A primer pair for amplifying part of the genome of all potyvirids by RT-PCR

Journal of Virological Methods

ELSEVIER Journal of Virological Methods 63 (1997) 9-16

A primer pair for amplifying part of the genome of all potyvirids by RT-PCR

Adrian Gibbs*, Anne Mackenzie

Research School of Biological Sciences, Australian National University, PO Box 475, Canberra, A.C.T. 2601, Australia

Accepted 1 July 1996

Abstract

Sequence analysis was used to design a pair of degenerate oligonucleotide primers that amplified a 1.6-2.1 kbp fragment from the 3’ end of the genome (virion protein gene and part of the Nib gene) of 17 species of the Potyviridae (‘potyvirids’); 11 potyviruses, 2 bymoviruses, 2 macluraviruses, an ipomovirus and a rymovirus. The ‘potyvirid primer 1’ hybridizes to the 3’ terminal poly-A region of the genome, and ‘potyvirid primer 2’ to the genomic region encoding the-GNNSGQ-motil’ of the Nib protein. Database searches showed that the potyvirid 2 primer is specific for potyvirids. Associated analyses indicated that the published amino acid sequence of part of the wheat streak mosaic rymovirus Nib protein is probably incorrect in part. Copyright 0 1997 Elsevier Science B.V.

Keywords: Potyvirid identification; RT-PCR; Poty-; Rymo-; Bymo-; Ipomo-; Macluravirus identification

1. Introduction

The Potyviridae is a family of plant viruses, named after potato virus Y, the type species of its principal genus Potyvirus. Many- cause economi- tally important crop diseases, mostly leaf mosaics or mottling. All are spread by vectors (aphids, mites and fungi), and many are also seed or pollen-borne.

Of 912 named and described plant viruses in the VIDE database (Brunt et al., 1996) over one fifth are from the Potyviridae, which we call ‘potyvirids’. They form at least three genera:

(1)

(2)

Potyvirus (129 species); aphid-transmitted viruses of mono- and dicotyledonous plants, type species potato virus y. Rymovirus (7 species); mite-transmitted viruses of monocotyledonous plants, type species ryegrass mosaic virus. Bymovirus (6 species); fungus-transmitted viruses of monocotyledonous plants; type species barley yellow mosaic virus.

(3) * Corresponding author. Tel.: + 61 6 2494211; fax: + 61 6

2494211; e-mail: [email protected]

0166-0934/97/$17.00 Copyright 0 1997 Elsevier Science B.V. All rights reserved

PIZ SO166-0934(96)02103-9

10 A. Gibbs, A. Mackenzie /Journal of Virological Methods 63 (1997) 9-16

In addition, there are 58 potyvirid species in the VIDE database unassigned to particular genera; most are probably potyviruses, Sense stricto, although it has been suggested that maclura mosaic virus, which has carlavirus-like virions, is suffi- ciently distinct to form, with others, a new potyvirid genus, Mucluravirus (Mowat et al., 1991) and, similarly, sweet potato mild mottle virus, which is transmitted by whitefly, to form, with others, the genus Ipomovirus (Brunt, 1992; Colinet et al., 1996).

Definitive potyvirids (Barnett, 1992; Shukla et al., 1994) have flexuous filamentous virions 650- 900 nm long comprised of the RNA genome and many subunits of a single protein species. All produce characteristic pinwheel inclusions in the cytoplasm of infected cells. Potyvirid genomes are single-stranded messenger-sense RNA of approxi- mately 9 kb. Most are monopartite, but those of the bymoviruses are bipartite. The 3’ termini of the genomes are polyadenylated, and each genome part is translated to produce a single polyprotein. The polymerase regions of the polyprotein have sequences that are most similar to those of coma-, nepo-, and picornaviruses (Zanotto et al., 1996).

