translation ………………...….44 Figure 1.5. eIF4F formation and ribosome recruitment ……………………....…48 Figure 1.6. Chemokines and Cancer …………………………………………….56

CHAPTER 2

Figure 2.1. µM concentrations of CCL5 induce apoptosis in PM1.CCR5 T cells …………………………………………………………………..…81

Figure 2.2. CCL5 does not affect Fas/FasL expression in T cells ………………85 Figure 2.3. FasL neutralizing monoclonal antibody NOK1 does not block CCL5

mediated apoptosis in PM1.CCR5 cells ……………………….……87 Figure 2.4. µM concentrations of CCL5 induce cytochrome c release, caspase-9

and caspase-3 activation and PARP cleavage ………………………89 Figure 2.5. µM concentrations of CCL5 induce apoptosis in human primary T

cells …………………………………………………………………93 Figure 2.6. CCL5 binding and receptor internalization of PM1.CCR5 and

PM1.CCR5Y339F cells ……………………………………….……96 Figure 2.7. Introduction of CCR5 but not CCR5Y339F into PM1 T cells renders

them susceptible to CCL5-inducible apoptosis …………………….98 Figure 2.8. CCL5-GAG interactions are important for apoptosis …………..…101 Figure 2.9. The CCL5 aggregation mutant E66S does not induce PM1.CCR5 cell

death …………………………………………………………….…105 CHAPTER 3

Figure 3.1. CCL5-mediated chemotaxis of activated CD4+ T cells is dependent on PI-3’K and mTOR ………………………………………………....125

Figure 3.2. CCL3/MIP1α-dependent T cell chemotaxis is not dependent on mTOR ……………………………………………………….……..127

Figure 3.3. Effect of various inhibitors on T cell viability and adhesion ……...130 Figure 3.4. CCL5-dependent phosphorlyation of mTOR, p70 S6K1 and ribosomal

protein S6 in T cells …………………………………………….....132 Figure 3.5. CCL5 phosphorylates the 4E-BP1 repressor of mRNA translation

through PI-3’ kinase and mTOR ………………………..…………135 Figure 3.6. CCL5-mediated PLD activation regulates T cell migration …….…137 Figure 3.7. CCL5 induces formation of the eIF4F initiation complex ……...…140 Figure 3.8. CCL5-inducible protein translation enhances mRNA association with

polyribosomes …………………………………………………..…142

xi

Figure 3.9. CCL5-inducible upregulation of cyclin D1 and MMP-9 protein levels is dependent on mTOR-mediated mRNA translation …………..…145

Figure 3.10. Possible model for CCL5-mediated mRNA translation in CD4+ Tcells ……………………………………………………………....152

CHAPTER 4

Figure 4.1. CCL5-mediated MCF-7 proliferation is dependent on mTOR ……166 Figure 4.2. CCL5 induces formation of the eIF4F initiation complex and enhances

mRNA association with polyribosomes …………………………...169 Figure 4.3. CCL5 mediates upregulation of proliferative and survival proteins

through a mTOR dependent mechanism …………………………..172 Figure 4.4. CCL5 faciliates recruitment of a subset of mRNAs to polysomes ..175

CHAPTER 5

Figure 5.1. Chemokines mediates leukocyte migration from blood to

extravascular tissue ……………………………………………......184 Figure 5.2. Illustration of the role of mTOR activity in T cell migration in vivo

………………………………………………………………….…..190

xii

LIST OF TABLES

CHAPTER 1 Table 1.1. The Chemokine Superfamily and Nomenclature ……………………...3

xiii

LIST OF ABBREVIATIONS

Ab Antibody ADP Adenosine diphosphate AICD Activation induced cell death AOP-CCL5 Aminooxypentane-CC chemokine ligand 5 APC Antigen presenting cell Arp2/3 Actin-related proteins 2/3 Bcl-2 B cell lymphoma-2 bp Base pair BRET Bioluminescence resonance energy transfer CCL5 CC chemokine ligand 5 CCR5 CC chemokine receptor 5 CCX-CKR ChemoCentryx chemokine receptor Cdc42 Cell division cycle 42 c-Myc Cellular-myelocytomatosis virus oncogene CS Chondroitin sulphate C-terminus Carboxy-terminus CTL Cytotoxic T lymphocyte CXCL CXC chemokine ligand CXCR CXC chemokine receptor CX3CL CX3C chemokine ligand CX3CR CX3C chemokine receptor DAD Defender against cell death DAG Diaceylglyerol DARC Duffy antigen receptor for chemokines DC Dendritic cell DNA Deoxyribonucleic acid DPG Diphosphoglycerate DRY Aspartate-Arginine-Tyrosine DS Dermatan sulphate DTT Dithiothreitol ECL Extra-cellular loop EDTA Ethylenediamine tetra-acetic acid EGTA Ethylene glycol-bis (2-aminoethylether)-N’N’N’N’-tetra-acetic

acid EGF Epidermal growth factor eIF Eukaryotic translation initiation factor ELR Glutamate-Leucine-Arginine ERK Extracellular signal-related kinase F-actin Filamentous actin FACS Flourescence activated cell sorter FAK Focal adhesion kinase FasL Fas antigen ligand FCS Fetal calf serum

xiv

FITC Flourescein isothiocynate FKBP12 FK506-binding protein of 12kDa FLF Fulminant liver failure FRAP/mTOR FKBP 12-rapamycin-associated protein/mammalian target of

rapamycin FRET Fluorescence resonance energy transfer GABA γ-aminobutyric acid GAG Glycosaminoglycan GAP GTPase activating protein GAPDH Glyceraldehyde 3-phosphate dehydrogenase GDP Guanosine diphosphate GEF Guanidine nucleotide exchange factor GFP Green fluorescent protein GM-CSF Granulocyte-macrophage colony-stimulating factor gp120 Glycoprotein of 120kDa GPCR G-protein coupled receptor GRK G-protein receptor kinase GTP Guanosine triphosphate HA Hyaluronic acid HEK Human embryonic kidney HEV High endothelial venule HIV Human immunodeficiency virus HLA Human leukocyte antigen HRP Horseradish peroxidase HS Heparin sulphate IP3 Inositol 1,4,5-phosphate Jnk c-Jun N-terminal kinase kDa Kilodalton KS Keratin sulphate KSHV Karposi’s sarcoma-associated herpes virus ICAM Intracellular adhesion molecule IFN Interferon IL Interleukin IP Immunoprecipitation IRES Internal ribosomal entry segment Jak Janus kinase LFA Lymphocyte function-associated antigen LPS Lipopolysaccharide MAPK Mitogen-activated protein kinase MCP Macrophage chemo-attractant protein MEF Murine embryonic fibroblast Met-CCL5 Methionine-CC chemokine ligand 5 Met-tRNA Methionine-transfer ribonucleic acid MHC Major histocompatibility complex MIP Macrophage inflammatory protein MLCK Myosin light chain kinase

xv

µM Micromolar MMP Matrix metalloproteinase mRNA Messenger RNA mTOR Mammalian target of rapamycin mTORC1 Mammalian target of rapamycin complex 1 NF-κB Nuclear factor-kappa B NK Natural killer NMR Nuclear magnetic resonance nM Nanomolar NP-40 Nonidet-40 N-terminus Amino-terminus OD Optical density OX-PHOS Oxidative phosphorylation p38 38kDa stress-activated kinase PA Phosphatidic acid PARP Poly ADP ribose polymerase PBS Phosphate buffered saline PCR Polymerase chain reaction PDK Phosphoinositide-dependent kinase PGE2 Prostaglandin E2 PH Pleckstrin homology PHA Phytohaemagglutinin PHAS Phosphorylated heat and acid soluble protein PI Propidium iodide PI-3’K Phosphatidylinositol 3-kinase PIKK Phosphoinositide kinase-related kinase PIP3 Phosphatidylinositol 3,4,5-phosphate PKB Protein kinase B PKC Protein kinase C PKR Protein kinase R PLCβ Phospholipase Cβ PLD Phospholipase D PMA Phorbol-12-miristate-13-acetate PMSF Phenylmethylsulfonylflouride PRR Pattern-recognition receptors PTEN Phosphatase and tensin homolog deleted in chromosome ten pTx Pertussis toxin RA Rheumatoid arthritis Rac Ras-related C3 botulinum toxin substrate RANTES Regulated on activation normal T cell expressed and secreted Raptor Regulatory associated protein of mTOR Rheb Ras-homolog enriched in brain Rho Ras homolog gene family Rictor Rapamycin-insensitive companion of mammalian target of

rapamycin RNA Ribonucleic acid

xvi

ROCK Rho kinase ROS Reactive oxygen species rpS6 Ribosomal protein S6 RT-PCR Reverse transcription-polymerase chain reaction SDF Stromal derived factor SDS Sodium dodecyl sulphate SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis SH2 Src-homology 2 SHIP Src-homology 2 domain-containing inositol phosphatase S6K S6 kinase Stat Signal transducer and activator of transcription TAM Tumor associated macrophages TBS Tris buffered saline TCR T cell receptor Th T helper TIL Tumor infiltrating T lymphocytes TLR Toll-like receptor TM Trans-membrane TNFα Tumor necrosis factor α TNFR Tumor necrosis factor receptor α TOP Tract of oligopyrimidines TRAIL TNF-related apoptosis-inducing ligand TSC Tuberous sclerosis complex TXP Threonine-X-Proline UTR Untranslated region VCAM Vascular cell adhesion molecule VEGF Vascular endothelial growth factor VLA Very late antigen WASp Wiskott-Aldrich syndrome protein WAVE/Scar Wiskott-Aldrich syndrome protein family verprolin-homologous

protein/suppressor of cyclic adenosine monophosphate receptor XCL XC chemokine ligand XCR XC chemokine receptor ZAP-70 Zeta-associated protein tyrosine kinase of 70kDa 4E-BP 4E-binding protein 7-AAD 7-amino actinomycin D

Chapter 1

Introduction

Portion of this chapter was published as:

Murooka, T.T., Ward, S.E., and Fish, E.N. (2005). Chemokines and cancer. Cancer Treat Res 126, 15-44.

Galligan C.L., Murooka, T.T., Rahbar, R., Baig, E., Majchrzak-Kita, B., and Fish, E.N.

(2006). Interferons and viruses: signalling for supremacy. Immunol Res 35, 27-40.

2

1.1. Chemokine Superfamily

1.1.1. Classification

The chemokines are soluble, small molecular weight (8-14 kDa) and basic

cytokines that bind to their cognate seven trans-membrane G-protein coupled receptors

(GPCRs) to elicit directed cell migration. Since their initial discovery almost 30 years

ago, approximately 47 human chemokines have been identified to date (Table 1.1). They

are separated into four sub-families based on the relative positioning and presence of the

first two cysteine residues at the N-terminus (Zlotnik and Yoshie, 2000). The cysteine

residues in CXC chemokines are separated by one non-conserved amino acid, whereas in

CC chemokines, the first two cysteine residues are adjacent. The XC chemokines lack

the first consensus cysteine, whereas the CX3C chemokine CX3CL1 is characterized by

three non-conserved amino acids between the first two cysteine residues. In 2000, a

system of nomenclature was introduced in which each ligand and receptor is identified by

its sub-family and given an identifying number (Bacon et al., 2002; Murphy et al., 2000).

For example, the CXC chemokine SDF-1α (stromal-derived factor 1α) is now known as

CXCL12 for CXC chemokine ligand 12, and the CC chemokine RANTES (regulated on

activation normal T cell expressed and secreted) is now known as CCL5 for CC

chemokine ligand 5. Throughout this thesis, chemokine ligands and receptors will be

referred to by the new nomenclature, with their corresponding original names found in

Table 1.1. This thesis will review our general understanding of chemokine/chemokine

receptor structure and function, with a major emphasis on the CC chemokine CCL5 and

its receptor, CCR5.

3

Table 1.1. The Chemokine Superfamily and Nomenclature Alternate Names Mouse Ligand Receptor(s)

CXC Chemokines

CXCL1 Groα/MGSAα Gro/KC CXCR2, CXCR1 CXCL2 Groβ/MGSAβ MIP-2 CXCR2 CXCL3 Groγ Dcip CXCR2 CXCL4 PF4 PF4 CXCR3b CXCL5 ENA-78 LIX CXCR2 CXCL6 GCP-2 CXCR1, CXCR2 CXCL7 NAP-2 Ppbp CXCR2 CXCL8 IL-8 CXCR1, CXCR2 CXCL9 MIG MIG CXCR3, CXCR3b CXCL10 IP-10 IP-10 CXCR3, CXCR3b CXCL11 I-TAC I-TAC CXCR3, CXCR3b, CXCR7 CXCL12 SDF-1α/β SDF-1α/β CXCR4, CXCR7 CXCL13 BLC, BCA-1 BLC, BCA-1 CXCR5 CXCL14 BRAK, Bolekine BRAK, Boleine Unknown CXCL15 none Lungkine Unknown CXCL16 none CXCL16 CXCR6 CXCL17 DMC DMC Unknown

CC Chemokines CCL1 I-309 TCA-3 CCR8 CCL2 MCP-1 JE CCR2 CCL3 MIP-1α/LD78α MIP-1α CCR1, CCR5 CCL4 MIP-1β MIP-1β CCR5 CCL5 RANTES RANTES CCR1, CCR3, CCR5 CCL7 MCP-3 MARC CCR1, CCR2, CCR3 CCL8 MCP-2 MCP-2, MCP-5 CCR1, CCR2, CCR3, CCR5 CCL11 Eotaxin Eotaxin CCR3 CCL13 MCP-4 CCR1, CCR2, CCR3 CCL14 HCC-1 CCR1 CCL15 HCC-2/LKN1/MIP-1γ CCL9, MIP-1γ CCR1, CCR3 CCL16 HCC-4/LEC/LCC-1 CCR1, CCR2, CCR5 CCL17 TARC TARC CCR4 CCL18 DC-CK1/PARC/AMAC-1 Unknown CCL19 MIP-3β/ELC MIP-13β CCR7 CCL20 MIP-3β/LARC MIP-α/LARC CCR6 CCL21 SLC/6Ckinase CCL21a, b, c/SLC CCR7 CCL22 MDC/STCP-1 ABCD-1 CCR4 CCL23 MPIF/CKβ8 CCL6/C10 CCR1 CCL24 Eotaxin-2/MPIF-2 Eotaxin-2 CCR3 CCL25 TECK TECK CCR9 CCL26 Eotaxin-3 CCL26l CCR3 CCL27 CTACK/ILC CTACK/ILC CCR10 CCL28 MEC MEC CCR3, CCR10

C Chemokines XCL1 Lymphotactin/SCM-1α Lymphotactin XCR1 XCL2 SCM-1β XCR1

CX3C Chemokine

CX3CL1 Fractalkine Fractalkine CX3CR1

4

Figure 1.1 Chemokines share similar structural elements Overlayed monomeric minimized mean structure of CCL2 (yellow), CCL5 (blue) and CCL11 (red) shows similar structural elements despite a low level of sequence homology.

5

Adapted from M. Crump et al J. Biol. Chem. 273 (1998)

C-terminal α-helix 30s loop

β1

β2 β3

40s loop

N-loop

N-terminus

310 helix

6

Chemokines are also functionally classified as homeostasis or inflammation.

Inflammatory chemokines control the recruitment of leukocytes during immunological

insult, whereas homeostatic chemokines are involved in normal leukocyte development

and the migration of cells to and within secondary lymphoid organs (Moser et al., 2004).

Most chemokines are secreted from the cell, with the exception of CX3CL1 and CXCL16,

which are tethered to the extracellular surface through a trans-membrane stalk (Zlotnik

and Yoshie, 2000). These chemokines can also be released in soluble form after

proteolytic cleavage. Interestingly, there are 47 chemokines that bind to 18 receptors,

suggestive of considerable redundancy within the chemokine system of ligand/receptor

interactions. This redundancy is thought to aid in fine-tuning specific chemokine-

mediated biological responses. For instance, CCR5-deficient mice develop normally,

suggesting that other chemokine receptors may compensate for the lack of CCR5 (Zhou

et al., 1998).

The CXC chemokines can be further subdivided into ELR+ and ELR-

chemokines based on the presence or absence of the Glutamate-Leucine-Arginine (ELR)

motif preceding the CXC sequence. ELR+ chemokines are potent promoters of

angiogenesis, exemplified by their ability to mediate the chemotaxis of endothelial cells

in corneal neo-vascularization experiments (Strieter et al., 1995). CXCL1, CXCL2,

CXCL3, CXCL5, CXCL6, CXCL7 and CXCL8 are all ELR+ chemokines, with CXCL12

the only ELR- chemokine with angiogenic properties (Luker and Luker, 2006; Moser et

al., 2004; Orimo et al., 2005). The role of chemokines in angiogenesis is discussed in

more detail in Section 1.4.2.3.

7

1.1.2. Chemokine Structure

The structures of several chemokines have been solved by nuclear magnetic

resonance (NMR) and/or X-ray crystallography. Studies have revealed that the three

dimensional structure of CCL5 is similar to that of CCL2, CCL3, CCL4 and CXCL8,

despite a relatively low level of sequence homology (Baldwin et al., 1991; Czaplewski et

al., 1999; Handel and Domaille, 1996; Lodi et al., 1994) (Figure 1.1). This “chemokine

fold” structure consists of three anti-parallel β-strands (β(1), β(2) and β(3)) overlaid by a C-

terminal α-helix. Upstream of the β-sheets is the flexible N-terminal region, followed by

a long N-loop and a short 310 helix. Two characteristic disulphide bridges between the

first and third, and the second and fourth cysteine residues stabilize the three dimensional

conformation. The flexible N-terminal region is believed to be important in receptor

activation, since modifications in this region have been shown to affect function (Gong

and Clark-Lewis, 1995; Jarnagin et al., 1999; Mizoue et al., 2001). In some instances, N-

terminal modifications have been shown to modify chemokine function, effectively

creating a variant potent antagonist. Retention of the N-terminal methionine in CCL5

(Met-CCL5) and CCL2 (Met-CCL2) both produced antagonists for CCR5 and CCR2,

respectively, as does the addition of amino-oxypentane to CCL5 (AOP-CCL5) (Signoret

et al., 2000; Simmons et al., 1997). In addition to the N-terminus, the N-loop between

the first two cysteines and the 310 helix contains residues involved in receptor binding

(Crump et al., 1997; Pakianathan et al., 1997). Taken together, in a hypothesized two-site

model of chemokine receptor activation, the core domain of chemokines (which differs

8

for each chemokine) binds to the extracellular loops of the receptor to help position the

N-terminal signalling domain of the ligand within the helical bundle of the receptor.

Chemokines are subject to proteolytic cleavage by specific proteases found at

inflammatory sites. As a result, a number of natural variants of inflammatory

chemokines with N-terminal modifications have been identified (Proost et al., 2006). The

resulting chemokine variants can either have increased or decreased chemokine

bioactivity. For example, the serine protease CD26 (also known as dipeptidyl peptidase

IV) is capable of mediating N-teriminal CCL5 cleavage, resulting in a CCL5 variant (3-

68) that exhibited reduced chemotactic and intracellular calcium mobilization ability

(Proost et al., 1998; Struyf et al., 1998). Thus, by altering the N-terminus, proteases can

alter chemokine function by directly affecting receptor binding. The data demonstrate the

potential for proteases to regulate chemokine activity during an inflammatory response.

It has been known for some time that chemokines form oligomers in solution, but

whether they were relevant physiologically was unknown. Subsequent mutational

analyses of different classes of chemokines revealed that CC chemokines form dimers

through residues near their N-terminus surrounding the first two cysteine residues, while

CXC chemokines predominantly dimerize through residues in the first strand of β(1)

(Proudfoot, 2006). Intriguingly, CCL5 not only forms dimers, but has a tendency to

extensively aggregate into higher-order oligomeric structures (Appay et al., 1999).

Extensive mutational studies have produced mutant CCL5 molecules that display unique

aggregation properties. A CCL5 mutant where Thr-7 is N-methylated on the amide

9

nitrogen ([Nme-7T]-CCL5), is monomeric and does not oligomerize on immobilized

glycosaminoglycans (GAGs), yet retains its ability to mediate chemotaxis in vitro

(Proudfoot et al., 2003). However, when tested in vivo using a peritoneal recruitment

assay, [Nme-7T]-CCL5 failed to recruit cells. In the same study, the dimeric [E66S]-

CCL5 mutant, but not the tetrameric [E26A]-CCL5 mutant, failed to recruit cells in vivo,

although both retained chemotactic ability in vitro. The data suggest that not only is

CCL5 aggregation required for biological activity in vivo, but a minimal quaternary

structure must be reached. Similarly, a Pro-8 to Ala substitution in CCL2 ([P8A]-CCL2)

resulted in a mutant chemokine that induced calcium mobilization and mediated

chemotaxis with wildtype potency and efficacy in vitro, while failing to do so in vivo

(Paavola et al., 1998; Proudfoot et al., 2003). Taken altogether, chemokine

oligomerization is physiologically relevant, and critical for chemokine function in vivo.

1.1.3. Glycosaminoglycan (GAG) Binding

Secreted chemokines bind to heparin-like glycosaminoglycans (GAGs), which

immobilize and concentrate chemokines at tissue sites. GAGs are normally attached to

proteins on the cell surface and/or the extracellular matrix to form proteoglycans

(Proudfoot, 2006). GAGs are widely diverse, and consist of repeating disaccharide units

with variations in basic composition of the saccharide in acetylation and N- and O-

sulphation patterns. A common feature of GAGs is their overall negative charge due to

the density of sulphate and carboxylate groups on the GAG chains. This suggests an

electrostatic interaction with the basic, positively charged chemokines (Kuschert et al.,

1999). There are several classes of GAGs, the most ubiquitous being heparin sulphate

10

(HS), a polysaccharide that is expressed on virtually every cell in the body. Others

include heparin, produced almost exclusively by mast cells; chondroitin sulphate (CS)

and dermatan sulphate (DS), found on cell surfaces and the extracellular matrix; keratin

sulphate (KS), found as part of the cornea and cartilage; and hyaluronic acid (HA).

Interestingly, chemokines have been shown to have a hierarchical preference for GAGs.

For example, CCL5 binding affinity for different GAGs was determined as heparin > DS

> HS > CS through competition studies, suggesting that specificity of chemokine-GAG

interactions may have important implications in vivo (Kuschert et al., 1999). The GAG

binding residues on various chemokines have been identified, described as XBBXBX and

XBBBXXBX (where B is a basic amino acid and X is any amino acid). In some cases,

the GAG binding epitopes can overlap with the receptor binding domains (Hileman et al.,

1998). Specific residues critical for GAG binding of chemokines CCL2, CCL3 and

CCL4 have now been identified (Chakravarty et al., 1998; Koopmann et al., 1999;

Koopmann and Krangel, 1997; Lau et al., 2004; Laurence et al., 2001; Martin et al.,

2001; Sadir et al., 2001; Vita et al., 2002). Proudfoot and colleagues identified the

heparin-binding BBXB motif found within the 40s loop for CCL5. An alanine mutant,

[44AANA47]-CCL5, exhibits an 80% reduction in heparin binding capacity and no

recruitment activity in vivo, although in vitro activity was retained (Proudfoot et al.,

2003; Shaw et al., 2004). Intriguingly, mixing both [44AANA47]-CCL5 and intact CCL5

resulted in heterodimers that were unable to recruit cells into the peritoneal cavity in vivo

(Johnson et al., 2004). Indeed, [44AANA47]-CCL5 functioned as a dominant negative

inhibitor in a number of inflammatory models by limiting leukocyte recruitment (Johnson

et al., 2004). Taken altogether, chemokine-GAG interactions are critical in promoting

11

chemokine aggregation, local retention and the establishment of a chemokine

concentration gradient, allowing immune cells to migrate via a haptotactic mechanism

(Amara et al., 1999; Cinamon et al., 2001; Kuschert et al., 1999; Netelenbos et al., 2002;

Pablos et al., 2003; Proudfoot et al., 2003). These immobilized chemokines allow

leukocytes to stop rolling, promote extravasation and direct chemotaxis.

1.1.4. Chemokine-mediated Signal Transduction

Chemokine ligands bind to and activate seven trans-membrane, G-protein coupled

chemokine receptors (GPCRs). In most cases, ligand binding causes the dissociation of

Gαi from the Gβγ subunit of the heterotrimeric G-proteins, leading to the activation of a

multitude of signalling cascades. These include activation of adenylyl cyclase and

phospholipase Cβ (PLCβ), resulting in intracellular calcium mobilization (Frederick and

Clayman, 2001; Richmond, 2002; Rossi and Zlotnik, 2000). Specifically, PLCβ

activation results in the generation of diacylglcerol (DAG) and inositol-1,4,5-triphosphate

(IP3) to subsequently activate protein kinase C (PKC), which in turn phosphorylates

CCR5 on the C-terminus. The majority of chemokine-mediated responses are inhibited

by pertussis toxin (PTx), a bacterial toxin that catalyzes the ADP-ribosylation of the Gαi

subunit, preventing all G-protein coupled signalling. However, chemokine receptors

have been reported to associate with other PTx-insensitive G-proteins, including Gq/11 or

G16, (Mellado et al., 2001b). Furthermore, CCR2 and CCR5 have been demonstrated to

induce a PTx-insensitive, tyrosine phosphorylation signalling cascade after ligand

binding, adding an additional layer of complexity to signalling pathways mediated by

chemokines (Bacon et al., 1995).

12

1.1.4.1. Jak-Stat Pathway

The Jak-Stat pathway is the principle signalling mechanism for many cytokines

and growth factors. It is clear through numerous studies that chemokines can activate the

Janus kinase (Jak)–Signal transducers and activators of transcription (Stat) signalling

pathway (Mellado et al., 1998; Rodriguez-Frade et al., 1999; Shahrara et al., 2003; Vila-

Coro et al., 1999a; Wong and Fish, 1998; Wong et al., 2001). Generally, activation of

Jaks occurs upon ligand-mediated receptor dimerization, when two Jaks are brought into

close proximity to facilitate trans-phosphorylation (Rawlings et al., 2004). Active Jaks

then directly phosphorylate a single tyrosine residue within the carboxy terminus of Stats

(Fu, 1992). Phosphorylated Stats then dimerize through their SH2 domains, translocate

to the nucleus and bind specific DNA sequences to regulate gene transcription (Darnell,

1998). CCL5 induced rapid tyrosine phosphorylation of CCR5, Jak2 and Jak3 in a PTx-

insensitive manner in PM1 T cells, suggesting that these events were independent of G-

protein signalling (Wong et al., 2001). Subsequent studies have shown that both CCL3

and CCL5 mediated Stat1:Stat1 and Stat1:Stat3 homo- and hetero-dimer formation in

Molt-4 and Jurkat T cells (Wong and Fish, 1998). Other studies have demonstrated that

CCL5 induced phosphorylation of Jak1 and Stat5 in a CCR5-dependent manner in HEK

293 cells (Mellado et al., 2001b). Similarly, CXCL12 has been shown to induce Jak2 and

Jak3 activation in T cells, although subsequent studies have not been able to reproduce

these finding (Moriguchi et al., 2005; Soriano et al., 2003; Vila-Coro et al., 1999b).

Nevertheless, CXCL12 stimulation of CD34+ hematopoietic progenitor cells induced

Jak2 phosphorylation and its association with PI-3’K to possibly modulate cell migration

13

(Zhang et al., 2001). Taken altogether, chemokines activate the Jak-Stat pathway to

invoke various biological responses, where specific usage of various Jak and Stat

molecules seems to be largely ligand and cell type specific (Wong and Fish, 2003).

14

1.2. Chemokine receptors

1.2.1. Classification

Currently, 18 chemokine receptors have been described (Table 1.1). All

chemokines exert their biological functions by binding to G-protein coupled receptors

(GPCR). Chemokine receptors are classified according to the sub-family of chemokine

ligands they are receptors for: CC chemokines bind to CC chemokine receptors (CCRs),

CXC chemokines bind to CXC chemokine receptors (CXCRs) , XC chemokines bind to

XC chemokine receptors (XCRs) , and CX3CL1 is the ligand for the CX3CR1 receptor

(Bacon et al., 2002; Murphy et al., 2000). The CC chemokine receptor 5, CCR5, contains

352 amino acids and has a calculated molecular mass of 40.6 kDa. CCR5 shares 71%

sequence identitiy with CCR2, and is the receptor for CCL3, CCL4 and CCL5 (Figure

1.2) (Combadiere et al., 1996; Raport et al., 1996; Samson et al., 1996). A number of

non-functional CCR5 variants have been identified, the most important being the

truncated CCR5Δ32 variant that is non-functional and not expressed on the cell surface

(Samson et al., 1996).

Several virus-encoded chemokine receptor-like molecules have also been

characterized. One of particular importance is the G-protein coupled receptor encoded by

the Kaposi’s sarcoma-associated herpresvirus KSHV (also know as HHV8), designated

KHSV-GPCR. This receptor shares a high degree of homology with human CXCR2

(Arvanitakis et al., 1997).

15

Figure 1.2 Two-dimensional diagram of CCR5 depicting residues critical for ligand

binding, receptor integrity, internalization and signal transduction

16

Adapted from M. Oppermann Cellular Signaling 16 (2004)

Intracellular Domain

Trans-membrane Domain

Extracellular Domain

G-protein binding

Palmitoylation sites

Serine phosphorylation

Y339

Y307

Y12

Tyrosine sulfation sites

17

Once expressed in endothelial cells, KSHV-GPCR can trigger a constitutive signal

sufficient to induce Kaposi-like sarcomas in mice (Bais et al., 1998; Sodhi et al., 2006).

Altered chemokine expression has also been reported in Kaposi’s sarcoma herpes virus-

infected cells. The virus has acquired genes encoding three chemokines, viral

macrophage inflammatory proteins (vMIP)-I, -II and –III (Nakano et al., 2003).

Recombinant vMIP-I and –II induced calcium mobilization and are chemotactic for

leukemic cells in a CCR5-dependent manner, suggesting a possible mechanism for the

propagation of Kaposi’s sarcoma. Taken together, viruses encode chemokine/chemokine

receptors to potentially interfere with or take advantage of host chemokines to favour

viral replication and dissemination.

1.2.2. Atypical Chemokine Receptor Family

Three ‘atypical’ chemokine receptors, also known as interceptors (internalizing

receptors) have been described, namely DARC (Duffy Antigen Receptor for

Chemokines), D6 and CCX-CKR (ChemoCentryx Chemokine Receptor). These

receptors, despite considerable structural similarity to chemokine receptors, do not signal

in response to chemokine binding. They either lack completely or exhibit an altered

DRY (Asp-Arg-Tyr) motif in the second intracellular loop and therefore cannot couple

with G-proteins to initiate signalling cascades (Comerford et al., 2007).

DARC is expressed on venular endothelial cells, cerebellar neurons and

erythrocytes, acting as a receptor for a variety of CC and CXC pro-inflammatory

chemokines (Pogo and Chaudhuri, 2000). The four extracellular domains of DARC are

18

essential for chemokine binding, but how they are able to bind multiple chemokines is

unclear (de Brevern et al., 2005). The role of DARC during an immune response differs

according to where it is expressed. DARC expression on erythrocytes acts as a

chemokine sink, both neutralizing excess chemokine in the bloodstream and preventing

chemokine diffusion into distant tissues or organs. This was demonstrated in DARC-

deficient mice, where intraperitoneal injection of lipopolysaccharide (LPS) induced

increased numbers of neutrophils in the lungs and livers in DARC-null compared to

wildtype mice (Dawson et al., 2000). The data suggest that in the absence of DARC,

excess inflammatory chemokines are allowed to reach distal sites. In contrast, DARC

expression on venule endothelial cells seems to play an important role in chemokine

transcytosis from the basolateral to the apical side of endothelial cells, as well as their

subsequent presentation to leukocytes (Middleton et al., 1997). Localized chemokine

injections in DARC-deficient mice resulted in diminished neutrophil recruitment

compared to wildtype mice, suggesting that DARC may be important in presenting

inflammatory chemokines to circulating leukocytes (Lee et al., 2003). Taken together,

DARC seems to have two distinct functions in vivo: (1) DARC expressed on erythrocytes

acts as a chemokine sink to limit chemokine circulation to distant tissues and (2) DARC

expression on endothelial cells aid in the transcytosis and presentation of chemokines for

circulating leukocytes, in a similar fashion to GAGs (Pruenster and Rot, 2006).

The D6 receptor binds almost all inflammatory CC chemokines (CCL2, CCL3,

CCL3L1, CCL4, CCL4L1, CCL5, CCL7, CCL8, CCL11, CCL13, CCL14, CCL17 and

CCL22), yet does not mediate chemotaxis or signalling (Hansell et al., 2006). Once

19

bound, the ligand-D6 complex is rapidly internalized and targeted for degradation. Like

other signalling chemokine receptors, D6 is recycled back to the cell surface for

additional ligand binding. In several inflammatory models using D6-deficient mice, it is

clear that D6 is anti-inflammatory, functioning to sequester and eliminate inflammatory

chemokines. In a mouse model of psoriasis, repeated application of phorbol ester to the

skin manifested a prolonged and exaggerated T cell-dependent cutaneous inflammation.

While inflammation was transient in wildtype mice, D6-deficient mice exhibited

exacerbated inflammation with an over-abundance of cutaneous pro-inflammatory CC

chemokines (Jamieson et al., 2005). How D6 is able to internalize bound ligand without

initiating signal transduction is not clear. In fact, D6 seems to be constitutively

phosphorylated on its C-terminal serine residues, but does not require β-arrestin 2

recruitment for internalization and degradation of CCL3 (Weber et al., 2004). Thus, D6

is responsible for the resolution of an inflammatory response by binding in a non-specific

manner to and degrading inflammatory chemokines.

The recently described CCX-CKR binds CCL19, CCL21 and CCL25, yet

mediates neither chemotaxis nor signal transduction (Comerford et al., 2006). CCX-CKR

internalization seems to occur independently of β-arrestin and clathrin-coated pits.

CCL19, CCL21 and CCL25 are critical mediators of lymph node organogenesis,

thymocyte localization during T cell development, and recruitment of mature dendritic

cells, naïve T cells and some memory T cell subsets into T-cell compartments within

secondary lymphoid organs (Campbell et al., 2003; Cyster, 2005; Misslitz et al., 2004;

Muller et al., 2003; Uehara et al., 2002; Ueno et al., 2004). CCX-CKR may actively

20

regulate migratory events within secondary lymphoid tissues to modulate immune

responses.

1.2.3. Receptor Structure

The inherent difficulty in crystallization of chemokine receptors has left the

bovine rhodopsin as the only experimental 3D structure available for any GPCRs

(Palczewski et al., 2000). All chemokine receptors are seven trans-membrane receptors,

with their N-terminus outside the cell, three extracellular and intracellular loops and a C-

terminus that contains multiple serine/threonine and tyrosine phosphorylation residues.

Chemokine receptors have disulphide bridges in their extracellular domains that provide

structure to the overall receptor. Generally, one disulfide bridge connects the N-terminus

to the third extracellular loop (ECL), while the second links the first and second ECL.

Several post-translational modifications are critical for proper chemokine receptor

function. For example, CCR5 is palmitoylated in its C-terminal domain on three cysteine

residues which are critical for intracellular trafficking. CCR5 mutants lacking these

palmitoylation residues are not expressed on the cell surface and remain sequestered in

intracellular biosynthetic compartments (Blanpain et al., 2001). CCR5 is also

glycosylated and tyrosine phosphorylated on its N-terminus. Tyrosine sulfation increases

receptor affinity for the ligand, as well as enhancing the usage of CCR5 by HIV-1 virus

as a cofactor for viral infection. With the exception of decoy receptors, most chemokine

receptors are coupled to the heterotrimeric G-proteins through the conserved DRY motif

in the second intracellular loop (Lagane et al., 2005).

21

1.2.4. Chemokine Ligand Binding Domains

The ligand binding regions of chemokine receptors have been defined through

various mutagenesis studies. The N-terminal domain of several receptors, namely CCR2,

CCR3, CCR5 and CXCR1 is crucial for ligand binding. CCR5 mutants with N-terminal

domain truncations exhibit a progressive decrease in chemokine binding affinity and

functional responsiveness (Blanpain et al., 1999a). Specifically, CCR5 mutants lacking

residues 2-13 exhibited weak responses to CCL4 and CCL5. Charged and aromatic

residues in this region, namely Asp-2, Tyr-3, Tyr-10, Asp-11, and Glu-18, are critical for

ligand binding (Blanpain et al., 1999a). In addition to the N-terminus, extensive

mutagenesis studies by Blanpain and colleagues have identified the extracellular loop

(ECL) 2 as another important ligand binding domain. As mentioned, two disulphide

bonds in the extracellular domains maintain the structure of the receptor helical bundle.

In CCR5, alanine substitution of any of the four extracellular domain cysteine residues,

namely Cys-20, Cys-101, Cys-178 and Cys-269, dramatically reduced receptor cell

surface expression and resulted in mutant receptors unable to bind CCL4 (Blanpain et al.,

1999b). Mutations to Cys-101 or Cys-178, predicted to link ECL1 and ECL2 of CCR5,

abolished recognition by anti-CCR5 antibodies. The epitope for the monoclonal antibody

2D7 that completely blocks CCR5 ligand binding and chemotaxis was mapped to the

second ECL of CCR5 (Wu et al., 1997). Furthermore, ECL2 specific monoclonal

antibodies are more efficient than antibodies against the N-terminus in blocking CCL4

and CCL5 binding (Lee et al., 1999). Taken altogether, disulfide bonds linking the ECLs

are required for maintaining structural integrity necessary for ligand binding and receptor

activation. Thus, two hypothetical interactions are believed to play a role in CCR5

22

activation: the globular body of the chemokine ligand contacts the N-terminus and the

extracellular loops of the receptor to orient the ligand N-terminus among the trans-

membrane helices. Indeed, the core domains of CCL3 and CCL5 bind distinct residues in

CCR5, whereas the N-terminus of these chemokines mediates receptor activation by

interacting with the trans-membrane helix bundle (Blanpain et al., 2003).

The trans-membrane region of CCR5 has also been shown to be important for

ligand binding and/or receptor activation. Mutagenesis of the Thr-X-Pro (TXP) motif in

the second trans-membrane helix of CCR5 resulted in a receptor with abolished

chemokine binding and functional responses (Govaerts et al., 2001). More recently, an

interaction between the arginine of the DRY motif and the cytosolic ends of TM6 was

shown to play a role in the transition from an inactive to active state (Springael et al.,

2007). The data reinforce the notion that trans-membrane regions contain important

structural elements for proper CCR5 ligand binding and subsequent receptor activation.

1.2.5. Receptor Internalization

Ligand-activated chemokine receptors are internalized through clathrin-coated pits

after serine phosphorylation by PKC and G-protein receptor kinases (GRKs) of their C-

terminal domains. CCR5 is phosphorylated on conserved serine residues Ser-336, Ser-

337, Ser-342 and Ser-349 (Oppermann et al., 1999). Specifically, Ser-337 is exclusively

phosphorylated by PKC, whereas Ser-349 represents a GRK phosphorylation site

(Pollok-Kopp et al., 2003). Mutation to any two serine residues abrogated ligand induced

receptor internalization and desensitization (Huttenrauch et al., 2002b). T cells from

23

GRK2+/- mice displayed enhanced CCR5-mediated calcium mobilization and chemotaxis,

indicating that GRKs play an important role in chemokine receptor desensitization

(Vroon et al., 2004). Phosphorylation of the C-terminus leads to the recruitment of β-

arrestins, which are large, multi-functional proteins that block further G-protein coupling

and attenuate additional signalling (Oppermann et al., 1999; Shenoy and Lefkowitz,

2003). Receptor internalization is initiated through β-arrestin binding to the clathrin

heavy chain and the β2-adaptin subunit of the heterotrimeric AP-2 adaptor complex

(Oppermann, 2004). Once internalized, receptors accumulate in peri-nuclear recycling

endosomes and are recycled back to the cell surface in their dephosphorylated form

(Blanpain et al., 1999c; Mueller and Strange, 2004; Pollok-Kopp et al., 2003).

Chemokine-mediated internalization is abolished in mouse embryonic fibroblasts lacking

β-arrestin 1/2, demonstrating that these molecules are critical for receptor internalization

(Fraile-Ramos et al., 2003). Notably, G-protein mediated signalling seems to be

dispensible for CCR5 internalization, as the CCR5 mutant R126N (where Arg-126 of the

DRY motif is replaced by Asn) abolished G-protein activation but there was no effect on

endocytosis in response to ligand (Lagane et al., 2005). Monovalent anti-CCR5

antibodies bound efficiently to CCR5 but did not induce internalization, suggesting that

CCR5 must exist, at a minimum, as a dimer for the internalization process to occur

(discussed in more detail in Section 1.2.6.) (Blanpain et al., 2002). Interestingly, β-

arrestins not only function to prevent further G-protein signalling, but also recruit and

initiate new signals themselves, such as Erk1/2 (Perry and Lefkowitz, 2002).

Additionally, β-arrestin ½ act as scaffolds that connect activated GPCRs with tyrosine

kinases c-Src, PI-3’K and NF-κB pathways (Lefkowitz and Shenoy, 2005).

24

1.2.6. Receptor Homo- and Hetero-Dimerization

Originally thought to function as monomers, it is now widely accepted that

chemokine receptors form functional dimers or even higher order oligomers (Hereld and

Jin, 2008). The emergence of new biophysical techniques, such as BRET

(Bioluminescence Resonance Energy Transfer) and FRET (Fluorescence Resonance

Energy Transfer) have allowed for the monitoring of chemokine receptor interactions in

live cells. These techniques are based on the non-radiative transfer of energy between an

energy donor and an energy acceptor that occurs only when the two are in close

proximity, typically within 100Å (Kroeger and Eidne, 2004). Numerous studies have

demonstrated that chemokine receptors CXCR2, CXCR4, CCR2 and CCR5 homo-

dimerize on the cell surface. CCR5 has been shown to homo-dimerize shortly after

synthesis in the endoplasmic reticulum (Issafras et al., 2002). Consistant with this, CCR5

dimers on the cell surface were observed in the absence of ligand, suggesting that ligand

binding is not a pre-requisite for CCR5 dimerization (El-Asmar et al., 2005; Issafras et al.,

2002). Similarly, CXCR4 dimerization was also found to be independent of ligand

binding (Babcock et al., 2003). Interestingly, co-expression of CCR2b with a mutant

CCR2b, where Tyr-139 in the DRY motif was mutated to phenylalanine (CCR2bY139F),

resulted in a non-functional chemokine receptor in response to CCL2 (Mellado et al.,

1998). The data suggest that CCR2 dimerization is a pre-requisite for its function, and

that CCR2bY139F may act as a dominant negative by associating with intact CCR2 to

form non-functional dimers.

25

Chemokine receptors also form hetero-dimers with other chemokine receptors.

FRET analysis showed that CCR2b and CCR5 were able to form functional hetero-

dimers when co-expressed in cells (El-Asmar et al., 2005; Hernanz-Falcon et al., 2004;

Issafras et al., 2002; Mellado et al., 2001c). Such hetero-dimers are as abundant as

homo-dimers, and are only able to bind a single chemokine ligand of either cognate

receptor at any one time (El-Asmar et al., 2005). In fact, CCL5 efficiently inhibits CCL2

binding only when both CCR5 and CCR2 are co-expressed, again suggesting that the

CCR2b/CCR5 hetero-dimer is responsive to one ligand. Similarly, CXCR4 will hetero-

dimerize with CCR2, but not CCR5 when co-expressed in cells (Babcock et al., 2003;

Percherancier et al., 2005). What remains to be demonstrated is a clear functional

relevance for chemokine receptor dimerization. For example, hetero-dimerization of the

metabotropic receptor GABAB1 with GABAB2 is absolutely required for their cell surface

expression and proper function (Pin et al., 2003). The functional consequence of

CCR2b/CCR5 heterodimers is controversial. Mellado and colleagues first demonstrated

that CCR2b and CCR5 homo- and hetero-dimers activate distinct signal transduction

pathways. Specifically, they showed that both CCR2b and CCR5 homo-dimers triggered

the Jak-Stat pathway and Gαi-mediated activation of PI-3’K in response to their

respective ligands. In the presence of both CCL2 and CCL5, they had a synergistic affect

on the CCR2b/CCR5 hetero-dimers, activating PI-3’K through Gq/11 and lowering the

threshold for calcium mobilization. However, subsequent studies have not been able to

reproduce these findings (El-Asmar et al., 2005; Springael et al., 2005). Additionally,

these results are incompatible with more current data showing that hetero-dimers respond

to only one ligand. Taken altogether, initial excitement over the possibility that different

26

combinations of chemokine receptor hetero-dimers may lead to distinct biological

function is purely speculative, and requires further investigation.

More recently, chemokine receptors have been reported to form hetero-dimers with

receptors belonging to other families. For example, CCR5 and CXCR4 were reported to

interact with opioid receptors, although the physiological relevance remains unclear

(Chen et al., 2004; Pello et al., 2008; Suzuki et al., 2002). Recent studies have

demonstrated that the CXCR4/δ-opioid receptor hetero-dimer completely inhibited

signalling in response to ligands for both receptor (Pello et al., 2008). It is intriguing to

speculate that such dimerization “locks” each receptor in an inactive conformation to

negatively regulate signalling.

27

1.3. Chemokine/Chemokine Receptor Function and the

Immune Response

1.3.1. Chemotaxis

Chemotaxis, or directed cell migration, is a tightly regulated process, critical for

numerous biological processes including proper tissue development, wound healing and

protection against invading pathogens. Chemotaxis requires the activation and re-

distribution of a number of signalling, adhesion and cytoskeletal molecules at the cell

surface. Numerous external stimuli that engage various cell surface receptors and

signalling cascades, can promote cell migration.

1.3.1.1. Cell Polarization

In general, cell migration can be viewed as a cyclical process. First, plasma

membrane receptors for a chemo-attractant bind their cognate ligand(s) and cluster at the

leading edge of the cell, known as the lamellipodium. This leads to the accumulation of

intracellular signalling and lipid molecules at this leading edge, causing the cell to

polarize. Second, there is formation of adhesions that attach the protrusion to the

substratum on which the cell is rolling. These act as traction points for migration,

integrating adhesion molecule signals to control dynamics and protrusion activities. To

complete the cycle, adhesion molecules detach at the back of the cell (termed the

uropodium) coupled with contractions to move the cell body forward (Giannone and

Sheetz, 2006; Hynes, 2002; Nelson and Nusse, 2004). F-actin polymerization is localized

at the lamellipodium, critical for the assembly of cellular protrusions (Cory et al., 2003;

28

Pollard and Borisy, 2003). Not surprisingly, lamellipodia contain numerous actin-

modifying enzymes, namely the Arp2/3 complex, WAVE/Scar and WASp (Myers et al.,

2005; Nozumi et al., 2003; Sukumvanich et al., 2004). In contrast, myosin-II is

assembled at the uropodium and lateral sides of the cell, where it provides rigidity to the

polarized cell through cortical tension. Assembly and contraction of actin:myosin

filaments at the uropodium provides the mechanical force needed to move the cell

forward. Therefore, re-distributing signalling and structural molecules to establish cell

polarity is a crucial initial step during chemotaxis.

1.3.1.2. Activation of the PI-3’K Pathway

PI-3’Kinase and its lipid product phosphatidylinositol-3,4,5 triphosphate

(PI(3,4,5)P3) have been widely implicated in controlling cell migration and polarity. The

PI-3’K family of proteins are defined as lipid kinases that phosphorylate the 3’-OH

position of the inositol ring of phosphoinositides and its derivatives (Vanhaesebroeck et

al., 2001). Members of the family are grouped into four classes (IA, IB, II and III) on the

basis of their structure and substrate specificity. Class IA and IB PI-3’K members are the

best characterized and are primarily responsible for the production of PI(3,4,5)P3 in

response to extracellular stimulation. Class IA PI-3’K generally functions downstream of

receptor tyrosine kinases and exist as a stable hetero-dimer, consisting of one of three

catalytic isoforms (p110α, p110β or p110δ) that associate with any one of the five

regulatory isoforms (p85α, p55β, p50α, p85β or p55γ). Class IB PI-3’K is activated by

the G protein βγ subunit, and consists of a p101/p87 regulatory subunit and a p110γ

catalytic subunit. Class II PI-3’K poorly phosphorylates PI(4,5)P2 and its biological

29

function is not well understood (Falasca and Maffucci, 2007). Class III PI-3K is

homologous to the yeast protein Vps34p and regulates intracellular vesicle trafficking

(Odorizzi et al., 2000). Once activated at the lamellipodium, PI-3’K is largely

responsible for the generation and accumulation of PI(3,4,5)P3 at the leading edge of the

cell. These phospholipids then act as secondary messengers to exclusively recruit

proteins with pleckstrin homology (PH) domains to localize a number of integrated

signalling pathways at the lamellipodium of the migrating cell. Of particular importance

is the PH domain containing Protein Kinase B (PKB, also known as Akt), which is

recruited to the membrane and phosphorylated on Thr-308 by Phosphoinositide-

Dependent Kinase 1 (PDK1). Full PKB activation requires additional phosphorylation on

Ser-473 within the hydrophobic motif, either by mTORC2 or DNA-PKCS (Feng et al.,

2004; Manning and Cantley, 2007). PKB is largely responsible for activation of a wide

range of signalling cascades, many intimately involved in cell cycle progression, cell

survival, metabolism, translation and cell motility (Brazil et al., 2002).

