Protein Annotation Ontology The BioSapiens Virtual Institute for Genome Annotations Janet Thornton & Gabby Reeves AFP/BioSapiens Vienna: July 07.
Click to edit Master title style Click to edit Master text styles Second level Third level Fourth level Fifth level 1 Clique para editar o estilo do título.
Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.
Functional Linkages between Proteins
