www.sciencemag.org/cgi/content/full/science.aam9970/DC1
Supplementary Materials for Plants transfer lipids to sustain colonization by mutualistic mycorrhizal
and parasitic fungi Yina Jiang, Wanxiao Wang, Qiujin Xie, Na Liu, Lixia Liu, Dapeng Wang, Xiaowei
Zhang, Chen Yang, Xiaoya Chen, Dingzhong Tang, Ertao Wang*
*Corresponding author. Email: [email protected]
Published 8 June 2017 on Science First Release DOI: 10.1126/science.aam9970
This PDF file includes:
Materials and Methods Figs. S1 to S20 Tables S1 to S3 References
Materials and Methods
Medicago truncatula materials, growth conditions and mycorrhizal infections
The Rhizophagus irregularis (syn. Glomus intraradices) inoculum and M. truncatula
ram2, str, dmi3-1, ram1-2, and della-123 mutants used in this study have been
described previously (20, 21, 31-33). The M. truncatula Acyl-ACP thioesterases B
(FatM; Medtr1g109110) mutant fatm (NF7660) was obtained from the Samuel
Roberts Noble Foundation Tnt1 population
(http://medicago-mutant.noble.org/mutant/database.php). The wild-type background
for ram2, str, and dmi3-1 is Jemalong A17, and for ram1-2, della-123, and fatm is
R108. The genotype of Tnt1 mutant fatm was confirmed by performing PCR on
genomic DNA using the transposon-specific primer Tnt1-F2 together with
gene-specific primers fatm_F and fatm _R listed in Table S3.
M. truncatula seeds were scarified with H2SO4, surface sterilised using 10% (v/v)
bleach for 2-3 min and then germinated on 1% water agar plates. The seedlings were
germinated on water agar plates in room temperature overnight after incubation at 4ºC
in the dark for over 24 h. For routine mycorrhization experiments, seedlings were
transplanted into a mixture of perlite and sand (1:1 v/v) containing an inoculum of
~400 R. irregularis spores per plant. For ‘nurse plant’ experiments, wild-type and
ram2 seedlings were planted together in the same pot separated by a 125 μm nylon
mesh to segregate the two root systems but allow hyphae to spread between them.
Plants were grown in a controlled environment chamber set to a 16 h light /8 h dark
period at 22ºC (photon flux density = 250 μmol m2/s).
Arabidopsis thaliana materials, growth conditions and powdery mildew infections
The Columbia-0 strain (Col-0) of A. thaliana was used as the wild-type genetic
background in all experiments. The A. thaliana kas1 (SAIL_503_E03) and kar1
(SALK_011081) mutants used in this study have been described previously (34, 35).
The A. thaliana Acyl-ACP thioesterases B (FatB; At1g08510) mutants fatb-1
(SALK_020856) and fatb-2 (SALK_032338) were identified from the TAIR database
(http://www.arabidopsis.org/). The genotype of T-DNA mutants were confirmed by
performing PCR on genomic DNA using the transposon-specific primer LBb1.3/BP
together with gene-specific primers LP and RP. Primer sequences are listed in Table
S3. A. thaliana kas1 complementation kas1/KASI seeds were a kind gift of Dr. Xue as
described previously (34).
A. thaliana seeds were surface-sterilized and chilled at 4°C for 3 d, then sown on
plates containing half-strength Murashige and Skoog medium (MS). Seedlings were
transplanted into soil 10 d after germination. For powdery mildew infection, plants
were grown in a growth room with a 9-h-light/15-h-dark photoperiod, light intensity
of 7000 to 8000 lux, and relative humidity of 50-60% at 21-24°C as described
previously (36). For transformation and seed set, the plants were placed in a growth
room at 21-24°C with a long-day photoperiod (16-h-light/8-h-hdark cycle).
Four-week-old plants were inoculated with G. cichoracearum, and the number of
conidiophores per colony was counted at 5 dpi, as described previously (37).
Microscopy
Mycorrhizae-colonized M. truncatula roots were washed and treated with 10% KOH
for 6 minutes at 95ºC, followed by 3 minutes in ink-acetic acid-water (5/5/90, v/v/v)
as described by Vierheilig et al. (38). Root length colonization was quantified using
the grid line intersect method as described by Giovannetti and Mosse (39) and imaged
under an Olympus SZX7 light microscope. Mycorrhizae-colonized roots were also
stained by WGA-AlexaFluor 488 as followed: Harvested roots were placed in 50%
ethanol for more than 4 h and then transferred to 20% (w/v) KOH for 2-3 days,
followed by 0.1 M HCl for 1-2 h at room temperature. After HCl was removed, the
sample was rinsed twice with distilled H2O, and once with PBS buffer (8 g of NaCl,
0.2 g of KCl, 1.44 g of Na2HPO4, and 0.24 g of KH2PO4 dissolved in distilled H2O in
each 1L PBS buffer, pH=7.4), and then immersed in PBS/WGA-AlexaFluor 488
staining solution (0.2 μg/mL) in the dark for 6 hours. Root length colonization was
imaged under an Olympus FV1000 confocal microscope.
A. thaliana trypan blue staining was used to monitor fungal structures and dead plant
cells (40). The samples were observed and photographed with a ZEISS AX10
microscope.
Gene expression analysis
Total RNA was extracted from root tissues using Trizol reagent (Invitrogen) and
treated with DNase I. First-strand cDNAs were generated using the PrimeScript™ 1st
Strand cDNA Synthesis Kit (TaKaRa). Quantitative RT-PCR was performed with the
MyiQ™ real-time PCR detection systems (BIO-RAD) by using the 2×RealStar Green
Fast Mixture (GenStar). The relative expression value was normalized by using M.
truncatula Elongation factor 1 (MtEF-1) in M. truncatula (41) and PP2A (At1g59830)
in A. thaliana (42). Primer sequences for the Real-time PCR are listed in Table S3.
Plasmid construction
For overexpression analysis, the cDNA sequences of MtPK (XM_003592110, 1,731
bp), MtKAS II (XM_003608444, 1,413 bp), MtKAR (XM_003601772, 963 bp),
MtFatM (XM_013614657, 1,137 bp) were amplified by PCR and cloned into
pENTR/SD/D-Topo (Invitrogen). The medium-chain acyl–ACP thioesterase gene
UcFatB from Umbellularia californica (GenBank ID: Q41635.1) was codon
optimized and synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). Each
fragment was then transferred from the entry vectors into pK7WG2R by Gateway LR
reactions (Invitrogen).
A binary vector for STR and STR2 co-overexpression analysis, the cDNA sequences
of STR (XM_003631084, 2,454bp) and STR2 (XM_003612901, 2,184bp) were
amplified by PCR and cloned into pENTR/SD/D-Topo and pDNOR-p4p3
(Invitrogen), respectively. These two fragments were then transferred from the entry
vectors into pK7m34GW2-8m21GW3D (containing 835 bp 35S promoter, ROLD
promoter and GFP fluorescence marker) by Gateway LR reactions.
For RNAi analysis, the RNAi target sequences of MtPK (567 bp), MtKAS II (508 bp),
MtKAR (473 bp), and MtFatM (343bp) regions were amplified by PCR and cloned
into pENTR/SD/D-Topo. Each fragment was then transferred into pK7GWIWGIIR
by Gateway LR reactions.
For promoter-GUS analysis, 5’ flanking genomic sequence regions of MtFatM (1,293
bp), AtKASI (1,869 bp), AtKAR (708 bp), and AtFatB (1,793 bp) were amplified by
PCR and cloned into pENTR/SD/D-Topo. The fragments were then transferred from
the entry vectors into pBGWFS7 by Gateway LR reactions.
For M. truncatula complementation analysis, the 35S promoter of pK7WG2R was
removed by HindIII, SpeI digestion and filled-in by Klenow, resulting in
pK7WG2Rδ35S. A clone containing a 4.6-kb genomic fragment, including 1.9 kb of
the RAM2 promoter and 2.7 kb gDNA, and a clone containing a 3.7-kb genomic
fragment, including 1.3 kb of the MtFATM promoter and 2.4 kb gDNA, and another
clone containing a 5.1-kb genomic fragment, including 2 kb of the STR promoter and
3.1 kb gDNA, was respectively amplified by PCR and cloned into
pENTR/SD/D-Topo. The fragment was then transferred from the entry vectors into
pK7WG2Rδ35S by Gateway LR reactions.