Constitutive PI-3’K activation is associated with tumorigenesis, thus negative

regulation by phosphatases determine critical tumour suppressor proteins. The SH2

domain-containing Inositol Phosphatase (SHIP) has a 5’-phosphoinositide phosphatase

activity which converts PI(3,4,5)P3 to PI(3,4)P2 (Kalesnikoff et al., 2003; Rohrschneider

et al., 2000). Another important phosphatase, the Phosphatase and Tensin Homolog

Deleted in Chromosome Ten (PTEN), hydrolyzes PI(3,4,5)P3 to PI(4,5,)P2 (Stambolic et

al., 1998). These phosphatases are critical suppressors of constitutive PI-3’K activity,

30

also associated with maintaining localized PI-3’K activation at the leading edge of the

migrating cell (discussed below).

The role of PI-3’K in chemokine-mediated cell migration has been well

documented through the use of pharmacological inhibitors such as wortmannin and

Ly294002. Turner and colleagues first demonstrated that CCL5-mediated T cell

chemotaxis and polarization were dependent on PI-3’K activation (Turner et al., 1995b).

Subsequent studies have shown that other chemokines, namely CCL2 and CXCL12,

stimulate wortmannin-sensitive chemotaxis of various cell types (Sotsios et al., 1999;

Turner et al., 1998). It is now clear that localized PI-3’K activation at the lamellipodium

is crucial to establish polarity and maintain chemotactic signalling gradients. Indeed,

GFP-tagged PH domains that selectively bind PI(3,4,5)P3 accumulate at the leading edge

of polarized cells undergoing chemotaxis (Rickert et al., 2000; Servant et al., 2000).

Coincidently, studies have shown that PTEN is largely excluded from the leading edge of

the migrating cell and accumulates at the trailing edge. The net effect is a transient

increase in the level of PIP3 at the lamellipodium. The crucial role of PTEN is

underscored by studies where overexpression or deficiency of PTEN were reported to

reduce or enhance leukocyte motility, respectively (Fox et al., 2002). Presumably, the

lack of PTEN leads to a loss or impairment in directionality, as PIP3 accumulation is less

localized.

In recent years, much of the focus has been on elucidating the role of different PI-

3’K isoforms on chemotaxis, using gene-specific knockout mice and isoform-specific

31

pharmacological inhibitors. The PI-3’Kγ isoform is undoubtedly a key regulator of

chemotaxis, activated downstream of chemokine receptors by the G-protein βγ subunit.

This seems to be the case for neutrophils and macrophages, where p110γ-deficiency leads

to defective chemotaxis towards several chemokines (Hirsch et al., 2000; Li et al., 2000;

Sasaki et al., 2000). However, B cells do not utilize p110γ, but rather use p110δ for

CXCL13-mediated chemotaxis and homing to Peyer’s patches (Reif et al., 2004).

Furthermore, the chemotactic responses of PI3Kγ-deficient T cells towards CXCL12,

CCL19 and CCL21 was not completely abrogated, suggesting that other PI-3’K isoforms

and/or PI-3’K-independent events are required for efficient migration (Reif et al., 2004).

Certainly, studies have shown that the Class IA p85/p110 hetero-dimer contributes to the

signals that determine optimal chemotactic migration towards CCL5 and CXCL12 in T

cells (Curnock et al., 2003; Turner et al., 1995b). In fact, the regulatory subunit p85 co-

immunoprecipitates with CXCR4 after CXCL12 stimulation, although a similar

association with CCR5 has not been shown (Vicente-Manzanares et al., 1999). The

p85/p110 hetero-dimer is known to interact with phosphotyrosine-containing proteins,

while CCL5 has been shown to mediate tyrosine phosphorylation/activation of a number

of effector molecules, including p56 lck, focal adhesion kinase (FAK) and zeta-associated

protein (ZAP-70) (Bacon et al., 1996; Vanhaesebroeck et al., 2001; Wong et al., 2001).

Although speculative, these proteins may be able to couple the p85/p110 hetero-dimer

with activated CCR5.

1.3.1.3. Recruitment of Rho family GTPases

32

The Rho family of small GTPases are key regulators of the actin/myosin

cytoskeleton during chemotaxis, the most well-known members being Rho, Rac and

Cdc42 (Raftopoulou and Hall, 2004). They act as molecular switches by cycling between

GDP-bound, inactive and GTP-bound, active forms. Rho GTPases are intimately

regulated by guanidine nucleotide exchange factors (GEFs) that catalyze the exchange of

GDP for GTP. Many RhoGEFs contain a PH domain, allowing them to accumulate at the

leading edge of the migrating cell in response to phospholipids. Indeed, GFP reporter

studies have demonstrated that both Rac1 and Cdc42 are exclusively recruited to and

activated at the lamellipodium (Itoh et al., 2002; Kraynov et al., 2000; Srinivasan et al.,

2003). Interestingly, Rac1 can stimulate PI-3’K activity, possibly establishing a positive

feedback loop for sustained asymmetrical accumulation of PI(3,4,5)P3 at the leading edge

(Wang et al., 2002). It is now clear that Rac1 and Cdc42 are crucial regulators of F-actin

polymerization directing peripheral lamellipodial and filopodial protrusions, respectively

(Raftopoulou and Hall, 2004). A family of WAVE/Scar and WASp proteins bridge Rac1

and Cdc42 to the Arp2/3 complex, that functions to nucleate actin polymerization and

facilitate branching of actin filaments (Pollard and Borisy, 2003). Specifically, Rac1,

through its binding to IRSp53, regulates WAVE dependent Arp2/3 complex activation

(Miki et al., 2000). Cdc42 directly binds to N-WASP, exposing the domains that activate

the Arp2/3 complex (Suetsugu et al., 1998). These dynamic actin structures at the

leading edge enable cells to form protrusion on the substratum in preparation for

migration. Migrational studies with Rac1 and Rac2 double-deficient hematopoietic cells

and neutrophils revealed that the cells were unable to respond to chemokines because of

defective F-actin polymerization (Gu et al., 2003). In contrast to Rac and Cdc42, Rho

33

seems to accumulate at the rear of the cell, where it regulates the assembly of contractile,

actin:myosin filaments through its effectors Rho kinase (ROCK) and myosin light chain

kinase (MLCK) (Amano et al., 1997; Amano et al., 1996; Ohashi et al., 2000; Sumi et al.,

2001). Therefore, Rho is an important regulator of cell contractions at the uropodium of

the migrating cell. Notably, CCL5 was shown to induce RhoA activation in Jurkat T

cells, although its role in chemotaxis was not investigated (Bacon et al., 1998). A

pharmacological inhibitor of ROCK blocked adhesion and migration of monocytes across

endothelial cells (Honing et al., 2004). There is also evidence that RhoA, acting through

mDia, has a direct positive effect on microtubule stability at the leading edge (Palazzo et

al., 2001). Recent studies have shown that mDia1-deficient T cells exhibit reduced

chemotaxis, negligible actin filament formation and impaired polarity in response to

CXCL12 and CCL21 (Sakata et al., 2007).

1.3.1.4. MAPK Signalling and Cytoskeletal Dynamics

The Mitogen-Activated Protein Kinase (MAPK) pathways that activate Erk, Jnk

and p38 kinases elicit wide-ranging cellular outcomes, including regulating gene

expression, cell proliferation and cell motility (Pullikuth and Catling, 2007). MAPK

signalling cascades comprise a core hierarchy of three kinases, each of which is activated

through phosphorylation by the kinase positioned upstream of it. Thus, the MAPKs are

phosphorylated and activated by the MAPK kinases (MAPKKs), which are themselves

activated by the MAPKK kinases (MAPKKK) (Figure 1.3). Numerous growth factors

and cytokines signal through MAPKs to induce cellular proliferation and the

transcriptional activation of cytokine genes (Pullikuth and Catling, 2007). Given that

34

Figure 1.3 The MAPK Signalling Cascade

35

Raf

Mek1/2

Erk1/2

Mekk1

Mek4/7

Jnk1/2

Tak

Mek3/6

p38

MAPKKK

MAPKK

MAPK

Biological Response

Mekk1-4, Tak1-3, Tao1-3, Ask1-2, Tpl2, Mlk3

36

chemokines are potent inducers of cytokines and proliferation, it is not surprising that

chemokines can activate multiple MAPK signalling cascades. For example, ligands for

CCR5 have been demonstrated to activate Erk, Jnk and p38 signalling pathways (Brill et

al., 2001; Ganju et al., 1998; Kraft et al., 2001; Misse et al., 2001; Wong et al., 2001)

Similarly, CXCL12 has been shown to induce Erk1/2 phosphorylation, leading to

increased astrocyte proliferation (Bajetto et al., 2001). Several studies have demonstrated

a specific contribution of MAPKs to cellular motility through the regulation of expression

of focal adhesions. Active Erk localizes to adhesions at the uropodium and facilitates

their disassembly to promote motility (Suetsugu et al., 2006; Webb et al., 2004).

Although a specific mechanism has not been described, sustained Erk phosphorylation

appears important in the down-regulation of Rho-dependent stress fibre formation (Sahai

et al., 2001). Disassembly of adhesions by MAPKs at the rear of the cell allows for the

migrating cell to push forward. Thus, MAPKs may play an unexpected role in

chemotaxis by regulating cytoskeletal dynamics in addition to their well described

functions as regulators of cell proliferation and cytokine production.

1.3.2. Role in Cell Death and Survival

Accumulating evidence has shown that chemokines invoke both apoptotic and

anti-apoptotic events in a wide range of cell types. Whether a chemokine protects from

or induces cell death depends on the chemokine, its concentration and/or the target cell.

One possible role for chemokine-mediated apoptosis is the resolution of an immune

response. Activation induced cell death (AICD) of T cells is an important mechanism of

clonal deletion after an immune response. Death receptors, especially Fas/FasL

37

(CD95/CD95L) interactions have been described as important inducers of AICD in T

cells, although different effectors, including c-Myc and TRAIL, have also been described

(Green et al., 2003; Ju et al., 1995). Several reports have demonstrated that chemokines

can potentiate T cell death. CXCL12 induces apoptosis of Jurkat T cells through a

Fas/FasL dependent mechanism after 3 days in culture (Colamussi et al., 2001).

Similarly, XCL1 can co-stimulate the apoptosis of CD4+ T cells triggered through the

CD3/TCR. This apoptosis is also dependent on Fas/FasL signalling, leading to caspase-9,

caspase-7 and PARP cleavage (Cerdan et al., 2001). These studies indicate that

chemokines may determine T cell fate during an immunological response, in addition to

AICD. Mellado and colleagues reported that melanoma tumour cell-derived CCL5

induced apoptosis of tumour infiltrating T lymphocytes (TILs) as a potential immune

escape mechanism in melanoma progression. T cell apoptosis was CCR5-dependent, and

mediated by cytochrome c release, caspase-9 and caspase-3 activation (Mellado et al.,

2001a). CCL5-CCR5 mediated caspase-3 activation and cell death were also reported in

neuroblastoma cells, and there is also evidence that the HIV-1 envelope-mediated

apoptosis of bystander uninfected CD4+ T cells, which leads to T cell depletion in

infected individuals, is CCR5-dependent (Algeciras-Schimnich et al., 2002; Yao et al.,

2001). CCR5 deficiency may predispose individuals to the development of fulminant

liver failure (FLF), by preventing hepatic NKT cell apoptosis (Ajuebor et al., 2005).

Work from our laboratory has demonstrated that CCL5-CCR5 interactions induce T cell

death (Murooka et al., 2006) (Chapter 2). Specifically, we showed that CCL5

aggregation at high ligand concentrations induces apoptosis in PM1, MOLT-4 and

activated peripheral blood T cells in a CCR5-dependent manner. When T cells are

38

subjected to µM concentration of CCL5, cells undergo apoptosis through cytosolic

release of the mitochondrial pro-apoptotic factors cytochrome c, caspase-9 and caspase-3,

followed by poly ADP ribose polymerase (PARP) cleavage. We showed that CCL5-

mediated cell death is independent of G-proteins, but rather dependent on tyrosine

kinases initiated through the Tyr-339 residue found on the C-teriminus of CCR5. Finally,

we showed that CCL5-GAG interactions and CCL5 oligomerization are important pre-

requisites to initiate a cascade of events resulting in T cell death. Taken together, our

data suggest that CCL5-induced cell death, in addition to CD95/CD95L mediated events,

may contribute to clonal deletion of T cells during an immunological response.

By contrast, there is evidence that chemokines have anti-apoptotic properties.

CCL3, CCL4 and CCL5, either individually or in combination, will reduce anti-CD3-

induced apoptosis of T cell blasts. These chemokines do not affect CD3 or Fas cell

surface expression levels, suggesting that they reduce AICD downstream of Fas (Pinto et

al., 2000). Interestingly, Tyner and colleagues have reported that virus-inducible CCL5 is

required to prevent apoptosis of virus-infected mouse macrophages in vivo. The

protective effects of CCL5 are dependent on CCR5 and activation of the PI-3’K/Akt and

Mek/Erk signalling pathways (Tyner et al., 2005). Although apparently contradicting our

data (Murooka et al, 2006), the cell lineage studied (macrophages vs T cells) and the

lower dose of CCL5 employed may explain these different observations. CCL1 activation

of CCR8 protected murine thymic lymphomas against corticoid- and dexamethasone-

induced apoptosis, possibly through Erk1/2 phosphorylation (Louahed et al., 2003;

Spinetti et al., 2003). Viewed altogether, conflicting data in regard to the pro- or anti-

39

apoptotic properties of several chemokines reflect the need for further studies. The

ability of chemokines to determine cell fate is a consequence of a number of important

factors, such as the nature of the chemokine, whether it exhibits aggregation and GAG-

binding, the chemokine dose effect, the nature of the specific cognate receptor, and the

lineage of the target cell. These factors are particularly important when considering

chemokine antagonists as possible therapeutics. The anti-apoptotic and survival effects

of chemokines are further discussed in Section 1.4.2.2.

1.3.3. T cell Co-stimulation

Distinct from their chemotactic properties, a number of chemokines have been

shown to co-stimulate T cell activation. For example, CXCL12 can co-stimulate anti-

CD3 stimulation of CD4+ T cells in the context of proliferation and IL-2, IFNγ, IL-4 and

IL-10 production. CXCL12 treatment alone did not have the same effect, suggesting that

the chemokine functions as a co-stimulator for T cells (Nanki and Lipsky, 2000). Such

co-stimulation was PTx-sensitive, but not altered by anti-CD25 antibodies, indicating the

dependence on G-protein, but not IL-2, mediated signalling (Nanki and Lipsky, 2001).

Furthermore, CXCL12 stimulated the physical association between CXCR4 and the TCR

to initiate signalling through ZAP-70 (Kumar et al., 2006). CCL5 is also a T cell co-

stimulatory molecule in the context of CD3 stimulation (Makino et al., 2002; Taub et al.,

1996). Studies in CCL5 deficient mice showed impaired T cell proliferation and cytokine

production in response to antigen or anti-CD3 stimulation (Makino et al., 2002). Anti-

CD3 stimulation of T cells, together with nM concentrations of CCL5, result in increased

proliferation and cytokine production, dependent on IL-2 and extracellular calcium (Taub

40

et al., 1996). In the same study, CCL3, CCL4 and CCL5 all induced expression of B7.1

in antigen presenting cells (APCs), suggesting an additional mechanism to modulate T

cell activation. In Jurkat T cells, Dairaghi and colleagues showed that T cell responses to

CCL5 are dependent on the level of CD3 cell surface expression (Dairaghi et al., 1998).

Interestingly, CCR5 constitutively co-localizes with CD4 on the cell surface (Xiao et al.,

1999). Furthermore, at higher, µM concentrations, CCL5 stimulated antigen-independent

activation of T cells in the context of increased proliferation, CD25 expression and

cytokine production. This unexpected property of CCL5 demonstrated that high doses of

CCL5 can bypass T cell receptor recognition of antigen to activate T cells (Bacon et al.,

1995; Dairaghi et al., 1998). Since these initial observations, it is now apparent that at

these µM concentrations, CCL5 forms large oligomers with a mass greater than 100 kDa

(Appay et al., 1999; Appay et al., 2000). CCL5 variants with a Glu-26 to alanine

mutation (E26A-CCL5), or a Glu-66 to serine mutation (E66S-CCL5) were unable to

form higher order aggregates at µM concentrations (Appay et al., 1999; Czaplewski et al.,

1999). These mutants are unable to activate T cells, demonstrating that the aggregating

properties of CCL5 are important for T cell activation (Appay et al., 1999; Appay et al.,

2000). Notably, the non-aggregating mutants retain their ability to signal via classical G-

protein dependent pathways in vitro. Whether high CCL5 concentrations are attainable in

vivo is unclear. Certainly, unusually high CCL5 concentrations may be realizable at site

of acute infection or inflammation through the sequestration of CCL5 by cell surface

and/or extracellular matrix GAGs. In addition, the unique ability of CCL5 to form higher

order aggregates, facilitated through GAG-binding, may also lead to an increase in local

CCL5 concentration (Appay et al., 1999; Appay et al., 2000; Czaplewski et al., 1999;

41

Hoogewerf et al., 1997; Kuschert et al., 1999; Martin et al., 2001; Proudfoot et al., 2001;

Proudfoot et al., 2003).

1.3.4. The mTOR/4E-BP1 Pathway and Chemotaxis

Regulation of protein synthesis in eukaryotes plays a critical in development,

differentiation, cell cycle progression, cell growth and apoptosis. Not surprisingly,

protein synthesis is regulated by both transcriptional and translational processes. One

highly regulated process is mRNA translation, (Proud, 2007). Once mRNAs are

transcribed, processed and exported into the cytoplasm, they are available for translation

through two principle pathways. The first involves the binding of translation initiation

factors (eIFs) to the 7-methyl guanosine residue (m7GpppN, where m is a methyl group

and N is any nucleotide) that caps the 5’ end of all nuclear-encoded eukaryotic mRNAs,

termed cap-dependent translation. Specifically, the interaction of the cap structure with

eIF4E, via the ribosomal-subunit-associated eIF4G, directs the translational machinery to

the 5’end of the mRNA (Richter and Sonenberg, 2005). A second pathway uses complex

secondary structure elements in the mRNA, called Internal Ribosomal Entry Segments

(IRES), to recruit small ribosomal subunits, independently of the cap structure, referred to

as cap-independent translation (Jackson, 2005). Because the vast majority of eukaryotic

mRNAs are translated in a cap-dependent manner, eIF4E represents the rate-limiting step

for translation, and is subject to exquisite regulation.

The embryonic lethality of mTOR-deficient mice demonstrates the importance of

mTOR during development (Gangloff et al., 2004; Martin and Sutherland, 2001). mTOR

42

possesses a carboxy-terminal region sharing significant homology with lipid kinases,

especially with PI-3’K, and has been assigned to a larger protein family termed the

PIKKs (Phosphoinositide Kinase-related Kinase) (Gingras et al., 2004). The anti-fungal

macrolide, rapamycin, is a potent immuno-suppressive agent with additionl potent anti-

proliferative properties. In the early 1990s, rapamycin was shown to bind to a small

protein receptor called FKBP12 (FK506-binding protein 12kDa), and the complex

specifically interacted with mTOR to inhibit its function (Sabatini et al., 1994; Sabers et

al., 1995). However, there is controversy whether rapamycin directly inhibits the intrinsic

kinase activity of mTOR by blocking autophosphorylation or whether it prevents mTOR

from interacting with its substrates (Edinger et al., 2003b; Peterson et al., 2000). mTOR

exists in two complexes: mTOR Complex1 (mTORC1), which is sensitive to rapamycin

and phosphorylates p70 S6K1 and initiation factor 4E binding proteins (4E-BPs), and

mTOR Complex2 (mTORC2), which is rapamycin-resistant and phosphorylates PKB

(Dann et al., 2007; Gingras et al., 1998; Hay and Sonenberg, 2004). mTORC1 is a

complex containing mTOR, Raptor (Regulatory Associated Protein of mTOR) and

mLST8, while the mTORC2 complex consists of mTOR, Rictor (Rapamycin-Insensitive

Companion of mTOR), Sin1 and mLST8 (Jacinto et al., 2004; Kim et al., 2002). Given

the importance of mTOR in development and protein translation, its activation is under

exquisite control by several molecules. The major upstream positive regulator is the

small GTPase, Rheb (Ras-Homolog Enriched in Brain) (Saucedo et al., 2003). Similar to

other GTPases, GTP-bound Rheb, but not GDP-bound, is active and stimulates mTOR

kinase activity (Long et al., 2005). Rheb activity is negatively regulated by the

mammalian TSC1/2 (Tuberous Sclerosis Complex 1/2), by increasing the intrinsic GTP

43

hydrolysis of Rheb (Inoki et al., 2003). Thus, TSC1/2 is a potent negative regulator of

mTOR by inactivating Rheb activity. It is now clear that TSC1/2 represent tumour

suppressor proteins, where mutation to either one is sufficient to cause TSC tumor

formation in a number of target organs (Yang and Guan, 2007). TSC1 and TSC2 form a

physical and functional complex, where TSC1 stabilizes the complex and TSC2 exerts

GTPase activating protein (GAP) activity. Thus, mutations in the TSC1/2 complex lead

to a hyperactive mTOR, leading to uncontrolled tumour formation (Gao et al., 2002).

Upstream of TSC1/2 is PKB, an important survival kinase with a wide array of effector

molecules. PKB has been shown to phosphorylate TSC2 directly on multiple sites to

inhibit its function (Inoki et al., 2002). Given that PI-3’K is largely responsible for the

recruitment and activation of PKB, as described earlier, it is now well established that PI-

3’K is responsible for indirectly activating mTOR activity (Figure 1.4). Another

important modulator of mTOR activity is phospholipase D (PLD)-dependent generation

of phosphatidic acid (PA). Several studies reported that PA was required for mTOR-

dependent S6K activation and 4E-BP1 phosphorylation in several cell types (Fang et al.,

2001; Foster, 2007; Hornberger et al., 2006). Interestingly, PA seems to compete for

mTOR binding with the rapamycin/FKBP12 complex, thereby modulating mTOR

activity (Fang et al., 2001).

A wide range of factors, including hormones, growth factors, mitogens and amino

acids, can initiate protein translation. eIF4E availability represents the rate-limiting step

for cap-dependent translation and thus act as the node of convergence for a number of

upstream signalling events. Three eIF4E inhibitory proteins, the 4E-BPs (4E-BP1-3, also

44

Figure 1.4 Regulation of cap-dependent mRNA translation The PI-3’K/PKB/mTOR pathway is activated by growth factors, hormones, mitogens, cytokines and chemokines. Nutrients (amino acids, glucose) also activate mTOR. The AMP-activated protein kinase (AMPK) also phosphorylates and enhances the activity of TSC2 under energy starvation. Activation of Ras/Raf/Mek/Erk pathways leads to Mnk activation. Mnk phosphorylates eIF4E within the eIF4F complex to regulate its binding affinity for the 5’-cap structure of mRNAs.

45

Mnk

PTEN

PI-3’K

Rheb-GTP

PIP2 PIP3

TSC1/2

eIF4B

4E-BP1

Cap-dependent translation (e.g., cyclin D1, VEGF, c-Myc)

Ras

S6K1

PKB

eIF4E

PDK1

mTOR

AMPK

Erk

Energy starvation

Raf

Mek

Growth factors, hormones, mitogens, cytokines, chemokines

*

* Positive feedback loop by rapamycin-resistant mTORC2

5’-TOP mRNA translation (e.g., ribosomal proteins)

46

known as PHAS-1-3 for Phosphorylated Heat and Acid Soluble protein stimulated by

Insulin), regulate mRNA translation by sequestering eIF4E. They constitute a family of

proteins that compete with eIF4G for an overlapping binding site on eIF4E. Indeed,

through X-ray crystallographic analysis, peptides derived from the regions of eIF4G and

4E-BP1 form nearly identical α-helical structures that lie along the same convex region of

eIF4E (Marcotrigiano et al., 1997; Matsuo et al., 1997). Notably, the eIF4G and 4E-BP1

binding sites on eIF4E do not overlap the cap binding sites. By sequestering eIF4E, 4E-

BPs are negative regulators of mRNA translation that requires high levels of available

eIF4E. Binding of the 4E-BPs to eIF4E is regulated by phosphorylation (Pause et al.,

1994). Hypo-phosphorylated 4E-BPs efficiently bind eIF4E, but once hyper-

phosphorylated on specific serine and threonine residues, this interaction is abrogated.

The number of phosphorylation sites is controversial, but the most critical sites for eIF4E

release are located on Thr-37, Thr-46, Ser-65, and Thr-70 (Hay and Sonenberg, 2004). In

fact, phosphorylation seems to proceed in a hierarchical manner. The Thr-37/46 residues

represent the priming sites, and are phosphorylated by mTOR in vitro (Brunn et al., 1997;

Burnett et al., 1998). Phosphorylation at these priming sites is critical for subsequent

phosphorylation on Thr-70, followed by Thr-65, ultimately leading to the release of 4E-

BP1 from eIF4E (Hay and Sonenberg, 2004). X-ray crystallography studies have

revealed that these residues on 4E-BP1 are all in close proximity to acidic amino acid

residues in eIF4E when in a complex. Therefore, accumulation of negatively charged

phosphate groups would likely lead to electrostatic repulsion of the acidic residues, to

mediate release of 4E-BP1 from eIF4E (Gross et al., 2003). Additionally, mTOR

controls the translation of 5’-TOP (tract of oligopyrimidines) mRNAs which often encode

47

for cytoplasmic ribosomal proteins (Meyuhas, 2000; Ruvinsky and Meyuhas, 2006).

Although 5’-TOP mRNA translation is sensitive to rapamycin, the mechanism of action

is unclear and studies have shown that S6K1 and its effector molecule rpS6 are

dispensable for their translation (Ruvinsky et al., 2005). Taken together, mTOR is a

critical regulator of the translational machinery by: (1) directly influencing eIF4E

availability for 5’-capped mRNA translation initiation and (2) up-regulating ribosomal

protein levels through modulation of 5’-TOP mRNA translation.

By regulating eIF4E availability, the assembly of the mRNA translation

machinery is greatly affected, thereby resulting in changes in the rate of protein

translation. The mRNA 5’-cap structure is bound by eIF4F, a hetero-trimeric protein

complex comprised of a large, scaffold protein eIF4G, the RNA helicase eIF4A and the

cap-binding eIF4E (Figure 1.5). eIF4G also associates with eIF3, a multi-subunit,

ribosome-associated initiation factor, to bridge the mRNA to the 40S ribosomal subunit.

The 40S ribosomal subunit is bound to eIF2, GTP and the initiator methionine-transfer

RNA (Met-tRNA), and the entire complex is termed the 43S pre-initiation complex

(Proud, 2007). In addition, the N-terminus of eIF4G binds the poly(A) binding protein

(PABP), leading to the circularization of the mRNA via the cap-eIF4F-poly(A) tail bridge,

which enhances mRNA translation. Optimal binding and passage along the 5’-UTR

towards the initiation codon by the translation initiation complex is often hindered by

long, complex secondary structures that are found in the 5’-UTR of some mRNAs

(Richter and Sonenberg, 2005). The helicase function of eIF4A is enhanced by eIF4B,

and is critical for unwinding the inhibitory secondary structures present in the 5’UTR.

48

Figure 1.5 eIF4F formation and ribosome recruitment Hypo-phosphorylated 4E-BP1 binds to and sequesters eIF4E. (B) Once phosphorylated, 4E-BP1 dissociates from eIF4E, allowing eIF4E to be incorporated into the eIF4F complex. (C) Through eIF4E, eIF4F binds to the mRNA 5’-cap structure. (D) The helicase activity of eIF4E (along with eIF4B) unwinds secondary structure within the 5’-UTR of the mRNA. (E) The resulting single stranded mRNA is further bound by the 43S pre-initiation complex via eIF3 that bridges the 40S ribosomal subunit with eIF4G. The complex scans the 5’-UTR towards the start codon. eIF4G also interacts with PABP1 to circularize the mRNA.

49

AUG

AUG

AUG

eIF4F complex

eIF4G eIF4A

4E-BP1

P ADP

ATP Pi

capAUG

mRNA

eIF4E

eIF3

eIF1A

40S

eIF2 +

GTP +

Met-tRNA

+

43S pre-initiation complex

ADP + Pi

ATPmRNA unwinding

A B

capAUG

eIF4B

C

D

E

(A)n PABP

50

Once the 43S pre-initiation complex is bound to mRNA, it is thought to scan the mRNA

in the 5’ to 3’ direction (Proud, 2007). When it encounters an AUG start codon in the

proper sequence context, other factors, including the 60S ribosomal subunit, are recruited

in order for protein synthesis to begin.

Two mRNA transcripts may be translated at very different rates, depending on the

length and structure of their 5’-UTRs. As mentioned earlier, the helicase activity of the

eIF4F translation initiation complex is crucial for unwinding inhibitory structures within

the 5’-UTR. Those mRNAs that are well translated when eIF4E availability is low are

termed “strong” mRNAs, and have relatively short, unstructured 5’-UTRs (e.g. β-actin,

GAPDH). Translation of “weak” mRNAs are most sensitive to alterations in eIF4F

levels, and typically encode for proliferative and survival proteins (e.g. c-Myc, vascular

endothelial growth factor (VEGF), bcl-2) (Armengol et al., 2007; Graff and Zimmer,

2003). This ensures that proliferation and survival proteins are preferentially synthesized

only during optimal growth conditions.

Several published reports suggest a role for both mTOR and p70 S6K1 in cellular

migration. GM-CSF-mediated neutrophil chemotaxis is inhibited by rapamycin, and the

extent of S6K1 phosphorylation correlates with migration (Gomez-Cambronero, 2003;

Lehman and Gomez-Cambronero, 2002). Fibronectin-induced migration of human

arterial E47 smooth muscle cells is sensitive to rapamycin (Sakakibara et al., 2005).

Several chemokines have been reported to activate S6K1, but this activation was studied

in the context of cell survival and proliferation, not migration (Hwang et al., 2003; Joo et

51

al., 2004; Lee et al., 2002; Loberg et al., 2006). As mentioned previously, a G protein-

coupled receptor encoded by KSHV exhibits constitutive activation of the TSC2/mTOR

pathway to promote Kaposi’s sarcomagenesis (Montaner, 2007; Sodhi et al., 2006).

However, the specific role for mTOR-dependent protein translation in T cell chemotaxis

is unclear. Recently, we demonstrated that rapamycin significantly reduced CCL5-

mediated T cell chemotaxis in vitro (Murooka et al., 2008). CCL5 induced rapid

phosphorylation/activation of mTOR, p70 S6K1 and ribosomal protein S6. Additionally,

CCL5 induced PI-3’K-, phospholipase D and mTOR-dependent

phosphorylation/deactivation of the transcriptional repressor 4E-BP1, which resulted in

its dissociation from eIF4E. Subsequently, eIF4E associated with the scaffold protein

eIF4G, forming the eIF4F translation initiation complex. Indeed, CCL5 initiated active

translation of mRNA, shown by the increased presence of high-molecular-weight

polysomes which were significantly reduced by rapamycin treatment. Notably, CCL5

induced protein translation of cyclin D1 and MMP-9, known mediators of migration. Our

data describe a mechanism by which CCL5 directly regulates translation of chemokine-

related mRNAs to “prime” CD4+ T cells for efficient chemotaxis.

52

1.4. Chemokine/Chemokine Receptors and Disease

1.4.1. Rheumatoid Arthritis

The influx of IFNγ-secreting CD4+, CD8+ effector T cells and activated

macrophages into tissues is characteristic of Th1-type inflammatory diseases, including

rheumatoid arthritis (Loetscher et al., 1998; Qin et al., 1998). RA is a chronic

inflammatory disease that affects synovial tissue in multiple joints. Such chronic

inflammation leads to severe morbidity and progressive structural damage to the joints.

While genetic associations between RA and variants of the human leukocyte antigens

(HLA) are well established, other genes also play important roles in RA susceptibility,

including chemokine/chemokine receptors (Jawaheer et al., 2002). RA is characterized

by extensive infiltration of activated T cells, B cells and macrophages into affected joints,

leading to the expansion of the synovial tissue. Inflammatory chemokines are critical for

actively recruiting leukocytes into inflamed synovial joints. Indeed, analysis of synovial

tissue and synovial fluid from patients with RA, revealed abundant expression of a wide

range of inflammatory chemokines and their receptors (Haringman et al., 2004; Hosaka et

al., 1994; Wong et al., 2003). RA synovial fibroblasts produce chemokines CCL2, CCL3,

CCL4 and CCL5 in response to TNFα, IL-1α and IL1β (Hosaka et al., 1994; Luster,

1998). In turn, these inflammatory chemokines promote leukocyte recruitment to the

joints and stimulate cells to release additional inflammatory mediators. For example,

stimulation of fibroblast-like synoviocytes from RA patients with CCL2, CCL5 or

CXCL12 resulted in enhanced IL-6 and IL-8 production (Nanki and Lipsky, 2001). Thus,

accumulating evidence implicates inflammatory chemokines in RA disease progression,

53

both through recruitment of activated leukocyte and direct modulation of cytokine

production in the affected joints.

Animal models for RA have been used extensively to examine the role of

chemokine/chemokine receptors in disease pathogenesis. Such models of disease are also

critical to evaluate the therapeutic potential of chemokine antagonists. Chemokine

expression profiles in affected tissues are comparable between human and rodent models

of RA. High levels of CCL3 and CCL5 in synovial fluid are present early and in later

stages of disease in both human patients and murine collagen-induced arthritic mice

(Rathanaswami et al., 1993; Robinson et al., 1995; Thornton et al., 1999).

Correspondingly, there is a selective accumulation of CCR5 and CXCR3 positive T cells

in the synovial joints (Suzuki et al., 1999). Indeed, upregulation of CCR1, CCR2 and

CCR5 mRNA levels coincide with peak inflammation in the joints of rat adjuvant-

induced arthritic mice (Shahrara et al., 2003). The data suggest that CCR5 is one of

several critical chemokine receptors that influence RA disease pathogenesis. The

implications are that individuals with altered/reduced CCR5 expression exhibit less

severe and/or slower progression of RA. To this end, several studies have focused on

cohorts of RA patients that are homozygous for the CCR5Δ32 allele, a non-functional

CCR5 receptor. Indeed, meta-analysis of five published case-control association studies

confirmed the negative association between CCR5Δ32 and RA, indicating that CCR5Δ32

is protective against the development of RA (Prahalad, 2006). Furthermore, the analysis

showed that CCR5Δ32 homozygosity conferred a much greater protective effect than

CCR5Δ32 heterozygosity, suggesting a gene dosage effect. It is important to note that

54

this analysis took into account published studies conducted in populations of European

ancestry, where the CCR5Δ32 allelic frequency is approximately 5-10% (Cooke et al.,

1998; Garred et al., 1998; Gomez-Reino et al., 1999; Pokorny et al., 2005; Samson et al.,

1996; Zapico et al., 2000). Whether these results are relevant for different ethnic groups

is unclear (John et al., 2003; Zuniga et al., 2003). Nevertheless, the data suggest the

possibility that CCR5 blockade may have therapeutic potential in selected cohorts of RA

patients.

The strategy to block chemokine/chemokine receptors as a therapy for RA is not

new, yet there are no clinical applications of this approach approved or in the clinic to

date. There is accumulating evidence in rodents that targeting the chemokine system can

dampen arthritic inflammation. Notably, targeting CCL2 or its receptor CCR2 in mice

significantly reduced joint destruction by limiting macrophage infiltration (Gong et al.,

1997; Ogata et al., 1997). In a rat adjuvant model of arthritis, administration of CCL5

neutralizing antibodies resulted in clinical improvement and reduced cellular infiltration

and subsequent reductions in joint damage (Barnes et al., 1998). Similarly, a non-peptide

CCR5 antagonist TAK-779 significantly reduced both incidence and severity of collagen-

induced arthritis in mice by reducing T cell migration (Yang et al., 2002). The

chemotaxis of monocytes towards patient synovial fluid was significantly reduced with

anti-CCL5 antibodies (Volin et al., 1998). Finally, a non-competitive allosteric inhibitor

of CXCR1 and CXCR2 significantly ameliorated adjuvant-induced arthritis in rats

(Barsante et al., 2008). Taken altogether, antagonists for various chemokine receptors,

that reduce leukocyte migration to affected tissues and dampen cytokine production in the

55

joints, may prove to be effective in RA. Currently, a fully humanized monoclonal

antibody against CCR2 is in Phase II clinical trial for RA by Millennium Pharmaceuticals

Inc.

1.4.2. Cancer

Many cancers can be characterized by abnormal chemokine production or

aberrant expression of and signalling by chemokine receptors. Through their interaction

with chemokine receptors on target cells, tumor-associated chemokines can promote

tumor growth directly, by mediating the influx of leukocytes to the tumor

microenvironment and stimulating the release of growth factors, or indirectly, by

initiating angiogenesis. To date, chemokines and their receptors have been implicated in

all steps of tumorigenesis, including the control of leukocyte infiltration into tumors,

initiation of primary tumor growth and survival, regulation of angiogenesis, and the

control of tumor cell adhesion, invasion and migration (Figure 1.6) (Murooka et al.,

2005). Understanding the complex role chemokines play at each stage of tumorigenesis

will assist with defining potential therapeutic strategies.

1.4.2.1. Chemokines influence Leukocyte Tumour Infiltration

Infiltrating leukocytes are found in most solid tumors, comprising

monocytes/macrophages, T cells, dendritic cells, and mast cells. The influx of immune

cells into solid tumors was initially believed to reflect an anti-tumor immune response.

However, there is increasing evidence that tumor-derived chemokines attract leukocytes

to the tumor microenvironment, thereby promoting tumor growth, angiogenesis and

56

Figure 1.6 Chemokines and Cancer The roles of chemokines and their receptors in various steps of tumorgenesis, namely leukocyte infiltration into tumors, initiation of primary tumor growth and survival, regulation of angiogenesis, and the control of tumor cell adhesion, invasion and migration, are shown.

57

Murooka, TT, Ward, SE and Fish, EN. Cancer Treat Res 126 (2005)

1 – Neoplastic Transformation

2 – Leukocyte Infiltration

3 – Tumor Cell Growth

4 - Angiogenesis

5 - Metastasis

6 – Organ Homing

Abnormal chemokine and chemokine receptor

expression in transformed cells up-regulate growth and

survival factor

Tumor-derived chemokines attract

circulating leukocytes, infiltrating the tumor

mass

Tumor-associated chemokines function

as growth and survival factors for

tumor cells through a autocrine and/or paracrine loop

Tumor-produced chemokines stimulate angiogenesis, causing neighbouring blood

vessels to grow into the tumor

Aberrant chemokine receptor expression

causes active migration of tumor

cells out into the vasculature

Expression of chemokine receptors on tumor cells allows

for specific organ homing

58

metastasis. Tumor associated macrophages (TAMs) have pro-tumor functions by virtue

of their release of growth factors, such as epidermal growth factor (EGF), and their

production of angiogenic mediators, including VEGF and basic fibroblast growth factor

(bFGF) (Mantovani et al., 1992). TAMs are also a source of IL-10 and prostaglandin E2

(PGE2), two potent immuno-modulating agents contributing to the general immuno-

suppression of the host (Chouaib et al., 1997).

Over two decades ago, Bottazzi and colleagues showed that CCL2 is expressed

and secreted by most tumor cell lines (Bottazzi et al., 1990; Bottazzi et al., 1983).

Specific monocyte/macrophage recruitment has been linked to local production of CCL2

by tumors and stromal cells, and is implicated in breast, ovarian, bladder, and lung cancer

(Bottazzi et al., 1990; Bottazzi et al., 1983; Frederick and Clayman, 2001; Silzle et al.,

2003). CCL2 production was also detected in tumor-infiltrating macrophages, indicating

the existence of an amplification loop for their recruitment. Correlative studies in breast

cancer patients showed that CCL2 expression levels are directly proportional to TAM

accumulation (Saji et al., 2001; Ueno et al., 2000). These studies also identified a

significant correlation between CCL2 levels and several potent angiogenic factors,

namely VEGF, thymidine phosphorylase (TP) and CXCL-8. Other studies have

demonstrated a pivotal role for tumor-derived CCL5 in leukocyte infiltration. CCL5 was

highly expressed in high grade breast tumors, while breast tumor cell lines express

functional CCL5 in culture that induces monocyte migration in vitro (Adler et al., 2003;

Azenshtein et al., 2002; Luboshits et al., 1999; Robinson et al., 2003; Saji et al., 2001).

Subsequent studies by Robinson and colleagues demonstrated the pro-neoplastic role of

59

CCL5 using a murine model of breast cancer. Administration of the CCR1/CCR5

antagonist, Met-CCL5, significantly reduced the extent of macrophage infiltration within

tumors, which correlated with reduced tumor burden (Robinson et al., 2003). Similar

conclusions can be drawn from studies where mammary carcinoma cells expressing

lower levels of CCL5 exhibit a decrease in tumor growth in vivo (Adler et al., 2003).

Following the recruitment of TAMs, both CCL2 and CCL5 also stimulate the release of

tumor-promoting factors by TAMs, namely MMP-9 and TNF-α (Azenshtein et al., 2002;

Robinson et al., 2002; Saji et al., 2001). Viewed altogether, chemokines are important

for the recruitment of tumor-promoting inflammatory cells into the tumor site, considered

critical in the initial stages of tumorgenesis.

1.4.2.2. Chemokines and Tumour Growth

Chemokines act as growth and survival factors for various tumors, generally in an

autocrine manner. CXCL12/CXCR4 signalling is the most well-studied chemokine

signalling axis that has direct pro-tumor growth effects on tumor cells. Upregulation of

CXCR4 is prevalent in various cancers, including colon carcinoma, lymphoma, breast

cancer, glioblastoma, leukemia, multiple myeloma, prostate cancer, oral squamous cell

carcinoma and pancreatic cancer (Chan et al., 2003; Floridi et al., 2003; Koshiba et al.,

2000; Moller et al., 2003; Sehgal et al., 1998a; Sehgal et al., 1998b; Sun et al., 2003;

Uchida et al., 2003; Zeelenberg et al., 2003). CXCL12 increases DNA synthesis and

proliferation of primary pre-B ALL, meningioma and adenoma cells, in an Erk1/2-

dependent manner (Barbieri et al., 2006; Florio et al., 2006; Mowafi et al., 2008).

Similarly, increased CXCL12/CXCR4 mediated proliferation in both human glioblastoma

60

and neuroepithelioma cell lines correlated with Erk1/2 and PKB activation (Barbero et al.,

2003; Barretina et al., 2003). Interestingly, a C-terminal domain-truncated CXCR4

exhibited a gain-of-function phenotype, leading to increased proliferation, motility and

loss of cell-to-cell contact (Ueda et al., 2006). The contributions of CCL5 and CCR5 in

the pathogenesis of breast cancer have been investigated by several groups. CCL5 is

reported to be highly expressed in high grade breast tumors (Azenshtein et al., 2002;

Luboshits et al., 1999; Niwa et al., 2001; Yaal-Hahoshen et al., 2006). Serum CCL5

levels were elevated in patients with high grade tumors compared to low grade tumors

(Niwa et al., 2001). Indeed, several breast cancer cell lines migrate towards CCL5

(Azenshtein et al., 2002; Luboshits et al., 1999; Robinson et al., 2003; Youngs et al.,

1997). This suggests the possibility that local production of CCL5 by tumor cells, or

other cells within the tumor microenvironment, results in CCL5 exerting effects directly

on breast tumor cells. Certainly, there is conflicting reports for the direct pro-growth

effects of CCL5 in breast cancer (Adler et al., 2003; Jayasinghe et al., 2008). Our data

support a pro-proliferative role for CCL5 in breast cancer. Specifically, CCL5 actively

promoted translation of proliferative and survival proteins, namely cyclin D1, c-Myc and

defender against cell death-1 (Dad-1) in CCR5-expressing breast cancer cells, in a

rapamycin-dependent manner (Murooka et. al., unpublished data). Thus, our data

demonstrate the potential for breast cancer cells to exploit downstream chemokine

signalling pathways for their proliferative and survival advantage through expression of

appropriate chemokine receptors. This is in contrast to studies showing that tumor-

derived CCL5 did not contribute to breast tumor formation in vivo (Jayasinghe et al.,

2008). One explanation for these contradictory results is the concentration differences in

61

CCL5 in these two studies. While we observed significant CCL5-mediated proliferative

effects at 10 nM, CCL5 expression levels by 4T1 breast cancer cells reported by

Jayasinghe and colleagues was approximately 100 fold less (Jayasinghe et al., 2008).

The data suggest that a threshold level of CCL5 is required in order for CCL5 to invoke a

proliferative response in breast cancer cells. Such a hypothesis is supported by several

studies showing that CCL5 content within tumor lesions is markedly higher in more

aggressive forms of breast cancer (Bieche et al., 2004; Niwa et al., 2001). Such a

threshold level may be attainable through the propensity of CCL5 to bind, oligomerize

and accumulate on GAGs at their secretion site (Proudfoot et al., 2003). Others have

reported chemokine activation of mTOR signalling leading to increased proliferation and

motility in cancer. The CXCR4/mTOR signalling pathway increased the proliferative

and migratory potential of gastric carcinoma cells (Hashimoto et al., 2008). CXCL8 has

been shown to up-regulate cyclin D1 at the level of translation in prostate cancer cells

(MacManus et al., 2007). Sodhi and colleagues show that endothelial-specific expression

of the Karposi’s sarcoma-associated herpesvirus (KSHV)-encoded gene, v-GPCR, is

sufficient to induce Kaposi-like sarcomas in mice, and is dependent on the

Akt/TSC2/mTOR signalling pathway (Sodhi et al., 2006). Recently, CCL5 was

implicated in mediating pro-growth and anti-apoptotic effects of gastric cancer cells

(Sugasawa et al., 2008). Notably, TILs rather than tumor cells, were the source of CCL5.

1.4.2.3. Chemokines in Angiogenesis/Angiostasis

Angiogenesis involves the formation of new vessels from pre-existing ones and is

regulated by a delicate balance between pro- and anti-angiogenic factors. There is

62

accumulating evidence that CXC chemokines regulate angiogenesis thereby promoting

tumor formation and metastasis. As described by Strieter et al., CXC chemokines

containing the ELR motif at their NH2 terminus (ELR+) are potent promoters of

angiogenesis. These chemokines were directly chemotactic for endothelial cells and

promoted angiogenesis in corneal neovascularization experiments (Koch et al., 1992;

Strieter et al., 1992). In contrast, CXC chemokines lacking this motif (ELR-) were potent

angiostatic factors (Strieter et al., 1995). These molecules were able to inhibit new vessel

formation induced by ELR+ chemokines and other pro-angiogenic mediators (Angiolillo

et al., 1995; Belperio et al., 2000; Sgadari et al., 1996). ELR+ chemokines that promote

angiogenesis include CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8.

Generally, the ELR- chemokines are IFN-γ inducible and inhibit angiogenesis (Belperio

et al., 2000). CXCL4, CXCL9, and CXCL10 are ELR- chemokines that inhibit

angiogenesis. Interestingly CXCL12, which is ELR-, is angiogenic (Gupta et al., 1998;

Salcedo et al., 1999). Additionally, CCL2 is a CC family chemokine stimulated

angiogenesis directly (Salcedo et al., 2000).

CXCL8 was the first chemokine to display potent angiogenic activity when

implanted into rat cornea and to induce proliferation and chemotaxis of human umbilical

vein endothelial (HUVEC) cells (Koch et al., 1992). A CXCL8 anti-sense

oligonucleotide specifically blocked the production of monocyte-induced angiogenic

activity, suggesting a role for CXCL8 in angiogenesis-dependent disorders. The

involvement of CXCL8 in tumor angiogenesis was initially described in human

bronchogenic carcinoma (Arenberg et al., 1996; Smith et al., 1994). Increased levels of

63

CXCL8 were detected in tumor tissue compared with normal lung tissue, and CXCL8

was able to induce corneal neovascularization. Further, anti-CXCL8 antibodies almost

completely abrogated angiogenic activity within tumors, establishing CXCL8 as a

primary mediator of angiogenesis in bronchogenic carcinoma. Similarly, anti-CXCL8

antibodies reduced human prostate tumor growth and tumor-related angiogenesis in SCID

mice (Moore et al., 1999). The angiogenic effects of CCL2 and CCL5 are less well

defined. These chemokines are likely indirect modulators of angiogenesis by recruiting

pro-angiogenic TAMs. Several correlative studies have shown that CCL2 is co-

expressed with known angiogenic factors VEGF and CXCL8 (Saji et al., 2001; Ueno et

al., 2000). Additionally, CCL5 has been shown to directly up-regulate MMP-9

expression in breast cancer cells (Azenshtein et al., 2002). Given the importance of

increased tumor vascularity to support tumor growth and spread, the angiogenic

properties of some chemokines have implications in tumor biology.