Serological methods have been used widely and successfully for over half a century to identify the virions of different viruses, and to determine the relationships between them. However, these methods are not particularly successful when used for potyviruses (Jordan, 1992; Shukla et al., 1994). Recent studies have shown that this is because the dominant epitopes of potyvirus virions are the variable terminal parts of the virion protein, espe- cially the N-terminal part, which has a repetitive sequence in some species (Ward et al., 1995) probably caused by polymerase slippage (Han- cock et al., 1995). Although serological tests are often not useful for determining the relationships of potyvirus species, group-specific monoclonal antibodies have been produced that react with the virions of more than 90% of tested potyviruses, but not other potyvirids (Jordan and Hammond, 1991; Jordan, 1992) except ryegrass mosaic rymovirus (Salm et al., 1994; Paul Guy, personal communication).

Recently, the use of RT-PCR (reverse transcription-polymerase chain reaction) to amplify DNA transcribed from genomic RNA has been successfully applied to a range of pathogens (Henson and French, 1993). This technique has been used successfully with individual potyviruses (e.g. Vunsh et al., 1990; Nicholas and Laliberte, 1991; Thom- son et al., 1995). However, Langeveld et al. (1991) designed degenerate olignucleotide primers from conserved amino acid sequences of the virion proteins, and showed that they amplified DNA fragments transcribed from several potyviruses in bulb crops, and that they did not amplify carla- or potexvirus sequences. Furthermore Pappu et al. (1993) used primers to clone the same region together with the 3’ untranslated region of the genome, as sequences of this region are useful for discriminating potyvirus strains, Colinet and Kummert (1993) and Colinet et al. (1994) used similar degenerate primers to separate different viruses from sweetpotato.

This paper reports the results of a search for more broadly specific potyvirus primers that could be used for surveying these viruses in wild plants. We compared the published sequences of several potyviruses, and found that part of the gene encoding their nuclear inclusion b (Nib) protein is conserved among all potyvirids. We report here that a degenerate primer to that region used for RT-PCR together with a poly-dT primer produces a fragment of 1.6-2.1 kbp, together sometimes with a fragment of 0.6-1.0 kbp, from all seventeen potyvirids tested.

2. Materials and methods

2.1. Sequence analysis

Potyvirus sequences were obtained and analysed using programs provided by the Aus- tralian National Genomic Information Service via AARnet. Potyvirus genomic sequences were obtained from the Genbank database, aligned by the program PILEUP, and the specificity of possible primer oligonucleotides assessed by searching the non-redundant international databases using the FASTA and BLASTX programs.

A. Gibbs, A. Mackenzie 1 Journal of Virological Methods 63 (1997) 9-16 11

2.2. Potyvirid isolates and RNA extraction

Ryegrass mosaic rymovirus (RGMV) was kindly supplied by Malcolm Andersen of the Pas- toral and Veterinary Institute, Hamilton, Victoria, Australia and propagated in Lolium perenne, Johnson grass mosaic (JGMV) and papaya ringspot (PRSV) potyviruses were kindly supplied by Dennis Persley of the Department of Primary Industries, Indooroopilly, Queensland, Australia and grown in Sorghum halepense and Carica papaya, respectively, barley mild mosaic (BaMMV) and oat mosaic (OMV) bymoviruses, maclura mosaic (MMV) and narcissus latent (NLV) macluraviruses, sweet potato mild mosaic ipomovirus (SPMMV), and sugarcane mosaic (SCMV) and turnip mosaic (TuMV) potyviruses kindly provided by Alan Brunt, Horticulture Research Inter- national, UK, in freeze-dried infected leaf tissue, and watermelon mosaic 2 (WMV2) potyvirus kindly supplied by Eric Huttner of Biochem Aus- tralia, Canberra, ,4ustralia in Cucurbita pepo cv Zucchini. Six unassigned potyviruses were obtained from naturally infected wild plants, five of them Australian endemics; commelina virus Y in Commelina cyanea (Commelinaceae), eustrephus virus Y (EVY) in Eustrephus latifolius (Philesi- aceae) and hibbertia virus Y (HVY) in the Hib- bertia scandens (Dilleniaceae), all collected from Jervis Bay, New South Wales, kennedya virus Y (KVY) in Kennedya rubicunda (Fabaceae) growing at Lake Burrill, New South Wales, glycine virus Y (GVY) in Glycine clandestina growing at Bawley Point, New South Wales (Kiratyi-Angul and Gibbs, 1992), and the sixth, conium virus Y (CVY), came from the immigrant weed Conium maculatum (Apiaceae) from the banks of the Mur- rumbidgee River near Cooma, New South Wales.