A binary vector for complementation of ram2 (or str) and UcFatB overexpression
analysis was constructed as followed: The 35S promoter of pK7WG2R was removed
by HindIII, SpeI digestion and replaced by a 2.3-kb DNA fragment containing 835 bp
35S promoter, UcFatB cDNA region and 273 bp NOS terminator which was
amplified by one step overlap PCR (YEASEN), resulting in
35S-UcFatB-nos-pK7WG2R. A 4.6-kb genomic fragment of RAM2 (or a 5.1 kb
genomic fragment of STR), as described above, was then transferred from the entry
vectors into 35S-UcFatB-nos-pK7WG2R by Gateway LR reactions.
For A. thaliana complementation analysis, a clone containing a 3.2-kb genomic
fragment, including 0.7 kb of the AtKAR promoter and 2.5 kb gDNA, and a clone
containing a 3.7 kb genomic fragment, including 1.8 kb of the AtFatB promoter and
1.9 kb gDNA was each amplified by PCR and cloned into pENTR/SD/D-Topo. The
fragment was then transferred from the entry vectors into pGWB601 by Gateway LR
reactions.
Primer sequences for plasmid construction are listed in Table S3.
M. truncatula hairy root transformation
The constructs were individually transferred into the A. rhizogenes strain Arqua-1,
which were then used to form chimeric transgenic plants using the transformation
protocol described by Boisson-Dernier et al (43). 3-4 weeks later, untransformed roots
were removed based on root RFP fluorescence and composite plants transferred to
cultivate in the greenhouse in a mixture of perlite and sand (1:1) inoculated with R.
irregularis. The root systems of individual plants were analysed for AM colonization
and gene expression levels were analysed upon given time points.
A. thaliana plant transformation
The constructs were verified by sequencing and transferred into Agrobacterium
tumefaciens GV3101, then transformed into plants using the floral dip method (44).
Transgenic plants were selected on half strength MS medium containing 15 μg/mL
basta, or 50 μg/mL of kanamycin (Sigma-Aldrich). Transformants were transplanted
to soil 15 d after germination, and T3 transgenic homozygous plants were used for
phenotyping.
GUS histochemical staining
Positive transgenic lines harboring promoter-GUS reporter gene construct were
stained in a solution comprised 0.5 mM potassium ferricyanide, 0.5 mM potassium
ferrocyanide, 0.5 mg/mL 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid, 0.1%[v/v]
Triton X-100, and 0.1 M sodium phosphate buffer ( pH 7.0) at 37 ºC for 6 h (45). To
stop this process and to clear the leaves, the samples were washed with 75% ethanol.
GUS-staining patterns were observed and photographed with a Nikon SMZ1270
microscope.
13C-Labeling analysis
Ri T-DNA-transformed roots of carrot (Daucus carota L.) colonized by the AM
fungus R. irregularis were grown, labeled and harvested using the protocol described
by Pfeffer et al (4). Final concentrations of (1,3-13
C) glycerol or (2-13
C) glycerol
(Cambridge Isotope Laboratories, Inc. 13
C = 99%) were 10 mM. Tissues were then
incubated for 6 to 8 weeks before harvest and freeze-dried for extraction. Before
GC-MS analysis, tissues were immersed in 6M HCl at 105ºC for 30 min and the
supernatant was freeze-dried, then Pyridine (Sigma) and BSTFA
(N,O-bis(trimethylsilyl)-trifluoroacetamide) +1 % TMCS (Trimethylchlorosilane)
were added to the residue and derivatized at 70ºC for 1 h. Insoluble particles were
removed from GC-MS samples by centrifugation at 12,000g for 10 min and by
filtration through a 0.22 μm pore filter.
GC-MS analyses were performed on a 6890N Network GC System, fitted with a 5975
Mass Spectrometer Detector (GC-MSD; Agilent, Palo Alto, CA, USA) and equipped
with an HP-5MS capillary column (30 m x 0.25 mm; film thickness 0.25 μm)[5%
Phenyl Methyl Siloxane] was employed. Oven temperature was beginning of 2 min at
100ºC, increasing at 5ºC/min to 260ºC, then held at 260ºC for 10 min. Mass spectra
were measured in the EI scan mode (70 eV) in the m/z (Amu) range of 40-600. Peak
identities were confirmed by the standard solution (ANPEL, Shanghai, China) and
National Institute of Standards and Technology libraries (NIST 14).
The GC-MS data were analysed as described by Liu et al (46). Briefly, a mass
isotopomer distribution vector (MDV) of each fragment of glucose, fatty acids, and
glycerin was determined from the respective mass spectra. The MDV was corrected
according to the natural abundance of all stable isotopes, including 13
C, 29
Si, 30
Si, and
18O. The MDV can be determined for each metabolite fragment containing specific
combinations of carbon atoms of the considered metabolite. For example, an MDV
was determined for each of the major three 6-glucose fragments (Fig. S1A), including
the C1-Glu fragment containing all C-1 carbon atoms, the C2-3-Glu fragment
containing C-2 and C-3 atoms, and the C1-3/4-6-Glu fragment containing C-1 to C-3 (or
C-4 to C-6) atoms. The summed fractional labeling (SFL) of a metabolite fragment
was calculated from the MDV according to SFL=
, in which n represents
the number of carbon atoms in the fragment and mi represents the relative abundance
of different mass isotopomers.
Cutin monomer analysis, FAME extraction and GC-QTOF-MS analysis
For cutin monomer extraction, M. truncatula A17 and str 4-week-seedlings leaves and
roots which grown in sand/perlite (1:1) were harvested and were prepared using the
modified method of Molina et al (47). Briefly, the plant tissue was immersed in
boiling isopropanol and heated for 10 min at 80-85ºC, then shaken gently for ~4 h at
room temperature. The solution was removed and another 5 ml of isopropanol was
added, and shaken again overnight. After remove of isopropanol, the tissue was
re-extracted with CHCl3: MeOH (2:1 v/v) at room temperature by shaking for
approximately 8 h. This step was repeated and shaken overnight. The sample was
extracted successively with MeOH (30 min), H2O (30 min), 2 M NaCl (1 h), H2O (30
min), MeOH (30 min), CHCl3: MeOH (1:2 v/v) (overnight) and CHCl3: MeOH (1:2
v/v) (overnight). All extraction steps were performed in a shaker (80 rpm) at room
temperature. Transmethylation was processed as followed: The residue left after the
extraction with CHCl3: MeOH (1:2 v/v), was washed with methanol and as much of
the supernatant was removed as possible. Then add 1 ml of fresh 5 % (v/v) H2SO4 in
MeOH, 0.5 ml of toluene and 30 μl of standard solution containing 1 mg/ml methyl
nonadecanoate in MeOH. Seal lid, vortex and heat at 80 ºC for 3 h (or more) with
occasional mixing. After cooling, add 2.5 ml of CH2Cl2 (dichlormethane) and 0.75 ml
of 0.9% KCl. Seal lid, vortex and centrifuge of 5-10 min at ~800 g. Remove lower
phase with a glass pipette (avoiding any of the upper) and put in a 2 ml glass vial.
Derivitization was processed as followed: Dry down this organic phase under nitrogen
gas, then re-suspend the fatty acid methyl esters (FAMES) by adding 50 μl of pyridine
and 50 μl of BSTFA+1 % TMCS. Seal lid, vortex and heat at 70 ºC for 1 h. Dry down
the FAMES again under nitrogen gas and resuspend in 100 μl of pyridine before run
on GC-QTOF-MS.
