ChIP-seq NGS Data Formats NGS analysis workflows Biological samples Sequence reads Quality control Mapping Assembly DE Analysis Variant Detection SRASRF FASTQ SAMBAMPileup…
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chemuclaedu Collaboratory Web Site http:qcbuclaeducollaboratory Collaboratory Workshops Workshop Outline ü …
mattshirley@jhmiedu Galaxy for NGS Data Analysis Matt Shirley Johns Hopkins School of Medicine Department of Oncology Biostatistics 1 Slides available at http:mattshirleycomtalks…
Visual validation of NGS data features using Tablet Iain Milne Gordon Stephen Micha Bayer Linda Cardle Paul D Shaw and David Marshall Information and Computational Sciences…
PowerPoint Presentation NGS Bioinformatics Workshop 1.2 Tutorial – Sequence Formats, Databases and Visualization Tools March 15th, 2012 BioSci room B9242 Facilitator: Richard…
1.BabelomicsNGS data Preprocessing Granada, June 2011 Javier Santoyo-Lopez [email protected]://bioinfo.cipf.es Genomics Department Centro de Investigacion Principe Felipe (CIPF)…
NGS FILE FORMATS FASTA HWI-ST398_0092:1:1:5372:2486#01 TTTTTCGTTCTTTTCATGTACCGCTTTTTGTTCGGTTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGAT ACGTAGCAGCAGCATCAGTACGACTACGACGACTAGCACATGCGACGATCGATGCTAGCTGACTATCGATG…
Transforming Molecularinformation into action Corporate Presentation January 2019 2 Transforming Molecularinformation into action Disclaimer The presentation and the information…
1. Speaker: Eric C.Y., LEE Advisor: I-Fang Chung 2011.Mar.21Monday, March 21, 2011 1 2. Outline • Motivation • Workflow • Result • Conclusion • My CommentMonday,…
Slide 1 NGS techniques and data relevant for metagenomics analyses Lex Nederbragt Norwegian Sequencing Center & Centre for Ecological and Evolutionary Synthesis…
7222015 Introduction to NGS data file:homedunnin01workgitTalksngs-introngs-introhtml 115 Introduction to NGS data Mark Dunning Last modified: 22 Jul 2015 Why do sequencing…
NGS Data Analysis Using Partek® Software Xiaowen Wang Field Application Specialist Who is Partek • Founded in 1993 • Building tools for statistics visualization •…
Visualizing NGS data with Visualizing NGS data with GenomeView June 2nd, 2010, Espoo, Finland Thomas Abeel – [email protected] VIB - Ghent University, Gent, Belgium Broad…
Transforming Molecularinformation into action H1 2018 results and operational advances 2 Transforming Molecularinformation into action Disclaimer The presentation and the…
10/22/12 NGS Sequence data 1/58hyphaltip.github.com/CSHL_2012_NGS/lecture/NGS_DNA.slides.html#slide1 NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu…
1.Sequencing data analysisWorkshop – part 1 / main principles and data formats Outline Introduction Sequencing flowMain data formats throughout this flow Maté Ongenaert2.…
1.Sequencing data analysisWorkshop – part 2 / mapping to a reference genomeOutlinePreviously in this workshop…Mapping to a reference genome – the stepsMapping to a…
1.Sequencing data analysisWorkshop – part 3 / peak calling and annotation Outline Previously in this workshop…Peak calling and annotation – the stepsPeak calling and…
1.Surya Saha [email protected] BTI PGRP Summer Internship Program 2014 Slides: https://bitly.com/BioinfoInternEx2014 Quality Control of NGS Data 2. 1. Evaluation 2. Preprocessing…
NNGS data analysis with Galaxy 1 NGS data analysis with Galaxy…