3.4: Transcription and Translation

3.5.1: Compare the structure of RNA and DNA.

3.5.1: Compare the structure of RNA and DNA.

IB Question: Compare the structure and composition of DNA with RNA. [4]

both are polymers of nucleotides / both nucleic acids;sugar is deoxyribose in DNA and ribose in RNA;DNA is double stranded and RNA is single stranded;DNA has a (double) helix;DNA has thymine while RNA has uracil; (require full names written out)both contain four nitrogenous bases / A, G, C, T for DNA and A, G, C, U for RNA; [4 max]

3.5.2: Outline DNA transcription in terms of the formation of an RNA strandcomplementary to the DNA strand by RNA polymerase.

3.5.3: Describe the genetic code in terms of codons composed of triplets of bases.

Genetic code

3.5.4:Explain the process of translation,leading to polypeptide formation.

Translation

What will be the sequence of amino acids from the following mRNA

transcript?

UAUGGAGCGCUAUCGAUCGUUAGA

IB Question: Explain the process of translation. [8]

messenger / mRNA attaches to ribosome (small unit);many ribosome/polyribosomes bind to same mRNA;carries codons / triplet of bases each coding for one amino acid;transfer / tRNA each have specific anticodon;triplet of bases for specific amino acid;tRNA carries specific amino acid;tRNA binds to ribosomes;to corresponding triplet base / codon;a second tRNA binds to next codon;two amino acids bind together;in a peptide linkage;first tRNA detaches;ribosome moves along mRNA;another tRNA binds to next codon;continues until polypeptide / protein formed to stop codon;stop codon has no corresponding tRNA/amino acid / causes release of polypeptide; [8 max]

IB Question: Compare DNA transcription with translation. [4]

both require ATP;DNA is transcribed and mRNA is translated;transcription produces RNA and translation produces polypeptides/protein;RNA polymerase for transcription and ribosomes for translation / ribosomes in translationonly;transcription in the nucleus (of eukaryotes) and translation in the cytoplasm/at ER;tRNA needed for translation but not transcription; [4 max]

One gene may code for multiple polypeptides due to alternative splicing

3.5.5: Discuss the relationship between one gene and one polypeptide.