Fatty Acid Methyl Esters (FAMES) were prepared using the modified method of
Browse et al (48) and the acidic catalysts transesterify both free fatty acids and those
bound to triglycerides and phospholipids in plant materials. Briefly, samples were
fully ground in liquid nitrogen, and then transferred into 8ml screw-capped glass
tubes. After addition of 1 mL fresh 5% H2SO4 (v/v in methanol) reagent, the tubes
were heated to 80°C for 1 h. When the samples cooled, 30 μl of methyl
nonadecanoate (1 mg/ml in MeOH), 0.3 mL of hexane and 1 mL of 0.9% NaCl were
added and the FAMES extracted into the hexane by vigorous shaking. After
centrifugation, the sample was taken directly from the hexane phase and was used for
GC-QTOF-MS analysis. When we calculated mole% of fatty acids, we define the sum
of most abundant fatty acids from C12:0 to C18:2 FA (C12:0, C16:0, C16:1, C18:0,
C18:1, C18:2, C18:2 FA) content as 100%.
For the analysis of the cutin monomers and FAME, an Agilent 7200 GC-QTOF-MS
(Agilent, SantaClara, USA) was used (49). GC was performed on a HP-5MS column
(Agilent, 30 m×0.25 mm i.d., 0.25 μm film thickness, 5% phenyl methyl siloxane
stationary phase). GC injection was performed in pulsed split mode (split rate 5:1,
purge flow to split vent 5mL/min). The following GC temperature gradient was used:
100°C for 2 min, 5°C/min to 190°C, 2°C/min to 230°C and hold at 230°C for 5 min,
10°C/min to 260°C. The QTOF Mass spectra were recorded at five scans per second
with a mass-to-charge ratio 40-600 m/z mass acquisition range. Electron energy was
kept at 70 eV, and the QTOF-MS was operated in 2 GHz-EDR mode in order to
extend the linear dynamic range.
Data acquisition and evaluation were carried out with MassHunter Acquisition and
MassHunter Quantitative and Qualitative Analysis (version B07, Agilent Technologies,
CA, USA), respectively. The cutin monomers and FAMES were identified by
comparing their mass spectra with those in the standard solution (ANPEL, Shanghai,
China) and the National Institute of Standards and Technology library (NIST 14).
TAGs extraction and molecular species analysis (LC-HRMS)
Triacylglycerols (TAGs) were prepared using the modified method of Li et al (50).
Samples were homogenised in liquid nitrogen and then transferred into 8 ml
screw-capped glass tubes. After addition of 5 ml of pre-cooled
chloroform-methanol-formic acid (10/10/1, v/v/v), the samples were mixed with a
vortex, then placed in the -20°C overnight. After addition of 2.2 ml of Hajra’s (0.2 M
H3PO4, 1 M KCl) reagent, the TAGs were extracted by vigorous shaking. The tubes
were centrifuged (1000 g for 5 min) and the lower phase was collected and
concentrated under N2, and then redissolved in 0.1 ml acetonitrile-isopropanol-water
(65/35/5, v/v/v) for liquid chromatography-high resolution mass spectrometry
(LC-HRMS) analysis. HRMS data was obtained from a Q-Exactive Orbitrap mass
spectrometer (Thermo Fisher Scientific, Bremen, Germany) coupled to an Acquity
Ultra Performance LC system (Waters, Texas, USA) (51). An Acquity UPLC BEH
C18 column (2.1×50 mm, 1.7 μm) was utilized at 55°C. Acetonitrile-water (60/40, v/v,
10 mM ammonium formate) and isopropanol-acetonitrile (90/10, v/v) were used as
mobile phases A and B, respectively. The elution was performed with a 14 min
gradient with 50% B at the beginning. 50% B was firstly maintained for 1 min, and
then linearly increased from 50% B to 95% B in 7 min. After washing the column for
2 min with 95% B, the buffer was decreased to 50% B immediately and the column
was reconditioned with initial gradient for 4 min. The MS was operated with HESI
ion source in positive mode. The MS scan mode of parallel reaction monitoring (PRM)
was used to realize the verification and quantification of TAGs. The PRM scan used
the following settings: MS2 resolution, 17,500; AGC target, 2e5; max IT, 60 ms;
isolation window, 1.5 m/z; normalised HCD collision energy, 20 eV. The precursor
ions and the product ions used for quantification of the target TAGs (with C16:1
and/or C12:0) were as follows: TAG(C44:2), 764.6763/493.4251/547.4721;
TAG(C48:3), 818.7232/547.4721; TAG(C48:2), 820.7389/549.4877; TAG(C48:1),
822.7545/551.5034; TAG(C50:4), 844.7388/573.4877; TAG(C50:3),
846.7545/575.5034; TAG(C50:2), 848.7702/577.5190; TAG(C50:1),
850.7859/579.5348. When we calculated mole% of TAG, we define the content of
total TAGs (C44:2, C48:3, C48:2, C48:1, C50:4, C50:3, C50:2, C50:1) as 100%.
C44:2 TAG was collected by LC-HRMS, transesterified and run on GC-QTOF-MS,
which showed that C16:1 is most likely C16:1ω5 according to fatty acids of AM
fungus, the standard solution (ANPEL, Shanghai, China) and the National Institute of
Standards and Technology library (NIST 14). C16:1ω5 was further confirmed to be a
mycorrhizal specific component and not present in plant tissue. The identification of
C16:1ω5 was shown as Fig. S20.
R. irregularis sequence data analysis
AM fungus R. irregularis (syn. G. intraradices) ‘high-confidence’ gene models for
genome and transcriptome sequencing data were downloaded (9, 52, 53). All
predicted gene models were functionally annotated and were aligned against the
KEGG database (Kyoto Encyclopedia of Genes and Genomes) (54). KEGG hits were
used to map EC numbers map GO (Gene Ontology) terms.
Supplement figures and tables
Fig. S1. Analysis of metabolism and transport in carrot roots colonization by R.
irregularis. (A) Sketch map of carbon positions in isotope labeling used in this study.
(B-C) Experimental schematic map for (1,3-13
C)glycerol labeling extraradical
mycelium (ERM) (B) and mycorrhized roots (IRM/R) (C). (D-E) Isotope tracer
showed ratios of 13
C2 labeled in C2-3 glucose (C2-3-Glu), C1-2/2-3 glycerol (C1-2/2-3-Gly)
and C2 unit of C16:0 fatty acid (16-FA) when (2-13
C)glycerol supplied to ERM (D)
and IRM/R (E). Values are the mean +/-SE of measurements from three independent
plates. The ratios are determined by GC-MS. **P < 0.01 (Student’s t-test).
Fig. S2. M. truncatula fatty acid biosynthesis genes are required for arbuscule
formation. (A) Time course of relative expression of fatty acid biosynthesis genes
(MtPK, MtKAS II, MtKAR, MtENR I, and MtFatM) at 14, 21, 28, 35 and 42 days post
inoculation with R. irregularis (dpi). (B) The AM colonization levels of plants which
were used for real-time PCR in (A). RLC, root length colonization. (C) Relative gene
expression levels in overexpression of MtPK, MtKAS II, MtKAR, and MtFatM plant
roots at 42 dpi. (D) Relative gene expression levels in MtPK, MtKAS II, and MtFatM
RNAi plant roots at 42 dpi. (MtKAR RNAi plants failed to generate lateral hairy roots
in two repeated experiments). MtKAS II RNAi was associated with weak mycorrhizal
phenotypes, which may be due to genetic redundancy arising from the two other
copies of MtKAS II in the M. truncatula genome (Table S2). These experiments were
repeated three times with similar results. Values are the mean +/- SE of measurements
performed on 8-12 plants. Error bars are standard error. **P < 0.01; ns, not
significantly (Student’s t- test).
Fig. S3. M. truncatula fatty acid biosynthesis gene FatM was required for
arbuscule formation. (A) Root length colonization (RLC) and of wild-type (R108),
fatm, ram2 and fatm/FatM (fatm complemented plants) at 42 dpi. (B) Images of
WGA-AF488 stained arbuscules of wild-type (R108), fatm, and fatm/FatM at 42 dpi.
Left, center, and right panels show confocal laser scanning microscopy images
(WGA-AF488), bright-field images (BF), and an overlay, respectively. The
fluorescent green signal arises from WGA-Alexafluor 488 staining of the fungal cell
wall. (C) Bright field images and (D) corresponding fluorescence microscopy images
of roots colonized with R. irregularis reveal GUS expression in cortical arbuscular
cells. Values are the mean +/- SE of measurements performed on 8-12 plants.
arbuscule (a). Roots were GUS stained for 6 h. Scale bar, 50 μm.