2.3. RNA extraction

Total nucleic acid (T-NA) was extracted from 25-100 mg of ftesh or dried leaf tissue using methods derived from those of Speirs and Longhurst (1993) and Thomson and Henry (1993). Tissue was frozen in liquid N, and ground to a fine powder. CTAB buffer (0.6 ml) cetyl trimethyl ammoni-urn bromide (2% (w/v), 1.4 M

NaCl, 0.1 M Tris-HCl pH 8.0, 0.5% B-mercaptoethanol) was added, mixed thoroughly and incubated at 55°C for 15-30 min. The mixture was shaken with 0.3 ml chloroform:isoamyl alcohol (24:1), and centrifuged at 14 000 x g for 5 min. The aqueous phase was mixed with 0.1 vol. 7.5 M ammonium acetate and 1 vol. isopropanol, centrifuged, and the T-NA pellet washed with 70% ethanol and dried. The T-NA was resuspended in 50-100 ~1 water and its quality and concentration checked by PAGE in a 3.5% gel in 7 M urea using 0.04% toluidine blue to stain the nucleic acids.

2.4. Oligonucleotides

Primers were synthesized in an Applied Biosys- terns DNA synthesizer. The degenerate primer pair used to replicate selectively the 3’ terminal portion of the genomes of various potyviruses were:

Potyvirid primer 1.

5'-CACGGATCCCGGG(T) ,,AGC-3’

G

C

Potyvirid primer 2.

5'-ACCACAGGATCCGGTAACAACAGCGGGCAACC-3'

CTTTTG

G A

GGBAAYAAYAGYGGDCARCC (consensus)

The italicized 5’ terminal regions were not virus- encoded, but add restriction endonuclease sites to aid cloning.

2.5. RT-PCR

cDNA was synthesized from 0.25- 1.0 ,ug T-NA in a 40 pl reaction mixture using the PROMEGA cDNA synthesis protocol. The Opti-Prime PCR Optimization Kit (Stratagene) was used to determine the optimal buffer conditions for priming the PCR reactions. DNA encoding the 3’ part of the viral genome was selectively amplified in a 100 ~1 mixture containing 20 mM (NH,), SO,, 75 mM Tris-HCl pH 9.0, 0.1% w/v Tween 20, 2.5 mM MgCl,, 200 mM each of dATP, dCTP, dGTP, dTTP, 0.3 PM potyvirid primer 1, 1 .O PM potyvirid primer 2, l-5 ~1 cDNA mixture and 1 unit

12 A. Gibbs, A. Mackenzie / Journal of Vwologlcal Methods 63 (1997) 9-16

4072

2036

1636

Fig. I, Photograph of a 1% agarose gel fractionating the DNA fragments produced by RT-PCR from extracts of plants infected with

various viruses. For abbreviations see Section 2.2. The original photograph was scanned and the images of the 0.6-2.1 kbp bands

obtained from SPMMV and SCMV enhanced electronically before printing.

of Tth DNA polymerase (Advanced Biotechnolo- @es). The mixture was incubated at 94°C for 2 min followed by 35 cycles of 94°C for 1 min, 60°C for 2 min and 72°C for 3 min, then a final 8 min incubation at 72°C. IO-20 ~1 aliquots of the mixture, and a BRL lkbp ‘ladder’, were fraction- ated by electrophoresis in 1% agarose gels and stained with ethidium bromide. All T-NAs from

plants infected with potyvirids yielded a DNA fragment of 1.6-2.1 kbp, which was electroeluted, shaken with phenol: chloroform (1: l), precipitated with ethanol, resuspended in water and ligated directly into the PROMEGA pGEM-T Vector. Some potyvirids also yielded a fragment of 0.6- 1.0 kbp, that, for some, was also cloned.