1.4.2.4. Chemokines in Metastasis

In a seminal paper published in 2001, Muller and colleagues identified that

differential chemokine and chemokine receptor expression corresponds with patterns of

metastasis in breast cancer (Muller et al., 2001). Breast cancer typically metastasizes to

regional lymph nodes, bone marrow, lung, and liver. Comparing the expression levels of

17 chemokine receptors in seven human breast cancer cell lines and normal primary

mammary epithelial cells, their data revealed that the breast cancer cells exhibited

specific patterns of receptor expression. Specifically, CXCR4 and CCR7 are highly

expressed in breast cancer cells, malignant breast tumors, and metastatic cells.

64

Subsequent studies examined patterns of expression for the ligands CXCL12, CCL19,

and CCL21, in different tissues. The highest levels of expression of CXCL12 were

detected in lymph nodes, lung, liver, and bone marrow, corresponding to the typical sites

of breast cancer metastasis. Low levels of CXCL12 were found in tissues that are not

typically associated with breast cancer metastases, such as the skin, brain, and kidneys.

CCL19 and CCL21 expression levels were highest in lymph nodes, although CCL21 was

expressed at higher levels, suggesting that this chemokine played a more prominent role

in the homing of breast cancer cells to the lymph nodes via its interaction with CCR7. To

determine whether the pattern of chemokine receptor expression observed was unique to

breast cancer, Muller and colleagues then examined chemokine receptor expression

patterns in malignant melanoma cells. Melanoma has a similar pattern of metastasis to

breast cancer, but also metastasizes within the skin. Interestingly, the authors showed

that melanoma cells expressed CXCR4 and CCR7, similar to breast cancer cells, but also

expressed higher than normal levels of CCR10, which interacts with the skin-specific

homeostatic chemokine, CCL27. Expression of CXCR4 in breast cancer cells has since

been shown to be regulated by the transcription factor NF-κB, which is activated by

extracellular signals (Helbig et al., 2003).

Recent studies by Karnoub and colleagues further implicate CCL5 as a potent

promoter of breast cancer metastasis in vivo. These studies addressed the complicated

interplay between breast tumor cells and the tumor-associated stroma (Karnoub et al.,

2007). The de novo production of CCL5 from mesenchymal stem cells acted directly on

cancer cells to enhance their motility, invasion and metastasis. Such tumor cell-

65

mesenchymal stem cell interactions were largely dependent on CCL5-CCR5.

Interestingly, the metastatic potential of tumor cells was reversible, suggesting that

CCL5-CCR5 interactions within the tumor microenvironment had to be maintained.

Additionally, insulin-like growth factor (IGF)-1-mediated migration of breast cancer cells

was dependent on CCR5 trans-activation via CCL5 expression (Mira et al., 2001). In an

experimental metastasis model of melanoma, CCR5-deficient mice developed

significantly fewer lung metastases than their wildtype counterparts (van Deventer et al.,

2005). Subsequent studies by the same group showed that CCR5 expression of

pulmonary mesenchymal cells was responsible for lung metastases through MMP-9

expression (van Deventer et al., 2008). These data lead us to hypothesize that CCL5-

CCR5 signalling in both stromal and breast cancer cells leads to phenotypic changes that

favour increased motility and invasiveness. Our data suggest that mTOR-dependent

translation of motility-related proteins is partially responsible for such phenotypic

changes (Murooka et al., 2008).

Other chemokine receptors have also been implicated in tumor metastasis.

CXCR1 and CXCR2 are expressed at higher levels in highly metastatic human melanoma

cell lines than in non-metastatic melanoma cells (Varney et al., 2003). In the same study,

neutralizing antibodies directed against these receptors were shown to inhibit both the

proliferation and invasive potential of melanoma cells, regardless of whether or not the

cells had been stimulated by CXCL8. In addition to its role in breast cancer metastasis,

CCR7 is associated with lymph node metastasis of esophageal squamous cell carcinoma,

with high levels of CCR7 expression correlating with lymphatic permeation, lymph node

66

metastasis, and poor survival (Ding et al., 2003). Interesting new studies showed that

MDA-MB-231 breast cancer cells stimulated CCL2-dependent osteoclast activation and

bone loss (Kinder et al., 2008; Zhu et al., 2007). Thus, localized expression of CCL2 was

responsible for breast cancer metastasis to the bone, and their subsequent erosion.

1.4.3. Human Immunodeficiency Virus (HIV) Infection

The relationship between the chemokine system and invading pathogens is highly

complex. While chemokines are highly expressed and are essential to coordinate the host

immune response, some are exploited by viruses for their pathogenicity. Furthermore,

viruses have acquired the ability to interfere with host chemokines to disrupt the immune

response. Different viruses encode for proteins that exhibit high homology with

chemokines or resemble chemokine receptors. Virally-encoded chemokine binding

proteins bind to host chemokines and interfere with their binding to their cognate

receptors. Viruses use these molecules to evade the protective mechanisms of the host

for their own survival advantage (Finlay and McFadden, 2006; Murphy, 2001; Seet et al.,

2003).

Over 10 years ago several groups demonstrated that the chemokine receptors

CCR5 and CXCR4 were essential co-receptors for HIV entry into host cells (Choe et al.,

1996; Dean et al., 1996; Doranz et al., 1996; Liu et al., 1996). Initial observations

revealed that the CC chemokines CCL3, CCL4 and CCL5 exerted HIV suppressive

activity (Cocchi et al., 1995). The HIV-1 envelope protein gp120 forms a tri-molecular

complex with host cell CD4 and either CCR5 or CXCR4. This results in the exposure of

67

a cryptic fusogenic peptide of gp41 from the HIV-1 envelope protein, which mediates

fusion between the viral envelope and host cell membranes (Berger et al., 1999; Wyatt

and Sodroski, 1998). It is now understood that CCR5 is utilized by macrophage tropic

HIV strains to infect mononuclear phagocytes, primary T cells and DCs, while CXCR4 is

used by HIV strains that infect CD4+ T lymphocytes. By infecting T cells and

monocytes, HIV-1 induces general immuno-suppression by crippling the CD4+ T cells

that orchestrate antiviral immunity (Gerard and Rollins, 2001; Horuk, 1999). Several

prominent mutations within the coding regions of CCR5 alter susceptibility of the host to

HIV-1 infection. As described earlier, individuals who are homozygous for the defective

allele CCR5Δ32 are largely resistant to HIV infection (Liu et al., 1996; Samson et al.,

1996). In fact, individuals who were heterozygous for the mutant CCR5 allele progress

slower towards AIDS (Dean et al., 1996). The utilization of chemokine receptors by HIV

is not restricted to CCR5 and CXCR4, as CCR3, CCR2b and CCR8 are capable of

mediating infection (Choe et al., 1996; Doranz et al., 1996; Horuk et al., 1998). Another

non-functional polymorphic CCR5, C101X-CCR5 is unable to mediate cell entry of HIV-

1 (Blanpain et al., 2000).

Since the initial reports of the HIV suppressive properties of CCL3, CCL4 and

CCL5, subsequent studies have demonstrated their protective roles in vivo. In one study,

high levels of CCL5 were found in both HIV-exposed humans and vaccinated monkeys

who were resistant to HIV or SIV infection, respectively (Furci et al., 1997; Wang et al.,

1998; Zagury et al., 1998). Another study showed that the number of CCL3 gene

duplications inversely predicted the risk of HIV infection and rate of disease progression

68

(Gonzalez et al., 2005). It is conceivable that these individuals with higher CCL3

expression limit HIV infection by CCL3 binding to and internalizing CCR5. The CCR5

antagonist AOP-CCL5 is a potent inhibitor of HIV infection, due to its ability to

internalize and prevent receptor recycling to the cell surface compared to wildtype CCL5

(Mack et al., 1998; Signoret et al., 2000). Thus, cell surface CCR5 availability is a

critical determinant of susceptibility to HIV infection and disease progression (Lederman

et al., 2006). CXCR4 internalization is also important in CXCL12-mediated protection

from HIV infection (Signoret et al., 1997). Viewed altogether, chemokines inhibit the

initial stages of HIV entry by either blocking the binding of the viral envelope protein

(gp120) to co-receptors, or by inducing internalization of the receptor after binding

(Appay and Rowland-Jones, 2001; Ward et al., 1998). Small molecule inhibitors that

target these chemokine receptors are currently in advanced-stage clinical trials in HIV,

with the CCR5 inhibitor Maraviroc recently being approved for clinical use in the US

(MacArthur and Novak, 2008). It is important to note that high concentrations of CCL5

unexpectedly enhanced HIV infection in vitro (Gordon et al., 1999; Trkola et al., 1999).

This is due to the propensity of CCL5 to aggregate and oligomerize at these high

concentrations, thereby activating T cells in an antigen-independent manner. Activated T

cells exibit increased tyrosine phosphorylation signalling, rendering cells more

permissive to HIV-1 infection (Trkola et al., 1999).

69

1.5. Hypothesis and Objectives

Hypothesis:

CCL5 exhibits dose-dependent distinct signalling events downstream of CCR5 activation.

Objectives:

Chapter 2: Characterization of CCL5-CCR5 mediated apoptosis in T cells, and the

role for glycosaminoglycan binding and CCL5 aggregation.

Chapter 3: Examine the role of mTOR and protein translation in CCL5-CCR5-mediated

T cell chemotaxis.

Chapter 4: Examine the role of mTOR in CCL5-mediated proliferation and survival of

breast cancer cells.

70

Chapter 2

CCL5-CCR5 Mediated Apoptosis in T cells: Requirement for

Glycosaminoglycan Binding and CCL5 Aggregation

Thomas T. Murooka1, Mark M. Wong1, Ramtin Rahbar1, Beata Majchrzak-Kita1, Amanda E.I. Proudfoot2 and Eleanor N. Fish1

1Division of Cellular and Molecular Biology, Toronto General Research Institute University Health Network & Department of Immunology, University of Toronto

2Serono Pharmaceutical Research Institute, Geneva, Switzerland

Chapter 2 was published as:

Murooka, T.T., Wong, M.M., Rahbar, R., Majchrzak-Kita, B., Proudfoot, A.E., and Fish, E.N. (2006). CCL5-CCR5-mediated Apoptosis in T cells: Requirement for

Glycosaminoglycan Binding and CCL5 Aggregation. J Biol Chem 281, 25184-25194.

T.T.M. performed experiments in Fig. 2.1A, 2.1E, 2.3, 2.4A, C, D, E, 2.5, 2.6, 2.8, 2.9, analyzed the data and drafted the manuscript.

M.W. performed experiments in Fig 2.1B, C, D and drafted the manuscript. R.R. performed experiments in Fig. 2.7 and analyzed the data.

B.M-K. performed experiments in Fig. 2.2, 2.4B A.E.I.P. provided valueable reagents.

E.N.F. designed research, analyzed the data and drafted the manuscript.

71

2.1. Abstract

CCL5 (RANTES) and its cognate receptor, CCR5, have been implicated in T cell

activation. CCL5 binding to glycosaminoglycans (GAGs) on the cell surface or in

extracellular matrix sequesters CCL5, thereby immobilizing CCL5 to provide the

directional signal. In two CCR5 expressing human T cell lines, PM1.CCR5 and

MOLT4.CCR5, and in human peripheral blood derived T cells, µM concentrations of

CCL5 induce apoptosis. CCL5-induced cell death involves the cytosolic release of

cytochrome c, the activation of caspase-9 and caspase-3 and poly ADP ribose polymerase

(PARP) cleavage. CCL5-induced apoptosis is CCR5 dependent, as native PM1 and

MOLT4 cells lacking CCR5 expression are resistant to CCL5-induced cell death.

Furthermore, we implicate Tyrosine-339 as a critical residue involved in CCL5-induced

apoptosis, as PM1 cells expressing a tyrosine mutant receptor, CCR5Y339F, do not

undergo apoptosis. We show that CCL5-CCR5 mediated apoptosis is dependent on cell

surface GAG binding. The addition of exogenous heparin and chondroitin sulfate, and

GAG digestion from the cell surface protects cells from apoptosis. Moreover, the non-

GAG binding variant, [44AANA47]-CCL5, fails to induce apoptosis. To address the role

of aggregation in CCL5-mediated apoptosis, non-aggregating CCL5 mutant E66S, that

forms dimers and E26A, that form tetramers at µM concentrations, were utilized. Unlike

native CCL5, the E66S mutant fails to induce apoptosis, suggesting that tetramers are the

minimal higher ordered CCL5 aggregates required for CCL5-induced apoptosis. Viewed

altogether, these data suggest that CCL5-GAG binding and CCL5 aggregation are

important for CCL5 activity in T cells, specifically in the context of CCR5-mediated

apoptosis.

72

2.2. Introduction

Chemokines were originally identified for their selective chemo-attractant and

pro-adhesive effects. They are responsible for directing leukocyte migration by forming

chemokine gradients and triggering firm arrest by activating integrins on the leukocyte

cell surface. It is now apparent that chemokines exhibit critical functions in many diverse

developmental and immunological operations (Aliberti et al., 2000; Ansel et al., 2000;

Karpus et al., 1997; Makino et al., 2002; Nagasawa et al., 1996; Szekanecz and Koch,

2000). A member of the β-chemokine family, CCL5 is both a T cell chemo-attractant

and an immunoregulatory molecule. Interestingly, CCL5 is preferentially chemotactic

for T cells of the Th1 and memory phenotype (Schall et al., 1990; Siveke and Hamann,

1998). This may be due to CCL5 binding to CCR5, which is predominantly expressed on

memory Th1 T cells (Kawai et al., 1999; Rabin et al., 1999). Given the prevalence of

memory Th1 T cells in inflammatory diseases and the coincident increased expression of

CCL5 and CCR5, CCL5-CCR5 mediated events in T cells may be critical in disease

pathogenesis (Gerard and Rollins, 2001; Luster, 1998).

CCL5 is a T cell co-stimulatory molecule in the context of CD3 stimulation

(Makino et al., 2002; Taub et al., 1996). Mice deficient in CCL5 demonstrate impaired T

cell proliferation and cytokine production in response to antigen or anti-CD3 stimulation

(Makino et al., 2002). Anti-CD3 stimulation of T cells together with nM CCL5 treatment

results in proliferation and cytokine production (Taub et al., 1996). At higher, µM

concentrations, CCL5 stimulates antigen-independent activation of T cells in terms of cell

proliferation, increased CD25 membrane expression and cytokine production, indicating

73

that high doses of CCL5 can bypass T cell receptor (TCR) recognition of antigen to

activate T cells (Bacon et al., 1995; Dairaghi et al., 1998). At these µM concentrations,

CCL5 forms large oligomers with a mass greater than 100 kDa (Appay et al., 1999;

Appay et al., 2000). Mutation of the acidic amino acid residues glutamate 26 to alanine

(E26A), or glutamate 66 to serine (E66S), in CCL5, results in CCL5 variants that are

unable to form higher order aggregates at µM concentrations (Appay et al., 1999;

Czaplewski et al., 1999). These mutants are unable to activate T cells, implying that the

aggregating properties of CCL5 are important for T cell activation (Appay et al., 1999;

Appay et al., 2000). Notably, the non-aggregating mutants retain their ability to signal

via classical G-protein dependent pathways in vitro. CCL5, as well as other chemokines,

can bind to glycosaminoglycans (GAGs) on the cell surface or the extracellular matrix

(ECM) to increase relative chemokine concentrations (Ali et al., 2000; Hoogewerf et al.,

1997). The predominant GAG binding site for CCL5 has been shown to be the BBXB

motif in the 40s loop (Martin et al., 2001; Proudfoot et al., 2001) and GAG binding in

vivo has been shown to be critical for CCL5 function (Proudfoot et al., 2003). Residues

critical for GAG binding of other chemokines including CCL3, CCL4, and MCP-1 have

now been identified (Chakravarty et al., 1998; Koopmann et al., 1999; Koopmann and

Krangel, 1997; Lau et al., 2004; Laurence et al., 2001; Martin et al., 2001; Sadir et al.,

2001; Vita et al., 2002). Whether the interaction of CCL5 with GAGs induces cellular

activation through a novel signaling mechanism is not clear. However, CCL5 and its

interaction with GAGs facilitate oligomerization and likely contribute to efficient

receptor presentation.

74

In this study we examined CCL5 activity in T cells in the context of GAG-binding,

aggregation and apoptosis. We present evidence that CCL5 aggregates form at high

ligand concentrations and that these may induce apoptosis in T cell lines and in primary

human T cells in a CCR5-dependent manner. We show that CCL5-induced apoptosis

involves the cytosolic release of the mitochondrial pro-apoptotic factor cytochrome c, the

activation of caspases -9 and -3 and poly ADP ribose polymerase (PARP) cleavage.

Additionally, we provide evidence for the critical role of intracellular Tyrosine (Y)

residue 339 of CCR5 in mediating cell death that is independent of G-protein mediated

events. Finally, we show that CCL5-GAG interactions and CCL5 oligomerization are

important pre-requisites to initiate a cascade of events resulting in T cell death. Taken

together, our data suggests a potential novel role for CCL5 in determining T cell fate

during an immunological response.

75

2.3. Materials and Methods

2.3.1. Cells and reagents

Human T cell lines PM1, PM1.CCR5, MOLT-4 and MOLT-4.CCR5, as well as

the anti-CCR5 monoclonal antibody (2D7) were obtained from the National Institutes of

Health AIDS Research and Reference Reagent Program. All cells were maintained in

culture in RPMI 1640 (Gibco-BRL) supplemented with 10% fetal calf serum (Gibco-

BRL), 100 units/ml penicillin, 100 mg/ml streptomycin (Gibco-BRL) and 25 µg/ml

plasmocin (InvivoGen). Antibodies for cleaved caspase-3 (1:1000) and caspase-9

(1:1000) were purchased from Cell Signaling, anti-cytochrome c antibody (1:1000) was

purchased from Santa Cruz, and anti-PARP antibody (1:2000) was purchased from BD

Pharmingen. Murine monoclonal anti-human CCL5 antibody and anti-tubulin antibody

(1:2000) were purchased from R & D Systems. Heparin sodium salt, chondroitin sulfate

A and chondroitinase ABC were from Sigma-Aldrich. JC-1 was purchased from

Molecular Probes. WT CCL5, CCL5 aggregation mutants E26A and E66S and

[44AANA47]-CCL5 were synthesized as previously reported (Proudfoot et al., 2001;

Proudfoot et al., 2003). CCL5 doses of 10 µg/ml correspond to 1.25 µM in all

experiments.

2.3.2. Preparation of primary T cells

Human peripheral blood derived T cells were isolated from consenting healthy

donors, as approved by the UHN research ethics committee. For activation, 106 resting T

cells/ml were cultured with 1 µg/ml PHA and 2 ng/mL IL-12 for 2 days, then cultured for

an additional 3 days in the presence of 100 U/ml hrIL-2. T cells were then stained with

76

anti human CCR5 antibody (2D7) and sorted for CCR5- and CCR5+ T cells. Sorted cells

were >95% CD3 positive.

2.3.3. Chondroitinase ABC treatment

Actively growing PM1.CCR5 cells were incubated with 10 µg/ml CCL5 for 24h.

In experiments where cellular surface GAGs were enzymatically digested, cells were first

resuspended at 5 x 105 cells/ml in RPMI containing 0% FCS and treated with

chondroitinase ABC (1 U/ml) for 1 h at 370C and 5% CO2. Cells were then washed three

times and incubated with 10 µg/ml CCL5 for 24h and analyzed by Annexin V/7-AAD

analysis. For experiments where cell surface CCL5 was measured, PM1.CCR5 cells

either untreated or pretreated with chondroitinase ABC were incubated with 10 µg/ml

CCL5 for 1 h on ice. Cells were collected, washed three times with ice cold PBS and

stained with anti-human CCL5 antibody (R & D Systems) followed by FITC-conjugated

anti-mouse IgG antibody. As isotype controls, cells were incubated with FITC labeled

isotype control IgG antibody (eBioscience) and analyzed by flow cytometry.

2.3.4. MTT, Annexin V/7-AAD staining and DNA fragmentation assay

The MTT assay was performed as previously described (Uddin et al., 1997).

Annexin V-FITC and 7-AAD staining were carried out according to the manufacturer’s

protocol (BD Pharmingen). Briefly, native PM1, PM1.CCR5, native MOLT-4 and

MOLT-4.CCR5 cells were incubated with 10 µg/ml CCL5 for 24h. Cells were then

collected, and 1 x 105 cells were incubated in 100 µl of binding buffer together with

Annexin V-FITC and 7-AAD for 15 min. Samples were analyzed immediately by flow

77

cytometry (FACSCalibur, BD). DNA fragmentation was analyzed using an apoptotic

DNA ladder kit (Roche Diagnostics, Germany) according to the manufacturer’s protocol.

DNA isolated from cells was resolved in a 2% agarose gel containing ethidium bromide

and visualized by a UV light source (Fluro-S MultiImager, BioRad).

2.3.5. JC-1 staining for mitochondrial membrane potential

PM1.CCR5 cells were incubated with 10 µg/ml CCL5 for the times indicated,

pelleted by centrifugation, washed and resuspended in warm phosphate-buffered saline at

1 x 106 cells/ml. JC-1 was added at a final concentration of 2µM and incubated at 370C

and 5% CO2 for 30 min. Cells were washed two times in PBS and resuspended in 1mL

of PBS. Cells were analyzed by flow cytometry (FACSCalibur, BD).

2.3.6. Subcellular Fractionation

Cytosolic fractions were isolated using a Mitochondrial Fractionation Kit (Active

Motif #40015) according to the manufacturer’s protocol. Cell lysates were resolved by

SDS-PAGE and immunoblotted with anti-cytochrome c antibody (Santa Cruz).

2.3.7. Western Blot Analysis

Cells were incubated with 10 µg/ml CCL5 for the times indicated, pelleted by

centrifugation, washed with ice-cold PBS and lysed in 100 μL of lysis buffer (1% Triton

X-100, 0.5% NP-40, 150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 1 mM

EGTA, 0.2 mM PMSF). Protein concentration in lysates was determined using Bio-Rad

DC protein assay kit (BioRad laboratories). 40 μg of protein lysate per sample was

78

denatured in 5X sample buffer and resolved by SDS-PAGE gel electrophoresis. The

separated proteins were transferred to a nitrocellulose membrane followed by blocking

with 5% BSA (w/v) in TBS for 1hr at room temperature. Membranes were probed with

the specified antibodies. Proteins were visualized using the ECL detection system

(Pierce).

2.3.8. Flow Cytometric Analysis

1 x 106 cells were incubated with anti-human CCR5, followed by FITC-

conjugated anti-mouse IgG antibody. As isotype controls, cells were incubated with

FITC labeled isotype control IgG antibody (eBioscience) and analyzed using the

FACSCalibur and CellQuest software. Cells were gated based on forward and side

scatter. For intracellular caspase-3 activity analysis, 1 x 106 cells were treated with CCL5

for the indicated times, fixed and permeabilized with 0.5% saponin on ice. Cells were

then incubated with FITC labeled anti-active caspase-3 (Transduction Laboratories) and

analyzed by flow cytometry. Notably, the anti-human CCR5 antibody recognizes

ectopically expressed intact CCR5 and CCR5Y339F.

2.3.9. CCR5 site-directed mutagenesis and PM1 transfection

The pEF-BOS-CCR5 carrying the human CCR5 gene was obtained from Dr.

Martin Oppermann (University of Gottingen, Germany). Site-directed mutagenesis was

performed on the pEF-BOS-CCR5 vectors. Single Y339F mutations were introduced

using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) using the following

primers: 5’ gcgagcaagctcagttttcacccgatccactgggg 3’ (forward) 5’

79

cgctcgttcgagtcaaaagtgggctaggtgacccc 3’ (reverse). Mutation was confirmed by

sequencing (ACGT Corporation, Toronto). Intact CCR5 and CCR5Y339F genes were

then subcloned into the pUMFG retroviral vector (a gift from Dr. Jeffery Medin, Division

of Experimental Therapeutics, Toronto General Research Institute). The amphotropic

packaging cell line Pheonix was transfected by the calcium phosphate/chloroquine

method. At 48 h post-transfection, the viral supernatant was collected and used for PM1

transfection, as described (Kinsella and Nolan, 1996). Positive transfectants were FACS

sorted using anti-human CCR5 antibody and used for subsequent experiments.

2.3.10. Statistical Analysis

Paired t-test was used to determine the statistical significance of differences

between groups.

80

2.4. Results

2.4.1. µM concentrations of CCL5 induce apoptosis in CCR5 expressing T cells

Chemokines and their receptors have been implicated in determining survival

(Boehme et al., 2000) and death (Colamussi et al., 2001; Jinquan et al., 2003; Kaul and

Lipton, 1999; Zhang et al., 2005) of various cell types. To investigate the biological

consequences of CCL5-CCR5 interactions on T cell survival or death, PM1.CCR5 T cells

were treated with different doses of CCL5 and the viability of cells assessed by the

apoptosis marker annexin V and the permeability indicator 7-amino actinomycin D (7-

AAD). At 10 ng/ml – 1 µg/ml (nM) doses, CCL5 treatment did not affect viability, but at

10 µg/ml (µM) doses CCL5 induced apoptosis (Figure 2.1.A). Classical apoptotic cell

death may be distinguished by DNA fragmentation, revealed when cells were treated with

PMA and ionomycin or 10 µg/ml of CCL5 (Figure 2.1.B). Additionally, we confirmed

that 10 µg/ml of CCL5 induced apoptosis in PM1.CCR5 and another CCR5-expressing T

cell line, MOLT-4.CCR5 (Figure 2.1.C). By contrast, native PM1 and MOLT-4 cells

lacking CCR5 expression were not susceptible to CCL5-inducible apoptotic cell death

(Figure 2.1.D, E). Notably, the PM1 and MOLT-4 cell lines do not express CCR1, an

alternate receptor for CCL5 in T cells.

2.4.2. CCL5 induced cell death is mediated by the mitochondrial/apoptosome pathway

At nM doses, CCL5 acts as a costimulatory signal for T cells. Indeed,

costimulation through CD28 in the context of CD3 protects cells from AICD (Collette et

al., 1998; Noel et al., 1996). Perhaps, at µM doses CCL5 bypasses the T cell receptor to

81

Figure 2.1. µM concentrations of CCL5 induce apoptosis in PM1.CCR5 T cells. (A) 2 x 105 PM1.CCR5 cells/ml were treated with varying doses of CCL5 for 24 h and percent apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative of three independent experiments (mean ± S.D.) **p<0.01. (B) 2 x 105 PM1.CCR5 cells/ml were either left untreated (control), treated with CCL5 (10 µg/ml) for either 24h or 48h. DNA fragmentation assay was performed as described in Experimental Procedures. Cells treated with PMA and ionomycin (P+I) for 24 h served as a positive control. Data are representative of two independent experiments. (C) 2 x 105 PM1.CCR5 and MOLT-4.CCR5 T cells/ml were either left untreated or treated with 10 µg/ml CCL5 for 24 h. Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. The percentage of the cell population in each quadrant is indicated to the right of each FACS blot. Data are representative of five independent experiments. (D) Cell surface CCR5 expression was determined for native PM1, PM1.CCR5, native MOLT-4, and MOLT-4.CCR5 cells by FACS. The dotted line represents the fluorescence intensity using a FITC labeled isotype control IgG antibody. The bold solid line and the grey solid line represents the fluorescence intensity using primary anti-CCR5 antibody in conjunction with the secondary anti-mouse FITC. Data are representative of three independent experiments. (E) 2 x 105 native PM1 and native MOLT-4 cells/ml were either left untreated or treated with 10 µg/ml CCL5 for 24 h. Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. The percentage of the cell population in each quadrant is indicated to the right of each FACS blot. Data are representative of three independent experiments.

82

Figure 2.1.

BA

C Untreated

0 7

092

7-A

AD

Annexin V-FITC

15 53

329

7-A

AD

MOLT-4.CCR5

0 15

50 35

Annexin V-FITC

7-A

AD

Annexin V-FITC

0 4

195

Annexin V-FITC

7-A

AD

CCL5 treated

CCL5 concentration

% A

nnex

in V

pos

itive

**

0

10

20

30

40

50

60

70

Control 10ng/mL 100ng/mL 1µg/mL 10µg/mL

PM1.CCR5

83

Native MOLT-4 MOLT-4.CCR5

CCR5-FITC CCR5-FITC

Native PM1PM1.CCR5

D

E Untreated CCL5 treated

7-A

AD

7-A

AD

MOLT-4

0 8

0 92

7-A

AD

0 2

197

7-A

AD

Annexin V-FITC Annexin V-FITC

Annexin V-FITC Annexin V-FITC

1 8

091

0.5 9

0.590

PM1

84

induce apoptosis. The Fas/FasL apoptotic pathway has been studied extensively in CD4+

T cells. We did not observe any change in Fas or FasL expression following CCL5

treatment for 24 hours (Figure 2.2.). Moreover, pretreatment of cultures with the anti-

FasL monoclonal antibody, NOK1, did not prevent CCL5-mediated apoptosis (Figure

2.3.). Changes in mitochondrial membrane permeability (ΔΨ) lead to the efflux of

apoptotic factors, the release of cytochrome c, apoptosome formation and finally

chromatin clumping and DNA fragmentation. Accordingly, we examined CCL5-

inducible changes in mitochondrial membrane potential and observed a time-dependent

reduction in ΔΨm (Figure 2.4.A). Indeed, the results in Figure 2.4.B reveal a CCL5

inducible and time-dependent accumulation of cytochrome c in the cytosol in PM1.CCR5

cells, that is maximal at 12 h. We observed a concomitant cleavage of caspase-9 (37 kDa

fragment) and caspase-3 (17 kDa and 19 kDa fragments) at 8 h that is sustained for 24 h

(Figure 2.4.C). The activation of caspase-3 was further confirmed by intracellular FACS

analysis using the anti-active caspase-3 antibody: At 10 h post-CCL5 treatment active

caspase-3 was detected (Figure 2.4.D). Finally, we examined the cleavage of the

endogenous caspase-3 substrate PARP, in similar time course studies. The 85 kDa

cleavage fragment of PARP was detected at 8 hours post-CCL5 treatment and to a greater

extent at 16 hours (Figure 2.4.E).

85

Figure 2.2 CCL5 does not affect Fas/FasL expression in T cells. 2 x 105 PM1.CCR5 or MOLT-4.CCR5 cells/ml were either left untreated (control) or treated with CCL5 (10 µg/ml) for 24 hrs. Cells were then collected, washed and stained for Fas or FasL. The dotted line represents the fluorescence intensity using a PE labeled isotype control IgG antibody. The bold solid line represents the fluorescence intensity using primary anti-Fas antibody, and the grey solid line represents the fluorescence intensity using primary anti-FasL antibody.

86

Figure 2.2.

PM1.CCR5

MOLT-4.CCR5

Untreated CCL5 treated

IgG control Anti-FasL Anti-Fas

87

Figure 2.3. FasL neutralizing monoclonal antibody NOK1 does not block CCL5-mediated apoptosis in PM1.CCR5 cells. PM1.CCR5 cells were pretreated with either IgG control or NOK1 antibody (10 µg/ml) for 30 minutes and either left untreated or treated with 10 µg/ml CCL5 for 24 h. Apoptotic cells were detected by staining with AnnexinV-FITC and 7-AAD. The percentage of the cell population in each quadrant is indicated to the right of each FACS blot. Data are representative of two independent experiments.

88

Figure 2.3.

1 12

1 86

1 59

5 34

0 13

285

2 50

7 42

Untreated CCL5 treated

IgG

NOK1

Annexin V-FITC

7-A

AD

89

Figure 2.4. µM concentrations of CCL5 induce cytochrome c release, caspase-9 and caspase-3 activation and PARP cleavage. (A) 1 x 106 PM1.CCR5 cells were treated with 10 µg/ml CCL5 for the indicated times. Cells were collected and stained with 2 µM JC-1, and analyzed by FACS. Mitochondrial depolarization was measured by decrease of JC-1 accumulation in the mitochondria (thus an increase in JC-1 monomers) due to loss of membrane potential. CCCP was used as positive control and gating correction (data not shown). Data are representative of two independent experiments. (mean ± S.D.) *p<0.05, **p<0.01 (B) PM1.CCR5 cells were either left untreated or treated with 10 µg/ml CCL5 for the indicated times. Cells were harvested and the cytosolic fraction isolated. The resulting lysates were resolved by SDS-PAGE and immunoblotted with anti-cytochrome c antibody. Membranes were stripped and reprobed for tubulin as loading control. The relative fold increase of cytochrome c levels is shown as signal intensity over loading control. Data are representative of two independent experiments. (C) PM1.CCR5 cells were either left untreated or treated with 10 µg/mL CCL5 for the indicated times. Cells were harvested and lysates were resolved by SDS-PAGE and immunoblotted with anti-caspase-9 or anti-cleaved caspase-3 antibody. Membranes were stripped and reprobed for tubulin as a loading control. The relative fold increase of protein level is shown as signal intensity over loading control. Data are representative of two independent experiments. (D) 1 x 106 PM1.CCR5 cells were either left untreated or treated with 10 µg/ml CCL5 for the times indicated, fixed with 2% paraformaldehyde and permeabilized with 0.5% saponin. Cells were then stained with an anti-active caspase-3-FITC antibody. Data are representative of three independent experiments. (E) PM1.CCR5 cells were either left untreated or treated with 10 µg/mL CCL5 for the indicated times and immunoblotted with anti-PARP antibody. The relative fold increase of protein level is shown as signal intensity over loading control.

90

Figure 2.4.

caspase-3

0

1

2

3

4

5

6

0 2 4 8 1 6 2 4

C C L5 t r e a t me nt ( ho ur s )

17kD a19kD a

CCL5 treatment (hours)

Sign

al In

tens

ity

A

0

10

20

30

40

50

60

70

80

90

100

0 2 4 8 16 24

CCL5 treatment (hours)

% ΔΨ

m * **

*

0 2 4 12 24 CCL5 treated (time [hrs])

B

WB: tubulin

WB: cytochrome c

0

0 . 5

1

1. 5

2

2 . 5

3

3 . 5

0 2 4 12 2 4C C L5 t r eat ment ( ho ur s)CCL5 treatment (hours)

cytochrome c

Sign

al In

tens

ity

Cleaved Caspase-9 0 2 4 8 16 24

CCL5 treated (time [hrs])

C

37kDa

19kDa 17kDa

Cleaved Caspase-3

WB: tubulin

caspase-9

CCL5 treatment (hours)

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

0 2 4 8 16 24

Sign

al In

tens

ity

91

Untreated

10h

24h 48h C

ount

s

Active caspase-3-FITC

D

0 2 4 8 16

CCL5 treated (time [hrs])

WB: Cleaved PARP

WB: tubulin

0

0.5

1

1.5

2

2.5

0 2 4 8 16CCL5 tr eatment (hour s)CCL5 treatment (hours)

Sign

al In

tens

ity

E

92

2.4.3. µM concentrations of CCL5 induce apoptosis in CCR5 expressing primary T

cells

Human primary T cells were isolated from peripheral blood from healthy donors

and activated as described in Experimental Procedures. Cells were subsequently sorted

based on cell surface CCR5 expression, and were >95% CD3 positive (Figure 2.5.A). To

further investigate the biological consequences of CCL5-CCR5 interactions in primary T

cells, CCR5+ and CCR5- primary T cells were treated with CCL5 for 24 h. Consistent

with our data for PM1.CCR5 cultures, CCL5 inducible apoptosis was dependent on

CCR5 expression, did not occur at 100 ng/ml – 1 µg/ml (nM) CCL5 doses, but required

10 µg/ml (µM) doses (Figure 2.5.B). Figure 2.5.C reveals a CCL5 inducible and time-

dependent cleavage of caspase-9 (37 kDa) at 2 h that is maximal at 8 h. These data

confirm that CCL5 induces apoptosis in T cells in a CCR5- and mitochondrial pathway-

dependent manner.

2.4.4. Expression of intact CCR5, but not CCR5Y339F, renders PM1 cells susceptible

to CCL5-inducible apoptosis

CCL5 mediated CCR5 activation results in the exchange of GTP for GDP by the

Gα subunit, the dissociation of heterotrimeric G-proteins into Gα and Gβγ subunits and

subsequent signal transduction. Additionally, we and others have provided evidence for

the CCL5-CCR5-dependent recruitment and activation of distinct protein tyrosine kinases

[reviewed in (Wong and Fish, 2003)]. To investigate whether phosphorylation of CCR5

on intracellular Tyrosine (Y) residues influences CCR5-mediated apoptosis, the

intracellular residue Y339 was mutagenized to phenylalanine (F). Vectors for intact

93

Figure 2.5. µM concentrations of CCL5 induce apoptosis in human primary T cells. (A) Human peripheral T cells were isolated as described in Experimetal Procedures. FACS analysis shows cell surface CCR5 expression of pre-sorted (left side) and post-sorted (right side) T cell populations. (B) 2 x 105 CCR5- or CCR5+ T cells/ml were incubated with varying doses of CCL5 for 24 h. Percent apoptotic cells were detected by Annexin V-FITC and 7-AAD. Data are representative of three independent experiments. (mean ± S.D.) *p<0.05 (C) CCR5+ T cells were either left untreated or treated with 10 µg/mL CCL5 for the indicated times. Cells were harvested and lysates were resolved by SDS-PAGE and immunoblotted with anti-caspase-9 antibody. Membranes were stripped and reprobed for tubulin as a loading control. The relative fold increase of protein level is shown as signal intensity over loading control. Data are representative of two independent experiments.

94

0

5

10

15

Untreated 100ng/mL 1ug/mL 10ug/mL

Figure 2.5.

0 2 4 8 16 24 CCL5 treated (time [hrs])

A

CCR5-FITC CCR5-FITC

CCR5- T cells

B

% A

nnex

in V

pos

itive

CCL5 concentration

*

C

CCR5− T cellsCCR5+ T cells

WB: tubulin

WB: Cleaved Caspase-9

0

0.5

1

1.5

2

2.5

3

3.5

4

0 2 4 8 16 24

Sign

al In

tens

ity

CCL5 treatment (hours)

CCR5+ T cellsIgG control Anti-CCR5

CCR5-FITC CCR5-FITC

Pre-sort Post-sort

95

CCR5 and CCR5Y339F cDNA were constructed (as described in Materials and

Methods) and introduced into native PM1 cells. Each transfectant was analyzed for cell

surface CCR5 expression using an anti-human CCR5 antibody (Figure 2.7.A), which

does not distinguish among the intact or mutant receptors, and clones exhibiting similar

ectopic expression levels were selected for use. CCL5 binding and receptor

internalization kinetics were comparable in PM1.CCR5Y339F and PM1.CCR5 cells

(Figure 2.6.A, B). In subsequent experiments we examined whether 10 µg/ml (µM)

doses of CCL5 would induce apoptosis in PM1 cells expressing Tyrosine-339 deficient

mutant CCR5. The data in Figure 2.7.B. show that CCL5 induced apoptosis in PM1 cells

expressing intact CCR5, but not in cells expressing CCR5Y339F.

2.4.5. CCL5-induced cell death is dependent on GAG interactions

In addition to the interaction of chemokines with their cognate cell surface

receptors, chemokines bind to heparin-like GAGs normally expressed on proteoglycan

components of the cell surface and extracellular matrix, thereby creating a concentration

gradient for cells to migrate along via a haptotactic mechanism (Amara et al., 1999;

Baltus et al., 2003; Cinamon et al., 2001; Kuschert et al., 1999; Netelenbos et al., 2002;

Pablos et al., 2003). Different studies suggest that chemokine-GAG interactions enhance

the functional activities of chemokines by a mechanism that involves sequestration onto

the cell surface (Ali et al., 2000; Burns et al., 1998; Hoogewerf et al., 1997). Binding

studies with immobilized heparin and HUVECs revealed that the affinity interaction of

CCL5 to GAGs can be ablated by the addition of heparin, heparin sulfate, chondroitin

sulfate and dermatan sulfate (Kuschert et al., 1999). Cell surface CCL5 binding was

96

Figure 2.6. CCL5 binding and receptor internalization of PM1.CCR5 and PM1.CCR5Y339F cells. (A) PM1.CCR5 and PM1.CCR5Y339F cells were either left untreated or treated with 250 nM CCL5 at 37˚C for the times indicated. Cells were collected on ice, washed, and stained for cell surface CCR5 expression. % CCR5 internalization was calculated as the MFI of treated cells / MFI of untreated cells x 100% (± S.D.) (B) PM1.CCR5 and PM1.CCR5Y339F cells were either left untreated or treated with 250 nM CCL5 for 1h on ice. Cells were collected, washed, and stained for CCR5 and CCL5. The data are shown as the ratio of CCL5 MFI and CCR5 MFI (± S.D.)

97

Figure 2.6.

0

20

40

60

80

100

120

0 5 15 30 60

Time (min)

% In

tern

aliz

atio

n

A

PM1.CCR5

PM1.CCR5Y339F

0

20

40

60

80

100

PM1.CCR5 PM1.CCR5Y339F

CC

L5

MFI

/ C

CR

5 M

FI R

atio

B

98

Figure 2.7. Introduction of CCR5 but not CCR5Y339F into PM1 T cells renders them susceptible to CCL5-inducible apoptosis. (A) cDNA for intact CCR5, CCR5Y339F or vector alone was introduced by retroviral transduction into native PM1 cells. Cell surface CCR5 expression of all transfectants was examined by FACS. The dotted line represents the fluorescence intensity using FITC labeled isotype control IgG antibody. The bold solid line represents the fluorescence intensity using primary anti-CCR5 antibody in conjunction with the secondary anti-mouse FITC. (B) 2 x 105 PM1.vector, PM1.CCR5 and PM1.CCR5Y339F cells/ml were either left untreated or treated with 10 µg/ml CCL5 for 24 h. % Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative experiment of five independent experiments. (mean ± S.D.) **p<0.01

99

Figure 2.7.

B

APM1.CCR5 PM1.CCR5Y339F PM1.vector

CCR5-FITC

**

CCR5-FITC CCR5-FITC

0

10

20

30

40

50

60

% A

nnex

in V

pos

itive

PM1.vector PM1.CCR5 PM1.CCR5Y339F

100

observed in both native PM1 and PM1.CCR5 cells, although consistently higher CCL5

binding was seen in PM1.CCR5, presumably due to expression of its high-affinity

receptor (Figure 2.8.A). The data suggest that PM1 T cells have GAGs on the cell

surface that are able to bind and sequester CCL5. To address the role of GAG

interactions in CCL5-induced cell death, PM1.CCR5 cells were treated with CCL5 and

varying doses of heparin and chondroitin sulfate. Addition of heparin or chondroitin

sulfate rescued PM1.CCR5 cells from CCL5- induced cell death: 10 µg/ml of heparin or

100 µg/ml chondroitin conferred complete protection (Figure 2.8.B). Subsequently,

PM1.CCR5 cells were treated with chondroitinase ABC to enzymatically remove the

GAGs from the cell surface. Chondroitinase treatment significantly reduced the ability of

CCL5 to bind to the cell surface (Figure 2.8.C) without altering CCR5 expression itself

(Figure 2.8.D). We show in Figure 2.8.E that chondroitinase treatment protected

PM1.CCR5 cells from CCL5-induced death. Similarly, when PM1.CCR5 cells were

treated with 10 µg/ml (µM) [44AANA47]-CCL5, a non-GAG binding variant of CCL5

(Proudfoot et al., 2003) we did not observe apoptosis (Figure 2.8.F). Moreover, when

PM1.CCR5 cells were treated with a cocktail of equal concentrations of [44AANA47]-

CCL5 and intact CCL5, which had been pre-mixed for 4 h at room temperature, the

resulting heterodimer did not induce apoptosis (Figure 2.8.G). The data suggest that in

the absence of CCL5-GAG interactions on the cell surface, CCL5-inducible CCR5

activation that leads to apoptosis does not occur.

101

Figure 2.8. CCL5-GAG interactions are important for apoptosis. (A) Native PM1 and PM1.CCR5 cells were either left untreated or treated with 10 µg/ml CCL5 for 1 hr on ice. CCL5 binding to the cell surface was determined by FACS analysis. The solid line represents staining with the FITC-labeled anti-CCL5 antibody and the dotted line staining with the FITC-labeled isotype control antibody. Mean fluorescence intensity is indicated in each FACS histogram. Data are representative of two independent experiments. (B) 2 x 105 PM1.CCR5 cells/ml were either left untreated or treated with 10 µg/ml CCL5, in the presence or absence of increasing doses of heparin or chondroitin sulfate A, for 24 h. Cell viability was determined using the MTT assay. Data are representative of three independent experiments. (mean ± S.D.) **p<0.01 (C) PM1.CCR5 cells were either pretreated with PBS or chondroitinase ABC prior to CCL5 treatment. CCL5 binding to the cell surface was determined by FACS analysis. Data are representative of three independent experiments. (D) PM1.CCR5 cells were either pretreated with PBS or chondroitinase ABC and cell surface CCR5 expression determined by FACS analysis. (E) PM1.CCR5 cells were either pretreated with PBS or chondroitinase ABC prior to 24 h CCL5 treatment. Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative of three independent experiments. (mean ± S.D.) **p<0.01 (F) PM1.CCR5 cells were either left untreated or treated with 10 µg/mL CCL5 or [44AANA47]-CCL5 for 24 h. Additionally, equal concentrations of [44AANA47]-CCL5 and wildtype CCL5 were preincubated for 4 h at room temperature, then PM1.CCR5 cells stimulated for 24 hours (1:1 [44AANA47]-CCL5:CCL5)~ heterodimer. Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative of three independent experiments. (mean ± S.D.) **p<0.01

102

Figure 2.8.

A

PM1

PM1.CCR5

CCL5 - FITC CCL5 - FITC

CCL5 - FITC

Untreated

Untreated

CCL5 - FITC

CCL5 treated

CCL5 treated

Mean: 6.4 Mean: 63.3

Mean: 3.7 Mean: 90.9

B

% V

iabi

lity

% V

iabi

lity

CCL5 + + + + Heparin - + + + µg/mL 0 1 10 100

CCL5 + + + + Chondroitin Sulfate - + + + µg/mL 0 1 10 100

103

0

10

20

30

40

50

60

F **E

0

10

20

30

40

50**

PBS

alon

e

PBS

+ C

CL

5

Cho

ndro

itina

se

Cho

ndro

itina

se

+ C

CL

5

% A

nnex

in V

pos

itive

Unt

reat

ed

CC

L5

[44A

AN

A47

]-C

CL

5

Het

erod

imer

% A

nnex

in V

pos

itive

PBS alone

Chondroitinase treated

C

PBS alone

CCL5 - FITC

PBS +CCL5

CCL5 - FITC

Chondroitinase +CCL5

CCL5 - FITC

CCR5-FITC

D

104

2.4.6. Aggregation of CCL5 is required for CCL5-induced cell death

At µM concentrations, CCL5 forms higher order oligomers/aggregates (Appay et

al., 1999; Czaplewski et al., 1999). Certainly, CCL5 oligomerization is necessary for

CCR1-mediated arrest of leukocytes on activated epithelium during leukocyte

recruitment, although subsequent CCR5-mediated transmigration does not require CCL5

aggregation (Baltus et al., 2003). To address the importance of CCL5 aggregation in

CCL5-induced PM1.CCR5 cell death, experiments were conducted using the E26A and

E66S CCL5 non-aggregating mutants. Importantly, at 10 µg/ml (µM) concentrations,

where native CCL5 forms large oligomers, E26A and E66S form tetramers and dimers,

respectively (Czaplewski et al., 1999). The results in Figure 2.9. show that the E66S

mutant did not induce cell death even at 100 µg/ml doses, in contrast to both the intact

CCL5 and the mutant E26A. The data suggest that CCL5 tetramers are the minimal

higher order aggregates required for inducing T cell death.

105

Figure 2.9. The CCL5 aggregation mutant E66S does not induce PM1.CCR5 cell death. 2 x 105 PM1.CCR5 cells/ml were either left untreated or treated with 10 µg/ml of CCL5, E26A, E66S or 100 µg/mL E66S. Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative of three independent experiments. (mean ± S.D.) **p<0.01

106

Figure 2.9.

0

10

20

30

40

50

60

70

Untreated CCL5 E26A E66S E66S

% A

nnex

in V

pos

itive

**

**

10µg/ml

100µg/ml E66S

107

2.5. Discussion

Chemokines are both chemotactic and immunoregulatory molecules. In addition

to their roles in the recruitment of T cells to sites of inflammation and in triggering their

adhesion and diapedesis, accumulating evidence implicates specific chemokines in

antigen-independent T cell activation. Clearly, activated chemokine receptors are able to

invoke many different signaling cascades that determine the functional outcome of the

target cell. Herein we report on CCL5 activity in T cells in the context of GAG-binding,

oligomerization and CCR5-mediated apoptosis. Certainly, CCL5-induced T cell death has

been implicated as a potential immune escape mechanism in melanoma progression,

associated with CCR5 mediated cytochrome c release, and caspase-9 and -3 activation

(Mellado et al., 2001a). CCL5-CCR5 mediated caspase-3 activation and cell death have

been reported in neuroblastoma cells, and there is also evidence that HIV-1 virion -

mediated apoptosis of bystander uninfected CD4+ T cells, which leads to T cell depletion

in infected individuals, is CCR5-dependent (Cartier et al., 2003).