Fig. S4. The plant-derived lauric acid can be transferred to the AM fungus. (A)
Cartoon of the culture system used for lipid analysis experiments in Fig. 1E and fig.
S4C, D. A 125 μm nylon mesh was used to segregate the root systems but allow
hyphae to spread between them. (B) Root length colonization (RLC) in UcFatB
overexpression and EV roots at 42 dpi. (C) Lauric acid content of UcFatB
overexpression and EV roots at 42 dpi. (D) Fungal TAG (C44:2, C16:1-C16:1-C12:0)
content in IRM/R of UcFatB overexpression and EV roots at 42 dpi. This lipid
species contains two molecules of the fungal marker fatty acid C16:1 and one of
C12:0. These experiments were repeated three times with similar results. Values are
the mean +/- SE of measurements performed on 8-12 plants. *P < 0.01; ns, not
significantly different (Student’s t-test).
Fig. S5. Mycorrhization of ram2 relies on the presence of a nurse plant. (A)
Arbuscule size distribution of ram2 and WT plants grown with a ram2 or WT nurse
plant at 42 dpi. (B) Expression level of PHOSPHATE TRANSPORTER4 (MtPT4) in
WT and ram2 grown as a monoculture or with a WT nurse plant at 42 dpi. PT4 is
expressed specifically in root cortical cells that harbor arbuscules, where it plays an
essential role in phosphate uptake (55). These experiments were repeated three times
with similar results.
Fig. S6. RAM2 is required for plant-derived lauric acid transfer from plant to
AM fungi. (A) Cartoon of the experimental design used to obtain ram2 root
mycorrhization with R.irregularis in the presence of a WT nurse plant in Fig. 2. (B)
Root length colonization (RLC) of WT-EV, WT-UcFatB, ram2-EV and ram2-UcFatB
roots at 42 dpi. (C) Quantity of the fungal TAG (C44:2) in mycorrhizal WT-EV,
WT-UcFatB, ram2-EV and ram2-UcFatB roots at 42 dpi. ram2 plants grew in the
presence of a WT nurse plant. WT plants grew as a monoculture. (D) Lauric acid
(C12:0 FA) content in WT-EV, WT-UcFatB, ram2/RAM2-EV and
ram2/RAM2-UcFatB hairy roots without R. irregularis infection. ram2 was
complemented by RAM2 gene driven by the RAM2 promoter. (E) Root length
colonization (RLC) in WT-EV, WT-UcFatB, ram2/RAM2-EV and
ram2/RAM2-UcFatB roots at 42 dpi. (F) Quantity of the fungal TAG (C44:2) in
mycorrhizal WT-EV, WT-UcFatB, ram2/RAM2-EV and ram2/RAM2-UcFatB roots at
42 dpi. Values are the mean +/- SE of measurements performed on 8-12 plants. *P <
0.01; ns, not significantly different (Student’s t-test).
Fig. S7. Relative gene expression levels of STR and STR2 in EV and transgenic
STR-STR2 plant hairy roots used in Fig. 3A and 3B. The relative expression was
normalized by using MtEF-1. These experiments were repeated three times with
similar results. Error bars are standard error.
Fig. S8. Cutin analyzes. (A) Relative gene expression levels and (B) Cutin analyzes
of total load in Arabidopsis wild-type (Col-0), empty vector (T3-EV), and STR-STR2
co-overexpression transgenitic T3 line (T3-6, T3-7, T3-36) leaves. The relative
expression was normalized by using PP2A. The data were obtained from three
biological replicates and are presented as means +/- SE. (B) Each value is the mean
SE of measurements performed on 15-20 plants. FW, fresh weight. *P < 0.01; ns, not
significantly different (Student’s t-test).
Fig. S9. Cutin analyses of A17 (WT) and str. Cutin total load (A, C) and monomer
load (B, D) were analyzed from WT and str 4-week-seedlings leaves (A, B) and roots
(C, D) grown in sand/perlite (1:1). These experiments were repeated three times with
similar results. Values are the mean +/- SE of measurements performed on 8-12 plants.
ns, not significantly different from WT (P>0.05, Student’s t-test).
Fig. S10. Mycorrhization of str relies on the presence of a nurse plant. (A)
Quantification of R. irregularis colonization in str and wild-type (WT) grown with a
str or WT nurse plant at 42 dpi. The “tester” labeled by red color, grown with “nurse”
plants. (B) Images of WGA-AF488 stained arbuscules of wild-type (WT), str and str
grown with a nurse (str/WT) at 42 dpi. Up and down panels show confocal laser
scanning microscopy images, and an overlay with light-field images, respectively. The
fluorescent green signal arises from WGA-Alexafluor 488 staining of the fungal cell
wall. Scale bar, 30 μm. (C) Expression level of MtPT4 in WT and str grown as a
monoculture or with a nurse WT plant at 42 dpi. These experiments were repeated
three times with similar results. Values are the mean +/-SE of measurements from
three independent plates and 8-12 plants of each genotype were analyzed. *P < 0.01;
ns not significantly different from WT (P>0.05, Student’s t-test).
Fig. S11. STR mediates plant-derived fatty acids transfer from plant to AM
fungus. (A) Cartoon of the experimental design used to obtain str root mycorrhization
with R.irregularis in the presence of a WT nurse plant in Fig. 3D. (B) Root length
colonization (RLC) of WT-EV, WT-UcFatB, str-EV and str-UcFatB hairy roots at 42
dpi. (C) Quantity of the fungal TAG (C44:2) in mycorrhizal WT-EV, WT-UcFatB,
str-EV and str-UcFatB roots at 42 dpi. str plants grew in the presence of a WT nurse
plant. WT plants grew as a monoculture. (D) Lauric acid (C12:0 FA) content in
WT-EV, WT-UcFatB, str/STR-EV and str/STR-UcFatB hairy roots without R.
irregularis infection. str was complemented by STR gene driven by the STR promoter.
(E) Root length colonization in WT-EV, str/STR-EV, WT-UcFatB and
str/STR-UcFatB at 42 dpi. (F) Quantity of the fungal TAG (C44:2) in mycorrhizal
WT-EV, WT-UcFatB, str/STR-EV and str/STR-UcFatB roots at 42 dpi. These
experiments were repeated three times with similar results. Values are the mean +/-SE
of measurements from three independent plates and 8-12 plants of each genotype
were analyzed. *P < 0.05; **P < 0.01; ns, not significantly different (Student’s t-test).
Fig. S12. Expression patterns of Arabidopsis KASI, KAR and FatB during
powdery mildew infections. (A) The expression of AtKASI, AtKAR and AtFatB after
6 h, 12 h, 18 h, 24 h, 2 d, 3 d, 4 d, and 5 d of powdery mildew (Erysiphe orontii)
infection according to microarray data in the Arabidopsis Information Resource
(TAIR). Relative expression was normalized with mock control. (B) Promoter:
reporter gene (GUS) studies reveal the expression of AtKASI, AtKAR and AtFatB at 8
dpi with/without G. cichoracearum infection (+/-). Leaves were GUS stained for 6 h.
Fig. S13. UcFatB overexpression in Arabidopsis. (A) Relative gene expression
levels of UcFatB in the rosette leaves (21-day old plant) of WT, EV and UcFatB
overexpression lines (three independent lines 16, 20, and 22). The relative expression
was normalized by using PP2A. The data were obtained from three biological
replicates and are presented as means +/- SE. (B) Quantitative analysis of
conidiophore formation per colony on 4-week-old wild-type (WT), empty vector (EV)
and transgenic UcFatB lines at 5 dpi. The bars represent means and SE from one
experiment (n = 30). The experiment was repeated twice with similar results. *P <
0.01; ns, not significantly different from WT (P>0.05, Student’s t-test).