DNA fragments were also made from some virus genome extracts using Amplitaq DNA polymerase (Perkin-Elmer) with the supplier’s buffers and the same dNTP, primer and MgCl, concen- trations.

Double-stranded DNA was isolated from re- combinant plasmids and sequenced from both 5’ and 3’ ends using the Sequenase (United States Biochemical) T7 DNA polymerase sequencing Kit according to the manufacturers instructions with the T7 or SP6 promoter primers.

3. Results

3.1. Primer sequence choice

Sequences of the 3’ terminal 2 kb of the genomes of ornithogalum mosaic, plum pox, potato Y, tobacco veinal mottle, watermelon mosaic 2 and zucchini yellow mosaic viruses were aligned using the program PILEUP. A region of 20 nucleotides of the Nib gene, that encodes the amino acid sequence-GNNSGQ-, was found to be most closely similar in all these sequences. This


1 10 20 30 40 50 60 70 TCGAA(:ATGGAACGATTGTGCAGAAGTTTCGAGGTAATAACAGTGGCC~CCAAGCACAGTTGTTGACAACG

SKMERLCRSFEVITVANQAQLLTT

RR W N DC A E V S R * * QWPTKHSC*QR

E~DGTI~QKFRGNNSGOPSTVVDND

80 90 100 110 120 130 140

ACGAT(:TGTTTAATCATAGCAATGGAGTATTGTAGAATGCGCGTTGA~AGGATCATG~CATAG~TGAGG

_TMCL IIAMEJ_CRMRVEKDH_EHRMR

R 13 V * S * QWSIVECALKRIMNIE*G

DVFNHSNGVL* N A R l KGS*T* N E D

153 160 170 180 190 200 210

ATACTI:TACGTGTGCAACGGAGATGATTTGCTTATCAATGCCGACACA~GGAC~GACTTCATACAGCAG

ILYVCNGDpL4IN9LDTKDKDFIQQ

Y_ /- TCATEMICLSMPTQRTKTSYSS

TVRVQRR* FAYQCRHKGQRLHTAV

Fig. 2. Part of the published nucleotide sequence of the NIbjVP genes of wheat streak mosaic rymovirus (Niblett et al., 1991)

translated in all three reading frames. The amino acid residues that matched 3 or more of 16 potyvirus sequences in a BLASTX

search are in bold, those that matched 10 or more are also underlined. Nucleotide 72 (enlarged and bold) is probably an artifact.

motif is called motif II by Habili and Symons (1989) and motif V by Koonin (1991), and is encoded by a sequence which, in different potyviruses, starts around 7800-8250 nucleotides from the 5’ end of the 9500-9900 nucleotides long genome.

The consensus of the sequences of this region, together with 32 nucleotides to the 5’ side of it, was used to search the Swissprot database using the BLASTX program, and found to match unequivocally not only with all the available amino acid sequences encoded by this region of the genomes of potyviruses, sensu stricto, but also with the homologous regions of the barley yellow mosaic, barley mild mosaic and wheat spindle streak bymovirus polymerase genes. The non-redundant Genbank nucleotide database was then searched, using the FASTA program, for sequences that matched the partially degenerate sequence; the primer with this sequence is called the potyvirid primer 2, and is listed above. Thirty two sequences gave a match that was probably not a chance occurrence (E < 3) all but two of these were from the motif II/V region of potyvirid genomes (25 potyviruses, four bymoviruses, and one rymovirus). The two exceptions were a hu- man placenta cDNA sequence (Accession number R69031; E = 1.7) and a Caenorhabditis elegans

cosmid (Accession number CEF43D9; E = 2.7), which matched with the complement of the degenerate sequence, but no other parts of these two sequences matched with potyvirus genomic sequences. These results, obtained in December 1995, indicate the clear specificity of this primer for potyvirid sequences; at the time of the search the database contained 660000 sequences (459 million nucleotides) from 3054 bacteria, 155 ar- chaea, 10 100 eukaryotes (3152 of them plants) and 1540 viral species, including species from 48 of the 53 plant virus genera. A similar search in June 1996, when the database was 30% larger gave the same result, but with 32 potyvirid matches.