The cell suicide machinery can be induced by several factors, which then

converge to activate caspases via two pathways: one involving caspase-8 recruitment to

death receptors (TNF or CD95) and the other involving the mitochondrial/apoptosome

pathway [reviewed in (Creagh et al., 2003)]. Our studies show that CCL5 induced

dissipation of mitochondrial membrane potential and cytochrome c release into the

cytosol in a time-dependent manner, with no involvement of CD95/CD95L. This was

accompanied by increased cleavage of caspase-9, caspase-3 and PARP. Taken together,

108

the data indicated that CCL5-inducible apoptosis in CCR5-expressing T cells is mediated

by activation of the mitochondrial/apoptosome pathway.

CCL5-inducible apoptosis was not sensitive to pertussis toxin (pTx) treatment,

implying a Gαi-independent mechanism. Accordingly, we focused on Tyrosine (Y)

residues in the intracellular portion of CCR5. CCR5 contains 3 intracellular tyrosine

residues, at position 127, 307 and 339. Y127 lies in the second intracellular loop of the

receptor in the DRY motif, highly conserved among CC chemokine receptors and

implicated in mediating chemokine receptor signal transduction. Mutation of the DRY

motif in CCR5 results in a non-functional receptor with reduced surface expression and

incapable of Gα subunit binding and signaling (Huttenrauch et al., 2002a; Venkatesen et

al., 2001). The other two intracellular tyrosine residues of CCR5, Y307 and Y339, reside

in the C-terminal tail of the receptor. While Y307 is conserved among CC chemokine

receptors, Y339 is unique to CCR5 and CCR4. In other studies, we have evidence that

vaccinia virus activation of CCR5 results in tyrosine phosphorylation signaling events

mediated by Y339 and not Y307 (Rahbar et al., 2006). Accordingly, we focused on

Y339, to investigate its contribution as a potential site for recruitment of signaling

effectors in mediating cell death. Dong et al. reported that whether HEK293 cells

express intact CCR5 or the tyrosine mutant variant, CCR5Y339F, CCL5-receptor binding

is unaffected (Dong et al., 2005). In agreement, we do not observe a defect in the kinetics

of CCL5 binding or internalization in PM1.CCR5Y339F cells in response to CCL5.

However, as described herein, CCL5-induced apoptosis in PM1 cells expressing intact

CCR5, but not in those expressing CCR5Y339F. The data suggest that Y339 may be a

109

critical target for effector recruitment after CCR5 dimerization, an obligatory step to

trigger signaling in response to CCL5 (Hernanz-Falcon et al., 2004). Certainly, Y139 in

the DRY motif of CCR2 has been identified as the primary target for Jak2 mediated

CCR2b receptor phosphorylation after MCP-1 binding (Mellado et al., 1998).

Furthermore, CCR2bY139F acts as a CCR2b dominant negative mutant, blocking

chemokine responses by forming non-functional dimers with intact CCR2b.

We investigated the role of CCL5-GAG interactions in mediating T cell apoptosis.

The addition of exogenous heparin and chondroitin sulfate completely rescued

PM1.CCR5 cells from CCL5-induced cell death in a dose-dependent manner. We infer

that heparin and chondroitin sulfate compete for CCL5-cell surface GAG interactions,

thereby effectively blocking cell death. Apparently, heparin is more potent than

chondroitin sulfate in protecting PM1.CCR5 cells from CCL5-induced cell death. This

result is consistent with CCL5 exhibiting a greater affinity for heparin than chondroitin

sulfate (Kuschert et al., 1999). The amino acid residues R45, K46 and R47 in CCL5

comprise a BBXB motif that is important for heparin binding (Martin et al., 2001;

Proudfoot et al., 2001). Other chemokines including CCL3, CCL4 and CXCL12 have a

similar motif (Chakravarty et al., 1998; Koopmann et al., 1999; Koopmann and Krangel,

1997; Laurence et al., 2001; Martin et al., 2001; Sadir et al., 2001; Vita et al., 2002). We

found that enzymatic digestion of cell surface chondroitin sulfate by chondroitinase ABC

treatment protected cells from CCL5-induced death. This was consistent with a

significant decrease in CCL5 binding to the cell surface after chondroitinase ABC

treatment, despite no effect on CCR5 cell surface expression (Fig 5C,D), in further

110

support of a role for GAGs in sequestering chemokines and facilitating chemokine

receptor binding. Proudfoot et al. have demonstrated that CCL5 GAG mutants

(designated [44AANA47]-CCL5) exhibit an 80% reduction in heparin binding capacity

and no recruitment activity in vivo, although in vitro activity is retained (Proudfoot et al.,

2003). Recently, Johnson et al. reported that [44AANA47]-CCL5 functions as a dominant-

negative inhibitor in a number of inflammatory models (Johnson et al., 2004). In

PM1.CCR5 cells, [44AANA47]-CCL5 was not able to induce apoptosis, even at

concentrations reaching 100 µg/mL. Additionally, mixing both [44AANA47]-CCL5 and

intact CCL5 results in heterodimers that are unable to recruit cells into the peritoneal

cavity in vivo (Johnson et al., 2004). We observe that this heterodimeric mixture will not

induce apoptosis in PM1.CCR5 cells, suggesting that [44AANA47]-CCL5 is able to

disrupt CCL5 oligomerization on GAGs. Taken together, our data suggest that in the

absence of CCL5-GAG interactions on the cell surface, CCL5-inducible CCR5 activation

that leads to apoptosis does not occur.

CCL5 forms higher order oligomers at µM concentrations (Appay et al., 1999;

Czaplewski et al., 1999). We have provided evidence that different non-aggregating

mutants variably affected cell death. Specifically, the E66S mutant did not induce cell

death, even at concentrations reaching 100 µg/mL, in contrast to both the native

aggregating CCL5 and the mutant E26A. The data suggest that CCL5 tetramers are the

minimal higher order aggregates required for inducing T cell death, in agreement with

evidence that tetramers are the minimal order aggregates required to recruit cells in vivo

(Proudfoot et al., 2003).

111

The ability of CCL5 to induce at least two distinct biological outcomes –

chemotaxis and apoptosis, is an important feature of this chemokine. At nM

concentrations, CCL5-CCR5 interactions induce a pertussis toxin-sensitive signaling

cascade responsible for the activation of integrins and chemotaxis. CCL5 at µM

concentration triggers distinct tyrosine phosphorylation signaling events, leading to

prolonged calcium influx, hyperphosphorylation and generalized T cell activation (Bacon

et al., 1995). The effects of µM CCL5 in T cells have been well documented, ranging

from influencing proliferation, cytokine production and permissiveness for HIV-1

infection (Appay et al., 1999; Appay et al., 2000; Bacon et al., 1995; Bacon et al., 1996;

Chang et al., 2002; Dairaghi et al., 1998; Szabo et al., 1997; Turner et al., 1996). As an

extension of these, the present study describes a potential novel mechanism by which

high concentrations of CCL5 determine T cell fate through activation of the

mitochondrial/apoptosome pathway. Because µM concentrations of CCL5 are required

to invoke this outcome, the important question is whether these concentrations of CCL5

are achievable or likely in vivo. Certainly, unusually high CCL5 concentrations may be

realizable at sites of acute infection or inflammation through the sequestration of CCL5

by cell surface and/or extracellular matrix GAGs. In addition, the unique ability of CCL5

to form aggregates, facilitated through GAG-binding, may also lead to an increase in

local CCL5 concentration (Appay et al., 1999; Appay et al., 2000; Czaplewski et al.,

1999; Hoogewerf et al., 1997; Kuschert et al., 1999; Martin et al., 2001; Proudfoot et al.,

2001; Proudfoot et al., 2003). We, therefore, infer that the CCL5-CCR5 induced

apoptosis of T cells we observe is not likely an in vitro artifact, but is attainable in vivo.

112

We argue against the possibility of CCL5 aggregates blocking the interaction of growth

factors with their receptors and indirectly inducing apoptosis, as the viability of native

PM1 and MOLT-4 cells lacking CCR5 expression, yet able to sequester CCL5 aggregates

by GAG binding, was not affected by µM CCL5.

This study describes a potential mechanism by which CCL5-CCR5 interactions

determines T cell fate. Apoptosis of T lymphocytes is critical in maintaining both central

and peripheral tolerance and homeostasis. AICD in T cells is certainly a major

mechanism of clonal deletion in the immune system. Death receptors, especially

CD95/CD95L interactions have been described as an important inducer of AICD in T

cells, although different effectors, including c-Myc and TRAIL, have also been identified.

Recently, Tyner et al. described an anti-apoptotic signaling pathway in macrophages

mediated by nM CCL5-CCR5 interactions (Tyner et al., 2005). Although apparently

contradicting our findings, the lineage of the cell type studied and the lower dose of

CCL5 employed, may explain these different observations. In the present study, we

describe a potential novel mechanism by which high concentrations of the CCL5

determine T cell fate through activation of the mitochondrial/apoptosome pathway. Our

results suggest that CCL5-induced cell death, in addition to CD95/CD95L mediated

events, may contribute to clonal deletion of T cells during an immunological response.

The identification of specific CCR5-mediated signaling effectors critical for apoptosis is

currently under investigation.

113

Chapter 3

CCL5-mediated T cell Chemotaxis Involves the Initiation of

mRNA Translation through mTOR/4E-BP1

Thomas T. Murooka*, Ramtin Rahbar*, Leonidas C. Platanias# and Eleanor N. Fish*1

*Division of Cellular and Molecular Biology, Toronto General Research Institute, University Health Network & Department of Immunology, University of Toronto

#Robert H. Lurie Comprehensive Cancer Center, Northwestern University Medical School, Chicago, USA

Chapter 3 was published as:

Murooka, T.T., Rahbar, R., Platanias, L.C., and Fish, E.N. (2008). CCL5-mediated T-cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1.

Blood 111, 4892-4901.

T.T.M. performed all experiments, analyzed the data and drafted the manuscript. R.R. analyzed the data and edited the manuscript.

L.C.P. designed research. E.N.F. designed research, analyzed the data and drafted the manuscript.

114

3.1. Abstract

The multi-step, coordinated process of T cell chemotaxis requires chemokines,

and their chemokine receptors, to invoke signaling events to direct cell migration. Here,

we examined the role for CCL5-mediated initiation of mRNA translation in CD4+ T cell

chemotaxis. Using rapamycin, an inhibitor of mTOR, our data show the importance of

mTOR in CCL5-mediated T cell migration. Cycloheximide, but not actinomycin D,

significantly reduced chemotaxis, suggesting a possible role for mRNA translation in T

cell migration. CCL5 induced phosphorylation/activation of mTOR, p70 S6K1 and

ribosomal protein S6. Additionally, CCL5 induced PI-3’K-, phospholipase D- and

mTOR-dependent phosphorylation and deactivation of the translational repressor 4E-BP1,

which resulted in its dissociation from the eukaryotic initiation factor-4E. Subsequently,

eIF4E associated with scaffold protein eIF4G, forming the eIF4F translation initiation

complex. Indeed, CCL5 initiated active translation of mRNA, shown by the increased

presence of high-molecular-weight polysomes which were significantly reduced by

rapamycin treatment. Notably, CCL5 induced protein translation of cyclin D1 and MMP-

9, known mediators of migration. Taken together, we describe a novel mechanism by

which CCL5 influences translation of rapamycin-sensitive mRNAs and “primes” CD4+ T

cell for efficient chemotaxis.

115

3.2. Introduction

Directed cell migration is a tightly regulated process, critical for numerous

biological processes including proper tissue development, wound healing and protection

against invading pathogens. Chemokines are soluble, extracellular chemo-attractant

molecules that play a vital role in many of these biological processes. The chemokines

are a large family of mainly secreted, 8-10 kDa proteins subdivided into 4 families based

on the relative positioning of the first two cysteine residues near the N-terminus (Luster,

1998; Stein and Nombela-Arrieta, 2005; Zlotnik et al., 1999). Chemokine ligands

interact with seven transmembrane, G protein-coupled receptors (GPCRs) to induce

directed cellular migration. Secreted chemokines bind to heparin-like

glycosaminoglycans (GAGs) normally expressed on proteoglycan components of the cell

surface and extracellular matrix, thereby creating a concentration gradient allowing

immune cells to migrate via a haptotactic mechanism (Amara et al., 1999; Cinamon et al.,

2001; Kuschert et al., 1999; Netelenbos et al., 2002; Pablos et al., 2003; Proudfoot et al.,

2003). These immobilized chemokines allow leukocytes to stop rolling, promote

extravasation and regulate directional migration.

T cell chemotaxis is a process that requires the activation and re-distribution of a

number of signaling, adhesion and cytoskeletal molecules at the cell surface (Raftopoulou

and Hall, 2004; Watanabe et al., 2005). CCL5/RANTES is a member of the β-

chemokines and is chemotactic for Th1 T cells, macrophages, dendritic cells and NK

cells through the expression of CCR1 and/or CCR5 (Kawai et al., 1999; Lederman et al.,

2006; Rabin et al., 1999; Schall et al., 1990; Siveke and Hamann, 1998). It is now clear

116

that signaling through CCR5 controls a multitude of cellular functions, including

chemotaxis, proliferation, cytokine production, survival and apoptosis (Bacon et al.,

1995; Bacon et al., 1998; Bacon et al., 1996; Dairaghi et al., 1998; Ganju et al., 2000;

Ganju et al., 1998; Murooka et al., 2006; Rahbar et al., 2006). Through studies with PI-

3’K inhibitors wortmannin and LY294002, it is known that CCL5-mediated PI-3’K

activation is critical for chemotaxis (Turner et al., 1995a; Ward, 2004; Wymann and

Marone, 2005). Chemokines activate the PI-3’Kγ isoform by the βγ subunits of trimeric

G proteins at the cell membrane, although contributions from other isoforms cannot be

discounted (Curnock et al., 2003; Curnock and Ward, 2003; Sasaki et al., 2000). Studies

with the mTOR inhibitor, rapamycin, have underscored the role for mTOR in fibronectin

and GM-CSF induced cellular migration downstream of PI-3’K (Daniel et al., 2004;

Gomez-Cambronero, 2003; Sakakibara et al., 2005; Sun et al., 2001). mTOR possesses a

carboxy-terminal region sharing significant homology with lipid kinases, especially with

PI-3’K, and has been assigned to a larger protein family termed the PIKKs

(phosphoinositide kinase-related kinase) (Gingras et al., 2004). mTOR exists in two

complexes: mTOR Complex1, which is sensitive to rapamycin and phosphorylates p70

S6K1 and initiation factor 4E binding proteins (4E-BPs), and mTOR Complex2, which is

rapamycin-resistant and phosphorylates PKB (Dann et al., 2007; Gingras et al., 1998;

Hay and Sonenberg, 2004). mTOR Complex1 is responsible for the phosphorylation of

S6K1 on Threonine-389 (Hay and Sonenberg, 2004; Loewith et al., 2002; Um et al.,

2006). Phosphorylation of 4E-BP1 at the priming site, Threonine-37/46, and additional

sites Serine-65 and Threonine-70 are LY294002 and rapamycin sensitive (albeit in

varying degrees), indicating that 4E-BP1 is regulated by both mTOR and PI-3’K (Hay

117

and Sonenberg, 2004; Proud, 2007). Another important modulator of mTOR activity is

phospholipase D (PLD), for which the primary alcohol, 1-butanol, but not tert-butanol,

blocks PLD-mediated S6K activation and 4E-BP1 phosphorylation in several cell

types(Fang et al., 2001; Foster, 2007; Hornberger et al., 2006). Indeed, CCL5 has been

shown to stimulate PLD activity in Jurkat T cells, but its role in chemotaxis has not been

studied (Bacon et al., 1998). mTOR-dependent modulation of S6K1 and 4E-BP1 has

been implicated in several cellular processes, including metabolism, nutrient sensing,

translation and cell growth (Gingras et al., 2004; Wullschleger et al., 2006). Here, we

examine for the first time the effects of CCL5 on the translation initiation of rapamycin-

sensitive mRNAs, and their contribution to CD4+ T cell chemotaxis.

mRNA translation is an energy-consuming process that is highly regulated at

multiple levels in mammalian cells. Changes in translation rates often correlate with

changes in the level of eIF4E, and thus its availability is under tight control. Three eIF4E

inhibitory proteins, the 4E-BPs (4E-BP1-3), regulate mRNA translation by sequestering

eIF4E (Haghighat et al., 1995). mTOR regulates translation by modulating the

availability of eIF4E through hyper-phosphorylation of 4E-BP1 (Beretta et al., 1996).

The mRNA 5’-cap structure is bound by eIF4F, a hetero-trimeric protein complex

comprised of an eIF4G backbone, the cap-binding eIF4E and the RNA helicase, eIF4A.

This complex facilitates ribosome binding and passage along the 5’-UTR (untranslated

region) towards the initiation codon (Richter and Sonenberg, 2005; von der Haar et al.,

2004). In addition, mTOR controls the translation of 5’-TOP (tract of oligopyrimidines)

mRNAs which often encodes for cytoplasmic ribosomal proteins (Meyuhas, 2000;

118

Ruvinsky and Meyuhas, 2006). Although 5’-TOP mRNA translation is sensitive to

rapamycin, the exact mechanism is unclear and recent studies have shown that S6K1 and

its effector molecule rpS6 are dispensable for their translation (Ruvinsky et al., 2005).

Taken together, mTOR is a crucial regulator of the translational machinery by: (1)

directly affecting eIF4F availability for 5’-capped mRNA translation initiation and (2)

up-regulating ribosomal protein levels through modulation of 5’-TOP mRNA translation.

Control of translational machinery is an important contributor to the overall gene

expression. Translational control allows for the rapid production of proteins without the

need for mRNA transcription, processing and export into the cytoplasm. In the present

study, we examined the role for CCL5-mediated initiation of mRNA translation in the

context of CD4+ T cell chemotaxis. Specifically, we focused on the translation of

rapamycin-sensitive mRNAs that contain significant secondary structures in their 5’-UTR.

We describe a novel mechanism by which CCL5 directly modulates protein levels to

“prime” cells for directed cellular migration, thus allowing for a more rapid and effective

immune response.

119

3.3. Materials and Methods 3.3.1. Cells and reagents

Human peripheral blood-derived T cells were isolated from healthy donors as

previously described (Murooka et al., 2006). Cells were maintained in RPMI 1640

supplemented with 10% fetal calf serum, 100 units/ml penicillin, 100 mg/ml streptomycin

and 2 mM L-glutamine (Gibco-BRL). Briefly, CD4+ T cells were purified using the

RosetteSep T cell enrichment cocktail according to manufacturer’s specifications

(StemCell Technologies). T cells were subsequently activated in the presence of plate

bound 10 µg/ml anti-CD3 antibody (eBiosciences) and 5 µg/ml anti-CD28 antibody

(eBiosciences) with soluble 5 ng/ml hrIL-12 (Bioshop, Canada) and 2.5 µg/ml anti-IL-4

antibody (eBiosciences) for 2 days, and further expanded in culture supplemented with

100 U/ml hrIL-2 (Bioshop, Canada) for 3 days. T cell purity and CCR5 expression were

confirmed at day 5 by FACS analysis using anti-human CCR5 antibody (2D7) and anti-

human CD3 antibody (BD Biosciences). Antibodies for phospho-eIF4E (Ser-209), eIF4E,

phospho-rpS6 (Ser-235/236), rpS6, phospho-4E-BP1 (Thr-37/46), phospho-4E-BP1 (Thr-

70), 4E-BP1, phospho-p70S6K1 (Thr-389), p70S6K1, phospho-mTOR (Ser-2448) and

mTOR were purchased from Cell Signaling Technology. Antibody for human cyclin D1

(DCS-6), eIF4E (P-2) and eIF4G (H-300) were purchased from Santa Cruz

Biotechnology. Murine monoclonal anti-tubulin antibody was purchased from R & D

Systems. Polyclonal rabbit antibody against human MMP-9 was purchased from

Chemicon International. Inhibitors cycloheximide, actinomycin D, rapamycin and

LY294002 were all obtained from Calbiochem. 1-butanol and tert-butanol were

purchased from Sigma-Aldrich (Canada). AS-252424 was purchased from Cayman

120

Chemical Company. 2,3-diphosphoglycerate (DPG) has been shown to inhibit PLD and

was purchased from Sigma-Aldrich (Canada).(Kanaho et al., 1993; Kusner et al., 1996)

CCL3 (LD78β) was purchased from Peptrotech (USA). CCL5 was a generous gift from

Dr. Amanda Proudfoot (Geneva Research Centre, Merck Serono International).

3.3.2. Immunoblotting and immunoprecipitation

T cells were serum starved in RPMI 1640/0.5% BSA overnight to reduce the

effects of the various growth factors found in fetal calf serum (FCS) on mTOR and

protein translation. Cells were incubated with 10 nM CCL5 for the times indicated,

collected, washed two times with ice-cold PBS and lysed in 100 μl lysis buffer (1%

Triton X-100, 0.5% NP-40, 150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 1

mM EGTA, 0.2 mM PMSF, 10 µg/ml aprotinin, 2 µg/ml leupeptin, 2 µg/ml pepstatin A).

For all experiments using inhibitors, cells were pretreated for 1 hour with the amount of

inhibitor indicated prior to CCL5 treatment. Protein concentration was determined using

the Bio-Rad DC protein assay kit (BioRad laboratories). 30 μg of protein lysate was

denatured in sample reducing buffer and resolved by SDS-PAGE gel electrophoresis.

The separated proteins were transferred to a nitrocellulose membrane followed by

blocking with 5% BSA (w/v) in TBS for 1 hour at room temperature. Membranes were

probed with the specified antibodies overnight in 5% BSA (w/v) in TBST (0.1% Tween-

20) at 4°C and the respective proteins visualized using the ECL detection system (Pierce).

For immunoprecipitation assays, 2 µg of mouse anti-eIF4E monoclonal antibody (P-2) or

rabbit anti-eIF4G polyclonal antibody (H-300) were added to 500 µg of protein lysates. 2

µg of appropriate whole molecule mouse or rabbit IgG antibody (Amersham Biosciences)

121

were used as controls. Antibodies were pulled down with protein A/G-sepharose beads

(Santa Cruz Biotechnology) and washed six times with lysis buffer. Beads were then

denatured in 5X sample reducing buffer and resolved by SDS-PAGE gel electrophoresis.

3.3.3. Flow Cytometric Analysis

1 x 106 cells were incubated with mouse anti-human CCR5 antibody for 45

minutes on ice and washed three times with ice-cold FACS buffer (PBS/2% FCS). Cells

were then incubated with FITC-conjugated anti-mouse IgG antibody (eBiosciences). As

control, cells were incubated with FITC-conjugated isotype control IgG antibody

(eBioscience). Cells were analyzed using the FACSCalibur and CellQuest software (BD

Biosciences).

3.3.4. Chemotaxis Assay

T cell chemotaxis was assayed using 24-well Transwell chambers with 5µm pores

(Corning). A total of 1 x 105 cells in 100 µl chemotaxis buffer (RPMI 1640/0.5% BSA)

were placed in the upper chambers. CCL5, diluted in 600 µl chemotaxis buffer, was

placed in the lower wells and the chambers incubated for 2 hours at 37ºC. Migrated cells

located in the bottom wells were collected, washed once with PBS and counted by FACS.

All experiments were conducted in triplicate. In experiments involving inhibitors, cells

were pretreated for 1 h at the indicated inhibitor concentrations and placed in the upper

chambers. Cell viability, as measured by PI staining (Figure 3.3), was not affected at any

of the concentrations of inhibitors used in this study.

122

3.3.5. Semi-quantitative RT-PCR

T cells (1 x 107) were serum starved in RPMI 1640/0.5% BSA overnight and

incubated at 37°C with 10 nM CCL5 for the times indicated. Cells were collected,

washed twice with ice-cold PBS and lysed with the RLT buffer (Qiagen). The resulting

lysates were homogenized with a QIA shredder column and total RNA extracted using

the RNeasy Mini kit (Qiagen). 2 µg of RNA was reverse transcribed using M-MLV

reverse transcriptase (Invitrogen). cDNA was then serially diluted in dH20 as indicated

and amplified for human cyclin D1, MMP-9 and GAPDH using the following primers

and conditions: cyclin D1, FP 5’ atggaacaccagctcctgtgctgc 3’ RP 5’

tcagatgtccacgtcccgcacgt 3’ (95°C 1 min, 65.5°C 30 sec, 72°C 1 min, 35 cycles); MMP-9,

FP 5’ cgtggttccaactcggtttg 3’ RP 5’aagccccacttcttgtcgct 3’ (95°C 1 min, 58°C 30 sec,

72°C 1 min, 30 cycles); GAPDH, FP 5' aaggctgagaacgggaagcttgtcatcaat 3' RP 5'

ttcccgtctagctcagggatgaccttgccc 3' (95°C 1 min, 55°C 30 sec, 72°C 1 min, 30 cycles)

3.3.6. Polysome gradients

Activated CD4+ T cells were serum-starved and treated with 10 nM CCL5 for 1

hour before lysis in ice-cold Nonidet P-40 lysis buffer (10 mM Tris-HCl (pH 8.0), 140

mM NaCl, 1.5 mM MgCl2, and 0.5% Nonidet P-40) supplemented with RNaseOut RNase

inhibitor (Invitrogen) at a final concentration of 500 U/ml. Nuclei were removed by

centrifugation at 3,000 x g for 2 minutes at 4 ºC. The supernatant was supplemented with

665 µg/ml heparin, 150 µg/ml cycloheximide, 20 mM DTT and 1 mM PMSF and

centrifuged at 15,000 x g for 5 minutes at 4 ºC to eliminate mitochondria. The

supernatant was then layered onto a 30 ml linear sucrose gradient (15-40% sucrose (w/v)

123

supplemented with 10 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1.5 mM MgCl2, 10 mM

DTT, 100 µg/ml cycloheximide, and 0.5 mg/ml heparin) and centrifuged in a SW32

swing-out rotor (Beckman) at 32,000 rpm for 2 hours at 4 ºC without a brake. Fractions

(750 µl) were carefully collected from the center of the column using a pipette and

digested with 100 µg of proteinase K in 1% SDS and 10 mM EDTA for 30 minutes at 37

ºC. RNAs were extracted by phenol-chloroform-isoamyl alcohol followed by ethanol

precipitation and dissolved in RNase free water before being analyzed by electrophoresis

on 1% denaturing formaldehyde agarose gels to examine polysome integrity. RNA from

each fraction was quantified at optical density (OD) of 254 nm. OD readings for each

fraction were plotted as a percentage of the total RNA of all fractions to facilitate visual

comparisons, and are shown as a function of gradient depth.

3.3.7. Statistical Analysis

Two-tailed t-test was used to determine the statistical significance of differences

between groups.

124

3.4. Results 3.4.1. CCL5-mediated chemotaxis of activated CD4+ T cells is mTOR-dependent

Studies were undertaken to examine the influence of mRNA translational events

on CCL5-mediated chemotaxis. Ex vivo activation of peripheral blood (PB) CD4+ T cells

with cytokines induced CCR5 expression (Figure 3.1.A, left panel). Notably, we observe

no expression of CCR1 in our activated CD4+ T cells. T cell populations used for

subsequent experiments were consistently >95% CD3 and CD4 positive. CCR5

expression on activated T cells correlated with a functional response to CCL5, as

evidenced by dose-dependent migration towards CCL5 and abrogation of migration by

pretreatment with anti-CCR5 antibody (5 µg/ml, 2D7) (Figure 3.1.A, right panel).

Subsequent experiments examined the effects of the PI-3’K inhibitor LY294002 or the

mTOR inhibitor rapamycin on CCL5-mediated chemotaxis. As shown in Figure 3.1.B,

pretreatment with either LY294002 or rapamycin significantly reduced CCL5-mediated T

cell chemotaxis in a dose-dependent manner. The data suggest that both PI-3’K and

mTOR play a role in CCL5-mediated T cell migration. The PI-3’Kγ-specific inhibitor,

AS-252424, also reduced CCL5-mediated T cell chemotaxis (Figure 3.1.C). Interestingly,

experiments with CCL3/MIP1α, another agonist ligand of CCR5, revealed that CCL3-

mediated T cell migration was insensitive to rapamycin at doses as high as 100 nM

(Figure 3.2.). Notably, we find that both CCL3/MIP1α and CCL4/MIP1β are poor

effectors of CCR5-mediated T cell chemotaxis when compared with CCL5, with CCL3

exhibiting superior chemotactic activity to CCL4. Specifically, whereas 10 nM CCL5

exhibits a migration index approximately 5 fold over control (Figure 3.1.A), the

migration index for 10 nM CCL3 is approximately 2 fold in identical in vitro chemotactic

125

Figure 3.1. CCL5-mediated chemotaxis of activated CD4+ T cells is dependent on PI-3’K and mTOR. (A) Activated peripheral blood (PB) T cells were stained with anti-CCR5 and anti-CD3 antibodies (solid line) or isotype controls (dotted line) and analyzed by FACS. CCL5-mediated chemotaxis is presented as migrated cells per well. (B) Activated PB T cells were pretreated with either DMSO (carrier) or the specified inhibitors for 1hr at the concentrations indicated, and CCL5-mediated chemotaxis measured using 10 nM CCL5. The data are presented as % migration, with the number of migrated cells at 10 nM CCL5 taken as 100%. Representatives of three independent experiments are shown (± S.D.) * p<0.05 (C) Activated PB T cells were pretreated with either ethanol (carrier) or AS-252424 for 1 hr at the concentration indicated, and CCL5-mediated chemotaxis measured using 10 nM CCL5. Data are representative of two independent experiments (± S.D.) * p<0.05 (D) Activated PB T cells pretreated with either DMSO (carrier), cycloheximide or actinomycin D for 30 min at the concentrations indicated. The data represent means ± S.D. of 3 independent experiments. * p<0.05

126

Figure 3.1.

0

20

40

60

80

100

120

0 1 2.5

AS-252424 (µM)

% M

igra

tion

0

10

20

30

0 1 10 100 anti-CCR5

CCL5 (nM)

% in

put c

ells

CCR5

** *

C

A

B

97%

CD3

**

**

D

0

20

40

60

80

100

120

0 10 20 50

Rapamycin (nM)

% M

igra

tion

0

20

40

60

80

100

120

0 5 10 20

LY294002 (µM)

% M

igra

tion

0

20

40

60

80

100

120

0 1 5

Actinomycin D (µg/ml)

% M

igra

tion

0

20

40

60

80

100

120

0 0.1 1 10

Cycloheximide (µg/ml)

% M

igra

tion

127

Figure 3.2. CCL3/MIP1α-dependent T cell chemotaxis is not dependent on mTOR. (A) Activated PB T cells were pretreated with either DMSO (carrier) or rapamycin for 1 hr at the concentrations indicated, and CCL3-mediated chemotaxis measured using 10 nM CCL3 (LD78β). The data are presented as % migration, with the number of migrated cells at 10 nM CCL3 taken as 100%. Representatives of two independent experiments are shown (± S.D.). * p<0.05 (B) Activated PB T cells were either left untreated or treated with 10 nM CCL3 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-4E-BP1 (Thr-37/46) antibody. Membranes were stripped and re-probed for 4E-BP1 as a loading control. The relative fold increase of 4E-BP1 phosphorylation is shown as signal intensity over loading control to the right of each blot. Representatives of two independent experiments are shown (± S.D.)

128

0 5 15 30

+ CCL3 (min)

p-4E-BP1(thr 37/46)

4E-BP1

Figure 3.2.

0

20

40

60

80

100

120

0 20 50 100

Rapamycin (nM)

% M

igra

tion

0

0.2

0.4

0.6

0.8

1

1.2

0 5 15 30

Time (min)

Fold

Indu

ctio

n

A

B

129

transwell experiments. To further investigate the involvement of mRNA translation on

CCL5-mediated T cell chemotaxis, cells were pretreated with cycloheximide or

actinomycin D, inhibitors of mRNA translation and transcription, respectively. As shown

in Figure 3.1.D, cycloheximide but not actinomycin D significantly reduced CCL5-

mediated T cell chemotaxis in a dose-dependent manner. The reduction in CCL5-

mediated T cell chemotaxis by inhibitors at the doses employed is not due their toxicity

or their ability to alter cell adhesion (Figure 3.3.A, B).

3.4.2. CCL5 induces phosphorylation of mTOR, p70 S6 kinase and S6 ribosomal

protein

Next, we examined CCL5-mediated phosphorylation/activation of mTOR.

mTOR is phosphorylated on Serine-2448 by the PI-3’K/PKB pathway (Nave et al., 1999).

In turn, phosphorylated/activated mTOR can directly phosphorylate p70 S6K1 at

Threonine-389 in vitro (Burnett et al., 1998). In time course studies we show that T cells

treated with 10 nM CCL5 induced the rapid phosphorylation/activation of mTOR on

Serine-2448 and S6K1 on Threonine-389, within 5 minutes (Figure 3.4.A, B). We also

showed a CCL5-mediated phosphorylation of S6 ribosomal protein (rpS6), a known

downstream effector of S6K1, on Serine-235/236 (Figure 3.4.C). Although rpS6 does not

regulate translation of 5’-TOP mRNAs, phosphorylation remains an acceptable readout

for S6K1 activity. Taken together, the data suggest that CCL5 is able to activate the

mTOR/S6K1 pathway to potentially influence translation initiation.

130

Figure 3.3. Effect of various inhibitors on T cell viability and adhesion. (A) Activated T cells were treated with either DMSO (carrier), ethanol (carrier) or the specified inhibitors for 3 hrs at the concentrations indicated, stained with propidium iodide and analyzed by FACS. Cells negative for PI stain were considered viable. The data represent means ± S.D. of at least 2 independent experiments. (B) 2 x 105 T cells were either left untreated, treated with DMSO (0.1% v/v) or ethanol (0.1% v/v) for 3 hrs, plated onto fibronectin-coated wells and incubated for 2 hrs at 37˚C. Cells were washed, fixed in 95% ethanol and stained with crystal violet (2% w/v). 100 µl of solubilization buffer was added and the absorbance read at 570 nm. Data are representative of two independent experiments performed in triplicate. The data show that the presence of DMSO or ethanol as a carrier did not affect T cell adhesion to fibronectin.

131

Figure 3.3.

0

20

40

60

80

100

0

0.1%

1-b

utan

ol

0.1%

tert

-but

anol

% V

iabi

lity

A

020406080

100

0 1 2.5

AS-252424 (µM)

% V

iabi

lity

020406080

100

0 20 50

Rapamycin (nM)

% V

iabi

lity

020406080

100

0 10 20

LY294002 (µM)

% V

iabi

lity

020406080

100

0 0.1 1 10

Cycloheximide (µg/ml)

% V

iabi

lity

020406080

100

0 1 5

Actinomycin D (µg/ml)

% V

iabi

lity

020406080

100

0 250 500

2,3-DPG (µM)%

Via

bilit

y

B

0

0.02

0.04

0.06

0.08

Untreated DMSO ethanol

Arb

itrar

y un

its (A

570 )

132

Figure 3.4. CCL5-dependent phosphorlyation of mTOR, p70 S6K1 and ribosomal protein S6 in T cells. Activated PB T cells were either left untreated or treated with 10 nM CCL5 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with (A) anti-phospho-mTOR (Ser-2448) antibody, anti-phospho-p70 S6 kinase (Thr-389) antibody, or anti-phospho-rpS6 (Ser-235/236) antibody. Membranes were stripped and re-probed for the appropriate loading controls. (B) The relative fold increase in phosphorylation is shown as signal intensity over loading control. Data are representative of two independent experiments.

133

mTOR

p-p70S6K1 p70S6K1

p-rpS6

rpS6

0 5 15 30

+ CCL5 (min)

p-mTOR

Figure 3.4.

p-mTOR

0

0.5

1

1.5

0 5 15 30

Time (min)

Fold

Ind

uctio

n

p-p70S6K1

00.5

11.5

22.5

0 5 15 30

Time (min)

Fold

Ind

uctio

n

p-rpS6

00.5

11.5

22.5

3

0 5 15 30

Time (min)

Fold

Indu

ctio

n

B

A

134

3.4.3. CCL5-mediated 4E-BP1 phosphorylation is PI-3’K-, PLD- and mTOR-dependent

mTOR has an additional role in phosphorylating the mRNA translational

repressor 4E-BP1. Phosphorylation of 4E-BP1 is sequential, since phosphorylation of

Threonine-37/46 appears to be required for Threonine-70 and Serine-65 phosphorylation

(Hay and Sonenberg, 2004). In PB T cells, CCL5 induced a rapid phosphorylation of 4E-

BP1 on both Threonine-37/46 and Threonine-70 sites (Figure 3.5.A). The roles of PI-3’K,

PLD and mTOR in CCL5-dependent 4E-BP1 phosphorylation on Threonine-37/46 were

determined using various inhibitors. Pretreatment of PB T cells with LY294002,

rapamycin, or 1-butanol abolished 4E-BP1 phosphorylation. (Figure 3.5.B, 3.6.B).

Consistent with their inhibitory effects on 4E-BP1 phosphorylation, both PLD inhibitors

2,3-DPG and 1-butanol reduced CCL5-mediated migration of PB T cells in a dose

dependent manner (Figure 3.6.A). Notably, CCL3 did not induce phosphorylation of 4E-

BP1 on Threonine-37/46, consistent with our findings that rapamycin also does not affect

CCL3-mediated T cell migration (Figure 3.2.B).

3.4.4. CCL5 initiates protein translation through formation of the eIF4F complex

The preceding suggests that CCL5 may regulate eIF4E availability through

mTOR- dependent phosphorylation of 4E-BP1. Increased availability of eIF4E allows for

the formation of the eIF4F complex, which also includes eIF4G, a multi-domain scaffold

protein, and eIF4A, a RNA helicase that is required to unwind regions of the secondary

structure in the 5’-UTRs of mRNAs (Richter and Sonenberg, 2005; von der Haar et al.,

2004). To determine whether CCL5 mediates the formation of the eIF4F complex, cells

were treated with CCL5 for 30 minutes and cell lysates immunoprecipiated for eIF4E and

135

Figure 3.5. CCL5 phosphorylates the 4E-BP1 repressor of mRNA translation through PI-3’ kinase and mTOR. (A) Activated PB T cells were either left untreated or treated with 10 nM CCL5 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-4E-BP1 (Thr-37/46) antibody or anti-phospho-4E-BP1 (Thr-70) antibody. Membranes were stripped and re-probed for 4E-BP1 as a loading control. The relative fold increase of 4E-BP1 phosphorylation is shown as signal intensity over loading control to the right of each blot. (B) Activated PB T cells were pretreated with either DMSO (carrier), 20 µM LY294002 or 50 nM rapamycin for 1 hr prior to 15 min treatment with 10 nM CCL5. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-4E-BP1 (Thr-37/46) antibody. Membranes were stripped and re-probed for 4E-BP1 as a loading control. The relative fold increase of 4E-BP1 phosphorylation is shown as signal intensity over loading control. Data are representative of two independent experiments.

136

p4E-BP1 (Thr 37/46)

4E-BP1

p4E-BP1 (Thr 70)

4E-BP1

LY294002 – – – + Rapamycin – – + – CCL5 – + + +

p-4E-BP1 (Thr 37/46)

4E-BP1

0 5 15 30

+ CCL5 (min)

Figure 3.5. A

B

Thr 70

Thr 37/46

00.5

11.5

22.5

3

0 5 15 30

Time (min)

Fold

Ind

uctio

n

0

1

2

3

0 5 15 30

Time (min)

Fold

Ind

uctio

n

00.5

11.5

22.5

33.5

Fold

Ind

uctio

n

DM

SO (c

arri

er)

LY

2940

02

Rap

amyc

in

DM

SO +

CC

L5

137

Figure 3.6. CCL5-mediated PLD activation regulates T cell migration. (A) Activated PB T cells were pretreated with either ethanol (carrier) or the specified inhibitors for 1hr at the concentrations indicated, and CCL5-mediated chemotaxis measured using 10 nM CCL5. The data are presented as % migration, with the number of migrated cells at 10 nM CCL5 taken as 100%. Data representative of three independent experiments are shown (± S.D.) * p<0.05 (B) T cells were pretreated with either ethanol (carrier), 500 µM 2,3-DPG or 0.1% 1-butanol for 1 hr prior to 15 min treatment with 10 nM CCL5. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-4E-BP1 (Thr-37/46) antibody. Blots were stripped and reprobed with anti-4E-BP1 antibody as a loading control. The relative fold increase of 4E-BP1 phosphorylation is shown as signal intensity over loading control. Data are representative of two independent experiments.

138

1-butanol – – – + 2,3-DPG – – + – CCL5 – + + +

p-4E-BP1 (Thr 37/46)

4E-BP1

Figure 3.6.

A

020

4060

80100

120

0

0.1%

1-b

utan

ol

0.1%

tert

-but

anol

% M

igra

tion

0

20

40

60

80

100

120

0 250 350 500

2,3-DPG (µM)

% M

igra

tion

* *

B

00.5

11.5

22.5

Fold

Indu

ctio

n

eth

anol

(car

rier

)

1-bu

tano

l

2,3-

DPG

etha

nol +

CC

L5

139

eIF4G. As shown in Figure 3.7.A, CCL5 induced an association between eIF4E and

eIF4G. To examine the phosphorylation status of eIF4E, cells were treated with 10 nM

CCL5 and the cell lysates resolved by SDS-PAGE gel electrophoresis. As shown in

Figure 3.7.B, CCL5 induced phosphorylation of eIF4E on Serine-209 after 15 minutes.

In order to directly show increased mRNA translation, sucrose gradient centrifugation

was performed. Cells were treated with CCL5 for 1 hour and RNAs from each fraction

extracted and analyzed by electrophoresis on a 1% denaturing formaldehyde agarose gel

to examine polysome integrity. The distribution of 28S, 18S and 5S rRNA in untreated

cells were visualized by ethidium bromide staining (Figure 3.8, upper panel). CCL5

initiated active translation of mRNA, as shown by the increased presence of high-

molecular-weight polysomes deep in the sucrose gradient (fractions 16-20) (Figure 3.8,

lower panel). Pretreatment with rapamycin inhibited the formation of heavy polysomes.

Viewed altogether, these data show that CCL5 promotes an mTOR-dependent active

translation of mRNA by the eIF4F translation initiation complex.

140

Figure 3.7. CCL5 induces formation of the eIF4F initiation complex. (A) Activated PB T cells were either left untreated or treated with 10 nM CCL5 for 30 min, lysed and immunoprecipitated with either anti-eIF4E or anti-eIF4G antibodies. Samples were resolved by SDS-PAGE and immunoblotted with anti-eIF4E and anti-eIF4G antibody. Whole molecule mouse or rabbit IgG was used as control. (B) Cells were either left untreated or treated with 10 nM CCL5 for the indicated times, then lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-eIF4E (Ser-209) antibody. Membranes were stripped and reprobed for eIF4E as a loading control. Data are representative of two independent experiments. Values denoting the extent of phosphorylation are shown in the right hand panel.

141

0 30 IgG

+ CCL5 (min)

0 30 IgG

+ CCL5 (min)

0 5 15 30

+ CCL5 (min)

p-eIF4E

eIF4E

p-eIF4E

Figure 3.7.

A

IB: eIF4G

IB: eIF4E

IP: eIF4E

IgG (HC)

IB: eIF4E

IB: eIF4G

IP: eIF4G

B

012345

0 5 15 30

Time (min)

Fold

Indu

ctio

n

142

Figure 3.8. CCL5-inducible protein translation enhances mRNA association with polyribosomes. PB T cells were pretreated with either DMSO (carrier) or 50 nM rapamycin for 1 hr, followed by 10 nM CCL5 for 1 hr. Cells were harvested, lysed and lysates layered onto a sucrose gradient. Fractions were collected after centrifugation, RNAs extracted and quantified at optical density (OD) 254 nm. A representative gel profile of fractions from untreated cells is shown to visualize the distribution of 5S, 18S and 28S rRNAs as an indicator of the polyribosome integrity (upper panel). OD readings for each fraction were plotted as a percentage of the total RNA of all fractions and are shown as a function of gradient depth (lower panel). Actively translated mRNA is associated with high-molecular-weight polysomes deep in the gradient (shaded region). Data are representative of two independent experiments.

143

Figure 3.8.

0

2

4

6

8

10

12

14

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

Fraction number

% T

otal

RN

A

Untreated CCL5 CCL5 + Rapamycin

15% Sucrose 40%

28S 18S

40S 60S 80S polysome

5S

144

3.4.5. CCL5-inducible protein translation of cyclin D1 and MMP-9 is mTOR-

dependent

Increased eIF4E availability leads to translation initiation of a subset of mRNAs with

substantial secondary structures in the 5’-UTR (De Benedetti and Graff, 2004). Among

these, both MMP-9 and cyclin D1 have recently been shown to promote cellular motility

(Hu and Ivashkiv, 2006; Khandoga et al., 2006; Li et al., 2006a; Li et al., 2006b;

Neumeister et al., 2003; Xia et al., 1996). Accordingly, we conducted studies to examine

whether CCL5 initiated the translation of cyclin D1 and MMP-9 levels. Serum starved T

cells were pretreated with either DMSO or rapamycin for 1 hour and treated with 10 nM

CCL5 in time course experiments. CCL5 induced upregulation of both cyclin D1 and

MMP-9 protein levels within 60 minutes, whereas rapamycin completely abolished this

induction (Figure 3.9.A). The observed increases in cyclin D1 and MMP-9 protein levels

were not due to increased mRNA transcription, as their mRNA levels remained

unchanged (Figure 3.9.B).

145

Figure 3.9. CCL5-inducible upregulation of cyclin D1 and MMP-9 protein levels is dependent on mTOR-mediated mRNA translation. (A) Activated PB T cells were either pretreated with DMSO (carrier) or 50 nM rapamycin for 1hr prior to treatment with 10 nM CCL5 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-cyclin D1 or anti-MMP-9 antibody. Membranes were stripped and reprobed for β-tubulin as loading control. The relative fold increase of cyclin D1 and MMP-9 protein level is shown as signal intensity over loading control. Data are representative of three independent experiments. (B) T cells were either left untreated or treated with 10 nM CCL5 for 1 hr and the mRNAs extracted. Semi-quantitative RT-PCRs were performed using primer sets specific for cyclin D1, MMP-9 and GAPDH, as described in Materials and Methods. Data are representative of two independent experiments.

146

0 30 60 90

UT + CCL5 (min)

0 30 60 90

Rapamycin + CCL5 (min)

cyclin D1

β-tubulin

0 30 60 90

UT + CCL5 (min)

0 30 60 90

Rapamycin + CCL5 (min)

pro active MMP-9

β-tubulin

Figure 3.9.

0

0.5

1

1.5

2

2.5

0 30 60 90Time (min)

Fold

Indu

ctio

n

Untreated Rapamycin

A Cyclin D1

Active MMP-9

B

ctrl

0 60

Cyclin D1

GAPDH

1:9 1:3 -- 1:9 1:3 --

CCL5 (min)

MMP-9

0

0.5

1

1.5

2

2.5

3

3.5

0 30 60 90

Time (min)

Fold

Indu

ctio

n

147

3.5. Discussion

Chemokines play a crucial role in directing leukocyte migration towards sites of

inflammation during an immune response. Considerable advances have been made

towards understanding the complex signaling cascades coordinating cell migration, which

include the activation of many distinct tyrosine kinases, lipid kinases, and MAPKs.

However, the contribution of mTOR-dependent mRNA translation to chemotaxis has not

been studied. Initial observations with cycloheximide and actinomycin D, inhibitors of

mRNA translation and transcription, respectively, demonstrated the importance of mRNA

translation for CCL5-mediated human T cell chemotaxis.

We have demonstrated that CCL5-mediated migration of activated CD4+ T cells

is partially dependent on mTOR. Once activated, mTOR regulates the translational

machinery by directly affecting eIF4F availability for 5’-capped mRNA translation

initiation and up-regulates ribosomal protein levels through 5’-TOP mRNA translation.