Fig. S14. Identification of fatty acid biosynthesis gene mutants in Arabidopsis. (A)
Schematic representation of Arabidopsis fatty acid biosynthesis gene AtKASI, AtKAR,
and AtFatB. T-DNA insertion sites are indicated by triangles. Black boxes, lines, and
white boxes indicate the exons, introns, and 5’/3’-UTR regions, respectively. (B)
qRT-PCR analysis on fatty acid biosynthesis gene expression levels in the rosette
leaves (21 DAG) of wild-type and mutants, respectively. The relative expression is
calculated by comparison with that of the wild type (set as 1.0). The data were from
three biological replicates and are presented as means +/- SE. (C) Four-week-old
wild-type (Col-0), kas1 (SAIL_503_E03), kar1 (SALK_011081), fatb-1
(SALK_020856), and fatb-2 (SALK_032338) plants were inoculated with G.
cichoracearum. The photographs were taken at 8 dpi. Scale bar, 1 cm. (D) The
photographs were taken for representative leaves showed in (C) at 8 dpi. Scale bar,
0.2 cm.
Fig. S15. Complementation test. KASI, KAR and FatB complement disease
phenotype to G. cichoracearum in kas1, kar and fatb-1 mutants. Trypan blue
staining of the four-week-old Col-0, kas1/KASI, kar/KAR, and fatb/FatB (candidate
genes were driven by its own promoter) leaves inoculated at 8 dpi shown to visualize
fungal structures and plant cell death. Scale bar, 50 μm.
Fig. S16. A new model shows that host plants synthesize fatty acid and transfer
to AM fungus by STR/STR2 transporter. 2-MAG, 2-monoacylglycerols.
Fig. S17. Distribution of enzymes involved in the fatty acid degradation pathway
(map 00071) of R. irregularis fungi genome and transcriptome sequencing data
analysed by KEGG.
Fig. S18. Distribution of enzymes involved in the fatty acid elongation pathway
(map 00062, n>16) of R. irregularis fungi genome and transcriptome sequencing
data analysed by KEGG.
Fig. S19. The expression of fatty acid synthesis genes were down regulated in the
M. truncatula symbiotic signalling pathway gene mutants. (A) Relative expression
of M. truncatula lipid biosynthesis genes (PK, KAS II, KAR, and FatM), RAM2, STR,
STR2, PT4 in R108, ram1-2 and della-123 at 42 dpi. (B) Relative expression of M.
truncatula lipid biosynthesis genes (PK, KAS II, KAR, and FatM), RAM2, STR, STR2,
PT4 in A17, dmi3-1and str at 42 dpi. These experiments were repeated three times
with similar results. Error bars are standard error.
Fig. S20. GC-QTOF-MS analysis of C16:1. (A) Gas chromatography results of fatty
acid methyl esters (FAMES) from AM fungi, M. truncatula mycorrhizal roots, and
non mycorrhizal roots. (B) Mass spectra of C16:1 FAME from AM fungi, and
mycorrhizal roots. (C) Mass spectra information of C16:1ω5 (11-Hexadecenoic acid,
methyl ester) in National Institute of Standards and Technology library (NIST 14).
Mass spectra of C16:1 from AM fungi and mycorrhizal roots was matched with mass
spectra of C16:1ω5 (11-Hexadecenoic acid), when the mass spectra was searched
against NIST 14. Note that C16:1ω5 is only present in mycorrhizal colonized roots
and AM fungi, but not in plant root without mycorrhizal infection.
Table S1. M. truncatula lipid biosynthetic enzyme coding genes information in MtGEA.
Gene
name
No GO term Medicago GeneChip
ID
Expression levels Description Blast2n
vs Mt genome 4.0
CDS
Root Myc (R.
irregularis) 6wk
Root Myc (F.
mosseae) 6wk
Root non-Myc
(control) 6wk
MtPK Plastidic pyruvate kinase beta
subunit 1
Mtr.38606.1.S1_at 2512.36 2276.85 914.615 Medtr1g099360.1
MtMCAT Malonyl CoA-ACP
transacylase
Mtr.37706.1.S1_at 3314.71 2450.16 1214.45 Medtr3g031380.1
MtKAS II Ketoacyl-ACP synthase II Mtr.20497.1.S1_s_at 1561.89 1007.67 438.349 Medtr4g096690.1
Mtr.12585.1.S1_at 1156.58 950.305 545.184 Medtr1g103020.1
MtKAR Ketoacyl-ACP reductase Msa.958.1.S1_at 3279.42 2413.29 1099.32 Medtr3g085740.1
MtENR I Enoyl-ACP reductase I Mtr.43890.1.S1_at 2497.44 2036.28 703.586 Medtr4g074950.1
MtHAD Hydroxyacyl-ACP dehydrase Mtr.41225.1.S1_at 1969.59 1423.25 810.025 Medtr2g008620.1
MtFatM Acyl-ACP thioesterases B Mtr.35910.1.S1_at 839.211 530.99 8.19741 Medtr1g109110.1
RAM 2 Glycerol-3-phosphate
acyltransferase
Mtr.11226.1.S1_a/
Mtr.36944.1.S1_at
1472.96
4314.89
634.044
2828.87
11.7647
79.2391
Medtr1g040500.1
Table S2. Fatty acid biosynthesis genes are induced by Ustilago maydis
Accession
No.
Description Probe Set Mean Expression Value
4 dpi 8 dpi
Non-
infected Infected
Non-
infected Infected
CF013098 Enoyl-ACP reductase Zm.4508.1.A1_at 60.2 227.27 74.93 242.67
CD441565 Enoyl-ACP reductase Zm.2736.1.S1_at 291.6 792.67 187.93 829.1
CF635461 Hydroxyacyl-ACP dehydrase Zm.11729.1.A1_at 90.07 413.13 64.93 446.87
AW066696 Myristoyl -ACP thioesterases Zm.1069.1.A1_at 184.17 657.1 171.37 663.33
CD568857 Myristoyl -ACP thioesterases Zm.4074.1.S1_at NO NO 19.6 135.43
Table S3. Primer sequences
Gene name Primer sequences
qRT-PCR Primers
MtPK forward 5’-CACCAAGGGTCCTGAGGTTA-3’
reverse 5’-ACTTCGCATTTCACGGAATC-3’
MtKASII forward 5’-GGGATAAAGACCGTGATGGAT-3’
reverse 5’-ACACACCGGCATCTACAAGAC-3’
MtKAR forward 5’-TCCAAGGAGATTGAGGCACT-3’
reverse 5’-CCTCCTGCCACTGAGACTTC-3’
MtENRI forward 5’-GTATTACCTGATGGTTCGTTAATGG-3’
reverse 5’-AAGAGAGTGGACAAGGATGTCTATG-3’
MtFatM forward 5’-TTGAGCAAAGGCCAATAAGGT-3’
reverse 5’-CTATGTAGAAAATGGACATGTAGTGA-3’
RAM2 forward 5’-TTGGTGATGAAAAGCCTGAT-3’
reverse 5’-AAGATTATGGGTTTTGGAAGTTTG-3’
STR forward 5’-TTCCAATGATGCAGTCCCA-3’