The potyvirid primer 1, which was used with the potyvirid primer 2, hybridizes with poly A regions, like those found at the 3’ terminus of all sequenced potyvirid genomes.

3.2. RT-PCR

The primers were tested in RT-PCR experi- ments with T-NA extracts of plant tissue infected with seventeen known potyvirids, and also leaves from tulip, hyacinth, daffodil and tritelia showing mosaic symptoms. All gave a fragment of 1.6-2.1 kbp, although the amount of the fragment yielded


by different extracts differed greatly. Fig. 1 a range of known and possible potyvirids. This shows the results obtained for a representative is of value as potyvirids constitute at least one sample of eleven of them, and shows that, in fifth of all described plant viruses, and the se- addition to the 1.6-2.1 kbp band, some also quence of the virion protein gene is particularly produced a smaller fragment of 0.6- 1 .O kbp. Ex- useful for identifying potyvirids as the sequences tracts from virus-free leaves (of the non-bulb of over 150 are currently in international data- species) did not give these bands. bases (Berger and Rybicki, 1995).

We tested a range of T-NA/cDNA concentra- tions and PCR conditions with the Optiprime PCR Optimization Kit to maximize the yield of specific fragments, and those given above consistently yielded dense bands for most viruses when checked by electrophoresis in polayacrylamide gels. When more than 1 pg of T-NA or more than 5 ~1 of cDNA were used, the yield of PCR fragments was decreased. PCR tests with Ampli- taq yielded the same fragments. We also tested various methods for isolating T-NA from several plant species, but none was successful consistently. Some species yield extracts that inhibit reverse transcription or the PCR, possibly because of phenolics or saccharides they contain. The cationic detergent CTAB with the reducing agent p-mercaptoethanol consistently produced the best T-NA preparations from most plant species. DNase treatment of the T-NA before cDNA synthesis did not improve fragment yield.

Our primers permit the complete virion protein gene, together with part of the Nib gene, to be transcribed and replicated by RT-PCR, whereas previously reported potyvirus generic primers focussed on the virion protein gene alone. Thus, our primer transcribes and repli- cates a fragment that includes the N-terminal region of the virion protein gene, which is more variable than other parts of that gene, and is perhaps best for discriminating between strains of each potyvirus species (Shukla et al., 1994).

We cloned and sequenced the large specific fragments obtained from CVY, EVY, HVY and RGMV (several isolates) and established by BLASTX searches that all unequivocally encode the selected 3’ terminal regions of distinctive poyvirids; these data are being prepared for pub- lication elsewhere. The small specific fragments obtained from GVY, HVY, KVY, PRSV and WMV2 were also cloned and sequenced, and found to comprise the portion of the genome between that encoding motif II of the, Nib gene, and the 5’ terminal part of the virion protein gene, which is A-rich.

Database searches using FASTA can be used to assess the specificity of primers. They showed that our potyvirid 2 primer matches more specifically (i.e. with smaller E values) with the potyvirid sequences in the database than with other sequences. We also tested the primers designed by Langeveld et al. (1991) in this way, and found that three (U335, U341 and 01000) matched potyvirus and ryegrass mosaic rymovirus virion proteins specifically (E < 1.0 and fewer than five non-potyvirus sequences mixed with the 155 potyvirus sequences), two (D335 and D341) were moderately specific (60% potyvirus sequences in first 100 matches), and three non-specific ( < 10% potyvirus in the first 100 matches). Interestingly, one of the primers that matched poorly with potyvirus sequences (UlOOO) matched very specifically (E = 0.004 for the first sequence to 0.29 at match 100) with sequences from a wide range of organisms, which included only six potyviruses, but also barley mild mosaic bymovirus; the only bymovirus match obtained with these primer sequences.