Published reports suggest a role for both mTOR and p70 S6K1 in cellular migration of

various cell types. GM-CSF-mediated neutrophil chemotaxis is inhibited by rapamycin,

wherein phosphorylation of S6K1 is associated with migration (Gomez-Cambronero,

2003; Lehman and Gomez-Cambronero, 2002). Similarly, fibronectin-induced migration

of human arterial E47 smooth muscle cells is sensitive to rapamycin (Sakakibara et al.,

2005). Several chemokines have been reported to activate S6K1, but this activation was

studied in the context of cell survival and proliferation, not migration (Hwang et al.,

2003; Joo et al., 2004; Lee et al., 2002; Loberg et al., 2006). Interestingly, a G protein-

coupled receptor (vGPCR), which belongs to the CXC chemokine receptor family, is

148

encoded by the Kaposi’s sarcoma-associated herpesvirus (KSHV or HHV8) and exhibits

constitutive activity. Ectopic expression and activation induced the TSC2/mTOR

pathway, which played a critical role in Kaposi’s sarcomagenesis by promoting cell

growth (Montaner, 2007; Sodhi et al., 2006). Here, we show the importance of mTOR in

CCL5-CCR5 mediated CD4+ T cell chemotaxis. CCL5 induces rapid

phosphorylation/activation of mTOR and S6K1. Several downstream effectors of S6K1

have been identified including rpS6, eIF4B and eEF2 (Proud, 2007; Ruvinsky and

Meyuhas, 2006). S6K1 activation favorably promotes translation by directly

phosphorylating eIF4B to assist eIF4A helicase in unwinding RNA secondary structure

(Raught et al., 2004). The role for rpS6 is less well understood, previously believed to be

associated with 5’ TOP mRNA translation. However, studies with knock-in mice in

which all five regulated sites of S6 phosphorylation were altered to alanines (S6[5A])

demonstrated that rpS6 is not required for 5’TOP mRNA translation, but rather for

controlling cell size (Ruvinsky et al., 2005). Nevertheless, phosphorylation of rpS6

remains an important readout for S6K1 activity.

mTOR also phosphorylates the mRNA translational repressor, 4E-BP1, in a

sequential manner (Brunn et al., 1997; Burnett et al., 1998). mTOR phosphorylates

Threonine-37/46, followed by phosphorylation of Threonine-70 and Serine-65, ultimately

leading to its release from eIF4E. Here we show CCL5 mediates a rapid phosphorylation

of 4E-BP1 on both Threonine-37/46 and Threonine-70 sites. Phosphorylation of

Threonine-37/46 is dependent on PI-3’K, PLD and mTOR. Therefore, the data indicate

that CCL5-mediated activation of the PI-3’K and PLD signaling pathways may converge

149

at the level of mTOR to modulate downstream 4E-BP1 phosphorylation. 4E-BP1 hyper-

phosphorylation releases eIF4E to allow for association with the scaffold protein eIF4G,

which along with the RNA helicase eIF4A, forms the eIF4F hetero-trimeric initiation

complex (Richter and Sonenberg, 2005; von der Haar et al., 2004). By binding to the 5’-

cap structure of mRNA through eIF4E, the eIF4F initiation complex facilitates ribosome

binding and its passage along the 5’-UTR towards the initiation codon. eIF4E is also

directly phosphorylated on Serine-209 by Mnk1/2, although the physiological relevance

is still unclear. Several reports demonstrated that phosphorylated eIF4E actually had

reduced m7G cap-binding ability (McKendrick et al., 2001; Scheper et al., 2002). Proud

and colleagues suggested that phosphorylation of eIF4E may allow the eIF4F complex to

detach from the 5’-cap during scanning to either accelerate translation or to allow a

second initiation complex to bind the mRNA (Proud, 2007). Our data support this model,

as phosphorylation of eIF4E was not evident until 15 minutes post CCL5 treatment

(Figure 3.7.B). This allows time for eIF4E to bind the cap structure and recruit

eIF4G/eIF4A and other associated factors such as eIF3 and the 40S subunit before the

complex is released for scanning. Consistent with this, CCL5 initiated active translation

of mRNA, as shown by increased presence of high-molecular-weight polysomes deep in

the sucrose gradient we analyzed (fractions 16-20). The presence of polysomes was

significantly reduced in the presence of rapamycin, further supporting the role for mTOR

in translation initiation.

It is well known that cap structures at the 5' end of mRNA are required for

efficient translation, nuclear export and protection from 5' exonucleases. Once bound by

150

eIF4F, ribosome binding and scanning can commence along the 5’-UTR towards the

initiation codon. Unlike mRNAs with short 5’UTRs (e.g. β-actin), a subset of mRNAs

with lengthy, highly structured 5’UTRs are poorly translated when eIF4F levels are low

(De Benedetti and Graff, 2004; Graff and Zimmer, 2003). Among these, cyclin D1 and

MMP-9 have been implicated in cellular migration of a number of cell types (Hu and

Ivashkiv, 2006; Khandoga et al., 2006; Li et al., 2006a; Li et al., 2006b; Neumeister et al.,

2003; Sun et al., 2001). Li and colleagues showed that cyclin D1-deficient mouse

embryo fibroblasts (MEFs) exhibited increased adhesion and decreased motility

compared to wildtype MEFs (Li et al., 2006b). Migratory defects in cyclin D1-deficient

MEFs were not a direct consequence of reduced DNA synthesis, but rather through de-

repression of ROCKII and TSP-1 expression. Use of PI-3’K and mTOR inhibitors in

cancer cell lines decreased cyclin D1 levels, where eIF4E over-expression led to its

increased production (Gao et al., 2004; Pene et al., 2002; Rosenwald et al., 1995;

Rosenwald et al., 1993). IL-8 has been shown to up-regulate cyclin D1 at the level of

translation in prostate cancer cell lines (MacManus et al., 2007). Similarly, in MMP-9

knockout mice, bone marrow-derived dendritic cell (BM-DC) migration to CCL19 was

impaired, and anti-MMP-9 antibody reduced CCL5-mediated migration of IFNα DCs

(Hu and Ivashkiv, 2006). Therefore, we investigated the ability of CCL5 to initiate

translation of both cyclin D1 and MMP-9 in T cells. Rapamycin-sensitive upregulation

of cyclin D1 and MMP-9 protein levels occurred within 1 hour of CCL5 treatment. Up-

regulation of protein levels was not due to increased transcription since we did not

observe significant mRNA synthesis of these genes within this time frame. Interestingly,

others have shown that CCL5-mediated increases in MMP-9 protein levels are detectable

151

early without significant upregulation of mRNA, indicating that the early effect of CCL5

on MMP-9 secretion was independent of mRNA synthesis (Chabot et al., 2006). Since T

cell chemotactic migration through a model basement membrane depends on the

degradation of matrix proteins by MMP-9, rapid production of the protease during the

early stages of cellular migration is critical in vivo (Xia et al., 1996).

Gomez-Mouton and colleagues used real-time microscopy to elegantly

demonstrate that CCR5-positive Jurkat T cells respond to CCL5 almost instantaneously,

forming a leading edge and directional migration towards the source of chemokines

(Gomez-Mouton et al., 2004). In a typical chemotaxis assay, migrated cells are collected

and counted after 2 hours of incubation, but as demonstrated by real-time microscopy, T

cells likely do not take 2 hours to migrate through the membrane pores. We have

unpublished data demonstrating that rapamycin does not affect CCL5-mediated actin

polymerization, indicating that mTOR plays no role in the initial stages of migration.

Rather, CCL5-mediated translation initiation may contribute to the rapid synthesis of

chemotaxis-related proteins to “prime” T cells for effective directed migration (Figure

3.10.). CCR5 is the receptor for several chemokines, specifically CCL3, CCL4, and

CCL5. We observe that CCL3 and CCL5 differentially activate mTOR signaling. mTOR

and mTOR-mediated signaling seem to be dispensable for CCL3-mediated T cell

chemotaxis. Notably, CCL3-CCR5 mediated chemotaxis of T cells is considerably less

effective than CCL5-CCR5-mediated T cell chemotaxis. It is intriguing to speculate that

CCR5-indicible activation of mTOR signaling may contribute to this differential potency.

The identification of additional proteins that are regulated by CCL5 at the level of

152

Figure 3.10. Possible model for CCL5-mediated mRNA translation in CD4+ Tcells. CCL5 activates the mTOR pathway and subsequent phosphorylation of p70 S6K1 and 4E-BP1. Hyper-phosphorylation of 4E-BP1 leads to its release from eIF4E where it binds to eIF4G to form the eIF4F initiation complex. Through eIF4E, eIF4F binds to the mRNA 5’-cap structure and facilitates ribosome binding and unwinding secondary structure in the 5’-UTR. Translation initiation leads to a rapid upregulation of cyclin D1 and MMP-9 protein levels to “prime” T cells for directed cell migration. S6K1 has been shown to phosphorylate eIF4B (RNA-binding protein that enhances activity of the eIF4A helicase) in response to insulin (dotted line).

153

Figure 3.10.

CCL5

mTOR

S6K

rpS6

4E-BP1

eIF4E

?

Cyclin D1 MMP-9 eIF4E

eIF4G eIF4A

eIF4B

AUG

Cell Migration

CCR5

PI-3’KPLD

154

translation is currently under investigation. Translational control generates a rapid

production of proteins without the need for mRNA transcription, processing and export

into the cytoplasm. As migratory responses must be both initiated and resolved with

speed and precision, it is beneficial that chemokines can effect translation and rapidly

influence the protein pool within the migrating cell. Our data describe a novel

mechanism by which the chemokine CCL5 may regulate translation of mRNAs that

encode proteins involved in T cell migration, such as cyclin D1 and MMP-9.

Additionally, our data suggest a mechanism for the immunosuppressive effects of

rapamycin, possibly by limiting host immune cell migration.

155

Chapter 4

CCL5 Promotes Breast Cancer Progression through mTOR/4E-BP1 dependent mRNA Translation

Thomas T. Murooka*, Ramtin Rahbar* and Eleanor N. Fish*1

*Division of Cellular and Molecular Biology, Toronto General Research Institute, University Health Network & Department of Immunology, University of Toronto

Chapter 4 is a manuscript submitted as:

Murooka, T.T., Rahbar, R. and Fish, E.N. CCL5 promotes breast cancer proliferation

through mTOR/4E-BP1 dependent mRNA translation.

T.T.M. performed all experiments, analyzed the data and drafted the manuscript. R.R. analyzed the data and edited the manuscript.

E.N.F. designed research, analyzed the data and drafted the manuscript.

156

4.1. Abstract

The proliferative capacity of breast cancer cells is regulated by factors intrinsic to

the cancer cells and by secreted factors in the microenvironment. Accumulating

evidence identifies a role for chemokines and their cognate receptors in cancer

progression and metastasis. Here, we investigated the proto-oncogenic potential of the

chemokine receptor, CCR5, when expressed in the breast cancer cell line, MCF-7. At

physiological levels, CCL5, a ligand for CCR5, enhanced MCF-7.CCR5 proliferation.

Treatment with the mTOR inhibitor, rapamycin, inhibited this CCL5-inducible

proliferation. Because mTOR is known to directly modulate mRNA translation, we

investigated whether CCL5 activation of CCR5 leads to increased translation. CCL5

induced the formation of the eIF4F translation initiation complex through an mTOR-

dependent process. Indeed, CCL5 initiated mRNA translation, shown by an increase in

high molecular-weight polysomes. Specifically, we show that CCL5 mediated a rapid

up-regulation of protein expression for cyclin D1, c-Myc and Dad-1, without affecting

their mRNA levels. CCL5 increased the recruitment of cyclin D1 and Dad-1 mRNAs to

polysomes, indicating that their protein expression was regulated at the level of

translation. Taken together, we describe a mechanism by which CCL5 influences

translation of rapamycin-sensitive mRNAs, thereby providing CCR5-positive breast

cancer cells with a proliferative advantage.

157

4.2. Introduction

A functional relationship exists between inflammation and tumor initiation/

progression. Different growth factors, cytokines, chemokines and angiogenic mediators

are found at chronic inflammatory sites, thereby creating a micro-environment suitable

for neoplastic growth (O'Hayre et al., 2008). Given that chemokines are important

mediators of inflammation by actively recruiting leukocytes and regulating cytokine

expression, there is considerable interest in chemokine/chemokine receptor dysregulation

in tumor biology. Chemokines play a critical role in all aspects of tumorigenesis,

including the control of leukocyte infiltration into tumors, initiation of primary tumor

growth, survival, invasion and organ-specific metastasis (Muller et al., 2001; O'Hayre et

al., 2008; Raman et al., 2007).

The chemokine family of chemotactic proteins contains one to three disulfide

bonds and is classified as homeostatic or inflammatory. Secreted by a number of cell

types, chemokines bind to glycosaminoglycans (GAGs) expressed on proteoglycan

components of the cell surface and extracellular matrix, and interact with seven

transmembrane G protein-coupled receptors (GPCRs). CCL5/RANTES is a member of

the β-chemokines and is chemotactic for T cells, macrophages, NK cells and eosinophils

through CCR1 and/or CCR5 (Kameyoshi et al., 1992; Schall et al., 1990; Taub et al.,

1995). Additionally, CCR5-mediated signaling controls cellular proliferation, cytokine

production, survival and apoptosis (Bacon et al., 1995; Bacon et al., 1998; Bacon et al.,

1996; Dairaghi et al., 1998; Ganju et al., 2000; Ganju et al., 1998; Murooka et al., 2006;

Rahbar et al., 2006; Tyner et al., 2005). Several studies have demonstrated a pivotal role

158

for the CCL5/CCR5 axis in breast cancer progression. CCL5 was reported to be highly

expressed in high grade tumors and was a predictor of rapid disease progression in stage

II breast cancer patients (Azenshtein et al., 2002; Luboshits et al., 1999; Niwa et al.,

2001; Yaal-Hahoshen et al., 2006). Additionally, serum CCL5 levels were elevated in

patients with high grade tumors compared to low grade tumors (Niwa et al., 2001).

Breast cancer cell lines have been shown to respond to and migrate towards CCL5, as

well as express physiological levels of CCL5 in culture (Azenshtein et al., 2002;

Luboshits et al., 1999; Robinson et al., 2003; Youngs et al., 1997). Finally, the CCR5

antagonist Met-CCL5 significantly reduced recruitment of macrophages and T cells into

tumors, resulting in a reduction in tumor mass in mice (Robinson et al., 2003). Viewed

altogether, these studies demonstrate that CCL5 can influence breast cancer progression

directly by affecting tumor survival and proliferation, or indirectly by recruiting tumor-

promoting inflammatory cells.

mTOR is a crucial regulator of the translational machinery by controlling S6K1

and 4E-BP1 phosphorylation/activation in multiple cellular processes, including

metabolism, nutrient sensing, translation and cell growth (Gingras et al., 2004;

Wullschleger et al., 2006). We have previously shown that CCL5 initiates mRNA

translation through mTOR/4E-BP1, thereby modulating CD4+ T cell chemotaxis

(Murooka et al., 2008). mTOR regulates mRNA translation by controlling the

availability of eIF4E through 4E-BP1 phosphorylation (Beretta et al., 1996). The eIF4F

complex, which is comprised of an eIF4G backbone, the cap-binding eIF4E and the RNA

helicase eIF4A, binds the mRNA 5’-cap structure (m7GpppN). eIF4F unwinds the

159

secondary structure in the 5'-untranslated region (UTR) of mRNA and facilitates binding

of the mRNA to the 40S ribosomal subunit (Richter and Sonenberg, 2005; von der Haar

et al., 2004). In addition, mTOR controls the translation of 5’-TOP (tract of

oligopyrimidines) mRNAs which often encode for cytoplasmic ribosomal proteins

(Meyuhas, 2000). Taken together, mTOR regulates the translation of a subset of mRNAs

with lengthy, highly structured 5’-UTRs, which typically encode growth and survival

proteins (Graff and Zimmer, 2003; Mamane et al., 2007).

Here, we demonstrate that the CCL5/CCR5 signaling axis can directly stimulate

growth of breast cancer cells through an mTOR-dependent mechanism. We show that

ectopic expression of CCR5 provides MCF-7 cells with a proliferative advantage when

cultured in the presence of exogenous CCL5. Through the formation of the eIF4F

translation initiation complex, CCL5 actively promotes mRNA translation, specifically of

cyclin D1, c-Myc and defender against cell death-1 (Dad-1). The data illustrate the

potential for breast cancer cells to exploit downstream chemokine signaling pathways for

their proliferative and survival advantage through expression of appropriate chemokine

receptors.

160

4.3. Materials and Methods

4.3.1. Cells and reagents

MCF-7 breast cancer cells were a generous gift from Dr. Jeffery Medin (Division

of Experimental Therapeutics, Toronto General Research Institute). Cells were

maintained in DMEM supplemented with 10% fetal calf serum, 100 units/ml penicillin,

100 mg/ml streptomycin and 2 mM L-glutamine (Gibco-BRL). Antibodies for eIF4E and

4E-BP1 were purchased from Cell Signaling Technology. Antibody for human cyclin D1

(DCS-6), eIF4G (H-300), phospho-Erk (E-4) and Erk1 (K-23) were purchased from Santa

Cruz Biotechnology (Santa Cruz, USA). Murine monoclonal anti-β-actin antibody was

purchased from Sigma-Aldrich. Anti-Dad-1 antibody was purchased from Abcam

(Cambridge, MA). Anti-CCR5 antibody was purchased from BD Biosciences. Anti-c-

Myc antibody was a generous gift from Dr. Linda Penn (Ontario Cancer Institute,

Toronto, Canada). CCL5 was a generous gift from Dr. Amanda Proudfoot (Geneva

Research Centre, Merck Serono International). 7-methyl GTP-Sepharose beads were

purchased from Amersham Biosciences. Rapamycin was obtained from Calbiochem and

resuspended in DMSO.

4.3.2. Plasmid Constructs

Full-length human CCR5 cDNA was generated by PCR using the pEF.BOS-

CCR5 vector, as previously described (Rahbar et al., 2006). Specific human CCR5

forward and reverse primers containing the BamH1 and NotI restriction sites,

respectively, and the FLAG epitope DYKDDDDK on the N-terminus, were used: FP 5’

ggatccatggactacaaggacgatgatgac gccgattatcaagtgtcaagtcca 3’ RP 5’

161

tgcggccgctcacaagcccacagatatttc 3’ (95°C 1 min, 64°C 30 sec, 72°C 75 sec, 30 cycles).

Human CCR5 was subcloned into pcDNA3.1+/Zeo+ vector (Invitrogen) and the

orientation and integrity of the insert confirmed by DNA sequencing (ACGT Corp.,

Toronto, Canada). To establish the MCF-7.CCR5 cell line, subconfluent MCF-7 cells in

6-well tissue culture dishes were transfected with 1 µg of either pcDNA3.1 or

pcDNA3.1/FLAG-CCR5 expression plasmids using Fugene-6 according to the

manufacturer’s protocol (Roche). Cells were selected in 250 µg/ml zeocin for 4 weeks

and FACS sorted for CCR5-positive clones. Stable CCR5 transfectant cell lines were

designated MCF-7.CCR5, whereas cells transfected with vector were designated MCF-

7.vector.

4.3.3. Proliferation Assay

MCF-7.vector and MCF-7.CCR5 cells (5 x 103) were seeded into 24-well plates in

DMEM/2% fetal calf serum (FCS). Cells were incubated with either 1 or 10 nM CCL5

for the days indicated, collected and counted with a hemocytometer. Cells were fed with

fresh media and CCL5 every other day. In CCR5 blocking studies, cells were pretreated

with the anti-CCR5 antibody (5 µg/mL) for 1 hour prior to CCL5 stimulation. To

determine the role of mTOR, cells were pretreated with rapamycin at the indicated doses

for 1 hour prior to CCL5 stimulation. Cells were subsequently fed with fresh media

containing rapamycin and CCL5 every other day.

4.3.4. Immunoblotting and immunoprecipitation

162

MCF-7.CCR5 cells (4 x 105) were serum starved in DMEM/0.5% BSA + 0.5%

fetal calf serum (FCS) to reduce the effects of the various growth factors found in fetal

calf serum on mTOR and protein translation. Cells were incubated with 10 nM CCL5 for

the times indicated, collected, washed with ice-cold PBS and lysed in 200 μl lysis buffer

(1% Triton X-100, 0.5% NP-40, 150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA,

1 mM EGTA, 0.2 mM PMSF, 10 µg/ml aprotinin, 2 µg/ml leupeptin, 2 µg/ml pepstatin

A). In experiments where rapamycin was used, MCF-7.CCR5 cells were pretreated for 1

hour prior to CCL5 treatment. Protein concentration was determined using the Bio-Rad

DC protein assay kit (BioRad laboratories). 30 μg of protein lysate was denatured in

sample reducing buffer and resolved by SDS-PAGE gel electrophoresis. The separated

proteins were transferred to a nitrocellulose membrane followed by blocking with 5%

BSA (w/v) in TBS for 1 hour at room temperature. Membranes were probed with the

specified antibodies overnight in 5% BSA (w/v) in TBST (0.1% Tween-20) at 4°C and

the respective proteins visualized using the ECL detection system (Pierce). For

immunoprecipitations using 7-methyl GTP-sepharose beads, 30 µl of beads were added

to 500 µg of protein lysates. 30 µl of unconjugated sepharose beads were used as

negative control. Beads were washed three times with lysis buffer, denatured in 5X

sample reducing buffer and resolved by SDS-PAGE gel electrophoresis.

4.3.5. Flow Cytometric Analysis

1 x 106 cells were incubated with mouse anti-human CCR5 antibody for 45

minutes on ice and washed three times with ice-cold FACS buffer (PBS/2% FCS). Cells

were then incubated with FITC-conjugated anti-mouse IgG antibody (eBiosciences).

163

Cells incubated with FITC-conjugated anti-mouse IgG antibody alone was used as

control. Cells were analyzed using the FACSCalibur and CellQuest software (BD

Biosciences).

4.3.6. Polysome gradients

MCF-7.CCR5 cells were serum-starved and treated with 10 nM CCL5 for 1 hour

before lysis in ice-cold Nonidet P-40 lysis buffer (10 mM Tris-HCl (pH 8.0), 140 mM

NaCl, 1.5 mM MgCl2, and 0.5% Nonidet P-40) supplemented with RNaseOut RNase

inhibitor (Invitrogen) at a final concentration of 500 U/ml. Nuclei were removed by

centrifugation at 3,000 x g for 2 minutes at 4 ºC. The supernatant was supplemented with

150 µg/ml cycloheximide, 20 mM DTT and 1 mM PMSF and centrifuged at 15,000 x g

for 5 minutes at 4 ºC to eliminate mitochondria. The supernatant was then layered onto a

30 ml linear sucrose gradient (15-40% sucrose (w/v) supplemented with 10 mM Tris-HCl

(pH 7.5), 140 mM NaCl, 1.5 mM MgCl2, 10 mM DTT, 100 µg/ml cycloheximide) and

centrifuged in a SW32 swing-out rotor (Beckman) at 32,000 rpm for 2 hours at 4 ºC

without a brake. Fractions (1 mL) were carefully collected from the center of the column

using a pipette and digested with 100 µg of proteinase K in 1% SDS and 10 mM EDTA

for 30 minutes at 37 ºC. RNAs were extracted by phenol-chloroform-isoamyl alcohol

followed by ethanol precipitation and dissolved in 20 µl RNase free water before being

analyzed by electrophoresis on 1.2% agarose gels to examine polysome integrity. RNA

from each fraction was quantified at optical density (OD) of 254 nm. OD readings for

each fraction were plotted as a percentage of the total RNA of all fractions to facilitate

visual comparisons, and are shown as a function of gradient depth.

164

4.3.7. RT-PCR

Total RNA was isolated using the RNease Mini-Kit (Qiagen). For the reverse

transcription reaction, 1 µg of total RNA or 1 µl of each polysome fraction were used.

For semi-quantitative PCR of total RNA, cDNAs were diluted 1:3 and 1:9 in water and

used for subsequent amplification of human cyclin D1, c-Myc, Dad-1, PKR and β-actin

using the following primers and conditions: cyclin D1, FP 5’ atggaacaccagctcctgtgctgc 3’

RP 5’ tcagatgtccacgtcccgcacgt 3’ (95°C 1 min, 65.5°C 30 sec, 72°C 1 min, 23 cycles); c-

Myc, FP 5’ cccggaattcgcccctcaacgttagcttc 3’ RP 5’

atagtttagcggccgctcacgcacaagagttccgtagctg 3’ (95°C 1 min, 58°C 30 sec, 72°C 1 min, 28

cycles); Dad-1, FP 5' agttcggttactgtctcctcg 3' RP 5' tgtgtccataagctgccatc 3' (95°C 1 min,

54°C 40 sec, 72°C 30 sec, 28 cycles); PKR, FP 5’ gccttttcatccaaatggaattc 3’ RP 5’

gaaatctgttctgggctcatg 3’ (95°C 1 min, 60°C 40 sec, 72°C 30 sec, 28 cycles); β-actin, FP

5’ tagcggggttcacccacactgtgccccatcta 3’ RP 5’ ctagaagcatttgcggtggaccgatggaggg 3’ (95°C

1 min, 58°C 40 sec, 72°C 1 min, 23 cycles). For polysomal PCR, 1 µl of cDNA from

each fraction was used. Aliquots were loaded onto 1-1.2% agarose gels and visualized

with ethidium bromide staining.

4.3.8. Statistical Analysis

Two-tailed t-test was used to determine the statistical significance of differences

between groups.

165

4.4. Results

4.4.1. CCL5-CCR5 inducible MCF-7 proliferation is dependent on mTOR.

There is evidence that MCF-7 breast cancer cells migrate

towards CCL5 in a G-protein dependent manner (Youngs et al., 1997). However, the

MCF-7 cells provided to us did not express cell surface CCR1 or CCR5, as

determined by FACS analysis (Figure 4.1.A). This may reflect the

heterogeneity of different MCF-7 cell lines (Prest et al., 1999). Thus, the stable sub-cell

lines MCF-7.vector and MCF-7.CCR5 were created, as described in Materials &

Methods, to examine the potential proto-oncogenic role of CCR5. Cell surface CCR5

expression was confirmed in the transfected cells by FACS analysis (Figure 4.1.A). To

examine their proliferative capacity, MCF-7.vector and MCF-7.CCR5 cells were cultured

in the presence of 1 and 10 nM CCL5 for up to 5 days. We observed a significant

increase in cell number on day 5 in MCF-7.CCR5 cells grown in the presence of 10 nM

CCL5, which was not observed in MCF-7.vector cells (Figure 4.1.B). The presence of

anti-CCR5 antibody abrogated this CCL5-induced growth effect (Figure 4.1.B, right

panel). Subsequent experiments examined the role of mTOR and mRNA translational

events in this CCL5-CCR5 mediated proliferation. As shown in Figure 4.1.C, rapamycin

significantly reduced CCL5-mediated MCF-7.CCR5 proliferation. The data suggest that

CCL5-induced proliferation may be dependent on mTOR activation. Notably, treatment

of MCF-7 cells with 10 and 50 nM rapamycin resulted in growth inhibition (Figure

4.1.C), underscoring the role mTOR plays in MCF-7 breast tumor growth (Noh et al.,

2007; Noh et al., 2004).

166

Figure 4.1. CCL5-mediated MCF-7 proliferation is dependent on mTOR. (A) MCF-7 cells were transfected with either pcDNA3 vector or pcDNA.CCR5 plasmid and selected for 4 weeks. Stable sub-cell lines were stained with anti-CCR5 (solid line) or isotype controls (dotted line) and analyzed by FACS. (B) 5 x 103 MCF-7.vector or MCF-7.CCR5 cells were seeded into 24 well plates and stimulated with CCL5. Cells were fed with fresh media containing the indicated doses of CCL5 every other day. MCF-7.CCR5 cells were pretreated with 5 µg/ml anti-CCR5 mAb (2D7) for 1 hr prior to CCL5 stimulation. Cells were trypsinized and counted with a hemocytometer. * p<0.05 (C) MCF-7.CCR5 cells were pretreated with either DMSO (carrier) or rapamycin at the indicated doses for 1 hr prior to CCL5 stimulation. Cells were fed with fresh media containing the indicated doses of rapamycin and CCL5 every other day. The data represent means ± S.D. of 3 independent experiments. * p<0.05

167

Figure 4.1.

Untreated

10nM Rapamycin Alone

50nM Rapamycin Alone

10nM CCL5

10nM Rapamycin + 10nM CCL5

50nM Rapamycin + 10nM CCL5

Untreated

1nM CCL5

10nM CCL5

Anti-CCR5 mAb

Anti-CCR5 mAb + 10nM CCL5

0

20000

40000

60000

80000

100000

120000

140000

0 5

0

20000

40000

60000

80000

100000

120000

140000

0 4 5

A

C

B

0

20000

40000

60000

80000

100000

120000

140000

0 4 5

MCF-7.vector

Cel

l num

ber

Time (Days) Time (Days)

MCF-7.CCR5

MCF-7.CCR5

Time (Days)

MCF-7.vector

CCR5

MCF-7.CCR5

CCR5

Cel

l num

ber

Cel

l num

ber

*

**

*

168

4.4.2. CCL5 activation of CCR5 leads to the formation of the eIF4F complex through

mTOR.

mTOR regulates eIF4E availability through 4E-BP1 phosphorylation (Richter and

Sonenberg, 2005). To determine whether CCL5 activation of CCR5 mediates the

formation of the eIF4F complex, MCF-7.CCR5 cells were treated with CCL5 for up to 60

min in the presence or absence of 50 nM rapamycin. 7-methyl GTP conjugated

sepharose beads that mimic the 5’ cap, was used to affinity pull-down eIF4E cell lysates

(Haller and Sarnow, 1997). As shown in Figure 4.2.A, treatment with 10 nM CCL5 led

to the dissociation of eIF4E and 4E-BP1, which was sensitive to rapamycin treatment.

The consequent CCL5-induced association of eIF4E with eIF4G was likewise blocked by

treatment with rapamycin. These findings suggest that CCL5-CCR5 interactions result in

the formation of the eIF4F translation initiation complex.

In subsequent experiments, we demonstrated that CCL5 increased mRNA

translation, using sucrose gradient centrifugation to isolate polysome fractions. MCF-

7.CCR5 cells were treated with 10 nM CCL5 for 1 hour, then cell extracts subjected to

sucrose gradient centrifugation and serial fractions collected. RNA from each fraction

extracted was analyzed by agarose gel electrophoresis to ensure polysome integrity. The

distribution of 18S and 28S rRNA in fractions derived from cells either treated with

CCL5 or left untreated was visualized by ethidium bromide staining (Figure 4.2.B, upper

panel). CCL5 initiated active translation of mRNA, as shown by the increased presence

of high-molecular-weight polysomes deep in the sucrose gradient (fractions 17-20)

169

Figure 4.2. CCL5 induces formation of the eIF4F initiation complex and enhances mRNA association with polyribosomes. (A) 1 x 106 MCF-7.CCR5 cells were pretreated with either DMSO (carrier) or 50 nM rapamycin for 1 hr prior to 10 nM CCL5 treatment for the indicated times. Cells were lysed and immunoprecipitated with 7-methyl GTP sepharose beads overnight. Beads were washed, resolved by SDS-PAGE and immunoblotted with anti-eIF4E, anti-eIF4G or anti-4E-BP1 antibodies. Unconjugated sepharose beads were used as negative control (neg). (B) MCF-7.CCR5 cells were pretreated with either DMSO (carrier) or 50 nM rapamycin for 1 hr, followed by 10 nM CCL5 for 1 hr. Cells were harvested, lysed and lysates layered onto a sucrose gradient. Fractions were collected after centrifugation, RNAs extracted and quantified at optical density (OD) 254 nm. Representative gel profile of fractions from untreated and CCL5-treated cells are shown to visualize the distribution of 5S, 18S and 28S rRNAs as an indicator of the polyribosome integrity (upper panel). OD readings for each fraction were plotted as a percentage of the total RNA of all fractions and are shown as a function of gradient depth (lower panel). Actively translated mRNA is associated with high-molecular-weight polysomes deep in the gradient (shaded region). Data are representative of two independent experiments.

Figure 4.2.

170

- - - + + +0 30 60 0 30 60

Rapamycin eIF4E

eIF4G

4E-BP1

A

Rapamycin eIF4E

CCL5 (min) 7-methyl GTP Sepharose neg

- - - + + +CCL5 (min) 0 30 60 0 30 60

7-methyl GTP Sepharose neg

CCL5

Untreated

15% Sucrose 40%

Untreated CCL5 CCL5 + Rapamycin

0

2

4

6

8

10

12

14

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Fraction number

% T

otal

RN

A

B

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Fraction #

171

(Figure 4.2.B, lower panel). Pretreatment with rapamycin inhibited the formation of

heavy polysomes. Viewed together, these data suggest that CCL5 may exert its

proliferative effect by actively translating mRNAs involved in cell growth and survival.

4.4.3. CCL5 induces protein translation of proliferation and survival proteins.

Increased eIF4E availability leads to translation initiation of a subset of mRNAs

with substantial secondary structures in their 5’-UTR. A large number of these mRNAs

encode for proliferation and survival proteins (Graff and Zimmer, 2003; Mamane et al.,

2007). Accordingly, we conducted studies to examine whether CCL5 initiated the

translation of cyclin D1, c-Myc and Dad-1, because of their well-studied roles in cell

cycle progression and survival. In time course studies, MCF-7.CCR5 cells were

pretreated with either DMSO (carrier) or rapamycin for 1 hour prior to treatment with 10

nM CCL5. CCL5 treatment rapidly up-regulated cyclin D1, c-Myc and Dad-1 protein

levels in a time dependent manner, whereas rapamycin treatment reduced their induction

(Figure 4.3.A). Notably, rapamycin treatment did not affect CCL5-mediated Erk1/2

phosphorylation, consistent with data that mTOR is not placed upstream of Erk1/2

(Steelman et al., 2008). We provide evidence that the increases in cyclin D1, c-Myc and

Dad-1 protein levels were not due to increased gene transcription, as their mRNA levels

remained unchanged after 1 hour of CCL5 treatment (Figure 4.3.B).

172

Figure 4.3. CCL5 mediates upregulation of proliferative and survival proteins through a mTOR dependent mechanism. (A) MCF-7.CCR5 cells were either pretreated with DMSO (carrier) or 50 nM rapamycin for 1 hr prior to treatment with 10 nM CCL5 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-cyclin D1, anti-Dad-1, anti-c-Myc, anti-phospho-Erk1/2, anti-Erk1/2 or β-actin. Data are representative of two independent experiments. (B) MCF-7.CCR5 cells were either pretreated with DMSO or 50 nM rapamycin for 1 hr prior to treatment with 10 nM CCL5 for 1hr and total mRNAs extracted. RT-PCR (undiluted, 1:3, 1:9) was performed using primer sets specific for cyclin D1, Dad-1, β-actin, c-Myc and PKR, as described in Materials and Methods.

173

Figure 4.3.

cyclin D1

β-actin

0 0.5 1 2 0 0.5 1 2

Dad-1p-Erk1/2 Erk1/2

c-Myc

β-actin

CCL5 Rapamycin + CCL5 A

B

β-actin

Dad-1

cyclin D1

UT CCL5 Rapamycin + CCL5

PKR

c-Myc

hrs:

174

4.4.4. CCL5 facilitates recruitment of a subset of mRNAs to polysomes.

To rule out the possibility that CCL5-mediated increases in protein expression

was due to effects on protein stability, the distribution of cyclin D1 and Dad-1 mRNA

along the sucrose density gradient was examined. MCF-7.CCR5 cells were pretreated

with either DMSO (carrier) or 50 nM rapamycin, then treated with 10 nM CCL5 for 1

hour. Cell extracts were subjected to sucrose density centrifugation, fractions collected

and RNA prepared. RT-PCR was performed on each fraction, the cDNAs analyzed by

agarose gel electrophoresis, and each amplified band was quantified by densitometry.

Total RNA was designated as the sum of the band density values of all fractions. As

shown in Figure 4.4., CCL5 induced the shifting of Dad-1 and cyclin D1 mRNAs to

heavier polysome fractions, which was inhibited by rapamycin. CCL5 did not induce the

accumulation of ß-actin mRNA to polysomes. In addition we included analysis of RNA

for PKR, a protein not known to be regulated by CCL5. Both ß-actin and PKR mRNA

profiles in the sucrose gradient were largely unaffected by rapamycin. The data suggest

that CCL5 facilitates the recruitment of a subset of mRNAs to polysomes in a

rapamycin–sensitive manner, thereby regulating their protein levels.

175

Figure 4.4. CCL5 faciliates recruitment of a subset of mRNAs to polysomes. (A) MCF-7.CCR5 cells were either pretreated with DMSO or 50 nM rapamycin for 1 hr prior to treatment with CCL5 for 1 hr. RNA from 20 fractions was extracted and reverse transcribed into cDNA. RT-PCR was performed to assess mRNA levels of cyclin D1, Dad-1, β-actin and PKR within each fraction. Aliquots from each reaction was loaded onto an agarose gel and visualized by ethidium bromide. Amplified PCR bands from fractions were quantified by densitometry and plotted as a % of total RNA to the right of each gel. Polysomes are found in fractions 17-20 (shaded region). Data are representative of two independent experiments.

176

Figure 4.4.

Fraction #

polysome

Fraction #: 1 3 5 7 9 11 12 13 14 15 16 17 18 19 20

Rapamycin +CCL5

Dad-1 UT

CCL5

polysome

Fraction #: 1 3 5 7 9 11 12 13 14 15 16 17 18 19 20

Rapamycin +CCL5

β-actin

UT CCL5

polysome

Fraction #: 1 3 5 7 9 11 12 13 14 15 16 17 18 19 20

Rapamycin +CCL5

PKR UT

CCL5

0

2

46

8

10

12

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

-1

4

9

14

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

02468

101214

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

polysome

Fraction #: 1 3 5 7 9 11 12 13 14 15 16 17 18 19 20

Rapamycin +CCL5

cyclin D1 UT

CCL5

Untreated

CCL5

CCL5 + Rapamycin

% to

tal R

NA

%

tota

l RN

A

% to

tal R

NA

0

2

4

6

8

10

12

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

% to

tal R

NA

177

4.5. Discussion

The tumor microenvironment comprises growth factors, cytokines, chemokines

and angiogenic factors. Many of these biological response modifiers activate signaling

cascades in the tumor cell leading to 4E-BP1 phosphorylation. Indeed, 4E-BP1

phosphorylation is increased in a number of cancers, and this increased phosphorylation

has been shown to correlate with poor breast cancer prognosis (Armengol et al., 2007).

Similarly, eIF4E over-expression has been associated with the malignant progression of

different cancers including breast, colon, lung and prostate (De Benedetti and Graff,

2004; Graff et al., 2008; Zhou et al., 2006). We have previously shown that CCL5

activation of CCR5 initiates mRNA translation through an mTOR/4E-BP1 signaling

cascade, thereby modulating CD4+ T cell chemotaxis (Murooka et al., 2008). In the

present study, we provide evidence that CCL5 activation of CCR5 results in signaling

mediated by the mTOR/4E-BP1 pathway that offers a proliferative advantage to MCF-7

breast cancer cells.

Accumulating evidence indicates that eIF4E may act as the node of convergence

for a number of upstream oncogenic signaling events. mTOR signaling is constitutively

active in a number of cancers and their proliferation is strongly inhibited by rapamycin

(Noh et al., 2004; Sabatini, 2006). The two major substrates of mTOR are the

serine/threonine kinase p70 S6K and the eIF4E-binding protein 4E-BP1, both shown to

directly modulate protein translation (Gingras et al., 2004). 4E-BP1 hyper-

phosphorylation releases eIF4E, allowing it to associate with the scaffold protein eIF4G,

which, along with the RNA helicase eIF4A, forms the eIF4F heterotrimeric initiation

178

complex. By binding to the 5’-cap structure of mRNAs through eIF4E, the eIF4F

complex facilitates ribosome binding and its passage along the 5’-UTR towards the

initiation codon. Although increased availability of eIF4F initiates the translation of all

cap-dependent mRNAs, a subset of mRNAs that contain lengthy, highly structured 5’-

UTRs are the most sensitive. These mRNAs typically encode for growth and survival

proteins (e.g. cyclin D1, VEGF, bcl-2), and are poorly translated when eIF4F availability

is limited (De Benedetti and Graff, 2004; Graff et al., 2008). Once eIF4F complex levels

are high, these mRNAs are preferentially translated and play critical roles in cell growth,

proliferation and survival.

Employing microarray analyses of polysomal RNAs, Mamane and colleagues

identified subsets of translationally regulated mRNAs in an inducible, eIF4E-expressing

NIH 3T3 cell line. These mRNAs encoded for a number of ribosomal proteins, anti-

apoptotic proteins and cell growth-related factors (Averous et al., 2008; De Benedetti and

Graff, 2004; Mamane et al., 2007). We have extended these findings to investigate the

potential for CCL5 to regulate translation of the mRNAs for cyclin D1, c-Myc and Dad-1.

The oncogenic properties of cyclin D1 during mitosis have been well characterized, and

its over-expression is common in many human cancers (Knudsen et al., 2006). Similarly,

the proto-oncogene c-Myc is over-expressed in many cancers, and high expression levels

correlate with advanced disease stage (Pelengaris et al., 2002; Vogelstein and Kinzler,

2004). Notably, eIF4E and c-Myc synergistically have anti-apoptotic effects on cells,

resulting in clonal transformation (Ruggero et al., 2004). Similarly, RNA knockdown of

c-Myc decreased MCF-7 growth rate both in vitro and in vivo (Wang et al., 2005). Dad-

179

1-deficiency results in embryonic lethality in mice, associated with an increased

frequency of apoptosis observed in selective tissues (Hong et al., 2000). Herein we show

that CCL5 rapidly up-regulates cyclin D1, c-Myc and Dad-1 protein levels without

increasing gene transcription. Furthermore, CCL5 facilitates the recruitment of Dad-1

and cyclin D1 mRNAs to polysomes in a rapamycin-sensitive manner. The specificity of

these translational events is reinforced by our observation that mRNAs for β-actin and

PKR did not redistribute along the sucrose gradient following CCL5 treatment of cells.

Increased eIF4E availability does not affect all cap-dependent mRNA translation, but

rather a subset of mRNAs. It is intriguing to speculate that aberrant CCR5 expression

may allow breast cancer cells to take advantage of CCL5 which accumulates within the

tumor microenvironment, thereby promoting protein translation associated with growth

proliferation.

Previous studies have described the proto-oncogenic roles of both CCL5 and

CCR5 in several cancer types (Aldinucci et al., 2008; Azenshtein et al., 2002; Luboshits

et al., 1999; Robinson et al., 2003; Sugasawa et al., 2008; Vaday et al., 2006; Youngs et

al., 1997). However, there are conflicting reports regarding the direct role of CCL5 in

breast tumor cell growth (Adler et al., 2003; Jayasinghe et al., 2008). Our data support

the proliferative role of CCL5 in breast cancer. This is in contrast to studies showing that

tumor-derived CCL5 did not contribute to breast tumor formation in vivo (Jayasinghe et

al., 2008). One explanation for these discrepant results is the concentration of CCL5 in

the two studies. While we observed significant CCL5-mediated proliferative effects at 10

nM, CCL5 produced by 4T1 breast cancer cells reported by Jayasinghe and colleagues

180

was approximately 100 fold less (Jayasinghe et al., 2008). We infer that a threshold level

of CCL5 is required in order for CCL5 to invoke a proliferative response in breast cancer

cells. The hypothesis is supported by several studies showing that CCL5 content within

tumor lesions is markedly higher in more aggressive forms of breast cancer (Bieche et al.,

2004; Niwa et al., 2001). Such a threshold may be attainable through the propensity of

CCL5 to bind, oligomerize and accumulate on GAGs at their secretion site (Proudfoot et

al., 2003).

Others have reported chemokine activation of mTOR signaling leading to

increased proliferation and motility in cancer. The CXCR4/mTOR signaling pathway

increased proliferative and migratory potential in gastric carcinoma cells (Hashimoto et

al., 2008). CXCL8 has been shown to up-regulate cyclin D1 at the level of translation in

prostate cancer cells (MacManus et al., 2007). Sodhi and colleagues show that

endothelial-specific expression of the Karposi’s sarcoma-associated herpesvirus (KSHV)-

encoded gene, v-GPCR, is sufficient to induce Kaposi-like sarcomas in mice, and is

dependent on the Akt/TSC2/mTOR signaling pathway (Sodhi et al., 2006). Recently,

CCL5 was implicated in mediating pro-growth and anti-apoptotic effects of gastric cancer

cells (Sugasawa et al., 2008).

Our data link CCL5-mediated proliferative effects in breast cancer with

mTOR/4E-BP1/eIF4E-dependent mRNA translation. Thus, targeting intermediates of

this signaling pathway may have therapeutic potential as anti-cancer drugs. Certainly,

rapamycin and its derivatives are currently being evaluated in multiple cancer clinical

181

trials (Guertin and Sabatini, 2007). In addition, Graff and colleagues have successfully

used eIF4E-specific anti-sense oligo-nucleotides to significantly reduce tumor growth in

mice (Graff et al., 2007). Small molecule inhibitors of eIF4E-eIF4G interaction were

also reported to reduce proliferation in several cancer cell lines (Moerke et al., 2007).

These initiatives have proven successful thus far, and warrant clinical investigations to

evaluate their efficacy in humans.

182

Chapter 5

Discussion and Future Directions

Portion of this chapter was published as:

Murooka, T.T., Ward, S.E., and Fish, E.N. (2005). Chemokines and cancer. Cancer Treat Res 126, 15-44.

Galligan C.L., Murooka, T.T., Rahbar, R., Baig, E., Majchrzak-Kita, B., and Fish, E.N.

(2006). Interferons and viruses: signalling for supremacy. Immunol Res 35, 27-40.

183

Chemokines and the Immune Response

Highly organized recruitment of effector T cells to the site of infection is

imperative for an effective adaptive immune response against a foreign pathogen.

Chemokine and chemokine receptors are largely responsible for orchestrating leukocyte

trafficking between infected tissues and the secondary lymphoid organs during an

immunological response (Figure 5.1). Once expressed, chemokines are presented on

GAGs by endothelial cells and extracellular matrix molecules to circulating leukocytes.

Activation through chemokine receptors facilitates the transition of leukocytes from fast

to slow rolling and finally, to firm adhesion. Chemokine gradients found within the

tissues determine where the leukocytes ultimately localize to. Importantly, some

chemokines also have immuno-modulatory roles, including their ability to regulate

cytokine expression, mediate co-stimulation of T cells, and determine T cell fate. Thus,

the chemokine system plays critical roles in all facets of both the innate and adaptive

immune response.

During immunological insult, the innate immune response is the first line of

defence against invading micro-organisms. Recognition of pathogens is mediated by

germline-encoded receptors called pattern-recognition receptors (PRRs). Many Toll-like

receptors (TLRs) function as PRRs and recognize conserved molecular patterns shared by

pathogens (Akira et al., 2001). Resident tissue macrophages and immature dendritic cells

express multiple TLRs and are the primary activators of innate immunity through the

release of several inflammatory mediators, including chemokines, via NFκB activation.

184

Figure 5.1 Chemokines mediate leukocyte migration from blood to extravascular

tissue The flow of leukocytes is slowed by a rolling behaviour mediated by mucin:selectin interactions between leukocytes and the endothelial surface. Chemokines are bound to the surface of the endothelial cell and the extracellular matrix through interactions with glycosaminoglycans (GAGs). Subsequent binding of chemokines to chemokine receptors on leukocytes increases cell adhesiveness by activating integrin affinity and avidity. Extravasation through the intercellular junction is followed by migration towards subluminal chemokines tethered to GAGs within the inflamed tissues.

185

Endothelium

Glycosaminoglycan

Inflammatory chemokine

Rolling

Activation Adherance

Extravasation

Mucin : selectin interaction

Integrin interaction

Inflammatory chemokine receptor

Inflamed tissue

Blood vessel flow

186

These chemokines, namely CXCL8, CCL3, CCL4, CCL5 and CXCL10, are largely

responsible for the recruitment of additional immature dendritic cells, neutrophils and NK

cells into infected tissues. They function to engulf or specifically kill infected cells to

clear invading microbes and contain larger parasites (Akira et al., 2001). Of particular

importance are immature dendritic cells, as they respond to many pathogen-associated

molecular patterns, such as LPS, bacterial lipoproteins, peptidoglycan and CpG

dinucleotides (Muzio et al., 2000). Immature DCs express chemokine receptors CCR1,

CCR5 and CCR6 which keep them within tissues (Sozzani et al., 2000). However, upon

activation through TLRs, immature DCs down-modulate the expression of these

chemokine receptors and up-regulate CCR7 expression (Dieu et al., 1998). The switch in

chemokine receptor expression results in the net migration of maturing DCs from

peripheral tissues to the afferent lymphatics, which express ligands for CCR7, CCL19

and CCL21 (Martin-Fontecha et al., 2003). Once in lymph nodes, CCR7 also allows

mature DCs to enter the T cell areas in the deep cortex (Gunn et al., 1999). Thus, the

change in the DC migratory pattern upon antigen uptake is vital for the induction of the

adaptive immune response.

Naïve T cells continuously circulate the periphery, entering LNs via High

Endothelial Venules (HEVs). They express the adhesion molecule CD62L (L-selectin),

LFA-1 and α4β7, and the chemokine receptor CCR7. CD62L mediates tethering and

rolling of naïve T cells on the endothelium of HEVs (Mora and von Andrian, 2006). This

allows naïve T cells to home into and be retained in lymphoid tissues via their ability to

respond to CCL21 synthesized in HEVs and by lymphatic endothelial cells (Gunn et al.,

187

1999). Once in the T cell zones, T cells and mature DCs continuously interact with one

another until a “match” is found. The resulting activation of T cells involves alterations

in cytokine production, increased proliferation and the acquisition of effector functions.

There is also a switch in chemokine receptor expression, depending on the effector

function they acquire. CCR5 and CXCR3 pre-dominate on primarily cytotoxic, IFNγ-

driven Th1 cells, while CCR4 and CCR8 are preferentially expressed on humoral, IL-4-

dependent Th2 cells (Luther and Cyster, 2001). Some activated CD4+ T cells up-

regulate CXCR5, allowing them to migrate towards the edges of B follicles to provide

help to B cells (Schaerli et al., 2000). Recently activated T cells down-modulate CCR7

expression and eventually re-express the S1P receptor (also known as endothelial

differentiation gene 1, EDG1), a 7 trans-membrane receptor, critical for T cell egression.

Thus, activated T cell egress is also an active process, responding to the S1P

concentration gradient that is present between the interior of the lymphoid tissue and the

adjacent blood or lymph (Cyster, 2005). The S1P receptor agonist, FTY720, displays

potent immuno-suppressive properties by down-regulating and inactivating the receptor

and preventing lymphocyte release from lymphoid organs (Matloubian et al., 2004).