reverse 5’-TGGTTATGACTGCAAATGTGAG-3’
STR2 forward 5’-GCAAGTGGGAGTCTTAAAGGA-3’
reverse 5’-GCCCTAATCTGAAATCAGCAG-3’
MtPT4 forward 5’-GACACGAGGCGCTTTCATAGCAGC-3’
reverse 5’-GTCATCGCAGCTGGAACAGCACCG-3’
MtEF-1 forward 5’-CTTTGCTTGGTGCTGTTTAGATGG-3’
reverse 5’-ATTCCAAAGGCGGCTGCATA-3’
AtKASI forward 5’-TCGCAAAACACACATCACACAC-3’
reverse 5’-GTGATTGACGATTTGATGGTAAG-3’
AtKAR forward 5’-GTCAGTTCTATTCGTGAAATCG-3’
reverse 5’-TAAAGATCGACCCAGTGGAGA-3’
AtFatB forward 5’-AATCATGTTAAGACTGCTGGATTGC-3’
reverse 5’-ATACCATTCTTTCCAGACTGACTGA-3’
AtPP2A forward 5’-GTCCTGGCGTGTGCGTTATATG-3’
reverse 5’-GGCACCAGATCCGTCCTAGTTG-3’
cDNA primers
MtPK forward 5’-ATGTCTCAGGTTCGATCCATTCAAAC-3’
reverse 5’-TTAATTTGTGGCAGCTACTGTTCGG-3’
MtKASII forward 5’-ATGCAATCACTTCAGCATCAACTAC-3’
reverse 5’-TCAGGGTCTGAAAGCGGAAAAAGCC-3’
MtKAR forward 5’-ATGGCTTCTCTTACCGGATCC-3’
reverse 5’-TTACATCACCATACCTCCATCAATG-3’
MtFatM forward 5’-ATGGCTGTTACTAATTTTACATGTTCA-3’
reverse 5’-CTATGTAGAAAATGGACATGTAGTGA-3’
STR forward 5’-ATGGCAAGGCTCGAGAGGGATG-3’
reverse 5’-TCATTTTCTTTCATTTTTGGAG-3’
STR2 forward 5’-ATGAAAACACAAGGTCTTGAAC-3’
reverse 5’-CTAGGACCTTTGATTTTTTGATG-3’
UcFatB forward 5’- ATGGCAACTACCTCATTGGCAT-3’
reverse 5’- TTAAACCCTTGGTTCAGCAGGA -3’
RNAi primers
MtPK forward 5’-CACCAAGGGTCCTGAGGTTA-3’
reverse 5’-AAAAGCGGAACCTCCTCAAT-3’
MtKASII forward 5’-ACATCGACGGGAAGAATGAC-3’
reverse 5’-TCACGGTCTTTATCCCAAGG-3’
MtKAR forward 5’-GATTGTTACCGGAGCTTCCA-3’
reverse 5’-TCAGGCCAATTACTCCTGCT-3’
MtFatM forward 5’-TTGGTTGATCCTCATCGTCA-3’
reverse 5’-TCATCACCCATGTGCTTGTT-3’
Complementation primers
MtRAM2 forward 5’-ATTGCCGGTGGGATAAACAC-3’
reverse 5’-TTAGCAACCCATTACTTTGTTG-3’
MtFatM forward 5’-AGACCACAACTGTTTGCTGCCTC-3’
reverse 5’-CTATGTAGAAAATGGACATGTAGT-3’
STR forward 5’-CTTTGATTTATATCCCCGTAGTGG-3’
reverse 5’-TCATTTTCTTTCATTTTTGGAG-3’
AtKAR forward 5’- GATTGAGGAACCAGGCACAT -3’
reverse 5’-CTAGATAGCAATACCTCCATCAA-3’
AtFatB forward 5’- CCATGAACCTGGTCCTCAAT -3’
reverse 5’-TTACGGTGCAGTTCCCCAAGTTG-3’
Promotor primers
MtFatM forward 5’-AGACCACAACTGTTTGCTGCCTC-3’
reverse 5’-TGTTCTGTTCCTTTTTTTATTTTTTCA-3’
AtKASI forward 5’-AAAACTCGGGTGGTGAACAA-3’
reverse 5’-GGTGGATCCAGAAATTGAGAGA-3’
AtKAR forward 5’-GATTGAGGAACCAGGCACAT-3’
reverse 5’-GGCGAATCTGTTGTTAAAGTGA-3’
AtFatB forward 5’-CCATGAACCTGGTCCTCAAT-3’
reverse 5’-GACGAGGAGATGAAGCGTTCAA-3’
Tnt 1 mutant primers
Tnt1-F2 5’-TCTTGTTAATTACCGTATCTCGGTGCTACA-3’
fatm_F forward 5’-ATGATTTTGTGTCACTGTCC-3’
fatm_R reverse 5’-CTATGTAGAAAATGGACAT-3’
T-DNA mutant primers
LBb1.3/BP 5’-ATTTTGCCGATTTCGGAAC-3’
kas1-LP forward 5’-AAACAATTGGGACAAAATGTTG-3’
kas1-RP reverse 5’-TCTGACCACCGAATCGAGTAG-3’
kar1-LP forward 5’-GCAAATTGAATGCTCGAAGAG-3’
kar1-RP reverse 5’-GCGATAGTGAAAGAGGTGACG-3’
fatb1-LP forward 5’-CGTGCTTGTTTAGCTGGAAAC-3’
fatb1-RP reverse 5’-TTTTTGGTCTCATGGGTTAGC-3’
fatb2-LP forward 5’-CTAGAATTTCCAATCACGGGG-3’
fatb2-RP reverse 5’-AAACACCAACAACAACTTGGG-3’
Other primers
35S-promotor forward 5’-AGATTAGCCTTTTCAATTTCAG-3’
reverse 5’-CGTGTTCTCTCCAAATGAAATG-3’
NOS-terminator forward 5’-GAGCTCGAATTTCCCCGATC-3’
reverse 5’-CCCGATCTAGTAACATAGAT-3’
References and Notes 1. S. Smith, D. Read, Mycorrhizal Symbiosis (Academic Press, 2008).
2. P. Bonfante, A. Genre, Mechanisms underlying beneficial plant-fungus interactions in mycorrhizal symbiosis. Nat. Commun. 1, 48 (2010). doi:10.1038/ncomms1046 Medline
3. S. E. Smith, F. A. Smith, Roles of arbuscular mycorrhizas in plant nutrition and growth: New paradigms from cellular to ecosystem scales. Annu. Rev. Plant Biol. 62, 227–250 (2011). doi:10.1146/annurev-arplant-042110-103846 Medline
4. P. E. Pfeffer, D. D. Douds Jr., G. Becard, Y. Shachar-Hill, Carbon uptake and the metabolism and transport of lipids in an arbuscular mycorrhiza. Plant Physiol. 120, 587–598 (1999). doi:10.1104/pp.120.2.587 Medline
5. B. Bago, P. E. Pfeffer, Y. Shachar-Hill, Carbon metabolism and transport in arbuscular mycorrhizas. Plant Physiol. 124, 949–958 (2000). doi:10.1104/pp.124.3.949 Medline
6. M. Trépanier, G. Bécard, P. Moutoglis, C. Willemot, S. Gagné, T. J. Avis, J.-A. Rioux, Dependence of arbuscular-mycorrhizal fungi on their plant host for palmitic acid synthesis. Appl. Environ. Microbiol. 71, 5341–5347 (2005). doi:10.1128/AEM.71.9.5341-5347.2005 Medline
7. B. Bago, W. Zipfel, R. M. Williams, J. Jun, R. Arreola, P. J. Lammers, P. E. Pfeffer, Y. Shachar-Hill, Translocation and utilization of fungal storage lipid in the arbuscular mycorrhizal symbiosis. Plant Physiol. 128, 108–124 (2002). doi:10.1104/pp.010466 Medline
8. O. Tehlivets, K. Scheuringer, S. D. Kohlwein, Fatty acid synthesis and elongation in yeast. Biochim. Biophys. Acta 1771, 255–270 (2007). doi:10.1016/j.bbalip.2006.07.004 Medline
9. K. Lin, E. Limpens, Z. Zhang, S. Ivanov, D. G. O. Saunders, D. Mu, E. Pang, H. Cao, H. Cha, T. Lin, Q. Zhou, Y. Shang, Y. Li, T. Sharma, R. van Velzen, N. de Ruijter, D. K. Aanen, J. Win, S. Kamoun, T. Bisseling, R. Geurts, S. Huang, Single nucleus genome sequencing reveals high similarity among nuclei of an endomycorrhizal fungus. PLOS Genet. 10, e1004078 (2014). doi:10.1371/journal.pgen.1004078 Medline
10. V. Wewer, M. Brands, P. Dörmann, Fatty acid synthesis and lipid metabolism in the obligate biotrophic fungus Rhizophagus irregularis during mycorrhization of Lotus japonicus. Plant J. 79, 398–412 (2014). doi:10.1111/tpj.12566 Medline