4. Discussion

Database searches have indicated that the pair of primers we describe here probably provide a specific test for the presence of any potyvirid, and their efficacy in PCR tests was proven with

The fact that our primer pair yields PCR fragments of measurably different sizes from different potyvirids, and also reveals which of the potyvirids have A-rich regions in the 5’ terminal regions of their virion protein genes, may also be useful features for primary diagnosis.

A. Gibbs, A. Mackenzie 1 Journal of Virological Methods 63 (1997) 9-16 15

Niblett et al. (11991) published the nucleotide sequence of the 3’ region of the wheat streak mosaic rymovirus genome that encoded part of the Nib protein and all the virion protein. We were surprised to jind that there was no -GNNS- GQP- motif in the appropriate place in the Nib amino acid sequence, however the nucleotide sequence encoded the motif in its third reading frame. When the nucleotide sequence was checked by the BLASTX program it was found (Fig. 2) that nucleotides 6-71, namely reading frame 3, encodes an amino acid sequence with more than 95% identity with the same region of most of the 16 potyvirus sequences with which it matched, whereas the remainder of the sequence (nucleotides 73-1820) most closely and consistently matched potyvirus NIbjVP proteins in reading frame 1. Thus, it is probable that nucleotide 72, G, is an artifact.

Acknowledgements

We thank Mark Gibbs and Paul Keese for very useful advice. Virus isolates were imported into Australia for this ,work under Permit 99503008 of the Australian Quarantine and Inspection Service.

References

Barnett, O.W. (Ed.) (1992) Potyvirus Taxonomy. Arch. Virol. Suppl. 5, pp. 450.

Berger, P. and Rybicki, E. (Eds.) (1995) Potyvirus Sequence Database-A project of the Potyvirus Working Group of the Plant Virus Subcommittee of the ICTV. ftp:// ftp.uidaho.edu/pub/data/potyvirus.

Brunt, A.A. (1992) The general properties of potyviruses. In: O.W. Barnett (Ed.), Potyvirus Taxonomy. Arch. Virol., Suppl. 5, Springer, New York, pp. 3-16.

Brunt, A., Crabtree, K., Dallwitz, M., Gibbs, A. and Watson, L. (Eds.) (1996) Viruses of Plants: Descriptions and Lists from the VIDE database. CAB International, Wallingford. pp. 1484.

Colinet, D. and Kummert, J. (1993) Identification of a sweetpotato feathery mottle virus isolate from China (SPFMV- CH) by the polyrnerase chain reaction with degenerate primers. J. Virol. Methods. 45, 149-159.

Colinet, D., Kummert, J. and Lepoivre, P. (1996) Molecular evidence that the whitefly-transmitted sweetpotato mild mottle virus belongs to a distinct genus of the Potyuirzdae.

Arch. Virol. 141, 125-135. Colinet, D., Kummert, J., Lepoivre, P. and Semal, J. (1994)

Identification of distinct potyviruses in mixedly-infected sweetpotato by the polymerase chain reaction with degenerate primers. Phytopath. 84, 65-69.

Habili, N. and Symons, R.H. (1989) Evolutionary relationships between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helices. Nucleic Acids Res. 17, 9543-9555.

Hancock, J.M., Chaleeprom, W., Chaleeprom, W., Dale, J. and Gibbs, A. (1995) Replication slippage in the evolution of potyviruses. J. Gen. Virol. 76, 3229-3232.

Henson, J.M. and French, R. (1993) The polymerase chain reaction and plant disease diagnosis. Annu. Rev. Phyto- pathol. 31, 81-109.

Jordan, R.L. (1992) Potyviruses, monoclonal antibodies and antigenic sites. In: O.W. Barnett. (Ed.), Potyvirus Taxon- omy. Arch. Virol. Suppl. 5, Springer, New York. pp. 81-95.