Taken together, chemokine receptor switching ensures that only activated T cells are

recruited to inflammatory sites.

Once in the circulation, activated T cell recruitment involves their rolling on the

endothelial surface. This process is primarily mediated by the selectin family as well as

the adhesion molecule VLA-4 (Alon et al., 1995). The inflammatory chemokine CCL5 is

highly expressed at inflammatory sites, and is presented on the apical surface of

188

endothelial cells via GAGs. Rolling of T cells is gradually replaced by more firm

adhesions, mediated through integrins. Chemokines can induce up-regulation of integrin

affinity through conformational changes, or induce integrin clustering to increased avidity

(Johnston and Butcher, 2002). CCR5 activation on T cells leads to their firm adhesion

through ICAM-1 and VCAM-1 on endothelial cells. After undergoing diapedesis, T cells

ultimately localize to the focus of infection via a CCL5 concentration gradient found

within the tissues.

5.1. mTOR and the Adaptive Immune Response

Efficient migration and localization of lymphocytes are essential for effective

immune responses. Thus, there is much interest in elucidating the molecular mechanisms

and signalling pathways that control lymphocyte trafficking. As discussed earlier, naïve

T cells express a unique array of molecules, namely CD62L, CCR7 and CXCR4, to help

maintain their retention within lymphoid organs. Recent studies by Sinclair and

colleagues demonstrated that the PI-3’K/mTOR pathway determines the repertoire of

adhesion and chemokine receptors expressed by T cells (Sinclair et al., 2008).

Specifically, IL-2-mediated down-regulation of CD62L, CCR7 and S1P1 were all

suppressed by LY294002 and rapamycin. Furthermore, adoptive transfer of rapamycin-

treated CTLs led to their increased retention in both the lymph node and spleen compared

to control CTLs in vivo. Interestingly, down-regulation of CD62L and CCR7 expression

by PI-3’K/mTOR was dependent on the cellular abundance of KLF2, a key transcription

factor for both CD62L and CCR7 (Bai et al., 2007; Carlson et al., 2006). Thus, both PI-

3’K and mTOR are responsible for regulating T cell egress in vivo by directly regulating

189

the expression of chemokine receptors and adhesion molecules. The data in Chapter 3

show that mTOR plays an important role in CCL5-mediated CD4+ T cell chemotaxis in

vitro. Rapamycin-mediated reduction of T cell chemotaxis correlated with reduced

protein translation, specifically cyclin D1 and MMP-9 (Figure 3.1, 3,8). The data

describe a mechanism by which CCL5 directly regulates translation of chemokine-related

mRNAs during T cell migration (Murooka et al., 2008). When considering the data from

these two studies (Murooka et al., 2008; Sinclair et al., 2008), an intriguing story

involving mTOR and lymphocyte trafficking is starting to emerge (Figure 5.2).

Prolonged antigen-bearing DC-T cell interactions lead to increased proliferation and

cytokine production, including IL-2. By up-regulating CD25, the α-subunit of the IL-2

receptor, T cells display increased IL-2/IL-2R signal transduction through PI-3’Kδ and

mTOR (Sinclair et al., 2008). Through an unknown mechanism, mTOR suppresses

KLF2 activity, causing down-regulation in CD62L, CCR7 and S1P1 mRNA expression.

Simultaneously, TCR-triggering in the presence of IL-12, up-regulates CCR5 expression,

further promoting T cell egress. Once out in the periphery, mTOR plays a positive role in

effector T cell migration towards inflamed peripheral tissue. T cells respond to a CCL5

concentration gradient, established through GAG binding on endothelial cells. There,

CCL5-mediated T cell migration is dependent on mTOR/4E-BP1 and the initiation of

mRNA translation. Specifically, chemotaxis-related protein synthesis is up-regulated to

possibly “prime” T cells for efficient migration. Once localized within inflammatory

sites, effector T cells exert their specialized functions to control and clear pathogens. The

implications are that rapamycin may exert its potent immuno-suppressive properties by

190

limiting activated effector T cell migration into inflamed tissue and simultaneously

preventing their egress from secondary lymphoid organs. Whether mTOR plays a role in

191

Figure 5.2 Illustration of the role of mTOR activity in T cell migration in vivo. Naïve T cells have high expression of KLF2. KLF2 up-regulates the expression of cell surface CD62L, CCR7 and S1P1 to ensure the normal recirculation of T cells into and out of secondary lymphoid organs. After a productive encounter with antigen-presenting cells, the IL-2/IL-2R signalling pathway suppresses KLF2 activity through PI-3’K/mTOR. Suppression of KLF2 leads to down-regulation of CD62L and CCR7 expression, promoting T cell egress from lymphoid tissue. Expression of S1P1 is similarly suppressed, although it is eventually re-expressed in activated T cells to allow their egress mediated by an alternative mechanism. Activated T cells up-regulate CCR5 and respond to the CCL5 concentration gradient in the periphery. CCL5-mediated CD4+ T cell chemotaxis is dependent on mTOR activity. Through mTOR, rapid translation of chemotaxis-related mRNAs “prime” T cells for efficient chemotaxis towards the site of inflammation.

192

HEV

eIF4E

4E-BP1

Activated Th1 cells CCL5/CCR5 complex

mTOR

Decreased LN homing

S1P1*

KLF2

CD62L CCR7

mTOR

LN homing and recirculation

Naïve T cells

KLF2

CD62L CCR7S1P1

Activated T cells IL-2/IL-2R

complex

Lymph node

Increased translation of chemotaxis-related mRNAs

CCL5 concentration

gradient

* S1P1 is eventually re-expressed in activated T cells to allow their egress mediated by an alternative pathway

Naïve T cells

193

cell migration mediated by other chemokines, namely CXCL12, CCL19 and CCL21, in T

cells as well as other cell types, namely B cells and macrophages, have not been studied.

5.1.1. mTOR-mediated Nutrient Sensing and Chemotaxis

The intriguing aspect of these studies is the possible cross-talk between the

control of lymphocyte migration and cellular metabolism. How do lymphocytes ensure

that energy demands for the highly energy-taxing process of cell migration are met? Can

chemokines play a role in regulating cellular metabolism and nutrient uptake during

migration? Several studies have shown that stimulation through the TCR and co-

stimulatory molecules triggers a switch in T cell metabolism to meet bio-energetic

demands of increased cell growth, proliferation and gene transcription. In fact, T cell

activation triggers a metabolic conversion from oxidative phosphorylation (OX-PHOS) to

high throughput glycolysis, termed aerobic glycolysis (Fox et al., 2005; Krauss et al.,

2001). Such a switch in metabolism is important for both energy production and

metabolic intermediates required for nucleotide, protein and lipid biosynthesis. Sustained

T cell activation leads to Ca2+-dependent increases in reactive oxygen species (ROS) and

has implications in shaping the T cell response (Jones et al., 2007). Additionally,

activated T cells display increased glucose uptake by up-regulating the glucose

transporter, Glut1, through PKB (Frauwirth et al., 2002; Rathmell et al., 2003).

Altogether, the data illustrate that recently activated T cells are metabolically equipped to

sustain rapid cell growth and proliferation. Once effector T cells leave lymphoid organs,

do they require sustained signalling in order to maintain their anabolic metabolism and

nutrient uptake? If so, can inflammatory chemokines deliver that signal, possibly through

194

mTOR activation? Since we have shown that CCL5-mediated mTOR activation leads to

mRNA translation, it will be interesting to investigate whether CCL5 has other mTOR-

mediated effects on T cells. Certainly, several studies demonstrated that mTOR kinase

activity is required for PKB-dependent expression of the amino acid transporter-

associated 4F2 heavy chain redistribution to the plasma membrane (Edinger et al., 2003b;

Edinger and Thompson, 2002). In fact, maintenance of nutrient transporters on the cell

surface depends on ongoing signal transduction (Edinger et al., 2003a). When cells are

deprived of IL-3, the turnover of nutrient transporters Glut1 and 4F2hc rapidly decreased

the rate of nutrient uptake. Additionally, mTOR is a positive regulator of glycolysis, as

rapamycin treatment decreased glycolytic rates in FL5.12 cells (Edinger et al., 2003b).

Microarray analysis of yeast and mammalian cells treated with rapamycin showed

decreased levels of mRNA transcripts encoding glycolytic enzymes (Hardwick et al.,

1999; Peng et al., 2002). mTOR-dependent uptake of nutrients and glycolytic metabolism

may be important to support increased protein translation and expansion in cell size, also

regulated through mTOR. Further studies are required to determine whether CCL5-

mediated mTOR activation affects cellular metabolism and nutrient uptake in T cells.

Specifically, whether CCL5 can regulate expression of amino acid transporter-associated

proteins, such as the 4F2 heavy chain and the glucose transporter Glut1, has not been

studied. Flow cytometric studies using PM1.CCR5 T cells and primary activated CD4+

T cells to determine whether CCL5 can up-regulate or sustain Glut1 and 4F2 expression

can be performed. The role of CCL5-CCR5 mediated Jak/Stat, PI-3’K/PKB/mTOR

and/or MAPK signalling pathways on Glut1 and 4F2 expression can be addressed using

the appropriate pharmacological inhibitors. If indeed Glut1 protein and cell surface

195

expression is up-regulated or maintained by CCL5, glucose uptake and metabolism can

be directly measured within cells. Glycolytic rates can be calculated by measuring the

amount of lactate produced to glucose consumed. Furthermore, siRNA knockdown

experiments of these nutrient receptors assessing the impact on cellular migration can

provide a link between nutrient sensing and chemotaxis. Finally, translationally-

regulated proteins can be identified by microarray analysis of polysomal mRNA. In these

experiments, T cells are treated with CCL5 in the presence or absence of rapamycin and

lysates subjected to sucrose centrifugation to isolate polysomal mRNA. These mRNAs

are isolated, purified and subjected to microarray analysis, to identify a subset of mRNAs

that are regulated by CCL5 at the level of translation. Specifically, proteins involved in

cellular metabolism and nutrient sensing will be of interest. Taken together, it is

intriguing to speculate that besides providing migrational cues, CCL5 may regulate

nutrient receptor trafficking, metabolism and protein expression in order to maintain a

high energy status during chemotaxis.

196

5.2. CCL5 determines T cell Fate through AICD

At the site of an infection, inflammatory chemokines are produced and secreted.

Chemokines are bound by heparin-like glycosaminoglycans, becoming immobilized and

concentrated within tissue sites. Accordingly, recently activated T cells recruited from

the lymphoid organs to a site of infection, are exposed to high CCL5 concentrations. The

propensity of CCL5 to form higher-order aggregates at high, µM concentrations,

prompted studies to investigate their effects on T cell function. It is now apparent that at

these concentrations, CCL5 forms large oligomers with a mass greater than 100 kDa

(Appay et al., 1999; Appay et al., 2000). Previous studies showed that CCL5 stimulated

antigen-independent activation of T cells in the context of increased proliferation, CD25

expression and cytokine production, only at these high concentrations (Bacon et al., 1995;

Dairaghi et al., 1998). This unexpected property of CCL5 demonstrated that high doses

of CCL5 can bypass T cell receptor recognition of antigen to activate T cells. As an

extension of these initial studies, we investigated whether CCL5-mediated T cell

activation may play a role in Activation-Induced Cell Death (AICD). AICD mediates the

removal of the activated and expanded T cells after an immune response (Krammer et al.,

2007). Typically, TCR re-stimulation of already expanded T cells in the absence of co-

stimulation leads to the efficient induction of cell death, in most cases through CD95, but

other mechanisms have also been described, namely TNFR1 and granzyme B (Devadas et

al., 2006). Re-stimulation of T cells up-regulates the expression of CD95L, leading to

induction of AICD through CD95/CD95L interactions between neighboring T cells (Li-

Weber and Krammer, 2003). Our data in Chapter 2 show that high, µM CCL5

concentrations induce T cell death (Murooka et al., 2006). Specifically, we show that

197

CCL5 aggregation at high ligand concentrations induces apoptosis in PM1, MOLT-4 and

activated peripheral blood T cells in a CCR5-dependent manner (Figure 2.1, 2.5). When

T cells are subjected to µM concentration of CCL5, cells undergo apoptosis through

cytosolic release of the mitochondrial pro-apoptotic factors cytochrome c, caspase-9 and

caspase-3, followed by poly ADP ribose polymerase (PARP) cleavage (Figure 2.4). In

both PM1.CCCR5 and MOLT-4.CCR5 cells, CCL5-mediated apoptosis was observed in

approximately 60% of the cells after 24 hours, whereas ex vivo activated T cells exhibited

approximately 9% apoptotic death. The data suggest that the sensitivity to CCL5-

mediated apoptosis is higher in the two T cell lines. It is also possible that 24 hours is not

sufficient for maximal cell death in primary T cells. Certainly, CXCL12-induced

apoptosis of Jurkat T cells was not observed until after 3 days in culture. The prolonged

lag period observed may reflect changes in gene expression of the death receptors

CD95/CD95L (Colamussi et al., 2001). Thus, additional time course studies with ex vivo

T cells are necessary to determine whether a similar lag period also exists in CCL5-

mediate apoptosis. The result from such studies may reveal that CCL5-mediated AICD

of T cells does not occur immediately, but rather is achieved over several days. This

would be in agreement with the overall kinetics of the T cell immune response, where T

cell function can be gradually “turned off” by prolonged exposure to high CCL5 doses.

Taken altogether, our data suggest that CCL5-induced cell death, in addition to

CD95/CD95L mediated events, may contribute to clonal deletion of T cells after an

immunological response.

198

Because µM concentrations of CCL5 are required to invoke this outcome, the

important question is whether these concentrations of CCL5 are achievable or likely in

vivo. Certainly, unusually high CCL5 concentrations may be realizable at sites of acute

infection or inflammation through the sequestration of CCL5 by cell surface and/or

extracellular matrix GAGs. In addition, the unique ability of CCL5 to form aggregates,

facilitated through GAG-binding, may also lead to an increase in local CCL5

concentration (Appay et al., 1999; Appay et al., 2000; Czaplewski et al., 1999;

Hoogewerf et al., 1997; Kuschert et al., 1999; Martin et al., 2001; Proudfoot et al., 2001;

Proudfoot et al., 2003). We, therefore, infer that the CCL5-CCR5 induced apoptosis of T

cells we observe is not likely an in vitro artifact, but is attainable in vivo. However, this

hypothesis remains an assumption, as CCL5 levels at inflammatory sites have never been

measured directly. Certainly, autoimmune animal models, such as collagen-induced

arthritis in mice, can be used to quantitate local CCL5 concentration in an active

inflammatory site. Such studies are experimentally challenging, because of the ability of

CCL5 to bind GAGs, either expressed on the extracellular matrix or cell surfaces, and the

tendency of CCL5 to form higher-order aggregates when present at high concentrations.

199

5.3. CCL5 promotes breast cancer proliferation

Many cancers are characterized by abnormal chemokine production or aberrant

expression of and signalling by chemokine receptors. Tumor-associated chemokines can

act directly on tumor cells to regulate proliferation and survival through an autocrine loop,

or recruit tumor-promoting leukocytes to the tumor microenvironment and stimulate the

release of growth factors. There is accumulating evidence for the pathogenic role of both

CCL5 and CCR5 in breast cancer. The CCL5/CCR5 axis has been associated with active

recruitment of TAMs, as well as their direct proliferative role in breast cancer cells.

Robinson and colleagues showed that administration of the CCR1/CCR5 antagonist, Met-

CCL5, significantly reduced the extent of macrophage infiltration within tumors, which

correlated with reduced tumor burden (Robinson et al., 2003). Breast tumor cells

expressing lower levels of CCL5 exhibited decreased growth in vivo (Adler et al., 2003).

In vitro studies have shown that both CCL2 and CCL5 stimulate the release of tumor-

promoting factors by macrophages, namely MMP-9 and TNFα (Azenshtein et al., 2002;

Robinson et al., 2003; Saji et al., 2001). The data indicate that inflammatory chemokines

can actively recruit tumor-promoting leukocytes into the tumor microenvironment, thus

establishing a continuous source of growth and angiogenic factors.

We investigated the possibility that CCL5 has direct proliferative and survival

effects on breast cancer cells mediated by mTOR. The data in Chapter 4 show that

exogenous CCL5 induced MCF-7 breast cancer cell proliferation (Figure 4.1.).

Specifically, CCL5 actively promoted translation of proliferative and survival proteins,

namely cyclin D1, c-Myc and defender against cell death-1 (Dad-1) in a rapamycin-

200

dependent manner (Figure 4.3, 4.4.). The implications are that breast cancer cells can

exploit downstream chemokine signalling pathways for their proliferative and survival

advantage, by expressing the appropriate chemokine receptors. This is in contrast to

studies showing that tumor-derived CCL5 did not contribute to breast tumor formation in

vivo (Jayasinghe et al., 2008). One explanation for these conflicting results is the

concentration of CCL5 in the two studies. While we observed significant CCL5-

mediated proliferative effects at 10 nM, CCL5 produced by 4T1 breast cancer cells,

reported by Jayasinghe and colleagues, was approximately 100 fold less (Jayasinghe et al.,

2008). The data suggest that a threshold level of CCL5 is required to invoke a

proliferative response in breast cancer cells. This hypothesis is supported by several

studies showing that CCL5 content within tumor lesions is markedly higher in the more

aggressive forms of breast cancer (Bieche et al., 2004; Niwa et al., 2001). This threshold

of CCL5 concentration may be attainable as a consequence of the propensity of CCL5 to

bind, oligomerize and accumulate on GAGs at their secretion site (Proudfoot et al., 2003).

5.3.1. CCL5-mediated mTOR Activation and Cellular Metabolism

First described by Otto Warburg (Warburg et al., 1924), it is increasingly clear

that tumor cells switch from oxidative phosphorylation to aerobic glycolysis, even when

oxygen is non-limiting (Bauer et al., 2004; Elstrom et al., 2004). Glycolysis yields much

less ATP per glucose molecule utilized compared to oxidative phosphorylation, but

provides cells with metabolic intermediates critical for cell growth. For example, the

pentose phosphate shunt converts glucose-6-phosphate to ribose-5-phosphate, a key

intermediate in nucleotide biosynthesis (Jones and Thompson, 2007). Recent work by

201

Christofk and colleagues demonstrated that a switch in a splice isoform of the glycolytic

enzyme pyruvate kinase is necessary for the metabolic switch to aerobic glycolysis.

RNA knockdown of the M2, but not the M1 isoform, reduced lactate production and

reduced tumor formation in vivo (Christofk et al., 2008a). Furthermore, the M2 isoform

binds directly and selectively to tyrosine-phosphorylated peptides (Christofk et al.,

2008b). The implications are that tyrosine phosphorylation signalling effectors can

potentially regulate glycolysis through the glycolytic enzyme pyruvate kinase. This is

consistent with studies showing that mammalian cells require exogenous signals to alter

their cellular metabolism. For example, hyperglycemia associated with Type I diabetes

remains high without insulin-mediated signal transduction to instruct cells to uptake

glucose (Saltiel and Kahn, 2001). Further studies are needed to investigate the effects of

CCL5 on cellular metabolism and nutrient uptake, possibly mediated by mTOR, in breast

cancer. Specifically, elucidating whether CCL5-CCR5 mediated signalling can alter

glucose metabolism and nucleotide biosynthesis to sustain increased mRNA translation

will be of interest. The impact of CCL5 on the expression of the glucose transporter

Glut1 and the amino acid transporter-associated protein, 4F2, can be assessed by flow

cytometry. Glucose uptake and metabolism can be directly measured in MCF-7.CCR5

cells, and the role of PI-3`K and mTOR can be assessed using the appropriate

pharmacological inhibitors. Glycolytic rates can be calculated by measuring the amount

of lactate produced to glucose comsumed. Furthermore, siRNA knockdown experiments

of these nutrient receptors to address their contributions to cell size, proliferation and

survival would be of interest. Results from these studies would provide insights into the

pro-tumorigenic effects of CCL5 and elucidate the contributions of altered cellular

202

metabolism, amino acid uptake and increased translation of proliferation and survival

proteins.

203

5.4. Conclusions

Chemokines were originally identified for their selective chemo-attractant and

pro-adhesive effects. They are responsible for directing leukocyte migration by forming

chemokine gradients and triggering firm arrest by activating integrins on the leukocyte

cell surface. Throughout this thesis, I have described the importance of the CCL5/CCR5

axis in the context of the immune response and cancer biology. Firstly, I showed that

CCL5-mediated effector T cell migration is regulated by mTOR-dependent mRNA

translation. I demonstrated that up-regulation of chemotaxis-related proteins may

“prime” T cells for efficient migration. Secondly, I show that high concentrations of

CCL5 at the inflammatory sites can instruct effector T cells to undergo apoptosis. The

data suggest that CCL5-induced cell death, in addition to CD95/CD95L mediated events,

may contribute to clonal deletion of T cells after an immunological response. Finally, I

demonstrate the pathological consequence of aberrant CCL5/CCR5 signalling in breast

cancer. CCL5 can directly induce proliferation of MCF-7 breast cancer cells through

increased translation of proliferation and survival proteins. These studies reinforce the

notion that chemokines are not only potent chemotactic mediators, but are key effectors

in diverse developmental, immunological and pathological processes.

204

Chapter 6

Dissemination of Work Arising from this Thesis

205

Chapter 2 was published as: Murooka, T.T., Wong, M.M., Rahbar, R., Majchrzak-Kita, B., Proudfoot, A.E., and Fish, E.N. (2006). CCL5-CCR5-mediated Apoptosis in T cells: Requirement for Glycosaminoglycan Binding and CCL5 Aggregation. J Biol Chem 281, 25184-25194. Chapter 3 was published as: Murooka, T.T., Rahbar, R., Platanias, L.C., and Fish, E.N. (2008). CCL5-mediated T-cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1. Blood 111, 4892-4901. Chapter 4 is a manuscript submitted as: Murooka, T.T., Rahbar, R., Platanias, L.C., and Fish, E.N. CCL5 promotes breast cancer proliferation through mTOR/4E-BP1 dependent mRNA translation. Portion of Chapter 1 and Chapter 5 are published as: Murooka, T.T., Ward, S.E., and Fish, E.N. (2005). Chemokines and cancer. Cancer Treat Res 126, 15-44. Galligan C.L., Murooka, T.T., Rahbar, R., Baig, E., Majchrzak-Kita, B., and Fish, E.N. (2006). Interferons and viruses: signalling for supremacy. Immunol Res 35, 27-40.

206

References

Adler, E. P., Lemken, C. A., Katchen, N. S., and Kurt, R. A. (2003). A dual role for

tumor-derived chemokine RANTES (CCL5). Immunol Lett 90, 187-194.

Ajuebor, M. N., Aspinall, A. I., Zhou, F., Le, T., Yang, Y., Urbanski, S. J., Sidobre, S.,

Kronenberg, M., Hogaboam, C. M., and Swain, M. G. (2005). Lack of Chemokine

Receptor CCR5 Promotes Murine Fulminant Liver Failure by Preventing the Apoptosis

of Activated CD1d-Restricted NKT Cells. J Immunol 174, 8027-8037.

Akira, S., Takeda, K., and Kaisho, T. (2001). Toll-like receptors: critical proteins linking

innate and acquired immunity. Nat Immunol 2, 675-680.

Aldinucci, D., Lorenzon, D., Cattaruzza, L., Pinto, A., Gloghini, A., Carbone, A., and

Colombatti, A. (2008). Expression of CCR5 receptors on Reed-Sternberg cells and

Hodgkin lymphoma cell lines: involvement of CCL5/Rantes in tumor cell growth and

microenvironmental interactions. Int J Cancer 122, 769-776.

Algeciras-Schimnich, A., Vlahakis, S. R., Villasis-Keever, A., Gomez, T., Heppelmann,

C. J., Bou, G., and Paya, C. V. (2002). CCR5 mediates Fas- and caspase-8 dependent

apoptosis of both uninfected and HIV infected primary human CD4 T cells. Aids 16,

1467-1478.

Ali, S., Palmer, A. C., Banerjee, B., Fritchley, S. J., and Kirby, J. A. (2000). Examination

of the function of RANTES, MIP-1alpha, and MIP-1beta following interaction with

heparin-like glycosaminoglycans. J Biol Chem 275, 11721-11727.

Aliberti, J., Reis e Sousa, C., Schito, M., Hieny, S., Wells, T., Huffnagle, G. B., and Sher,

A. (2000). CCR5 provides a signal for microbial induced production of IL-12 by CD8

alpha+ dendritic cells. Nat Immunol 1, 83-87.

207

Alon, R., Kassner, P. D., Carr, M. W., Finger, E. B., Hemler, M. E., and Springer, T. A.

(1995). The integrin VLA-4 supports tethering and rolling in flow on VCAM-1. J Cell

Biol 128, 1243-1253.

Amano, M., Chihara, K., Kimura, K., Fukata, Y., Nakamura, N., Matsuura, Y., and

Kaibuchi, K. (1997). Formation of actin stress fibers and focal adhesions enhanced by

Rho-kinase. Science 275, 1308-1311.

Amano, M., Ito, M., Kimura, K., Fukata, Y., Chihara, K., Nakano, T., Matsuura, Y., and

Kaibuchi, K. (1996). Phosphorylation and activation of myosin by Rho-associated kinase

(Rho-kinase). J Biol Chem 271, 20246-20249.

Amara, A., Lorthioir, O., Valenzuela, A., Magerus, A., Thelen, M., Montes, M.,

Virelizier, J. L., Delepierre, M., Baleux, F., Lortat-Jacob, H., and Arenzana-Seisdedos, F.

(1999). Stromal cell-derived factor-1alpha associates with heparan sulfates through the

first beta-strand of the chemokine. J Biol Chem 274, 23916-23925.

Angiolillo, A. L., Sgadari, C., Taub, D. D., Liao, F., Farber, J. M., Maheshwari, S.,

Kleinman, H. K., Reaman, G. H., and Tosato, G. (1995). Human interferon-inducible

protein 10 is a potent inhibitor of angiogenesis in vivo. J Exp Med 182, 155-162.

Ansel, K. M., Ngo, V. N., Hyman, P. L., Luther, S. A., Forster, R., Sedgwick, J. D.,

Browning, J. L., Lipp, M., and Cyster, J. G. (2000). A chemokine-driven positive

feedback loop organizes lymphoid follicles. Nature 406, 309-314.

Appay, V., Brown, A., Cribbes, S., Randle, E., and Czaplewski, L. G. (1999).

Aggregation of RANTES is responsible for its inflammatory properties. Characterization

of nonaggregating, noninflammatory RANTES mutants. J Biol Chem 274, 27505-27512.

208

Appay, V., Dunbar, P. R., Cerundolo, V., McMichael, A., Czaplewski, L., and Rowland-

Jones, S. (2000). RANTES activates antigen-specific cytotoxic T lymphocytes in a

mitogen-like manner through cell surface aggregation. Int Immunol 12, 1173-1182.

Appay, V., and Rowland-Jones, S. L. (2001). RANTES: a versatile and controversial

chemokine. Trends Immunol 22, 83-87.

Arenberg, D. A., Kunkel, S. L., Polverini, P. J., Glass, M., Burdick, M. D., and Strieter, R.

M. (1996). Inhibition of interleukin-8 reduces tumorigenesis of human non-small cell

lung cancer in SCID mice. J Clin Invest 97, 2792-2802.

Armengol, G., Rojo, F., Castellvi, J., Iglesias, C., Cuatrecasas, M., Pons, B., Baselga, J.,

and Ramon y Cajal, S. (2007). 4E-binding protein 1: a key molecular "funnel factor" in

human cancer with clinical implications. Cancer Res 67, 7551-7555.

Arvanitakis, L., Geras-Raaka, E., Varma, A., Gershengorn, M. C., and Cesarman, E.

(1997). Human herpesvirus KSHV encodes a constitutively active G-protein-coupled

receptor linked to cell proliferation. Nature 385, 347-350.

Averous, J., Fonseca, B. D., and Proud, C. G. (2008). Regulation of cyclin D1 expression

by mTORC1 signaling requires eukaryotic initiation factor 4E-binding protein 1.

Oncogene 27, 1106-1113.

Azenshtein, E., Luboshits, G., Shina, S., Neumark, E., Shahbazian, D., Weil, M., Wigler,

N., Keydar, I., and Ben-Baruch, A. (2002). The CC chemokine RANTES in breast

carcinoma progression: regulation of expression and potential mechanisms of

promalignant activity. Cancer Res 62, 1093-1102.

Babcock, G. J., Farzan, M., and Sodroski, J. (2003). Ligand-independent dimerization of

CXCR4, a principal HIV-1 coreceptor. J Biol Chem 278, 3378-3385.

209

Bacon, K., Baggiolini, M., Broxmeyer, H., Horuk, R., Lindley, I., Mantovani, A.,

Maysushima, K., Murphy, P., Nomiyama, H., Oppenheim, J., et al. (2002).

Chemokine/chemokine receptor nomenclature. J Interferon Cytokine Res 22, 1067-1068.

Bacon, K. B., Premack, B. A., Gardner, P., and Schall, T. J. (1995). Activation of dual T

cell signaling pathways by the chemokine RANTES. Science 269, 1727-1730.

Bacon, K. B., Schall, T. J., and Dairaghi, D. J. (1998). RANTES activation of

phospholipase D in Jurkat T cells: requirement of GTP-binding proteins ARF and RhoA.

J Immunol 160, 1894-1900.

Bacon, K. B., Szabo, M. C., Yssel, H., Bolen, J. B., and Schall, T. J. (1996). RANTES

induces tyrosine kinase activity of stably complexed p125FAK and ZAP-70 in human T

cells. J Exp Med 184, 873-882.

Bai, A., Hu, H., Yeung, M., and Chen, J. (2007). Kruppel-like factor 2 controls T cell

trafficking by activating L-selectin (CD62L) and sphingosine-1-phosphate receptor 1

transcription. J Immunol 178, 7632-7639.

Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E. G., Gutkind, J. S., Asch, A.

S., Cesarman, E., Gershengorn, M. C., Mesri, E. A., and Gerhengorn, M. C. (1998). G-

protein-coupled receptor of Kaposi's sarcoma-associated herpesvirus is a viral oncogene

and angiogenesis activator. Nature 391, 86-89.

Bajetto, A., Barbero, S., Bonavia, R., Piccioli, P., Pirani, P., Florio, T., and Schettini, G.

(2001). Stromal cell-derived factor-1alpha induces astrocyte proliferation through the

activation of extracellular signal-regulated kinases 1/2 pathway. J Neurochem 77, 1226-

1236.

Baldwin, E. T., Weber, I. T., St Charles, R., Xuan, J. C., Appella, E., Yamada, M.,

Matsushima, K., Edwards, B. F., Clore, G. M., Gronenborn, A. M., and et al. (1991).

210

Crystal structure of interleukin 8: symbiosis of NMR and crystallography. Proc Natl Acad

Sci U S A 88, 502-506.

Baltus, T., Weber, K. S., Johnson, Z., Proudfoot, A. E., and Weber, C. (2003).

Oligomerization of RANTES is required for CCR1-mediated arrest but not CCR5-

mediated transmigration of leukocytes on inflamed endothelium. Blood 102, 1985-1988.

Barbero, S., Bonavia, R., Bajetto, A., Porcile, C., Pirani, P., Ravetti, J. L., Zona, G. L.,

Spaziante, R., Florio, T., and Schettini, G. (2003). Stromal cell-derived factor 1alpha

stimulates human glioblastoma cell growth through the activation of both extracellular

signal-regulated kinases 1/2 and Akt. Cancer Res 63, 1969-1974.

Barbieri, F., Bajetto, A., Porcile, C., Pattarozzi, A., Massa, A., Lunardi, G., Zona, G.,

Dorcaratto, A., Ravetti, J. L., Spaziante, R., et al. (2006). CXC receptor and chemokine

expression in human meningioma: SDF1/CXCR4 signaling activates ERK1/2 and

stimulates meningioma cell proliferation. Ann N Y Acad Sci 1090, 332-343.

Barnes, D. A., Tse, J., Kaufhold, M., Owen, M., Hesselgesser, J., Strieter, R., Horuk, R.,

and Perez, H. D. (1998). Polyclonal antibody directed against human RANTES

ameliorates disease in the Lewis rat adjuvant-induced arthritis model. J Clin Invest 101,

2910-2919.

Barretina, J., Junca, J., Llano, A., Gutierrez, A., Flores, A., Blanco, J., Clotet, B., and

Este, J. A. (2003). CXCR4 and SDF-1 expression in B-cell chronic lymphocytic leukemia

and stage of the disease. Ann Hematol 82, 500-505.

Barsante, M. M., Cunha, T. M., Allegretti, M., Cattani, F., Policani, F., Bizzarri, C.,

Tafuri, W. L., Poole, S., Cunha, F. Q., Bertini, R., and Teixeira, M. M. (2008). Blockade

of the chemokine receptor CXCR2 ameliorates adjuvant-induced arthritis in rats. Br J

Pharmacol 153, 992-1002.

211

Bauer, D. E., Harris, M. H., Plas, D. R., Lum, J. J., Hammerman, P. S., Rathmell, J. C.,

Riley, J. L., and Thompson, C. B. (2004). Cytokine stimulation of aerobic glycolysis in

hematopoietic cells exceeds proliferative demand. Faseb J 18, 1303-1305.

Belperio, J. A., Keane, M. P., Arenberg, D. A., Addison, C. L., Ehlert, J. E., Burdick, M.

D., and Strieter, R. M. (2000). CXC chemokines in angiogenesis. J Leukoc Biol 68, 1-8.

Beretta, L., Gingras, A. C., Svitkin, Y. V., Hall, M. N., and Sonenberg, N. (1996).

Rapamycin blocks the phosphorylation of 4E-BP1 and inhibits cap-dependent initiation

of translation. Embo J 15, 658-664.

Berger, E. A., Murphy, P. M., and Farber, J. M. (1999). Chemokine receptors as HIV-1

coreceptors: roles in viral entry, tropism, and disease. Annu Rev Immunol 17, 657-700.

Bieche, I., Lerebours, F., Tozlu, S., Espie, M., Marty, M., and Lidereau, R. (2004).

Molecular profiling of inflammatory breast cancer: identification of a poor-prognosis

gene expression signature. Clin Cancer Res 10, 6789-6795.

Blanpain, C., Doranz, B. J., Bondue, A., Govaerts, C., De Leener, A., Vassart, G., Doms,

R. W., Proudfoot, A., and Parmentier, M. (2003). The core domain of chemokines binds

CCR5 extracellular domains while their amino terminus interacts with the transmembrane

helix bundle. J Biol Chem 278, 5179-5187.

Blanpain, C., Doranz, B. J., Vakili, J., Rucker, J., Govaerts, C., Baik, S. S., Lorthioir, O.,

Migeotte, I., Libert, F., Baleux, F., et al. (1999a). Multiple charged and aromatic residues

in CCR5 amino-terminal domain are involved in high affinity binding of both

chemokines and HIV-1 Env protein. J Biol Chem 274, 34719-34727.

Blanpain, C., Lee, B., Tackoen, M., Puffer, B., Boom, A., Libert, F., Sharron, M.,

Wittamer, V., Vassart, G., Doms, R. W., and Parmentier, M. (2000). Multiple

nonfunctional alleles of CCR5 are frequent in various human populations. Blood 96,

1638-1645.

212

Blanpain, C., Lee, B., Vakili, J., Doranz, B. J., Govaerts, C., Migeotte, I., Sharron, M.,

Dupriez, V., Vassart, G., Doms, R. W., and Parmentier, M. (1999b). Extracellular

cysteines of CCR5 are required for chemokine binding, but dispensable for HIV-1

coreceptor activity. J Biol Chem 274, 18902-18908.

Blanpain, C., Migeotte, I., Lee, B., Vakili, J., Doranz, B. J., Govaerts, C., Vassart, G.,

Doms, R. W., and Parmentier, M. (1999c). CCR5 binds multiple CC-chemokines: MCP-3

acts as a natural antagonist. Blood 94, 1899-1905.

Blanpain, C., Vanderwinden, J. M., Cihak, J., Wittamer, V., Le Poul, E., Issafras, H.,

Stangassinger, M., Vassart, G., Marullo, S., Schlndorff, D., et al. (2002). Multiple active

states and oligomerization of CCR5 revealed by functional properties of monoclonal

antibodies. Mol Biol Cell 13, 723-737.

Blanpain, C., Wittamer, V., Vanderwinden, J. M., Boom, A., Renneboog, B., Lee, B., Le

Poul, E., El Asmar, L., Govaerts, C., Vassart, G., et al. (2001). Palmitoylation of CCR5 is

critical for receptor trafficking and efficient activation of intracellular signaling pathways.

J Biol Chem 276, 23795-23804.

Boehme, S. A., Lio, F. M., Maciejewski-Lenoir, D., Bacon, K. B., and Conlon, P. J.

(2000). The chemokine fractalkine inhibits Fas-mediated cell death of brain microglia. J

Immunol 165, 397-403.

Bottazzi, B., Colotta, F., Sica, A., Nobili, N., and Mantovani, A. (1990). A

chemoattractant expressed in human sarcoma cells (tumor-derived chemotactic factor,

TDCF) is identical to monocyte chemoattractant protein-1/monocyte chemotactic and

activating factor (MCP-1/MCAF). Int J Cancer 45, 795-797.

213

Bottazzi, B., Polentarutti, N., Acero, R., Balsari, A., Boraschi, D., Ghezzi, P., Salmona,

M., and Mantovani, A. (1983). Regulation of the macrophage content of neoplasms by

chemoattractants. Science 220, 210-212.

Brazil, D. P., Park, J., and Hemmings, B. A. (2002). PKB binding proteins. Getting in on

the Akt. Cell 111, 293-303.

Brill, A., Hershkoviz, R., Vaday, G. G., Chowers, Y., and Lider, O. (2001).

Augmentation of RANTES-induced extracellular signal-regulated kinase mediated

signaling and T cell adhesion by elastase-treated fibronectin. J Immunol 166, 7121-7127.

Brunn, G. J., Hudson, C. C., Sekulic, A., Williams, J. M., Hosoi, H., Houghton, P. J.,

Lawrence, J. C., Jr., and Abraham, R. T. (1997). Phosphorylation of the translational

repressor PHAS-I by the mammalian target of rapamycin. Science 277, 99-101.

Burnett, P. E., Barrow, R. K., Cohen, N. A., Snyder, S. H., and Sabatini, D. M. (1998).

RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1. Proc

Natl Acad Sci U S A 95, 1432-1437.

Burns, J. M., Gallo, R. C., DeVico, A. L., and Lewis, G. K. (1998). A new monoclonal

antibody, mAb 4A12, identifies a role for the glycosaminoglycan (GAG) binding domain

of RANTES in the antiviral effect against HIV-1 and intracellular Ca2+ signaling. J Exp

Med 188, 1917-1927.

Campbell, D. J., Kim, C. H., and Butcher, E. C. (2003). Chemokines in the systemic

organization of immunity. Immunol Rev 195, 58-71.

Carlson, C. M., Endrizzi, B. T., Wu, J., Ding, X., Weinreich, M. A., Walsh, E. R., Wani,

M. A., Lingrel, J. B., Hogquist, K. A., and Jameson, S. C. (2006). Kruppel-like factor 2

regulates thymocyte and T-cell migration. Nature 442, 299-302.

214

Cartier, L., Dubois-Dauphin, M., Hartley, O., Irminger-Finger, I., and Krause, K. H.

(2003). Chemokine-induced cell death in CCR5-expressing neuroblastoma cells. J

Neuroimmunol 145, 27-39.

Cerdan, C., Devilard, E., Xerri, L., and Olive, D. (2001). The C-class chemokine

lymphotactin costimulates the apoptosis of human CD4(+) T cells. Blood 97, 2205-2212.

Chabot, V., Reverdiau, P., Iochmann, S., Rico, A., Senecal, D., Goupille, C., Sizaret, P.

Y., and Sensebe, L. (2006). CCL5-enhanced human immature dendritic cell migration

through the basement membrane in vitro depends on matrix metalloproteinase-9. J

Leukoc Biol 79, 767-778.

Chakravarty, L., Rogers, L., Quach, T., Breckenridge, S., and Kolattukudy, P. E. (1998).

Lysine 58 and histidine 66 at the C-terminal alpha-helix of monocyte chemoattractant

protein-1 are essential for glycosaminoglycan binding. J Biol Chem 273, 29641-29647.

Chan, C. C., Shen, D., Hackett, J. J., Buggage, R. R., and Tuaillon, N. (2003). Expression

of chemokine receptors, CXCR4 and CXCR5, and chemokines, BLC and SDF-1, in the

eyes of patients with primary intraocular lymphoma. Ophthalmology 110, 421-426.

Chang, T. L., Gordon, C. J., Roscic-Mrkic, B., Power, C., Proudfoot, A. E., Moore, J. P.,

and Trkola, A. (2002). Interaction of the CC-chemokine RANTES with

glycosaminoglycans activates a p44/p42 mitogen-activated protein kinase-dependent

signaling pathway and enhances human immunodeficiency virus type 1 infectivity. J

Virol 76, 2245-2254.

Chen, C., Li, J., Bot, G., Szabo, I., Rogers, T. J., and Liu-Chen, L. Y. (2004).

Heterodimerization and cross-desensitization between the mu-opioid receptor and the

chemokine CCR5 receptor. Eur J Pharmacol 483, 175-186.

215

Choe, H., Farzan, M., Sun, Y., Sullivan, N., Rollins, B., Ponath, P. D., Wu, L., Mackay,

C. R., LaRosa, G., Newman, W., et al. (1996). The beta-chemokine receptors CCR3 and

CCR5 facilitate infection by primary HIV-1 isolates. Cell 85, 1135-1148.

Chouaib, S., Asselin-Paturel, C., Mami-Chouaib, F., Caignard, A., and Blay, J. Y. (1997).

The host-tumor immune conflict: from immunosuppression to resistance and destruction.

Immunol Today 18, 493-497.

Christofk, H. R., Vander Heiden, M. G., Harris, M. H., Ramanathan, A., Gerszten, R. E.,

Wei, R., Fleming, M. D., Schreiber, S. L., and Cantley, L. C. (2008a). The M2 splice

isoform of pyruvate kinase is important for cancer metabolism and tumour growth.

Nature 452, 230-233.

Christofk, H. R., Vander Heiden, M. G., Wu, N., Asara, J. M., and Cantley, L. C. (2008b).

Pyruvate kinase M2 is a phosphotyrosine-binding protein. Nature 452, 181-186.

Cinamon, G., Grabovsky, V., Winter, E., Franitza, S., Feigelson, S., Shamri, R., Dwir, O.,

and Alon, R. (2001). Novel chemokine functions in lymphocyte migration through

vascular endothelium under shear flow. J Leukoc Biol 69, 860-866.

Cocchi, F., DeVico, A. L., Garzino-Demo, A., Arya, S. K., Gallo, R. C., and Lusso, P.

(1995). Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-

suppressive factors produced by CD8+ T cells. Science 270, 1811-1815.

Colamussi, M. L., Secchiero, P., Gonelli, A., Marchisio, M., Zauli, G., and Capitani, S.

(2001). Stromal derived factor-1 alpha (SDF-1 alpha) induces CD4+ T cell apoptosis via

the functional up-regulation of the Fas (CD95)/Fas ligand (CD95L) pathway. J Leukoc

Biol 69, 263-270.

216

Collette, Y., Benziane, A., Razanajaona, D., and Olive, D. (1998). Distinct regulation of

T-cell death by CD28 depending on both its aggregation and T-cell receptor triggering: a

role for Fas-FasL. Blood 92, 1350-1363.

Combadiere, C., Ahuja, S. K., Tiffany, H. L., and Murphy, P. M. (1996). Cloning and

functional expression of CC CKR5, a human monocyte CC chemokine receptor selective

for MIP-1(alpha), MIP-1(beta), and RANTES. J Leukoc Biol 60, 147-152.

Comerford, I., Litchfield, W., Harata-Lee, Y., Nibbs, R. J., and McColl, S. R. (2007).

Regulation of chemotactic networks by 'atypical' receptors. Bioessays 29, 237-247.

Comerford, I., Milasta, S., Morrow, V., Milligan, G., and Nibbs, R. (2006). The

chemokine receptor CCX-CKR mediates effective scavenging of CCL19 in vitro. Eur J

Immunol 36, 1904-1916.

Cooke, S. P., Forrest, G., Venables, P. J., and Hajeer, A. (1998). The delta32 deletion of

CCR5 receptor in rheumatoid arthritis. Arthritis Rheum 41, 1135-1136.

Cory, G. O., Cramer, R., Blanchoin, L., and Ridley, A. J. (2003). Phosphorylation of the

WASP-VCA domain increases its affinity for the Arp2/3 complex and enhances actin

polymerization by WASP. Mol Cell 11, 1229-1239.

Creagh, E. M., Conroy, H., and Martin, S. J. (2003). Caspase-activation pathways in

apoptosis and immunity. Immunol Rev 193, 10-21.

Crump, M. P., Gong, J. H., Loetscher, P., Rajarathnam, K., Amara, A., Arenzana-

Seisdedos, F., Virelizier, J. L., Baggiolini, M., Sykes, B. D., and Clark-Lewis, I. (1997).

Solution structure and basis for functional activity of stromal cell-derived factor-1;

dissociation of CXCR4 activation from binding and inhibition of HIV-1. Embo J 16,

6996-7007.

217

Curnock, A. P., Sotsios, Y., Wright, K. L., and Ward, S. G. (2003). Optimal chemotactic

responses of leukemic T cells to stromal cell-derived factor-1 requires the activation of

both class IA and IB phosphoinositide 3-kinases. J Immunol 170, 4021-4030.

Curnock, A. P., and Ward, S. G. (2003). Development and characterisation of

tetracycline-regulated phosphoinositide 3-kinase mutants: assessing the role of multiple

phosphoinositide 3-kinases in chemokine signaling. J Immunol Methods 273, 29-41.

Cyster, J. G. (2005). Chemokines, sphingosine-1-phosphate, and cell migration in

secondary lymphoid organs. Annu Rev Immunol 23, 127-159.

Czaplewski, L. G., McKeating, J., Craven, C. J., Higgins, L. D., Appay, V., Brown, A.,

Dudgeon, T., Howard, L. A., Meyers, T., Owen, J., et al. (1999). Identification of amino

acid residues critical for aggregation of human CC chemokines macrophage

inflammatory protein (MIP)-1alpha, MIP-1beta, and RANTES. Characterization of active

disaggregated chemokine variants. J Biol Chem 274, 16077-16084.

Dairaghi, D. J., Soo, K. S., Oldham, E. R., Premack, B. A., Kitamura, T., Bacon, K. B.,

and Schall, T. J. (1998). RANTES-induced T cell activation correlates with CD3

expression. J Immunol 160, 426-433.

Daniel, C., Pippin, J., Shankland, S. J., and Hugo, C. (2004). The rapamycin derivative

RAD inhibits mesangial cell migration through the CDK-inhibitor p27KIP1. Lab Invest

84, 588-596.

Dann, S. G., Selvaraj, A., and Thomas, G. (2007). mTOR Complex1-S6K1 signaling: at

the crossroads of obesity, diabetes and cancer. Trends Mol Med 13, 252-259.

Darnell, J. E., Jr. (1998). Studies of IFN-induced transcriptional activation uncover the

Jak-Stat pathway. J Interferon Cytokine Res 18, 549-554.

218

Dawson, T. C., Lentsch, A. B., Wang, Z., Cowhig, J. E., Rot, A., Maeda, N., and Peiper,

S. C. (2000). Exaggerated response to endotoxin in mice lacking the Duffy

antigen/receptor for chemokines (DARC). Blood 96, 1681-1684.

De Benedetti, A., and Graff, J. R. (2004). eIF-4E expression and its role in malignancies

and metastases. Oncogene 23, 3189-3199.

de Brevern, A. G., Wong, H., Tournamille, C., Colin, Y., Le Van Kim, C., and Etchebest,

C. (2005). A structural model of a seven-transmembrane helix receptor: the Duffy

antigen/receptor for chemokine (DARC). Biochim Biophys Acta 1724, 288-306.

Dean, M., Carrington, M., Winkler, C., Huttley, G. A., Smith, M. W., Allikmets, R.,

Goedert, J. J., Buchbinder, S. P., Vittinghoff, E., Gomperts, E., et al. (1996). Genetic

restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5

structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort

Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study.

Science 273, 1856-1862.

Devadas, S., Das, J., Liu, C., Zhang, L., Roberts, A. I., Pan, Z., Moore, P. A., Das, G.,

and Shi, Y. (2006). Granzyme B is critical for T cell receptor-induced cell death of type 2

helper T cells. Immunity 25, 237-247.

Dieu, M. C., Vanbervliet, B., Vicari, A., Bridon, J. M., Oldham, E., Ait-Yahia, S., Briere,

F., Zlotnik, A., Lebecque, S., and Caux, C. (1998). Selective recruitment of immature and

mature dendritic cells by distinct chemokines expressed in different anatomic sites. J Exp

Med 188, 373-386.

Ding, Y., Shimada, Y., Maeda, M., Kawabe, A., Kaganoi, J., Komoto, I., Hashimoto, Y.,

Miyake, M., Hashida, H., and Imamura, M. (2003). Association of CC chemokine

receptor 7 with lymph node metastasis of esophageal squamous cell carcinoma. Clin

Cancer Res 9, 3406-3412.