11. V. Vijayakumar, G. Liebisch, B. Buer, L. Xue, N. Gerlach, S. Blau, J. Schmitz, M. Bucher, Integrated multi-omics analysis supports role of lysophosphatidylcholine and related glycerophospholipids in the Lotus japonicas–Glomus intraradices mycorrhizal symbiosis. Plant Cell Environ. 39, 393–415 (2016). doi:10.1111/pce.12624 Medline
12. H. Wada, D. Shintani, J. Ohlrogge, Why do mitochondria synthesize fatty acids? Evidence for involvement in lipoic acid production. Proc. Natl. Acad. Sci. U.S.A. 94, 1591–1596 (1997). doi:10.1073/pnas.94.4.1591 Medline
13. J. Niklas, K. Schneider, E. Heinzle, Metabolic flux analysis in eukaryotes. Curr. Opin. Biotechnol. 21, 63–69 (2010). doi:10.1016/j.copbio.2010.01.011 Medline
14. V. A. Benedito, I. Torres-Jerez, J. D. Murray, A. Andriankaja, S. Allen, K. Kakar, M. Wandrey, J. Verdier, H. Zuber, T. Ott, S. Moreau, A. Niebel, T. Frickey, G. Weiller, J. He, X. Dai, P. X. Zhao, Y. Tang, M. K. Udvardi, A gene expression atlas of the model legume Medicago truncatula. Plant J. 55, 504–513 (2008). doi:10.1111/j.1365-313X.2008.03519.x Medline
15. C. Hogekamp, D. Arndt, P. A. Pereira, J. D. Becker, N. Hohnjec, H. Küster, Laser microdissection unravels cell-type-specific transcription in arbuscular mycorrhizal roots, including CAAT-box transcription factor gene expression correlating with fungal contact and spread. Plant Physiol. 157, 2023–2043 (2011). doi:10.1104/pp.111.186635 Medline
16. A. Bravo, M. Brands, V. Wewer, P. Dörmann, M. J. Harrison, Arbuscular mycorrhiza-specific enzymes FatM and RAM2 fine-tune lipid biosynthesis to promote development of arbuscular mycorrhiza. New Phytol. 214, 1631–1645 (2017). doi:10.1111/nph.14533 Medline
17. T. A. Voelker, A. C. Worrell, L. Anderson, J. Bleibaum, C. Fan, D. J. Hawkins, S. E. Radke, H. M. Davies, Fatty acid biosynthesis redirected to medium chains in transgenic oilseed plants. Science 257, 72–74 (1992). doi:10.1126/science.1621095 Medline
18. W. L. Yang, M. Pollard, Y. Li-Beisson, F. Beisson, M. Feig, J. Ohlrogge, A distinct type of glycerol-3-phosphate acyltransferase with sn-2 preference and phosphatase activity producing 2-monoacylglycerol. Proc. Natl. Acad. Sci. U.S.A. 107, 12040 (2010).
19. W. Yang, J. P. Simpson, Y. Li-Beisson, F. Beisson, M. Pollard, J. B. Ohlrogge, A land-plant-specific glycerol-3-phosphate acyltransferase family in Arabidopsis: Substrate specificity, sn-2 preference, and evolution. Plant Physiol. 160, 638–652 (2012). doi:10.1104/pp.112.201996 Medline
20. E. Wang, S. Schornack, J. F. Marsh, E. Gobbato, B. Schwessinger, P. Eastmond, M. Schultze, S. Kamoun, G. E. D. Oldroyd, A common signaling process that promotes mycorrhizal and oomycete colonization of plants. Curr. Biol. 22, 2242–2246 (2012). doi:10.1016/j.cub.2012.09.043 Medline
21. Q. Zhang, L. A. Blaylock, M. J. Harrison, Two Medicago truncatula half-ABC transporters are essential for arbuscule development in arbuscular mycorrhizal symbiosis. Plant Cell 22, 1483–1497 (2010). doi:10.1105/tpc.110.074955 Medline
22. C. Gutjahr, D. Radovanovic, J. Geoffroy, Q. Zhang, H. Siegler, M. Chiapello, L. Casieri, K. An, G. An, E. Guiderdoni, C. S. Kumar, V. Sundaresan, M. J. Harrison, U. Paszkowski, The half-size ABC transporters STR1 and STR2 are indispensable for mycorrhizal arbuscule formation in rice. Plant J. 69, 906–920 (2012). doi:10.1111/j.1365-313X.2011.04842.x Medline
23. T. H. Yeats, J. K. Rose, The formation and function of plant cuticles. Plant Physiol. 163, 5–20 (2013). doi:10.1104/pp.113.222737 Medline
24. G. Doehlemann, R. Wahl, R. J. Horst, L. M. Voll, B. Usadel, F. Poree, M. Stitt, J. Pons-Kühnemann, U. Sonnewald, R. Kahmann, J. Kämper, Reprogramming a maize plant: Transcriptional and metabolic changes induced by the fungal biotroph Ustilago maydis. Plant J. 56, 181–195 (2008). doi:10.1111/j.1365-313X.2008.03590.x Medline
25. J. T. Ascencio-Ibáñez, R. Sozzani, T.-J. Lee, T.-M. Chu, R. D. Wolfinger, R. Cella, L. Hanley-Bowdoin, Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. Plant Physiol. 148, 436–454 (2008). doi:10.1104/pp.108.121038 Medline
26. L. Adam, S. C. Somerville, Genetic characterization of five powdery mildew disease resistance loci in Arabidopsis thaliana. Plant J. 9, 341–356 (1996). doi:10.1046/j.1365-313X.1996.09030341.x Medline
27. D. Tang, J. Ade, C. A. Frye, R. W. Innes, Regulation of plant defense responses in Arabidopsis by EDR2, a PH and START domain-containing protein. Plant J. 44, 245–257 (2005). doi:10.1111/j.1365-313X.2005.02523.x Medline
28. C. Vannini, A. Carpentieri, A. Salvioli, M. Novero, M. Marsoni, L. Testa, M. C. de Pinto, A. Amoresano, F. Ortolani, M. Bracale, P. Bonfante, An interdomain network: The endobacterium of a mycorrhizal fungus promotes antioxidative responses in both fungal and plant hosts. New Phytol. 211, 265–275 (2016). doi:10.1111/nph.13895 Medline
29. E. Gobbato, J. F. Marsh, T. Vernié, E. Wang, F. Maillet, J. Kim, J. B. Miller, J. Sun, S. A. Bano, P. Ratet, K. S. Mysore, J. Dénarié, M. Schultze, G. E. D. Oldroyd, A GRAS-type transcription factor with a specific function in mycorrhizal signaling. Curr. Biol. 22, 2236–2241 (2012). doi:10.1016/j.cub.2012.09.044 Medline
30. L. H. Luginbuehl, G. N. Menard, S. Kurup, H. Van Erp, G. V. Radhakrishnan, A. Breakspear, G. E. D. Oldroyd, P. J. Eastmond, Fatty acids in arbuscular mycorrhizal fungi are synthesized by the host plant. Science 10.1126/science.aan0081 (2017).