Jordan, R. and Hammond, J. (1991) Comparison and differen- tiation of potyvirus isolates and identification of strain-, virus-, subgroup-specific and potyvirus group-common epitopes using monoclonal antibodies. J. Gen. Virol. 72, 25-36.

Kiratyi-Angul, S. and Gibbs, A. (1992) Group-specific anti- serum detects potyviruses in several wild plant species in S.E. Australia. Aust. Plant Path. 21, 118%119.

Koonin, E.V. (1991) The phylogeny of RNA-dependent RNA polymerases of positive-strand RNA viruses. J. Gem Virol. 72, 2197-2206.

Langeveld, S.A., Dore, J.M., Memehnk, J., Derks, A.F., van der Vlugt, C.I., Asjes, C.J. and Bol, J.F. (1991) Identifica- tion of potyviruses using the polymerase chain reaction with degenerate primers. J. Gen. Virol. 72, 1531-1541.

Mowat, W.P., Dawson, S., Duncan, G.H. and Robinson, D.J. (1991) Narcissus latent, a virus with filamentous particles and a novel combination of properties. Ann. Appl. Biol. 119, 31-46.

Niblett, C.L., Zagula, K.R., Calvert, L.A., Kendall, T.L., Stark, D.M., Smith, C.E., Beachy, R.N. and Lommel, S.A. (1991) cDNA cloning and nucleotide sequence of the wheat streak mosaic virus capsid protein gene. J. Gen. Virol. 72, 499-504.

Nicholas, 0. and Laliberte, J.-F. (1991) The use of PCR for cloning of large cDNA fragments of turnip mosaic potyvirus. J. Virol. Methods 32, 57-66.

Pappu, S.S., Brand, R., Pappu, H.R., Rybicki, E.P., Gough, K.H., Frenkel, M.J. and Niblett, C.L. (1993) A polymerase chain reaction method adapted for selective amplification and cloning of 3’ sequences of potyviral genomes: applica- tion to dasheen mosaic virus. J. Virol. Methods 41, 9-20.

Salm, S.N., Rey, M.E.C. and Wolfson, M.M. (1994) A South African isolate of ryegrass mosaic virus. Plant Path. 43, 709-712.

Shukla, D.D., Ward, C.W. and Brunt, A.A. (1994) The Po- tyviridae. CAB International, Wallingford, UK. pp. 516.


Speirs, J. and Longhurst, T. (1993) RNA Extraction and

Fractionation. In: Methods in Plant Biochemistry, Vol.

10, Academic Press, New York, pp. l-32.

Thomson, D. and Henry, R. (1993) Use of DNA from dry

leaves for PCR and RAPD analysis. Plant Mol. Biol.

Reporter 11, 202-206.

Thomson, K.G., Dietzgen, R.G., Gibbs, A.J., Tang, Y.C.,

Liesak, W. Teakle, D S. and Stackebrandt, E. (1995)

Identification of zucchini yellow mosaic potyvirus by RT-

PCR and analysis of sequence variability. J. Virol. Meth-

ods. 55, 83396.

Vunsh, R., Rosner, A. and Stein, A. (1990) The use of the

polymerase chain reaction (PCR) for the detection of

bean yellow mosaic virus in gladiolus. Ann. Appl. Biol.

117, 561-569.

Ward, C.W., Weiller, G., Shukla, D.D. and Gibbs, A.J.

(1995) Molecular systematics of the Potyviridae, the

largest plant virus family. In: A.J. Gibbs, C.H. Calisher

and F. Garcia-Arena1 (Eds.), Molecular Basis of Virus

Evolution, Cambridge University Press, Cambridge, pp.

4777500.

Zanotto, P.M. de A., Gibbs, M.J., Gould, E.A. and Holmes,

E.C (1996) A re-evaluation of the higher taxonomy of

viruses based on RNA polymerases. J. Virol. (in press).

A primer pair for amplifying part of the genome of all potyvirids by RT-PCR

Documents

Transcript of A primer pair for amplifying part of the genome of all potyvirids by RT-PCR