219

Dong, H. F., Wigmore, K., Carrington, M. N., Dean, M., Turpin, J. A., and Howard, O.

M. (2005). Variants of CCR5, which are permissive for HIV-1 infection, show distinct

functional responses to CCL3, CCL4 and CCL5. Genes Immun.

Doranz, B. J., Rucker, J., Yi, Y., Smyth, R. J., Samson, M., Peiper, S. C., Parmentier, M.,

Collman, R. G., and Doms, R. W. (1996). A dual-tropic primary HIV-1 isolate that uses

fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors.

Cell 85, 1149-1158.

Edinger, A. L., Cinalli, R. M., and Thompson, C. B. (2003a). Rab7 prevents growth

factor-independent survival by inhibiting cell-autonomous nutrient transporter expression.

Dev Cell 5, 571-582.

Edinger, A. L., Linardic, C. M., Chiang, G. G., Thompson, C. B., and Abraham, R. T.

(2003b). Differential effects of rapamycin on mammalian target of rapamycin signaling

functions in mammalian cells. Cancer Res 63, 8451-8460.

Edinger, A. L., and Thompson, C. B. (2002). Akt maintains cell size and survival by

increasing mTOR-dependent nutrient uptake. Mol Biol Cell 13, 2276-2288.

El-Asmar, L., Springael, J. Y., Ballet, S., Andrieu, E. U., Vassart, G., and Parmentier, M.

(2005). Evidence for negative binding cooperativity within CCR5-CCR2b heterodimers.

Mol Pharmacol 67, 460-469.

Elstrom, R. L., Bauer, D. E., Buzzai, M., Karnauskas, R., Harris, M. H., Plas, D. R.,

Zhuang, H., Cinalli, R. M., Alavi, A., Rudin, C. M., and Thompson, C. B. (2004). Akt

stimulates aerobic glycolysis in cancer cells. Cancer Res 64, 3892-3899.

Falasca, M., and Maffucci, T. (2007). Role of class II phosphoinositide 3-kinase in cell

signalling. Biochem Soc Trans 35, 211-214.

220

Fang, Y., Vilella-Bach, M., Bachmann, R., Flanigan, A., and Chen, J. (2001).

Phosphatidic acid-mediated mitogenic activation of mTOR signaling. Science 294, 1942-

1945.

Feng, J., Park, J., Cron, P., Hess, D., and Hemmings, B. A. (2004). Identification of a

PKB/Akt hydrophobic motif Ser-473 kinase as DNA-dependent protein kinase. J Biol

Chem 279, 41189-41196.

Finlay, B. B., and McFadden, G. (2006). Anti-immunology: evasion of the host immune

system by bacterial and viral pathogens. Cell 124, 767-782.

Floridi, F., Trettel, F., Di Bartolomeo, S., Ciotti, M. T., and Limatola, C. (2003).

Signalling pathways involved in the chemotactic activity of CXCL12 in cultured rat

cerebellar neurons and CHP100 neuroepithelioma cells. J Neuroimmunol 135, 38-46.

Florio, T., Casagrande, S., Diana, F., Bajetto, A., Porcile, C., Zona, G., Thellung, S.,

Arena, S., Pattarozzi, A., Corsaro, A., et al. (2006). Chemokine stromal cell-derived

factor 1alpha induces proliferation and growth hormone release in GH4C1 rat pituitary

adenoma cell line through multiple intracellular signals. Mol Pharmacol 69, 539-546.

Foster, D. A. (2007). Regulation of mTOR by phosphatidic acid? Cancer Res 67, 1-4.

Fox, C. J., Hammerman, P. S., and Thompson, C. B. (2005). Fuel feeds function: energy

metabolism and the T-cell response. Nat Rev Immunol 5, 844-852.

Fox, J. A., Ung, K., Tanlimco, S. G., and Jirik, F. R. (2002). Disruption of a single Pten

allele augments the chemotactic response of B lymphocytes to stromal cell-derived

factor-1. J Immunol 169, 49-54.

Fraile-Ramos, A., Kohout, T. A., Waldhoer, M., and Marsh, M. (2003). Endocytosis of

the viral chemokine receptor US28 does not require beta-arrestins but is dependent on the

clathrin-mediated pathway. Traffic 4, 243-253.

221

Frauwirth, K. A., Riley, J. L., Harris, M. H., Parry, R. V., Rathmell, J. C., Plas, D. R.,

Elstrom, R. L., June, C. H., and Thompson, C. B. (2002). The CD28 signaling pathway

regulates glucose metabolism. Immunity 16, 769-777.

Frederick, M. J., and Clayman, G. L. (2001). Chemokines in cancer. Expert Rev Mol

Med 2001, 1-18.

Fu, X. Y. (1992). A transcription factor with SH2 and SH3 domains is directly activated

by an interferon alpha-induced cytoplasmic protein tyrosine kinase(s). Cell 70, 323-335.

Furci, L., Scarlatti, G., Burastero, S., Tambussi, G., Colognesi, C., Quillent, C., Longhi,

R., Loverro, P., Borgonovo, B., Gaffi, D., et al. (1997). Antigen-driven C-C chemokine-

mediated HIV-1 suppression by CD4(+) T cells from exposed uninfected individuals

expressing the wild-type CCR-5 allele. J Exp Med 186, 455-460.

Gangloff, Y. G., Mueller, M., Dann, S. G., Svoboda, P., Sticker, M., Spetz, J. F., Um, S.

H., Brown, E. J., Cereghini, S., Thomas, G., and Kozma, S. C. (2004). Disruption of the

mouse mTOR gene leads to early postimplantation lethality and prohibits embryonic stem

cell development. Mol Cell Biol 24, 9508-9516.

Ganju, R. K., Brubaker, S. A., Chernock, R. D., Avraham, S., and Groopman, J. E. (2000).

Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem 275,

17263-17268.

Ganju, R. K., Dutt, P., Wu, L., Newman, W., Avraham, H., Avraham, S., and Groopman,

J. E. (1998). Beta-chemokine receptor CCR5 signals via the novel tyrosine kinase

RAFTK. Blood 91, 791-797.

Gao, N., Flynn, D. C., Zhang, Z., Zhong, X. S., Walker, V., Liu, K. J., Shi, X., and Jiang,

B. H. (2004). G1 cell cycle progression and the expression of G1 cyclins are regulated by

222

PI3K/AKT/mTOR/p70S6K1 signaling in human ovarian cancer cells. Am J Physiol Cell

Physiol 287, C281-291.

Gao, X., Zhang, Y., Arrazola, P., Hino, O., Kobayashi, T., Yeung, R. S., Ru, B., and Pan,

D. (2002). Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. Nat

Cell Biol 4, 699-704.

Garred, P., Madsen, H. O., Petersen, J., Marquart, H., Hansen, T. M., Freiesleben

Sorensen, S., Volck, B., Svejgaard, A., and Andersen, V. (1998). CC chemokine receptor

5 polymorphism in rheumatoid arthritis. J Rheumatol 25, 1462-1465.

Gerard, C., and Rollins, B. J. (2001). Chemokines and disease. Nat Immunol 2, 108-115.

Giannone, G., and Sheetz, M. P. (2006). Substrate rigidity and force define form through

tyrosine phosphatase and kinase pathways. Trends Cell Biol 16, 213-223.

Gingras, A. C., Kennedy, S. G., O'Leary, M. A., Sonenberg, N., and Hay, N. (1998). 4E-

BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the

Akt(PKB) signaling pathway. Genes Dev 12, 502-513.

Gingras, A. C., Raught, B., and Sonenberg, N. (2004). mTOR signaling to translation.

Curr Top Microbiol Immunol 279, 169-197.

Gomez-Cambronero, J. (2003). Rapamycin inhibits GM-CSF-induced neutrophil

migration. FEBS Lett 550, 94-100.

Gomez-Mouton, C., Lacalle, R. A., Mira, E., Jimenez-Baranda, S., Barber, D. F., Carrera,

A. C., Martinez, A. C., and Manes, S. (2004). Dynamic redistribution of raft domains as

an organizing platform for signaling during cell chemotaxis. J Cell Biol 164, 759-768.

223

Gomez-Reino, J. J., Pablos, J. L., Carreira, P. E., Santiago, B., Serrano, L., Vicario, J. L.,

Balsa, A., Figueroa, M., and de Juan, M. D. (1999). Association of rheumatoid arthritis

with a functional chemokine receptor, CCR5. Arthritis Rheum 42, 989-992.

Gong, J. H., and Clark-Lewis, I. (1995). Antagonists of monocyte chemoattractant

protein 1 identified by modification of functionally critical NH2-terminal residues. J Exp

Med 181, 631-640.

Gong, J. H., Ratkay, L. G., Waterfield, J. D., and Clark-Lewis, I. (1997). An antagonist of

monocyte chemoattractant protein 1 (MCP-1) inhibits arthritis in the MRL-lpr mouse

model. J Exp Med 186, 131-137.

Gonzalez, E., Kulkarni, H., Bolivar, H., Mangano, A., Sanchez, R., Catano, G., Nibbs, R.

J., Freedman, B. I., Quinones, M. P., Bamshad, M. J., et al. (2005). The influence of

CCL3L1 gene-containing segmental duplications on HIV-1/AIDS susceptibility. Science

307, 1434-1440.

Gordon, C. J., Muesing, M. A., Proudfoot, A. E., Power, C. A., Moore, J. P., and Trkola,

A. (1999). Enhancement of human immunodeficiency virus type 1 infection by the CC-

chemokine RANTES is independent of the mechanism of virus-cell fusion. J Virol 73,

684-694.

Govaerts, C., Blanpain, C., Deupi, X., Ballet, S., Ballesteros, J. A., Wodak, S. J., Vassart,

G., Pardo, L., and Parmentier, M. (2001). The TXP motif in the second transmembrane

helix of CCR5. A structural determinant of chemokine-induced activation. J Biol Chem

276, 13217-13225.

Graff, J. R., Konicek, B. W., Carter, J. H., and Marcusson, E. G. (2008). Targeting the

eukaryotic translation initiation factor 4E for cancer therapy. Cancer Res 68, 631-634.

Graff, J. R., Konicek, B. W., Vincent, T. M., Lynch, R. L., Monteith, D., Weir, S. N.,

Schwier, P., Capen, A., Goode, R. L., Dowless, M. S., et al. (2007). Therapeutic

224

suppression of translation initiation factor eIF4E expression reduces tumor growth

without toxicity. J Clin Invest 117, 2638-2648.

Graff, J. R., and Zimmer, S. G. (2003). Translational control and metastatic progression:

enhanced activity of the mRNA cap-binding protein eIF-4E selectively enhances

translation of metastasis-related mRNAs. Clin Exp Metastasis 20, 265-273.

Green, D. R., Droin, N., and Pinkoski, M. (2003). Activation-induced cell death in T cells.

Immunol Rev 193, 70-81.

Gross, J. D., Moerke, N. J., von der Haar, T., Lugovskoy, A. A., Sachs, A. B., McCarthy,

J. E., and Wagner, G. (2003). Ribosome loading onto the mRNA cap is driven by

conformational coupling between eIF4G and eIF4E. Cell 115, 739-750.

Gu, Y., Filippi, M. D., Cancelas, J. A., Siefring, J. E., Williams, E. P., Jasti, A. C., Harris,

C. E., Lee, A. W., Prabhakar, R., Atkinson, S. J., et al. (2003). Hematopoietic cell

regulation by Rac1 and Rac2 guanosine triphosphatases. Science 302, 445-449.

Guertin, D. A., and Sabatini, D. M. (2007). Defining the role of mTOR in cancer. Cancer

Cell 12, 9-22.

Gunn, M. D., Kyuwa, S., Tam, C., Kakiuchi, T., Matsuzawa, A., Williams, L. T., and

Nakano, H. (1999). Mice lacking expression of secondary lymphoid organ chemokine

have defects in lymphocyte homing and dendritic cell localization. J Exp Med 189, 451-

460.

Gupta, S. K., Lysko, P. G., Pillarisetti, K., Ohlstein, E., and Stadel, J. M. (1998).

Chemokine receptors in human endothelial cells. Functional expression of CXCR4 and

its transcriptional regulation by inflammatory cytokines. J Biol Chem 273, 4282-4287.

225

Haghighat, A., Mader, S., Pause, A., and Sonenberg, N. (1995). Repression of cap-

dependent translation by 4E-binding protein 1: competition with p220 for binding to

eukaryotic initiation factor-4E. Embo J 14, 5701-5709.

Haller, A. A., and Sarnow, P. (1997). In vitro selection of a 7-methyl-guanosine binding

RNA that inhibits translation of capped mRNA molecules. Proc Natl Acad Sci U S A 94,

8521-8526.

Handel, T. M., and Domaille, P. J. (1996). Heteronuclear (1H, 13C, 15N) NMR

assignments and solution structure of the monocyte chemoattractant protein-1 (MCP-1)

dimer. Biochemistry 35, 6569-6584.

Hansell, C. A., Simpson, C. V., and Nibbs, R. J. (2006). Chemokine sequestration by

atypical chemokine receptors. Biochem Soc Trans 34, 1009-1013.

Hardwick, J. S., Kuruvilla, F. G., Tong, J. K., Shamji, A. F., and Schreiber, S. L. (1999).

Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling

pathways directly controlled by the Tor proteins. Proc Natl Acad Sci U S A 96, 14866-

14870.

Haringman, J. J., Ludikhuize, J., and Tak, P. P. (2004). Chemokines in joint disease: the

key to inflammation? Ann Rheum Dis 63, 1186-1194.

Hashimoto, I., Koizumi, K., Tatematsu, M., Minami, T., Cho, S., Takeno, N., Nakashima,

A., Sakurai, H., Saito, S., Tsukada, K., and Saiki, I. (2008). Blocking on the

CXCR4/mTOR signalling pathway induces the anti-metastatic properties and autophagic

cell death in peritoneal disseminated gastric cancer cells. Eur J Cancer 44, 1022-1029.

Hay, N., and Sonenberg, N. (2004). Upstream and downstream of mTOR. Genes Dev 18,

1926-1945.

226

Helbig, G., Christopherson, K. W., 2nd, Bhat-Nakshatri, P., Kumar, S., Kishimoto, H.,

Miller, K. D., Broxmeyer, H. E., and Nakshatri, H. (2003). NF-kappaB promotes breast

cancer cell migration and metastasis by inducing the expression of the chemokine

receptor CXCR4. J Biol Chem 278, 21631-21638.

Hereld, D., and Jin, T. (2008). Slamming the DOR on chemokine receptor signaling:

heterodimerization silences ligand-occupied CXCR4 and delta-opioid receptors. Eur J

Immunol 38, 334-337.

Hernanz-Falcon, P., Rodriguez-Frade, J. M., Serrano, A., Juan, D., del Sol, A., Soriano, S.

F., Roncal, F., Gomez, L., Valencia, A., Martinez, A. C., and Mellado, M. (2004).

Identification of amino acid residues crucial for chemokine receptor dimerization. Nat

Immunol 5, 216-223.

Hileman, R. E., Fromm, J. R., Weiler, J. M., and Linhardt, R. J. (1998).

Glycosaminoglycan-protein interactions: definition of consensus sites in

glycosaminoglycan binding proteins. Bioessays 20, 156-167.

Hirsch, E., Katanaev, V. L., Garlanda, C., Azzolino, O., Pirola, L., Silengo, L., Sozzani,

S., Mantovani, A., Altruda, F., and Wymann, M. P. (2000). Central role for G protein-

coupled phosphoinositide 3-kinase gamma in inflammation. Science 287, 1049-1053.

Hong, N. A., Flannery, M., Hsieh, S. N., Cado, D., Pedersen, R., and Winoto, A. (2000).

Mice lacking Dad1, the defender against apoptotic death-1, express abnormal N-linked

glycoproteins and undergo increased embryonic apoptosis. Dev Biol 220, 76-84.

Honing, H., van den Berg, T. K., van der Pol, S. M., Dijkstra, C. D., van der Kammen, R.

A., Collard, J. G., and de Vries, H. E. (2004). RhoA activation promotes transendothelial

migration of monocytes via ROCK. J Leukoc Biol 75, 523-528.

227

Hoogewerf, A. J., Kuschert, G. S., Proudfoot, A. E., Borlat, F., Clark-Lewis, I., Power, C.

A., and Wells, T. N. (1997). Glycosaminoglycans mediate cell surface oligomerization of

chemokines. Biochemistry 36, 13570-13578.

Hornberger, T. A., Chu, W. K., Mak, Y. W., Hsiung, J. W., Huang, S. A., and Chien, S.

(2006). The role of phospholipase D and phosphatidic acid in the mechanical activation

of mTOR signaling in skeletal muscle. Proc Natl Acad Sci U S A 103, 4741-4746.

Horuk, R. (1999). Chemokine receptors and HIV-1: the fusion of two major research

fields. Immunol Today 20, 89-94.

Horuk, R., Hesselgesser, J., Zhou, Y., Faulds, D., Halks-Miller, M., Harvey, S., Taub, D.,

Samson, M., Parmentier, M., Rucker, J., et al. (1998). The CC chemokine I-309 inhibits

CCR8-dependent infection by diverse HIV-1 strains. J Biol Chem 273, 386-391.

Hosaka, S., Akahoshi, T., Wada, C., and Kondo, H. (1994). Expression of the chemokine

superfamily in rheumatoid arthritis. Clin Exp Immunol 97, 451-457.

Hu, Y., and Ivashkiv, L. B. (2006). Costimulation of chemokine receptor signaling by

matrix metalloproteinase-9 mediates enhanced migration of IFN-alpha dendritic cells. J

Immunol 176, 6022-6033.

Huttenrauch, F., Nitzki, A., Lin, F. T., Honing, S., and Oppermann, M. (2002a). Beta-

arrentin binding to CC chemokine receptor 5 requires multiple C-terminal receptor

phosphorylation sites and involves a conserved Asp-Arg-Tyr sequence motif. J Biol

Chem 277, 30769-30777.

Huttenrauch, F., Nitzki, A., Lin, F. T., Honing, S., and Oppermann, M. (2002b). Beta-

arrestin binding to CC chemokine receptor 5 requires multiple C-terminal receptor

phosphorylation sites and involves a conserved Asp-Arg-Tyr sequence motif. J Biol

Chem 277, 30769-30777.

228

Hwang, J. H., Chung, H. K., Kim, D. W., Hwang, E. S., Suh, J. M., Kim, H., You, K. H.,

Kwon, O. Y., Ro, H. K., Jo, D. Y., and Shong, M. (2003). CXC chemokine receptor 4

expression and function in human anaplastic thyroid cancer cells. J Clin Endocrinol

Metab 88, 408-416.

Hynes, R. O. (2002). Integrins: bidirectional, allosteric signaling machines. Cell 110,

673-687.

Inoki, K., Li, Y., Xu, T., and Guan, K. L. (2003). Rheb GTPase is a direct target of TSC2

GAP activity and regulates mTOR signaling. Genes Dev 17, 1829-1834.

Inoki, K., Li, Y., Zhu, T., Wu, J., and Guan, K. L. (2002). TSC2 is phosphorylated and

inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4, 648-657.

Issafras, H., Angers, S., Bulenger, S., Blanpain, C., Parmentier, M., Labbe-Jullie, C.,

Bouvier, M., and Marullo, S. (2002). Constitutive agonist-independent CCR5

oligomerization and antibody-mediated clustering occurring at physiological levels of

receptors. J Biol Chem 277, 34666-34673.

Itoh, R. E., Kurokawa, K., Ohba, Y., Yoshizaki, H., Mochizuki, N., and Matsuda, M.

(2002). Activation of rac and cdc42 video imaged by fluorescent resonance energy

transfer-based single-molecule probes in the membrane of living cells. Mol Cell Biol 22,

6582-6591.

Jacinto, E., Loewith, R., Schmidt, A., Lin, S., Ruegg, M. A., Hall, A., and Hall, M. N.

(2004). Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin

insensitive. Nat Cell Biol 6, 1122-1128.

Jackson, R. J. (2005). Alternative mechanisms of initiating translation of mammalian

mRNAs. Biochem Soc Trans 33, 1231-1241.

229

Jamieson, T., Cook, D. N., Nibbs, R. J., Rot, A., Nixon, C., McLean, P., Alcami, A., Lira,

S. A., Wiekowski, M., and Graham, G. J. (2005). The chemokine receptor D6 limits the

inflammatory response in vivo. Nat Immunol 6, 403-411.

Jarnagin, K., Grunberger, D., Mulkins, M., Wong, B., Hemmerich, S., Paavola, C.,

Bloom, A., Bhakta, S., Diehl, F., Freedman, R., et al. (1999). Identification of surface

residues of the monocyte chemotactic protein 1 that affect signaling through the receptor

CCR2. Biochemistry 38, 16167-16177.

Jawaheer, D., Li, W., Graham, R. R., Chen, W., Damle, A., Xiao, X., Monteiro, J.,

Khalili, H., Lee, A., Lundsten, R., et al. (2002). Dissecting the genetic complexity of the

association between human leukocyte antigens and rheumatoid arthritis. Am J Hum

Genet 71, 585-594.

Jayasinghe, M. M., Golden, J. M., Nair, P., O'Donnell, C. M., Werner, M. T., and Kurt, R.

A. (2008). Tumor-derived CCL5 does not contribute to breast cancer progression. Breast

Cancer Res Treat 111, 511-521.

Jinquan, T., Jacobi, H. H., Jing, C., Millner, A., Sten, E., Hviid, L., Anting, L., Ryder, L.

P., Glue, C., Skov, P. S., et al. (2003). CCR3 expression induced by IL-2 and IL-4

functioning as a death receptor for B cells. J Immunol 171, 1722-1731.

John, S., Smith, S., Morrison, J. F., Symmons, D., Worthington, J., Silman, A., and

Barton, A. (2003). Genetic variation in CCR5 does not predict clinical outcome in

inflammatory arthritis. Arthritis Rheum 48, 3615-3616.

Johnson, Z., Kosco-Vilbois, M. H., Herren, S., Cirillo, R., Muzio, V., Zaratin, P.,

Carbonatto, M., Mack, M., Smailbegovic, A., Rose, M., et al. (2004). Interference with

heparin binding and oligomerization creates a novel anti-inflammatory strategy targeting

the chemokine system. J Immunol 173, 5776-5785.

230

Johnston, B., and Butcher, E. C. (2002). Chemokines in rapid leukocyte adhesion

triggering and migration. Semin Immunol 14, 83-92.

Jones, R. G., Bui, T., White, C., Madesh, M., Krawczyk, C. M., Lindsten, T., Hawkins, B.

J., Kubek, S., Frauwirth, K. A., Wang, Y. L., et al. (2007). The proapoptotic factors Bax

and Bak regulate T Cell proliferation through control of endoplasmic reticulum Ca(2+)

homeostasis. Immunity 27, 268-280.

Jones, R. G., and Thompson, C. B. (2007). Revving the engine: signal transduction fuels

T cell activation. Immunity 27, 173-178.

Joo, E. K., Broxmeyer, H. E., Kwon, H. J., Kang, H. B., Kim, J. S., Lim, J. S., Choe, Y.

K., Choe, I. S., Myung, P. K., and Lee, Y. (2004). Enhancement of cell survival by

stromal cell-derived factor-1/CXCL12 involves activation of CREB and induction of

Mcl-1 and c-Fos in factor-dependent human cell line MO7e. Stem Cells Dev 13, 563-570.

Ju, S. T., Panka, D. J., Cui, H., Ettinger, R., el-Khatib, M., Sherr, D. H., Stanger, B. Z.,

and Marshak-Rothstein, A. (1995). Fas(CD95)/FasL interactions required for

programmed cell death after T-cell activation. Nature 373, 444-448.

Kalesnikoff, J., Sly, L. M., Hughes, M. R., Buchse, T., Rauh, M. J., Cao, L. P., Lam, V.,

Mui, A., Huber, M., and Krystal, G. (2003). The role of SHIP in cytokine-induced

signaling. Rev Physiol Biochem Pharmacol 149, 87-103.

Kameyoshi, Y., Dorschner, A., Mallet, A. I., Christophers, E., and Schroder, J. M. (1992).

Cytokine RANTES released by thrombin-stimulated platelets is a potent attractant for

human eosinophils. J Exp Med 176, 587-592.

231

Kanaho, Y., Nakai, Y., Katoh, M., and Nozawa, Y. (1993). The phosphatase inhibitor

2,3-diphosphoglycerate interferes with phospholipase D activation in rabbit peritoneal

neutrophils. J Biol Chem 268, 12492-12497.

Karnoub, A. E., Dash, A. B., Vo, A. P., Sullivan, A., Brooks, M. W., Bell, G. W.,

Richardson, A. L., Polyak, K., Tubo, R., and Weinberg, R. A. (2007). Mesenchymal stem

cells within tumour stroma promote breast cancer metastasis. Nature 449, 557-563.

Karpus, W. J., Lukacs, N. W., Kennedy, K. J., Smith, W. S., Hurst, S. D., and Barrett, T.

A. (1997). Differential CC chemokine-induced enhancement of T helper cell cytokine

production. J Immunol 158, 4129-4136.

Kaul, M., and Lipton, S. A. (1999). Chemokines and activated macrophages in HIV

gp120-induced neuronal apoptosis. Proc Natl Acad Sci U S A 96, 8212-8216.

Kawai, T., Seki, M., Hiromatsu, K., Eastcott, J. W., Watts, G. F., Sugai, M., Smith, D. J.,

Porcelli, S. A., and Taubman, M. A. (1999). Selective diapedesis of Th1 cells induced by

endothelial cell RANTES. J Immunol 163, 3269-3278.

Khandoga, A., Kessler, J. S., Hanschen, M., Khandoga, A. G., Burggraf, D., Reichel, C.,

Hamann, G. F., Enders, G., and Krombach, F. (2006). Matrix metalloproteinase-9

promotes neutrophil and T cell recruitment and migration in the postischemic liver. J

Leukoc Biol 79, 1295-1305.

Kim, D. H., Sarbassov, D. D., Ali, S. M., King, J. E., Latek, R. R., Erdjument-Bromage,

H., Tempst, P., and Sabatini, D. M. (2002). mTOR interacts with raptor to form a

nutrient-sensitive complex that signals to the cell growth machinery. Cell 110, 163-175.

Kinder, M., Chislock, E., Bussard, K. M., Shuman, L., and Mastro, A. M. (2008).

Metastatic breast cancer induces an osteoblast inflammatory response. Exp Cell Res 314,

173-183.

232

Kinsella, T. M., and Nolan, G. P. (1996). Episomal vectors rapidly and stably produce

high-titer recombinant retrovirus. Hum Gene Ther 7, 1405-1413.

Knudsen, K. E., Diehl, J. A., Haiman, C. A., and Knudsen, E. S. (2006). Cyclin D1:

polymorphism, aberrant splicing and cancer risk. Oncogene 25, 1620-1628.

Koch, A. E., Polverini, P. J., Kunkel, S. L., Harlow, L. A., DiPietro, L. A., Elner, V. M.,

Elner, S. G., and Strieter, R. M. (1992). Interleukin-8 as a macrophage-derived mediator

of angiogenesis. Science 258, 1798-1801.

Koopmann, W., Ediriwickrema, C., and Krangel, M. S. (1999). Structure and function of

the glycosaminoglycan binding site of chemokine macrophage-inflammatory protein-1

beta. J Immunol 163, 2120-2127.

Koopmann, W., and Krangel, M. S. (1997). Identification of a glycosaminoglycan-

binding site in chemokine macrophage inflammatory protein-1alpha. J Biol Chem 272,

10103-10109.

Koshiba, T., Hosotani, R., Miyamoto, Y., Ida, J., Tsuji, S., Nakajima, S., Kawaguchi, M.,

Kobayashi, H., Doi, R., Hori, T., et al. (2000). Expression of stromal cell-derived factor 1

and CXCR4 ligand receptor system in pancreatic cancer: a possible role for tumor

progression. Clin Cancer Res 6, 3530-3535.

Kraft, K., Olbrich, H., Majoul, I., Mack, M., Proudfoot, A., and Oppermann, M. (2001).

Characterization of sequence determinants within the carboxyl-terminal domain of

chemokine receptor CCR5 that regulate signaling and receptor internalization. J Biol

Chem 276, 34408-34418.

Krammer, P. H., Arnold, R., and Lavrik, I. N. (2007). Life and death in peripheral T cells.

Nat Rev Immunol 7, 532-542.

233

Krauss, S., Brand, M. D., and Buttgereit, F. (2001). Signaling takes a breath--new

quantitative perspectives on bioenergetics and signal transduction. Immunity 15, 497-502.

Kraynov, V. S., Chamberlain, C., Bokoch, G. M., Schwartz, M. A., Slabaugh, S., and

Hahn, K. M. (2000). Localized Rac activation dynamics visualized in living cells.

Science 290, 333-337.

Kroeger, K. M., and Eidne, K. A. (2004). Study of G-protein-coupled receptor-protein

interactions by bioluminescence resonance energy transfer. Methods Mol Biol 259, 323-

333.

Kumar, A., Humphreys, T. D., Kremer, K. N., Bramati, P. S., Bradfield, L., Edgar, C. E.,

and Hedin, K. E. (2006). CXCR4 physically associates with the T cell receptor to signal

in T cells. Immunity 25, 213-224.

Kuschert, G. S., Coulin, F., Power, C. A., Proudfoot, A. E., Hubbard, R. E., Hoogewerf,

A. J., and Wells, T. N. (1999). Glycosaminoglycans interact selectively with chemokines

and modulate receptor binding and cellular responses. Biochemistry 38, 12959-12968.

Kusner, D. J., Hall, C. F., and Schlesinger, L. S. (1996). Activation of phospholipase D is

tightly coupled to the phagocytosis of Mycobacterium tuberculosis or opsonized zymosan

by human macrophages. J Exp Med 184, 585-595.

Lagane, B., Ballet, S., Planchenault, T., Balabanian, K., Le Poul, E., Blanpain, C.,

Percherancier, Y., Staropoli, I., Vassart, G., Oppermann, M., et al. (2005). Mutation of

the DRY motif reveals different structural requirements for the CC chemokine receptor 5-

mediated signaling and receptor endocytosis. Mol Pharmacol 67, 1966-1976.

Lau, E. K., Paavola, C. D., Johnson, Z., Gaudry, J. P., Geretti, E., Borlat, F., Kungl, A. J.,

Proudfoot, A. E., and Handel, T. M. (2004). Identification of the glycosaminoglycan

binding site of the CC chemokine, MCP-1: implications for structure and function in vivo.

J Biol Chem 279, 22294-22305.

234

Laurence, J. S., Blanpain, C., De Leener, A., Parmentier, M., and LiWang, P. J. (2001).

Importance of basic residues and quaternary structure in the function of MIP-1 beta:

CCR5 binding and cell surface sugar interactions. Biochemistry 40, 4990-4999.

Lederman, M. M., Penn-Nicholson, A., Cho, M., and Mosier, D. (2006). Biology of

CCR5 and its role in HIV infection and treatment. Jama 296, 815-826.

Lee, B., Sharron, M., Blanpain, C., Doranz, B. J., Vakili, J., Setoh, P., Berg, E., Liu, G.,

Guy, H. R., Durell, S. R., et al. (1999). Epitope mapping of CCR5 reveals multiple

conformational states and distinct but overlapping structures involved in chemokine and

coreceptor function. J Biol Chem 274, 9617-9626.

Lee, J. S., Frevert, C. W., Wurfel, M. M., Peiper, S. C., Wong, V. A., Ballman, K. K.,

Ruzinski, J. T., Rhim, J. S., Martin, T. R., and Goodman, R. B. (2003). Duffy antigen

facilitates movement of chemokine across the endothelium in vitro and promotes

neutrophil transmigration in vitro and in vivo. J Immunol 170, 5244-5251.

Lee, Y., Gotoh, A., Kwon, H. J., You, M., Kohli, L., Mantel, C., Cooper, S., Hangoc, G.,

Miyazawa, K., Ohyashiki, K., and Broxmeyer, H. E. (2002). Enhancement of intracellular

signaling associated with hematopoietic progenitor cell survival in response to SDF-

1/CXCL12 in synergy with other cytokines. Blood 99, 4307-4317.

Lefkowitz, R. J., and Shenoy, S. K. (2005). Transduction of receptor signals by beta-

arrestins. Science 308, 512-517.

Lehman, J. A., and Gomez-Cambronero, J. (2002). Molecular crosstalk between p70S6k

and MAPK cell signaling pathways. Biochem Biophys Res Commun 293, 463-469.

Li, Z., Jiang, H., Xie, W., Zhang, Z., Smrcka, A. V., and Wu, D. (2000). Roles of PLC-

beta2 and -beta3 and PI3Kgamma in chemoattractant-mediated signal transduction.

Science 287, 1046-1049.

235

Li, Z., Jiao, X., Wang, C., Ju, X., Lu, Y., Yuan, L., Lisanti, M. P., Katiyar, S., and Pestell,

R. G. (2006a). Cyclin D1 induction of cellular migration requires p27(KIP1). Cancer Res

66, 9986-9994.

Li, Z., Wang, C., Jiao, X., Lu, Y., Fu, M., Quong, A. A., Dye, C., Yang, J., Dai, M., Ju,

X., et al. (2006b). Cyclin D1 regulates cellular migration through the inhibition of

thrombospondin 1 and ROCK signaling. Mol Cell Biol 26, 4240-4256.

Liu, R., Paxton, W. A., Choe, S., Ceradini, D., Martin, S. R., Horuk, R., MacDonald, M.

E., Stuhlmann, H., Koup, R. A., and Landau, N. R. (1996). Homozygous defect in HIV-1

coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1

infection. Cell 86, 367-377.

Li-Weber, M., and Krammer, P. H. (2003). Function and regulation of the CD95 (APO-

1/Fas) ligand in the immune system. Semin Immunol 15, 145-157.

Loberg, R. D., Day, L. L., Harwood, J., Ying, C., St John, L. N., Giles, R., Neeley, C. K.,

and Pienta, K. J. (2006). CCL2 is a potent regulator of prostate cancer cell migration and

proliferation. Neoplasia 8, 578-586.

Lodi, P. J., Garrett, D. S., Kuszewski, J., Tsang, M. L., Weatherbee, J. A., Leonard, W. J.,

Gronenborn, A. M., and Clore, G. M. (1994). High-resolution solution structure of the

beta chemokine hMIP-1 beta by multidimensional NMR. Science 263, 1762-1767.

Loetscher, P., Uguccioni, M., Bordoli, L., Baggiolini, M., Moser, B., Chizzolini, C., and

Dayer, J. M. (1998). CCR5 is characteristic of Th1 lymphocytes. Nature 391, 344-345.

Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J. L., Bonenfant, D.,

Oppliger, W., Jenoe, P., and Hall, M. N. (2002). Two TOR complexes, only one of which

is rapamycin sensitive, have distinct roles in cell growth control. Mol Cell 10, 457-468.

236

Long, X., Lin, Y., Ortiz-Vega, S., Yonezawa, K., and Avruch, J. (2005). Rheb binds and

regulates the mTOR kinase. Curr Biol 15, 702-713.

Louahed, J., Struyf, S., Demoulin, J. B., Parmentier, M., Van Snick, J., Van Damme, J.,

and Renauld, J. C. (2003). CCR8-dependent activation of the RAS/MAPK pathway

mediates anti-apoptotic activity of I-309/ CCL1 and vMIP-I. Eur J Immunol 33, 494-501.

Luboshits, G., Shina, S., Kaplan, O., Engelberg, S., Nass, D., Lifshitz-Mercer, B.,

Chaitchik, S., Keydar, I., and Ben-Baruch, A. (1999). Elevated expression of the CC

chemokine regulated on activation, normal T cell expressed and secreted (RANTES) in

advanced breast carcinoma. Cancer Res 59, 4681-4687.

Luker, K. E., and Luker, G. D. (2006). Functions of CXCL12 and CXCR4 in breast

cancer. Cancer Lett 238, 30-41.

Luster, A. D. (1998). Chemokines--chemotactic cytokines that mediate inflammation. N

Engl J Med 338, 436-445.

Luther, S. A., and Cyster, J. G. (2001). Chemokines as regulators of T cell differentiation.

Nat Immunol 2, 102-107.

MacArthur, R. D., and Novak, R. M. (2008). Reviews of anti-infective agents: maraviroc:

the first of a new class of antiretroviral agents. Clin Infect Dis 47, 236-241.

Mack, M., Luckow, B., Nelson, P. J., Cihak, J., Simmons, G., Clapham, P. R., Signoret,

N., Marsh, M., Stangassinger, M., Borlat, F., et al. (1998). Aminooxypentane-RANTES

induces CCR5 internalization but inhibits recycling: a novel inhibitory mechanism of

HIV infectivity. J Exp Med 187, 1215-1224.

MacManus, C. F., Pettigrew, J., Seaton, A., Wilson, C., Maxwell, P. J., Berlingeri, S.,

Purcell, C., McGurk, M., Johnston, P. G., and Waugh, D. J. J. (2007). Interleukin-8

237

Signaling Promotes Translational Regulation of Cyclin D in Androgen-Independent

Prostate Cancer Cells. Mol Cancer Res 5, 737-748.

Makino, Y., Cook, D. N., Smithies, O., Hwang, O. Y., Neilson, E. G., Turka, L. A., Sato,

H., Wells, A. D., and Danoff, T. M. (2002). Impaired T cell function in RANTES-

deficient mice. Clin Immunol 102, 302-309.

Mamane, Y., Petroulakis, E., Martineau, Y., Sato, T. A., Larsson, O., Rajasekhar, V. K.,

and Sonenberg, N. (2007). Epigenetic activation of a subset of mRNAs by eIF4E explains

its effects on cell proliferation. PLoS ONE 2, e242.

Manning, B. D., and Cantley, L. C. (2007). AKT/PKB signaling: navigating downstream.

Cell 129, 1261-1274.

Mantovani, A., Bottazzi, B., Colotta, F., Sozzani, S., and Ruco, L. (1992). The origin and

function of tumor-associated macrophages. Immunol Today 13, 265-270.

Marcotrigiano, J., Gingras, A. C., Sonenberg, N., and Burley, S. K. (1997). Cocrystal

structure of the messenger RNA 5' cap-binding protein (eIF4E) bound to 7-methyl-GDP.

Cell 89, 951-961.

Martin, L., Blanpain, C., Garnier, P., Wittamer, V., Parmentier, M., and Vita, C. (2001).

Structural and functional analysis of the RANTES-glycosaminoglycans interactions.

Biochemistry 40, 6303-6318.

Martin, P. M., and Sutherland, A. E. (2001). Exogenous amino acids regulate

trophectoderm differentiation in the mouse blastocyst through an mTOR-dependent

pathway. Dev Biol 240, 182-193.

MartIn-Fontecha, A., Sebastiani, S., Hopken, U. E., Uguccioni, M., Lipp, M.,

Lanzavecchia, A., and Sallusto, F. (2003). Regulation of dendritic cell migration to the

238

draining lymph node: impact on T lymphocyte traffic and priming. J Exp Med 198, 615-

621.

Matloubian, M., Lo, C. G., Cinamon, G., Lesneski, M. J., Xu, Y., Brinkmann, V.,

Allende, M. L., Proia, R. L., and Cyster, J. G. (2004). Lymphocyte egress from thymus

and peripheral lymphoid organs is dependent on S1P receptor 1. Nature 427, 355-360.

Matsuo, H., Li, H., McGuire, A. M., Fletcher, C. M., Gingras, A. C., Sonenberg, N., and

Wagner, G. (1997). Structure of translation factor eIF4E bound to m7GDP and

interaction with 4E-binding protein. Nat Struct Biol 4, 717-724.

McKendrick, L., Morley, S. J., Pain, V. M., Jagus, R., and Joshi, B. (2001).

Phosphorylation of eukaryotic initiation factor 4E (eIF4E) at Ser209 is not required for

protein synthesis in vitro and in vivo. Eur J Biochem 268, 5375-5385.

Mellado, M., de Ana, A. M., Moreno, M. C., Martinez, C., and Rodriguez-Frade, J. M.

(2001a). A potential immune escape mechanism by melanoma cells through the

activation of chemokine-induced T cell death. Curr Biol 11, 691-696.

Mellado, M., Rodriguez-Frade, J. M., Aragay, A., del Real, G., Martin, A. M., Vila-Coro,

A. J., Serrano, A., Mayor, F., Jr., and Martinez, A. C. (1998). The chemokine monocyte

chemotactic protein 1 triggers Janus kinase 2 activation and tyrosine phosphorylation of

the CCR2B receptor. J Immunol 161, 805-813.

Mellado, M., Rodriguez-Frade, J. M., Manes, S., and Martinez, A. C. (2001b).

Chemokine signaling and functional responses: the role of receptor dimerization and TK

pathway activation. Annu Rev Immunol 19, 397-421.

Mellado, M., Rodriguez-Frade, J. M., Vila-Coro, A. J., Fernandez, S., Martin de Ana, A.,

Jones, D. R., Toran, J. L., and Martinez, A. C. (2001c). Chemokine receptor homo- or

heterodimerization activates distinct signaling pathways. Embo J 20, 2497-2507.

239

Meyuhas, O. (2000). Synthesis of the translational apparatus is regulated at the

translational level. Eur J Biochem 267, 6321-6330.

Middleton, J., Neil, S., Wintle, J., Clark-Lewis, I., Moore, H., Lam, C., Auer, M., Hub, E.,

and Rot, A. (1997). Transcytosis and surface presentation of IL-8 by venular endothelial

cells. Cell 91, 385-395.

Miki, H., Yamaguchi, H., Suetsugu, S., and Takenawa, T. (2000). IRSp53 is an essential

intermediate between Rac and WAVE in the regulation of membrane ruffling. Nature 408,

732-735.

Mira, E., Lacalle, R. A., Gonzalez, M. A., Gomez-Mouton, C., Abad, J. L., Bernad, A.,

Martinez, A. C., and Manes, S. (2001). A role for chemokine receptor transactivation in

growth factor signaling. EMBO Rep 2, 151-156.

Misse, D., Esteve, P. O., Renneboog, B., Vidal, M., Cerutti, M., St Pierre, Y., Yssel, H.,

Parmentier, M., and Veas, F. (2001). HIV-1 glycoprotein 120 induces the MMP-9

cytopathogenic factor production that is abolished by inhibition of the p38 mitogen-

activated protein kinase signaling pathway. Blood 98, 541-547.

Misslitz, A., Pabst, O., Hintzen, G., Ohl, L., Kremmer, E., Petrie, H. T., and Forster, R.

(2004). Thymic T cell development and progenitor localization depend on CCR7. J Exp

Med 200, 481-491.

Mizoue, L. S., Sullivan, S. K., King, D. S., Kledal, T. N., Schwartz, T. W., Bacon, K. B.,

and Handel, T. M. (2001). Molecular determinants of receptor binding and signaling by

the CX3C chemokine fractalkine. J Biol Chem 276, 33906-33914.

Moerke, N. J., Aktas, H., Chen, H., Cantel, S., Reibarkh, M. Y., Fahmy, A., Gross, J. D.,

Degterev, A., Yuan, J., Chorev, M., et al. (2007). Small-molecule inhibition of the

interaction between the translation initiation factors eIF4E and eIF4G. Cell 128, 257-267.

240

Moller, C., Stromberg, T., Juremalm, M., Nilsson, K., and Nilsson, G. (2003). Expression

and function of chemokine receptors in human multiple myeloma. Leukemia 17, 203-210.

Montaner, S. (2007). Akt/TSC/mTOR activation by the KSHV G protein-coupled

receptor: emerging insights into the molecular oncogenesis and treatment of Kaposi's

sarcoma. Cell Cycle 6, 438-443.

Moore, B. B., Arenberg, D. A., Stoy, K., Morgan, T., Addison, C. L., Morris, S. B., Glass,

M., Wilke, C., Xue, Y. Y., Sitterding, S., et al. (1999). Distinct CXC chemokines mediate

tumorigenicity of prostate cancer cells. Am J Pathol 154, 1503-1512.

Mora, J. R., and von Andrian, U. H. (2006). T-cell homing specificity and plasticity: new

concepts and future challenges. Trends Immunol 27, 235-243.

Moriguchi, M., Hissong, B. D., Gadina, M., Yamaoka, K., Tiffany, H. L., Murphy, P. M.,

Candotti, F., and O'Shea, J. J. (2005). CXCL12 signaling is independent of Jak2 and Jak3.

J Biol Chem 280, 17408-17414.

Moser, B., Wolf, M., Walz, A., and Loetscher, P. (2004). Chemokines: multiple levels of

leukocyte migration control. Trends Immunol 25, 75-84.

Mowafi, F., Cagigi, A., Matskova, L., Bjork, O., Chiodi, F., and Nilsson, A. (2008).

Chemokine CXCL12 enhances proliferation in pre-B-ALL via STAT5 activation. Pediatr

Blood Cancer 50, 812-817.

Mueller, A., and Strange, P. G. (2004). Mechanisms of internalization and recycling of

the chemokine receptor, CCR5. Eur J Biochem 271, 243-252.

Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., McClanahan, T.,

Murphy, E., Yuan, W., Wagner, S. N., et al. (2001). Involvement of chemokine receptors

in breast cancer metastasis. Nature 410, 50-56.

241

Muller, G., Reiterer, P., Hopken, U. E., Golfier, S., and Lipp, M. (2003). Role of

homeostatic chemokine and sphingosine-1-phosphate receptors in the organization of

lymphoid tissue. Ann N Y Acad Sci 987, 107-116.

Murooka, T. T., Rahbar, R., Platanias, L. C., and Fish, E. N. (2008). CCL5-mediated T-

cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1.

Blood 111, 4892-4901.

Murooka, T. T., Ward, S. E., and Fish, E. N. (2005). Chemokines and cancer. Cancer

Treat Res 126, 15-44.

Murooka, T. T., Wong, M. M., Rahbar, R., Majchrzak-Kita, B., Proudfoot, A. E., and

Fish, E. N. (2006). CCL5-CCR5-mediated Apoptosis in T Cells: REQUIREMENT FOR

GLYCOSAMINOGLYCAN BINDING AND CCL5 AGGREGATION. J Biol Chem 281,

25184-25194.

Murphy, P. M. (2001). Viral exploitation and subversion of the immune system through

chemokine mimicry. Nat Immunol 2, 116-122.

Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, R., Matsushima, K.,

Miller, L. H., Oppenheim, J. J., and Power, C. A. (2000). International union of

pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol Rev 52, 145-

176.

Muzio, M., Polentarutti, N., Bosisio, D., Manoj Kumar, P. P., and Mantovani, A. (2000).

Toll-like receptor family and signalling pathway. Biochem Soc Trans 28, 563-566.

Myers, S. A., Han, J. W., Lee, Y., Firtel, R. A., and Chung, C. Y. (2005). A

Dictyostelium homologue of WASP is required for polarized F-actin assembly during

chemotaxis. Mol Biol Cell 16, 2191-2206.

242

Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y.,

Yoshida, N., Kikutani, H., and Kishimoto, T. (1996). Defects of B-cell lymphopoiesis

and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1.

Nature 382, 635-638.

Nakano, K., Isegawa, Y., Zou, P., Tadagaki, K., Inagi, R., and Yamanishi, K. (2003).

Kaposi's sarcoma-associated herpesvirus (KSHV)-encoded vMIP-I and vMIP-II induce

signal transduction and chemotaxis in monocytic cells. Arch Virol 148, 871-890.

Nanki, T., and Lipsky, P. E. (2000). Cutting edge: stromal cell-derived factor-1 is a

costimulator for CD4+ T cell activation. J Immunol 164, 5010-5014.

Nanki, T., and Lipsky, P. E. (2001). Stimulation of T-Cell activation by CXCL12/stromal

cell derived factor-1 involves a G-protein mediated signaling pathway. Cell Immunol 214,

145-154.

Nave, B. T., Ouwens, M., Withers, D. J., Alessi, D. R., and Shepherd, P. R. (1999).

Mammalian target of rapamycin is a direct target for protein kinase B: identification of a

convergence point for opposing effects of insulin and amino-acid deficiency on protein

translation. Biochem J 344 Pt 2, 427-431.

Nelson, W. J., and Nusse, R. (2004). Convergence of Wnt, beta-catenin, and cadherin

pathways. Science 303, 1483-1487.

Netelenbos, T., Zuijderduijn, S., Van Den Born, J., Kessler, F. L., Zweegman, S.,

Huijgens, P. C., and Drager, A. M. (2002). Proteoglycans guide SDF-1-induced migration

of hematopoietic progenitor cells. J Leukoc Biol 72, 353-362.

Neumeister, P., Pixley, F. J., Xiong, Y., Xie, H., Wu, K., Ashton, A., Cammer, M., Chan,

A., Symons, M., Stanley, E. R., and Pestell, R. G. (2003). Cyclin D1 governs adhesion

and motility of macrophages. Mol Biol Cell 14, 2005-2015.

243

Niwa, Y., Akamatsu, H., Niwa, H., Sumi, H., Ozaki, Y., and Abe, A. (2001). Correlation

of tissue and plasma RANTES levels with disease course in patients with breast or

cervical cancer. Clin Cancer Res 7, 285-289.

Noel, P. J., Boise, L. H., Green, J. M., and Thompson, C. B. (1996). CD28 costimulation

prevents cell death during primary T cell activation. J Immunol 157, 636-642.

Noh, W. C., Kim, Y. H., Kim, M. S., Koh, J. S., Kim, H. A., Moon, N. M., and Paik, N. S.

(2007). Activation of the mTOR signaling pathway in breast cancer and its correlation

with the clinicopathologic variables. Breast Cancer Res Treat.

Noh, W. C., Mondesire, W. H., Peng, J., Jian, W., Zhang, H., Dong, J., Mills, G. B.,

Hung, M. C., and Meric-Bernstam, F. (2004). Determinants of rapamycin sensitivity in

breast cancer cells. Clin Cancer Res 10, 1013-1023.

Nozumi, M., Nakagawa, H., Miki, H., Takenawa, T., and Miyamoto, S. (2003).

Differential localization of WAVE isoforms in filopodia and lamellipodia of the neuronal

growth cone. J Cell Sci 116, 239-246.

Odorizzi, G., Babst, M., and Emr, S. D. (2000). Phosphoinositide signaling and the

regulation of membrane trafficking in yeast. Trends Biochem Sci 25, 229-235.

Ogata, H., Takeya, M., Yoshimura, T., Takagi, K., and Takahashi, K. (1997). The role of

monocyte chemoattractant protein-1 (MCP-1) in the pathogenesis of collagen-induced

arthritis in rats. J Pathol 182, 106-114.

Ohashi, K., Nagata, K., Maekawa, M., Ishizaki, T., Narumiya, S., and Mizuno, K. (2000).

Rho-associated kinase ROCK activates LIM-kinase 1 by phosphorylation at threonine

508 within the activation loop. J Biol Chem 275, 3577-3582.

244

O'Hayre, M., Salanga, C. L., Handel, T. M., and Allen, S. J. (2008). Chemokines and

cancer: migration, intracellular signalling and intercellular communication in the

microenvironment. Biochem J 409, 635-649.

Oppermann, M. (2004). Chemokine receptor CCR5: insights into structure, function, and

regulation. Cell Signal 16, 1201-1210.

Oppermann, M., Mack, M., Proudfoot, A. E., and Olbrich, H. (1999). Differential effects

of CC chemokines on CC chemokine receptor 5 (CCR5) phosphorylation and

identification of phosphorylation sites on the CCR5 carboxyl terminus. J Biol Chem 274,

8875-8885.

Orimo, A., Gupta, P. B., Sgroi, D. C., Arenzana-Seisdedos, F., Delaunay, T., Naeem, R.,

Carey, V. J., Richardson, A. L., and Weinberg, R. A. (2005). Stromal fibroblasts present

in invasive human breast carcinomas promote tumor growth and angiogenesis through

elevated SDF-1/CXCL12 secretion. Cell 121, 335-348.

Paavola, C. D., Hemmerich, S., Grunberger, D., Polsky, I., Bloom, A., Freedman, R.,

Mulkins, M., Bhakta, S., McCarley, D., Wiesent, L., et al. (1998). Monomeric monocyte

chemoattractant protein-1 (MCP-1) binds and activates the MCP-1 receptor CCR2B. J

Biol Chem 273, 33157-33165.

Pablos, J. L., Santiago, B., Galindo, M., Torres, C., Brehmer, M. T., Blanco, F. J., and

Garcia-Lazaro, F. J. (2003). Synoviocyte-derived CXCL12 is displayed on endothelium

and induces angiogenesis in rheumatoid arthritis. J Immunol 170, 2147-2152.

Pakianathan, D. R., Kuta, E. G., Artis, D. R., Skelton, N. J., and Hebert, C. A. (1997).

Distinct but overlapping epitopes for the interaction of a CC-chemokine with CCR1,

CCR3 and CCR5. Biochemistry 36, 9642-9648.

245

Palazzo, A. F., Joseph, H. L., Chen, Y. J., Dujardin, D. L., Alberts, A. S., Pfister, K. K.,

Vallee, R. B., and Gundersen, G. G. (2001). Cdc42, dynein, and dynactin regulate MTOC

reorientation independent of Rho-regulated microtubule stabilization. Curr Biol 11, 1536-

1541.

Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le

Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., et al. (2000). Crystal structure of

rhodopsin: A G protein-coupled receptor. Science 289, 739-745.

Pause, A., Belsham, G. J., Gingras, A. C., Donze, O., Lin, T. A., Lawrence, J. C., Jr., and

Sonenberg, N. (1994). Insulin-dependent stimulation of protein synthesis by

phosphorylation of a regulator of 5'-cap function. Nature 371, 762-767.

Pelengaris, S., Khan, M., and Evan, G. (2002). c-MYC: more than just a matter of life

and death. Nat Rev Cancer 2, 764-776.

Pello, O. M., Martinez-Munoz, L., Parrillas, V., Serrano, A., Rodriguez-Frade, J. M.,

Toro, M. J., Lucas, P., Monterrubio, M., Martinez, A. C., and Mellado, M. (2008). Ligand

stabilization of CXCR4/delta-opioid receptor heterodimers reveals a mechanism for

immune response regulation. Eur J Immunol 38, 537-549.

Pene, F., Claessens, Y. E., Muller, O., Viguie, F., Mayeux, P., Dreyfus, F., Lacombe, C.,

and Bouscary, D. (2002). Role of the phosphatidylinositol 3-kinase/Akt and

mTOR/P70S6-kinase pathways in the proliferation and apoptosis in multiple myeloma.

Oncogene 21, 6587-6597.

Peng, T., Golub, T. R., and Sabatini, D. M. (2002). The immunosuppressant rapamycin

mimics a starvation-like signal distinct from amino acid and glucose deprivation. Mol

Cell Biol 22, 5575-5584.

246

Percherancier, Y., Berchiche, Y. A., Slight, I., Volkmer-Engert, R., Tamamura, H., Fujii,

N., Bouvier, M., and Heveker, N. (2005). Bioluminescence resonance energy transfer

reveals ligand-induced conformational changes in CXCR4 homo- and heterodimers. J

Biol Chem 280, 9895-9903.

Perry, S. J., and Lefkowitz, R. J. (2002). Arresting developments in heptahelical receptor

signaling and regulation. Trends Cell Biol 12, 130-138.

Peterson, R. T., Beal, P. A., Comb, M. J., and Schreiber, S. L. (2000). FKBP12-

rapamycin-associated protein (FRAP) autophosphorylates at Serine 2481 under

translationally repressive conditions. J Biol Chem 275, 7416-7423.

Pin, J. P., Galvez, T., and Prezeau, L. (2003). Evolution, structure, and activation

mechanism of family 3/C G-protein-coupled receptors. Pharmacol Ther 98, 325-354.

Pinto, L. A., Williams, M. S., Dolan, M. J., Henkart, P. A., and Shearer, G. M. (2000).

Beta-chemokines inhibit activation-induced death of lymphocytes from HIV-infected

individuals. Eur J Immunol 30, 2048-2055.

Pogo, A. O., and Chaudhuri, A. (2000). The Duffy protein: a malarial and chemokine

receptor. Semin Hematol 37, 122-129.

Pokorny, V., McQueen, F., Yeoman, S., Merriman, M., Merriman, A., Harrison, A.,

Highton, J., and McLean, L. (2005). Evidence for negative association of the chemokine

receptor CCR5 d32 polymorphism with rheumatoid arthritis. Ann Rheum Dis 64, 487-

490.

Pollard, T. D., and Borisy, G. G. (2003). Cellular motility driven by assembly and

disassembly of actin filaments. Cell 112, 453-465.

247

Pollok-Kopp, B., Schwarze, K., Baradari, V. K., and Oppermann, M. (2003). Analysis of

ligand-stimulated CC chemokine receptor 5 (CCR5) phosphorylation in intact cells using

phosphosite-specific antibodies. J Biol Chem 278, 2190-2198.

Prahalad, S. (2006). Negative association between the chemokine receptor CCR5-Delta32

polymorphism and rheumatoid arthritis: a meta-analysis. Genes Immun 7, 264-268.

Prest, S. J., Rees, R. C., Murdoch, C., Marshall, J. F., Cooper, P. A., Bibby, M., Li, G.,

and Ali, S. A. (1999). Chemokines induce the cellular migration of MCF-7 human breast

carcinoma cells: subpopulations of tumour cells display positive and negative chemotaxis

and differential in vivo growth potentials. Clin Exp Metastasis 17, 389-396.

Proost, P., De Meester, I., Schols, D., Struyf, S., Lambeir, A. M., Wuyts, A., Opdenakker,

G., De Clercq, E., Scharpe, S., and Van Damme, J. (1998). Amino-terminal truncation of

chemokines by CD26/dipeptidyl-peptidase IV. Conversion of RANTES into a potent

inhibitor of monocyte chemotaxis and HIV-1-infection. J Biol Chem 273, 7222-7227.

Proost, P., Struyf, S., and Van Damme, J. (2006). Natural post-translational modifications

of chemokines. Biochem Soc Trans 34, 997-1001.

Proud, C. G. (2007). Signalling to translation: how signal transduction pathways control

the protein synthetic machinery. Biochem J 403, 217-234.

Proudfoot, A. E. (2006). The biological relevance of chemokine-proteoglycan

interactions. Biochem Soc Trans 34, 422-426.

Proudfoot, A. E., Fritchley, S., Borlat, F., Shaw, J. P., Vilbois, F., Zwahlen, C., Trkola,

A., Marchant, D., Clapham, P. R., and Wells, T. N. (2001). The BBXB motif of

RANTES is the principal site for heparin binding and controls receptor selectivity. J Biol

Chem 276, 10620-10626.

248

Proudfoot, A. E., Handel, T. M., Johnson, Z., Lau, E. K., LiWang, P., Clark-Lewis, I.,

Borlat, F., Wells, T. N., and Kosco-Vilbois, M. H. (2003). Glycosaminoglycan binding

and oligomerization are essential for the in vivo activity of certain chemokines. Proc Natl

Acad Sci U S A 100, 1885-1890.

Pruenster, M., and Rot, A. (2006). Throwing light on DARC. Biochem Soc Trans 34,

1005-1008.

Pullikuth, A. K., and Catling, A. D. (2007). Scaffold mediated regulation of MAPK

signaling and cytoskeletal dynamics: a perspective. Cell Signal 19, 1621-1632.

Qin, S., Rottman, J. B., Myers, P., Kassam, N., Weinblatt, M., Loetscher, M., Koch, A. E.,

Moser, B., and Mackay, C. R. (1998). The chemokine receptors CXCR3 and CCR5 mark

subsets of T cells associated with certain inflammatory reactions. J Clin Invest 101, 746-

754.

Rabin, R. L., Park, M. K., Liao, F., Swofford, R., Stephany, D., and Farber, J. M. (1999).

Chemokine receptor responses on T cells are achieved through regulation of both

receptor expression and signaling. J Immunol 162, 3840-3850.

Raftopoulou, M., and Hall, A. (2004). Cell migration: Rho GTPases lead the way. Dev

Biol 265, 23-32.

Rahbar, R., Murooka, T. T., Hinek, A. A., Galligan, C. L., Sassano, A., Yu, C.,

Srivastava, K., Platanias, L. C., and Fish, E. N. (2006). Vaccinia virus activation of CCR5

invokes tyrosine phosphorylation signaling events that support virus replication. J Virol

80, 7245-7259.

Raman, D., Baugher, P. J., Thu, Y. M., and Richmond, A. (2007). Role of chemokines in

tumor growth. Cancer Lett 256, 137-165.

249

Raport, C. J., Gosling, J., Schweickart, V. L., Gray, P. W., and Charo, I. F. (1996).

Molecular cloning and functional characterization of a novel human CC chemokine

receptor (CCR5) for RANTES, MIP-1beta, and MIP-1alpha. J Biol Chem 271, 17161-

17166.

Rathanaswami, P., Hachicha, M., Sadick, M., Schall, T. J., and McColl, S. R. (1993).

Expression of the cytokine RANTES in human rheumatoid synovial fibroblasts.

Differential regulation of RANTES and interleukin-8 genes by inflammatory cytokines. J

Biol Chem 268, 5834-5839.

Rathmell, J. C., Elstrom, R. L., Cinalli, R. M., and Thompson, C. B. (2003). Activated

Akt promotes increased resting T cell size, CD28-independent T cell growth, and

development of autoimmunity and lymphoma. Eur J Immunol 33, 2223-2232.

Raught, B., Peiretti, F., Gingras, A. C., Livingstone, M., Shahbazian, D., Mayeur, G. L.,

Polakiewicz, R. D., Sonenberg, N., and Hershey, J. W. (2004). Phosphorylation of

eucaryotic translation initiation factor 4B Ser422 is modulated by S6 kinases. Embo J 23,

1761-1769.

Rawlings, J. S., Rosler, K. M., and Harrison, D. A. (2004). The JAK/STAT signaling

pathway. J Cell Sci 117, 1281-1283.

Reif, K., Okkenhaug, K., Sasaki, T., Penninger, J. M., Vanhaesebroeck, B., and Cyster, J.

G. (2004). Cutting edge: differential roles for phosphoinositide 3-kinases, p110gamma

and p110delta, in lymphocyte chemotaxis and homing. J Immunol 173, 2236-2240.

Richmond, A. (2002). Nf-kappa B, chemokine gene transcription and tumour growth. Nat

Rev Immunol 2, 664-674.

Richter, J. D., and Sonenberg, N. (2005). Regulation of cap-dependent translation by

eIF4E inhibitory proteins. Nature 433, 477-480.

250

Rickert, P., Weiner, O. D., Wang, F., Bourne, H. R., and Servant, G. (2000). Leukocytes

navigate by compass: roles of PI3Kgamma and its lipid products. Trends Cell Biol 10,

466-473.

Robinson, E., Keystone, E. C., Schall, T. J., Gillett, N., and Fish, E. N. (1995).

Chemokine expression in rheumatoid arthritis (RA): evidence of RANTES and

macrophage inflammatory protein (MIP)-1 beta production by synovial T cells. Clin Exp

Immunol 101, 398-407.

Robinson, S. C., Scott, K. A., and Balkwill, F. R. (2002). Chemokine stimulation of

monocyte matrix metalloproteinase-9 requires endogenous TNF-alpha. Eur J Immunol 32,

404-412.

Robinson, S. C., Scott, K. A., Wilson, J. L., Thompson, R. G., Proudfoot, A. E., and

Balkwill, F. R. (2003). A chemokine receptor antagonist inhibits experimental breast

tumor growth. Cancer Res 63, 8360-8365.

Rodriguez-Frade, J. M., Vila-Coro, A. J., Martin, A., Nieto, M., Sanchez-Madrid, F.,

Proudfoot, A. E., Wells, T. N., Martinez, A. C., and Mellado, M. (1999). Similarities and

differences in RANTES- and (AOP)-RANTES-triggered signals: implications for

chemotaxis. J Cell Biol 144, 755-765.

Rohrschneider, L. R., Fuller, J. F., Wolf, I., Liu, Y., and Lucas, D. M. (2000). Structure,

function, and biology of SHIP proteins. Genes Dev 14, 505-520.

Rosenwald, I. B., Kaspar, R., Rousseau, D., Gehrke, L., Leboulch, P., Chen, J. J.,

Schmidt, E. V., Sonenberg, N., and London, I. M. (1995). Eukaryotic translation

initiation factor 4E regulates expression of cyclin D1 at transcriptional and post-

transcriptional levels. J Biol Chem 270, 21176-21180.

251

Rosenwald, I. B., Lazaris-Karatzas, A., Sonenberg, N., and Schmidt, E. V. (1993).

Elevated levels of cyclin D1 protein in response to increased expression of eukaryotic

initiation factor 4E. Mol Cell Biol 13, 7358-7363.

Rossi, D., and Zlotnik, A. (2000). The biology of chemokines and their receptors. Annu

Rev Immunol 18, 217-242.

Ruggero, D., Montanaro, L., Ma, L., Xu, W., Londei, P., Cordon-Cardo, C., and Pandolfi,

P. P. (2004). The translation factor eIF-4E promotes tumor formation and cooperates with

c-Myc in lymphomagenesis. Nat Med 10, 484-486.

Ruvinsky, I., and Meyuhas, O. (2006). Ribosomal protein S6 phosphorylation: from

protein synthesis to cell size. Trends Biochem Sci 31, 342-348.

Ruvinsky, I., Sharon, N., Lerer, T., Cohen, H., Stolovich-Rain, M., Nir, T., Dor, Y.,

Zisman, P., and Meyuhas, O. (2005). Ribosomal protein S6 phosphorylation is a

determinant of cell size and glucose homeostasis. Genes Dev 19, 2199-2211.

Sabatini, D. M. (2006). mTOR and cancer: insights into a complex relationship. Nat Rev

Cancer 6, 729-734.

Sabatini, D. M., Erdjument-Bromage, H., Lui, M., Tempst, P., and Snyder, S. H. (1994).

RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion

and is homologous to yeast TORs. Cell 78, 35-43.

Sabers, C. J., Martin, M. M., Brunn, G. J., Williams, J. M., Dumont, F. J., Wiederrecht,

G., and Abraham, R. T. (1995). Isolation of a protein target of the FKBP12-rapamycin

complex in mammalian cells. J Biol Chem 270, 815-822.

252

Sadir, R., Baleux, F., Grosdidier, A., Imberty, A., and Lortat-Jacob, H. (2001).

Characterization of the stromal cell-derived factor-1alpha-heparin complex. J Biol Chem

276, 8288-8296.

Sahai, E., Olson, M. F., and Marshall, C. J. (2001). Cross-talk between Ras and Rho

signalling pathways in transformation favours proliferation and increased motility. Embo

J 20, 755-766.

Saji, H., Koike, M., Yamori, T., Saji, S., Seiki, M., Matsushima, K., and Toi, M. (2001).

Significant correlation of monocyte chemoattractant protein-1 expression with

neovascularization and progression of breast carcinoma. Cancer 92, 1085-1091.

Sakakibara, K., Liu, B., Hollenbeck, S., and Kent, K. C. (2005). Rapamycin inhibits

fibronectin-induced migration of the human arterial smooth muscle line (E47) through the

mammalian target of rapamycin. Am J Physiol Heart Circ Physiol 288, H2861-2868.

Sakata, D., Taniguchi, H., Yasuda, S., Adachi-Morishima, A., Hamazaki, Y., Nakayama,

R., Miki, T., Minato, N., and Narumiya, S. (2007). Impaired T lymphocyte trafficking in

mice deficient in an actin-nucleating protein, mDia1. J Exp Med 204, 2031-2038.

Salcedo, R., Ponce, M. L., Young, H. A., Wasserman, K., Ward, J. M., Kleinman, H. K.,

Oppenheim, J. J., and Murphy, W. J. (2000). Human endothelial cells express CCR2 and

respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood

96, 34-40.

Salcedo, R., Wasserman, K., Young, H. A., Grimm, M. C., Howard, O. M., Anver, M. R.,

Kleinman, H. K., Murphy, W. J., and Oppenheim, J. J. (1999). Vascular endothelial

growth factor and basic fibroblast growth factor induce expression of CXCR4 on human

endothelial cells: In vivo neovascularization induced by stromal-derived factor-1alpha.

Am J Pathol 154, 1125-1135.

253

Saltiel, A. R., and Kahn, C. R. (2001). Insulin signalling and the regulation of glucose

and lipid metabolism. Nature 414, 799-806.

Samson, M., Labbe, O., Mollereau, C., Vassart, G., and Parmentier, M. (1996). Molecular

cloning and functional expression of a new human CC-chemokine receptor gene.

Biochemistry 35, 3362-3367.

Sasaki, T., Irie-Sasaki, J., Jones, R. G., Oliveira-dos-Santos, A. J., Stanford, W. L., Bolon,

B., Wakeham, A., Itie, A., Bouchard, D., Kozieradzki, I., et al. (2000). Function of

PI3Kgamma in thymocyte development, T cell activation, and neutrophil migration.

Science 287, 1040-1046.

Saucedo, L. J., Gao, X., Chiarelli, D. A., Li, L., Pan, D., and Edgar, B. A. (2003). Rheb

promotes cell growth as a component of the insulin/TOR signalling network. Nat Cell

Biol 5, 566-571.

Schaerli, P., Willimann, K., Lang, A. B., Lipp, M., Loetscher, P., and Moser, B. (2000).

CXC chemokine receptor 5 expression defines follicular homing T cells with B cell

helper function. J Exp Med 192, 1553-1562.

Schall, T. J., Bacon, K., Toy, K. J., and Goeddel, D. V. (1990). Selective attraction of

monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature

347, 669-671.

Scheper, G. C., van Kollenburg, B., Hu, J., Luo, Y., Goss, D. J., and Proud, C. G. (2002).

Phosphorylation of eukaryotic initiation factor 4E markedly reduces its affinity for

capped mRNA. J Biol Chem 277, 3303-3309.

Seet, B. T., McCaughan, C. A., Handel, T. M., Mercer, A., Brunetti, C., McFadden, G.,

and Fleming, S. B. (2003). Analysis of an orf virus chemokine-binding protein: Shifting

254

ligand specificities among a family of poxvirus viroceptors. Proc Natl Acad Sci U S A

100, 15137-15142.

Sehgal, A., Keener, C., Boynton, A. L., Warrick, J., and Murphy, G. P. (1998a). CXCR-4,

a chemokine receptor, is overexpressed in and required for proliferation of glioblastoma

tumor cells. J Surg Oncol 69, 99-104.

Sehgal, A., Ricks, S., Boynton, A. L., Warrick, J., and Murphy, G. P. (1998b). Molecular

characterization of CXCR-4: a potential brain tumor-associated gene. J Surg Oncol 69,

239-248.

Servant, G., Weiner, O. D., Herzmark, P., Balla, T., Sedat, J. W., and Bourne, H. R.

(2000). Polarization of chemoattractant receptor signaling during neutrophil chemotaxis.

Science 287, 1037-1040.

Sgadari, C., Angiolillo, A. L., Cherney, B. W., Pike, S. E., Farber, J. M., Koniaris, L. G.,

Vanguri, P., Burd, P. R., Sheikh, N., Gupta, G., et al. (1996). Interferon-inducible

protein-10 identified as a mediator of tumor necrosis in vivo. Proc Natl Acad Sci U S A

93, 13791-13796.

Shahrara, S., Amin, M. A., Woods, J. M., Haines, G. K., and Koch, A. E. (2003).

Chemokine receptor expression and in vivo signaling pathways in the joints of rats with

adjuvant-induced arthritis. Arthritis Rheum 48, 3568-3583.

Shaw, J. P., Johnson, Z., Borlat, F., Zwahlen, C., Kungl, A., Roulin, K., Harrenga, A.,

Wells, T. N., and Proudfoot, A. E. (2004). The X-ray structure of RANTES: heparin-

derived disaccharides allows the rational design of chemokine inhibitors. Structure

(Camb) 12, 2081-2093.

255

Shenoy, S. K., and Lefkowitz, R. J. (2003). Trafficking patterns of beta-arrestin and G

protein-coupled receptors determined by the kinetics of beta-arrestin deubiquitination. J

Biol Chem 278, 14498-14506.

Signoret, N., Oldridge, J., Pelchen-Matthews, A., Klasse, P. J., Tran, T., Brass, L. F.,

Rosenkilde, M. M., Schwartz, T. W., Holmes, W., Dallas, W., et al. (1997). Phorbol

esters and SDF-1 induce rapid endocytosis and down modulation of the chemokine

receptor CXCR4. J Cell Biol 139, 651-664.

Signoret, N., Pelchen-Matthews, A., Mack, M., Proudfoot, A. E., and Marsh, M. (2000).

Endocytosis and recycling of the HIV coreceptor CCR5. J Cell Biol 151, 1281-1294.

Silzle, T., Kreutz, M., Dobler, M. A., Brockhoff, G., Knuechel, R., and Kunz-Schughart,

L. A. (2003). Tumor-associated fibroblasts recruit blood monocytes into tumor tissue. Eur

J Immunol 33, 1311-1320.

Simmons, G., Clapham, P. R., Picard, L., Offord, R. E., Rosenkilde, M. M., Schwartz, T.

W., Buser, R., Wells, T. N., and Proudfoot, A. E. (1997). Potent inhibition of HIV-1

infectivity in macrophages and lymphocytes by a novel CCR5 antagonist. Science 276,

276-279.

Sinclair, L. V., Finlay, D., Feijoo, C., Cornish, G. H., Gray, A., Ager, A., Okkenhaug, K.,

Hagenbeek, T. J., Spits, H., and Cantrell, D. A. (2008). Phosphatidylinositol-3-OH kinase

and nutrient-sensing mTOR pathways control T lymphocyte trafficking. Nat Immunol 9,

513-521.

Siveke, J. T., and Hamann, A. (1998). T helper 1 and T helper 2 cells respond

differentially to chemokines. J Immunol 160, 550-554.

Smith, D. R., Polverini, P. J., Kunkel, S. L., Orringer, M. B., Whyte, R. I., Burdick, M. D.,

Wilke, C. A., and Strieter, R. M. (1994). Inhibition of interleukin 8 attenuates

angiogenesis in bronchogenic carcinoma. J Exp Med 179, 1409-1415.

256

Sodhi, A., Chaisuparat, R., Hu, J., Ramsdell, A. K., Manning, B. D., Sausville, E. A.,

Sawai, E. T., Molinolo, A., Gutkind, J. S., and Montaner, S. (2006). The TSC2/mTOR

pathway drives endothelial cell transformation induced by the Kaposi's sarcoma-

associated herpesvirus G protein-coupled receptor. Cancer Cell 10, 133-143.

Soriano, S. F., Serrano, A., Hernanz-Falcon, P., Martin de Ana, A., Monterrubio, M.,

Martinez, C., Rodriguez-Frade, J. M., and Mellado, M. (2003). Chemokines integrate

JAK/STAT and G-protein pathways during chemotaxis and calcium flux responses. Eur J

Immunol 33, 1328-1333.

Sotsios, Y., Whittaker, G. C., Westwick, J., and Ward, S. G. (1999). The CXC chemokine

stromal cell-derived factor activates a Gi-coupled phosphoinositide 3-kinase in T

lymphocytes. J Immunol 163, 5954-5963.

Sozzani, S., Allavena, P., Vecchi, A., and Mantovani, A. (2000). Chemokines and

dendritic cell traffic. J Clin Immunol 20, 151-160.

Spinetti, G., Bernardini, G., Camarda, G., Mangoni, A., Santoni, A., Capogrossi, M. C.,

and Napolitano, M. (2003). The chemokine receptor CCR8 mediates rescue from

dexamethasone-induced apoptosis via an ERK-dependent pathway. J Leukoc Biol 73,

201-207.

Springael, J. Y., de Poorter, C., Deupi, X., Van Durme, J., Pardo, L., and Parmentier, M.

(2007). The activation mechanism of chemokine receptor CCR5 involves common

structural changes but a different network of interhelical interactions relative to rhodopsin.

Cell Signal 19, 1446-1456.

Springael, J. Y., Urizar, E., and Parmentier, M. (2005). Dimerization of chemokine

receptors and its functional consequences. Cytokine Growth Factor Rev 16, 611-623.

257

Srinivasan, S., Wang, F., Glavas, S., Ott, A., Hofmann, F., Aktories, K., Kalman, D., and

Bourne, H. R. (2003). Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and

polarity during neutrophil chemotaxis. J Cell Biol 160, 375-385.

Stambolic, V., Suzuki, A., de la Pompa, J. L., Brothers, G. M., Mirtsos, C., Sasaki, T.,

Ruland, J., Penninger, J. M., Siderovski, D. P., and Mak, T. W. (1998). Negative

regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95,

29-39.

Steelman, L. S., Abrams, S. L., Whelan, J., Bertrand, F. E., Ludwig, D. E., Basecke, J.,

Libra, M., Stivala, F., Milella, M., Tafuri, A., et al. (2008). Contributions of the

Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways to leukemia. Leukemia

22, 686-707.

Stein, J. V., and Nombela-Arrieta, C. (2005). Chemokine control of lymphocyte

trafficking: a general overview. Immunology 116, 1-12.

Strieter, R. M., Kunkel, S. L., Elner, V. M., Martonyi, C. L., Koch, A. E., Polverini, P. J.,

and Elner, S. G. (1992). Interleukin-8. A corneal factor that induces neovascularization.

Am J Pathol 141, 1279-1284.

Strieter, R. M., Polverini, P. J., Kunkel, S. L., Arenberg, D. A., Burdick, M. D., Kasper, J.,

Dzuiba, J., Van Damme, J., Walz, A., Marriott, D., and et al. (1995). The functional role

of the ELR motif in CXC chemokine-mediated angiogenesis. J Biol Chem 270, 27348-

27357.

Struyf, S., De Meester, I., Scharpe, S., Lenaerts, J. P., Menten, P., Wang, J. M., Proost, P.,

and Van Damme, J. (1998). Natural truncation of RANTES abolishes signaling through

the CC chemokine receptors CCR1 and CCR3, impairs its chemotactic potency and

generates a CC chemokine inhibitor. Eur J Immunol 28, 1262-1271.

258

Suetsugu, S., Miki, H., and Takenawa, T. (1998). The essential role of profilin in the

assembly of actin for microspike formation. Embo J 17, 6516-6526.

Suetsugu, S., Murayama, K., Sakamoto, A., Hanawa-Suetsugu, K., Seto, A., Oikawa, T.,

Mishima, C., Shirouzu, M., Takenawa, T., and Yokoyama, S. (2006). The RAC binding

domain/IRSp53-MIM homology domain of IRSp53 induces RAC-dependent membrane

deformation. J Biol Chem 281, 35347-35358.

Sugasawa, H., Ichikura, T., Kinoshita, M., Ono, S., Majima, T., Tsujimoto, H., Chochi,

K., Hiroi, S., Takayama, E., Saitoh, D., et al. (2008). Gastric cancer cells exploit CD4+

cell-derived CCL5 for their growth and prevention of CD8+ cell-involved tumor

elimination. Int J Cancer 122, 2535-2541.

Sukumvanich, P., DesMarais, V., Sarmiento, C. V., Wang, Y., Ichetovkin, I., Mouneimne,

G., Almo, S., and Condeelis, J. (2004). Cellular localization of activated N-WASP using

a conformation-sensitive antibody. Cell Motil Cytoskeleton 59, 141-152.

Sumi, T., Matsumoto, K., and Nakamura, T. (2001). Specific activation of LIM kinase 2

via phosphorylation of threonine 505 by ROCK, a Rho-dependent protein kinase. J Biol

Chem 276, 670-676.

Sun, J., Marx, S. O., Chen, H. J., Poon, M., Marks, A. R., and Rabbani, L. E. (2001).

Role for p27(Kip1) in Vascular Smooth Muscle Cell Migration. Circulation 103, 2967-

2972.

Sun, Y. X., Wang, J., Shelburne, C. E., Lopatin, D. E., Chinnaiyan, A. M., Rubin, M. A.,

Pienta, K. J., and Taichman, R. S. (2003). Expression of CXCR4 and CXCL12 (SDF-1)

in human prostate cancers (PCa) in vivo. J Cell Biochem 89, 462-473.

259

Suzuki, N., Nakajima, A., Yoshino, S., Matsushima, K., Yagita, H., and Okumura, K.

(1999). Selective accumulation of CCR5+ T lymphocytes into inflamed joints of

rheumatoid arthritis. Int Immunol 11, 553-559.

Suzuki, S., Chuang, L. F., Yau, P., Doi, R. H., and Chuang, R. Y. (2002). Interactions of

opioid and chemokine receptors: oligomerization of mu, kappa, and delta with CCR5 on

immune cells. Exp Cell Res 280, 192-200.

Szabo, M. C., Butcher, E. C., McIntyre, B. W., Schall, T. J., and Bacon, K. B. (1997).

RANTES stimulation of T lymphocyte adhesion and activation: role for LFA-1 and

ICAM-3. Eur J Immunol 27, 1061-1068.

Szekanecz, Z., and Koch, A. E. (2000). Cell-cell interactions in synovitis. Endothelial

cells and immune cell migration. Arthritis Res 2, 368-373.

Taub, D. D., Sayers, T. J., Carter, C. R., and Ortaldo, J. R. (1995). Alpha and beta

chemokines induce NK cell migration and enhance NK-mediated cytolysis. J Immunol

155, 3877-3888.

Taub, D. D., Turcovski-Corrales, S. M., Key, M. L., Longo, D. L., and Murphy, W. J.

(1996). Chemokines and T lymphocyte activation: I. Beta chemokines costimulate human

T lymphocyte activation in vitro. J Immunol 156, 2095-2103.

Thornton, S., Duwel, L. E., Boivin, G. P., Ma, Y., and Hirsch, R. (1999). Association of

the course of collagen-induced arthritis with distinct patterns of cytokine and chemokine

messenger RNA expression. Arthritis Rheum 42, 1109-1118.

Trkola, A., Gordon, C., Matthews, J., Maxwell, E., Ketas, T., Czaplewski, L., Proudfoot,

A. E., and Moore, J. P. (1999). The CC-chemokine RANTES increases the attachment of

human immunodeficiency virus type 1 to target cells via glycosaminoglycans and also

260

activates a signal transduction pathway that enhances viral infectivity. J Virol 73, 6370-

6379.

Turner, L., Ward, S. G., Sansom, D., and Westwick, J. (1996). A role for RANTES in T

lymphocyte proliferation. Biochem Soc Trans 24, 93S.

Turner, L., Ward, S. G., and Westwick, J. (1995a). RANTES-activated human T

lymphocytes. A role for phosphoinositide 3-kinase. J Immunol 155, 2437-2444.

Turner, L., Ward, S. G., and Westwick, J. (1995b). A role for phosphoinositide 3--kinase

in RANTES induced chemotaxis of T lymphocytes. Biochem Soc Trans 23, 283S.

Turner, S. J., Domin, J., Waterfield, M. D., Ward, S. G., and Westwick, J. (1998). The

CC chemokine monocyte chemotactic peptide-1 activates both the class I p85/p110

phosphatidylinositol 3-kinase and the class II PI3K-C2alpha. J Biol Chem 273, 25987-

25995.

Tyner, J. W., Uchida, O., Kajiwara, N., Kim, E. Y., Patel, A. C., O'Sullivan, M. P.,

Walter, M. J., Schwendener, R. A., Cook, D. N., Danoff, T. M., and Holtzman, M. J.

(2005). CCL5-CCR5 interaction provides antiapoptotic signals for macrophage survival

during viral infection. Nat Med 11, 1180-1187.

Uchida, D., Begum, N. M., Almofti, A., Nakashiro, K., Kawamata, H., Tateishi, Y.,

Hamakawa, H., Yoshida, H., and Sato, M. (2003). Possible role of stromal-cell-derived

factor-1/CXCR4 signaling on lymph node metastasis of oral squamous cell carcinoma.

Exp Cell Res 290, 289-302.

Uddin, S., Fish, E. N., Sher, D., Gardziola, C., Colamonici, O. R., Kellum, M., Pitha, P.

M., White, M. F., and Platanias, L. C. (1997). The IRS-pathway operates distinctively

from the Stat-pathway in hematopoietic cells and transduces common and distinct signals

during engagement of the insulin or interferon-alpha receptors. Blood 90, 2574-2582.

261

Ueda, Y., Neel, N. F., Schutyser, E., Raman, D., and Richmond, A. (2006). Deletion of

the COOH-terminal domain of CXC chemokine receptor 4 leads to the down-regulation

of cell-to-cell contact, enhanced motility and proliferation in breast carcinoma cells.

Cancer Res 66, 5665-5675.

Uehara, S., Grinberg, A., Farber, J. M., and Love, P. E. (2002). A role for CCR9 in T

lymphocyte development and migration. J Immunol 168, 2811-2819.

Ueno, T., Saito, F., Gray, D. H., Kuse, S., Hieshima, K., Nakano, H., Kakiuchi, T., Lipp,

M., Boyd, R. L., and Takahama, Y. (2004). CCR7 signals are essential for cortex-medulla

migration of developing thymocytes. J Exp Med 200, 493-505.

Ueno, T., Toi, M., Saji, H., Muta, M., Bando, H., Kuroi, K., Koike, M., Inadera, H., and

Matsushima, K. (2000). Significance of macrophage chemoattractant protein-1 in

macrophage recruitment, angiogenesis, and survival in human breast cancer. Clin Cancer

Res 6, 3282-3289.

Um, S. H., D'Alessio, D., and Thomas, G. (2006). Nutrient overload, insulin resistance,

and ribosomal protein S6 kinase 1, S6K1. Cell Metab 3, 393-402.

Vaday, G. G., Peehl, D. M., Kadam, P. A., and Lawrence, D. M. (2006). Expression of

CCL5 (RANTES) and CCR5 in prostate cancer. Prostate 66, 124-134.

van Deventer, H. W., O'Connor, W., Jr., Brickey, W. J., Aris, R. M., Ting, J. P., and

Serody, J. S. (2005). C-C chemokine receptor 5 on stromal cells promotes pulmonary

metastasis. Cancer Res 65, 3374-3379.

van Deventer, H. W., Wu, Q. P., Bergstralh, D. T., Davis, B. K., O'Connor, B. P., Ting, J.

P., and Serody, J. S. (2008). C-C chemokine receptor 5 on pulmonary fibrocytes

facilitates migration and promotes metastasis via matrix metalloproteinase 9. Am J Pathol

173, 253-264.

262

Vanhaesebroeck, B., Leevers, S. J., Ahmadi, K., Timms, J., Katso, R., Driscoll, P. C.,

Woscholski, R., Parker, P. J., and Waterfield, M. D. (2001). Synthesis and function of 3-

phosphorylated inositol lipids. Annu Rev Biochem 70, 535-602.

Varney, M. L., Li, A., Dave, B. J., Bucana, C. D., Johansson, S. L., and Singh, R. K.

(2003). Expression of CXCR1 and CXCR2 receptors in malignant melanoma with

different metastatic potential and their role in interleukin-8 (CXCL-8)-mediated

modulation of metastatic phenotype. Clin Exp Metastasis 20, 723-731.

Venkatesen, S., Petrovic, A., Locati, M., Kim, Y. O., Weissman, D., and Murphy, P. M.

(2001). A membrane-proximal basic domain and cysteine cluster in the C-terminal tail of

CCR5 contribute a bipartite motif critical for cell surface expression. J Biol Chem 276,

40133-40145.

Vicente-Manzanares, M., Rey, M., Jones, D. R., Sancho, D., Mellado, M., Rodriguez-

Frade, J. M., del Pozo, M. A., Yanez-Mo, M., de Ana, A. M., Martinez, A. C., et al.

(1999). Involvement of phosphatidylinositol 3-kinase in stromal cell-derived factor-1

alpha-induced lymphocyte polarization and chemotaxis. J Immunol 163, 4001-4012.

Vila-Coro, A. J., Mellado, M., Martin de Ana, A., Martinez, A. C., and Rodriguez-Frade,

J. M. (1999a). Characterization of RANTES- and aminooxypentane-RANTES-triggered

desensitization signals reveals differences in recruitment of the G protein-coupled

receptor complex. J Immunol 163, 3037-3044.

Vila-Coro, A. J., Rodriguez-Frade, J. M., Martin De Ana, A., Moreno-Ortiz, M. C.,

Martinez, A. C., and Mellado, M. (1999b). The chemokine SDF-1alpha triggers CXCR4

receptor dimerization and activates the JAK/STAT pathway. Faseb J 13, 1699-1710.

Vita, C., Drakopoulou, E., Ylisastigui, L., Bakri, Y., Vizzavona, J., Martin, L.,

Parmentier, M., Gluckman, J. C., and Benjouad, A. (2002). Synthesis and

263

characterization of biologically functional biotinylated RANTES. J Immunol Methods

266, 53-65.

Vogelstein, B., and Kinzler, K. W. (2004). Cancer genes and the pathways they control.

Nat Med 10, 789-799.

Volin, M. V., Shah, M. R., Tokuhira, M., Haines, G. K., Woods, J. M., and Koch, A. E.

(1998). RANTES expression and contribution to monocyte chemotaxis in arthritis. Clin

Immunol Immunopathol 89, 44-53.

von der Haar, T., Gross, J. D., Wagner, G., and McCarthy, J. E. (2004). The mRNA cap-

binding protein eIF4E in post-transcriptional gene expression. Nat Struct Mol Biol 11,

503-511.

Vroon, A., Heijnen, C. J., Lombardi, M. S., Cobelens, P. M., Mayor, F., Jr., Caron, M. G.,

and Kavelaars, A. (2004). Reduced GRK2 level in T cells potentiates chemotaxis and

signaling in response to CCL4. J Leukoc Biol 75, 901-909.

Wang, F., Herzmark, P., Weiner, O. D., Srinivasan, S., Servant, G., and Bourne, H. R.

(2002). Lipid products of PI(3)Ks maintain persistent cell polarity and directed motility in

neutrophils. Nat Cell Biol 4, 513-518.

Wang, Y., Tao, L., Mitchell, E., Bogers, W. M., Doyle, C., Bravery, C. A., Bergmeier, L.

A., Kelly, C. G., Heeney, J. L., and Lehner, T. (1998). Generation of CD8 suppressor

factor and beta chemokines, induced by xenogeneic immunization, in the prevention of

simian immunodeficiency virus infection in macaques. Proc Natl Acad Sci U S A 95,

5223-5228.

Wang, Y. H., Liu, S., Zhang, G., Zhou, C. Q., Zhu, H. X., Zhou, X. B., Quan, L. P., Bai, J.

F., and Xu, N. Z. (2005). Knockdown of c-Myc expression by RNAi inhibits MCF-7

breast tumor cells growth in vitro and in vivo. Breast Cancer Res 7, R220-228.

264

Warburg, O., Posener, K., and Negelein, E. (1924). Biochem Z., clii, 309.

Ward, S. G. (2004). Do phosphoinositide 3-kinases direct lymphocyte navigation? Trends

Immunol 25, 67-74.

Ward, S. G., Bacon, K., and Westwick, J. (1998). Chemokines and T lymphocytes: more

than an attraction. Immunity 9, 1-11.

Watanabe, T., Noritake, J., and Kaibuchi, K. (2005). Regulation of microtubules in cell

migration. Trends Cell Biol 15, 76-83.

Webb, D. J., Donais, K., Whitmore, L. A., Thomas, S. M., Turner, C. E., Parsons, J. T.,

and Horwitz, A. F. (2004). FAK-Src signalling through paxillin, ERK and MLCK

regulates adhesion disassembly. Nat Cell Biol 6, 154-161.

Weber, M., Blair, E., Simpson, C. V., O'Hara, M., Blackburn, P. E., Rot, A., Graham, G.

J., and Nibbs, R. J. (2004). The chemokine receptor D6 constitutively traffics to and from

the cell surface to internalize and degrade chemokines. Mol Biol Cell 15, 2492-2508.

Wong, M., and Fish, E. N. (1998). RANTES and MIP-1alpha activate stats in T cells. J

Biol Chem 273, 309-314.

Wong, M., Uddin, S., Majchrzak, B., Huynh, T., Proudfoot, A. E., Platanias, L. C., and

Fish, E. N. (2001). Rantes activates Jak2 and Jak3 to regulate engagement of multiple

signaling pathways in T cells. J Biol Chem 276, 11427-11431.

Wong, M. M., and Fish, E. N. (2003). Chemokines: attractive mediators of the immune

response. Semin Immunol 15, 5-14.

265

Wong, T., Majchrzak, B., Bogoch, E., Keystone, E. C., and Fish, E. N. (2003).

Therapeutic implications for interferon-alpha in arthritis: a pilot study. J Rheumatol 30,

934-940.

Wu, L., LaRosa, G., Kassam, N., Gordon, C. J., Heath, H., Ruffing, N., Chen, H.,

Humblias, J., Samson, M., Parmentier, M., et al. (1997). Interaction of chemokine

receptor CCR5 with its ligands: multiple domains for HIV-1 gp120 binding and a single

domain for chemokine binding. J Exp Med 186, 1373-1381.

Wullschleger, S., Loewith, R., and Hall, M. N. (2006). TOR signaling in growth and

metabolism. Cell 124, 471-484.

Wyatt, R., and Sodroski, J. (1998). The HIV-1 envelope glycoproteins: fusogens,

antigens, and immunogens. Science 280, 1884-1888.

Wymann, M. P., and Marone, R. (2005). Phosphoinositide 3-kinase in disease: timing,

location, and scaffolding. Curr Opin Cell Biol 17, 141-149.

Xia, M., Gaufo, G. O., Wang, Q., Sreedharan, S. P., and Goetzl, E. J. (1996).

Transduction of specific inhibition of HuT 78 human T cell chemotaxis by type I

vasoactive intestinal peptide receptors. J Immunol 157, 1132-1138.

Xiao, X., Wu, L., Stantchev, T. S., Feng, Y. R., Ugolini, S., Chen, H., Shen, Z., Riley, J.

L., Broder, C. C., Sattentau, Q. J., and Dimitrov, D. S. (1999). Constitutive cell surface

association between CD4 and CCR5. Proc Natl Acad Sci U S A 96, 7496-7501.

Yaal-Hahoshen, N., Shina, S., Leider-Trejo, L., Barnea, I., Shabtai, E. L., Azenshtein, E.,

Greenberg, I., Keydar, I., and Ben-Baruch, A. (2006). The chemokine CCL5 as a

potential prognostic factor predicting disease progression in stage II breast cancer patients.

Clin Cancer Res 12, 4474-4480.

266

Yang, Q., and Guan, K. L. (2007). Expanding mTOR signaling. Cell Res 17, 666-681.

Yang, Y. F., Mukai, T., Gao, P., Yamaguchi, N., Ono, S., Iwaki, H., Obika, S., Imanishi,

T., Tsujimura, T., Hamaoka, T., and Fujiwara, H. (2002). A non-peptide CCR5 antagonist

inhibits collagen-induced arthritis by modulating T cell migration without affecting anti-

collagen T cell responses. Eur J Immunol 32, 2124-2132.

Yao, Q., Compans, R. W., and Chen, C. (2001). HIV envelope proteins differentially

utilize CXCR4 and CCR5 coreceptors for induction of apoptosis. Virology 285, 128-137.

Youngs, S. J., Ali, S. A., Taub, D. D., and Rees, R. C. (1997). Chemokines induce

migrational responses in human breast carcinoma cell lines. Int J Cancer 71, 257-266.

Zagury, D., Lachgar, A., Chams, V., Fall, L. S., Bernard, J., Zagury, J. F., Bizzini, B.,

Gringeri, A., Santagostino, E., Rappaport, J., et al. (1998). C-C chemokines, pivotal in

protection against HIV type 1 infection. Proc Natl Acad Sci U S A 95, 3857-3861.

Zapico, I., Coto, E., Rodriguez, A., Alvarez, C., Torre, J. C., and Alvarez, V. (2000).

CCR5 (chemokine receptor-5) DNA-polymorphism influences the severity of rheumatoid

arthritis. Genes Immun 1, 288-289.

Zeelenberg, I. S., Ruuls-Van Stalle, L., and Roos, E. (2003). The chemokine receptor

CXCR4 is required for outgrowth of colon carcinoma micrometastases. Cancer Res 63,

3833-3839.

Zhang, H. M., Yuan, J., Cheung, P., Chau, D., Wong, B. W., McManus, B. M., and Yang,

D. (2005). Gamma interferon-inducible protein 10 induces HeLa cell apoptosis through a

p53-dependent pathway initiated by suppression of human papillomavirus type 18 E6 and

E7 expression. Mol Cell Biol 25, 6247-6258.

Zhang, X. F., Wang, J. F., Matczak, E., Proper, J. A., and Groopman, J. E. (2001). Janus

kinase 2 is involved in stromal cell-derived factor-1alpha-induced tyrosine

267

phosphorylation of focal adhesion proteins and migration of hematopoietic progenitor

cells. Blood 97, 3342-3348.

Zhou, S., Wang, G. P., Liu, C., and Zhou, M. (2006). Eukaryotic initiation factor 4E

(eIF4E) and angiogenesis: prognostic markers for breast cancer. BMC Cancer 6, 231.

Zhou, Y., Kurihara, T., Ryseck, R. P., Yang, Y., Ryan, C., Loy, J., Warr, G., and Bravo,

R. (1998). Impaired macrophage function and enhanced T cell-dependent immune

response in mice lacking CCR5, the mouse homologue of the major HIV-1 coreceptor. J

Immunol 160, 4018-4025.

Zhu, J., Jia, X., Xiao, G., Kang, Y., Partridge, N. C., and Qin, L. (2007). EGF-like ligands

stimulate osteoclastogenesis by regulating expression of osteoclast regulatory factors by

osteoblasts: implications for osteolytic bone metastases. J Biol Chem 282, 26656-26664.

Zlotnik, A., Morales, J., and Hedrick, J. A. (1999). Recent advances in chemokines and

chemokine receptors. Crit Rev Immunol 19, 1-47.

Zlotnik, A., and Yoshie, O. (2000). Chemokines: a new classification system and their

role in immunity. Immunity 12, 121-127.

Zuniga, J. A., Villarreal-Garza, C., Flores, E., Barquera, R., Perez-Hernandez, N., Montes

de Oca, J. V., Cardiel, M. H., Vargas-Alarcon, G., and Granados, J. (2003). Biological

relevance of the polymorphism in the CCR5 gene in refractory and non-refractory

rheumatoid arthritis in Mexicans. Clin Exp Rheumatol 21, 351-354.