31. E. Gobbato, E. Wang, G. Higgins, S. A. Bano, C. Henry, M. Schultze, G. E. D. Oldroyd, RAM1 and RAM2 function and expression during arbuscular mycorrhizal symbiosis and Aphanomyces euteiches colonization. Plant Signal. Behav. 8, e26049 (2013). doi:10.4161/psb.26049 Medline
32. C. Chen, M. Gao, J. Liu, H. Zhu, Fungal symbiosis in rice requires an ortholog of a legume common symbiosis gene encoding a Ca2+/calmodulin-dependent protein kinase. Plant Physiol. 145, 1619–1628 (2007). doi:10.1104/pp.107.109876 Medline
33. Y. Jin, H. Liu, D. Luo, N. Yu, W. Dong, C. Wang, X. Zhang, H. Dai, J. Yang, E. Wang, DELLA proteins are common components of symbiotic rhizobial and mycorrhizal signalling pathways. Nat. Commun. 7, 12433 (2016). doi:10.1038/ncomms12433 Medline
34. G. Z. Wu, H. W. Xue, Arabidopsis β-ketoacyl-[acyl carrier protein] synthase I is crucial for fatty acid synthesis and plays a role in chloroplast division and embryo development. Plant Cell 22, 3726–3744 (2010). doi:10.1105/tpc.110.075564 Medline
35. Y. Li-Beisson, B. Shorrosh, F. Beisson, M. X. Andersson, V. Arondel, P. D. Bates, S. Baud, D. Bird, A. Debono, T. P. Durrett, R. B. Franke, I. A. Graham, K. Katayama, A. A. Kelly, T. Larson, J. E. Markham, M. Miquel, I. Molina, I. Nishida, O. Rowland, L. Samuels, K. M. Schmid, H. Wada, R. Welti, C. Xu, R. Zallot, J. Ohlrogge, Acyl-lipid metabolism. Arabidopsis Book 11, e0161 (2013). doi:10.1199/tab.0161 Medline
36. G. Wu, S. Liu, Y. Zhao, W. Wang, Z. Kong, D. Tang, ENHANCED DISEASE RESISTANCE4 associates with CLATHRIN HEAVY CHAIN2 and modulates plant
immunity by regulating relocation of EDR1 in Arabidopsis. Plant Cell 27, 857–873 (2015). doi:10.1105/tpc.114.134668 Medline
37. Y. Wang, M. T. Nishimura, T. Zhao, D. Tang, ATG2, an autophagy-related protein, negatively affects powdery mildew resistance and mildew-induced cell death in Arabidopsis. Plant J. 68, 74–87 (2011). doi:10.1111/j.1365-313X.2011.04669.x Medline
38. H. Vierheilig, A. P. Coughlan, U. Wyss, Y. Piche, Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl. Environ. Microbiol. 64, 5004–5007 (1998). Medline
39. M. Giovannetti, B. Mosse, An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots. New Phytol. 84, 489–500 (1980). doi:10.1111/j.1469-8137.1980.tb04556.x
40. C. A. Frye, R. W. Innes, An Arabidopsis mutant with enhanced resistance to powdery mildew. Plant Cell 10, 947–956 (1998). doi:10.1105/tpc.10.6.947 Medline
41. S. K. Gomez, H. Javot, P. Deewatthanawong, I. Torres-Jerez, Y. Tang, E. B. Blancaflor, M. K. Udvardi, M. J. Harrison, Medicago truncatula and Glomus intraradices gene expression in cortical cells harboring arbuscules in the arbuscular mycorrhizal symbiosis. BMC Plant Biol. 9, 10 (2009). doi:10.1186/1471-2229-9-10 Medline
42. T. Czechowski, M. Stitt, T. Altmann, M. K. Udvardi, W. R. Scheible, Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 139, 5–17 (2005). doi:10.1104/pp.105.063743 Medline
43. A. Boisson-Dernier, M. Chabaud, F. Garcia, G. Bécard, C. Rosenberg, D. G. Barker, Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations. Mol. Plant Microbe Interact. 14, 695–700 (2001). doi:10.1094/MPMI.2001.14.6.695 Medline
44. S. J. Clough, A. F. Bent, Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743 (1998). doi:10.1046/j.1365-313x.1998.00343.x Medline
45. F. Rook, N. Gerrits, A. Kortstee, M. van Kampen, M. Borrias, P. Weisbeek, S. Smeekens, Sucrose-specific signalling represses translation of the Arabidopsis ATB2 bZIP transcription factor gene. Plant J. 15, 253–263 (1998). doi:10.1046/j.1365-313X.1998.00205.x Medline
46. L. Liu, L. Zhang, W. Tang, Y. Gu, Q. Hua, S. Yang, W. Jiang, C. Yang, Phosphoketolase pathway for xylose catabolism in Clostridium acetobutylicum revealed by 13C metabolic flux analysis. J. Bacteriol. 194, 5413–5422 (2012). doi:10.1128/JB.00713-12 Medline
47. I. Molina, G. Bonaventure, J. Ohlrogge, M. Pollard, The lipid polyester composition of Arabidopsis thaliana and Brassica napus seeds. Phytochemistry 67, 2597–2610 (2006). doi:10.1016/j.phytochem.2006.09.011 Medline
48. J. Browse, P. J. McCourt, C. R. Somerville, Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue. Anal. Biochem. 152, 141–145 (1986). doi:10.1016/0003-2697(86)90132-6 Medline
49. T. Mairinger, M. Steiger, J. Nocon, D. Mattanovich, G. Koellensperger, S. Hann, Gas chromatography-quadrupole time-of-flight mass spectrometry-based determination of isotopologue and tandem mass isotopomer fractions of primary metabolites for 13C-metabolic flux analysis. Anal. Chem. 87, 11792–11802 (2015). doi:10.1021/acs.analchem.5b03173 Medline
50. J. Li, M. Hoene, X. Zhao, S. Chen, H. Wei, H.-U. Häring, X. Lin, Z. Zeng, C. Weigert, R. Lehmann, G. Xu, Stable isotope-assisted lipidomics combined with nontargeted isotopomer filtering, a tool to unravel the complex dynamics of lipid metabolism. Anal. Chem. 85, 4651–4657 (2013). doi:10.1021/ac400293y Medline
51. H. Blasco, P. Corcia, P.-F. Pradat, C. Bocca, P. H. Gordon, C. Veyrat-Durebex, S. Mavel, L. Nadal-Desbarats, C. Moreau, D. Devos, C. R. Andres, P. Emond, Metabolomics in cerebrospinal fluid of patients with amyotrophic lateral sclerosis: An untargeted approach via high-resolution mass spectrometry. J. Proteome Res. 12, 3746–3754 (2013). doi:10.1021/pr400376e Medline
52. E. Tisserant, M. Malbreil, A. Kuo, A. Kohler, A. Symeonidi, R. Balestrini, P. Charron, N. Duensing, N. Frei dit Frey, V. Gianinazzi-Pearson, L. B. Gilbert, Y. Handa, J. R. Herr, M. Hijri, R. Koul, M. Kawaguchi, F. Krajinski, P. J. Lammers, F. G. Masclaux, C. Murat, E. Morin, S. Ndikumana, M. Pagni, D. Petitpierre, N. Requena, P. Rosikiewicz, R. Riley, K. Saito, H. San Clemente, H. Shapiro, D. van Tuinen, G. Bécard, P. Bonfante, U. Paszkowski, Y. Y. Shachar-Hill, G. A. Tuskan, J. P. W. Young, I. R. Sanders, B. Henrissat, S. A. Rensing, I. V. Grigoriev, N. Corradi, C. Roux, F. Martin, Genome of an arbuscular mycorrhizal fungus provides insight into the oldest plant symbiosis. Proc. Natl. Acad. Sci. U.S.A. 110, 20117–20122 (2013). doi:10.1073/pnas.1313452110 Medline
53. E. Tisserant, A. Kohler, P. Dozolme-Seddas, R. Balestrini, K. Benabdellah, A. Colard, D. Croll, C. Da Silva, S. K. Gomez, R. Koul, N. Ferrol, V. Fiorilli, D. Formey, P. Franken, N. Helber, M. Hijri, L. Lanfranco, E. Lindquist, Y. Liu, M. Malbreil, E. Morin, J. Poulain, H. Shapiro, D. van Tuinen, A. Waschke, C. Azcón-Aguilar, G. Bécard, P. Bonfante, M. J. Harrison, H. Küster, P. Lammers, U. Paszkowski, N. Requena, S. A. Rensing, C. Roux, I. R. Sanders, Y. Shachar-Hill, G. Tuskan, J. P. W. Young, V. Gianinazzi-Pearson, F. Martin, The transcriptome of the arbuscular mycorrhizal fungus Glomus intraradices (DAOM 197198) reveals functional tradeoffs in an obligate symbiont. New Phytol. 193, 755–769 (2012). doi:10.1111/j.1469-8137.2011.03948.x Medline
54. H. Ogata, S. Goto, K. Sato, W. Fujibuchi, H. Bono, M. Kanehisa, KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 27, 29–34 (1999). doi:10.1093/nar/27.1.29 Medline
55. H. Javot, R. V. Penmetsa, N. Terzaghi, D. R. Cook, M. J. Harrison, A Medicago truncatula phosphate transporter indispensable for the arbuscular mycorrhizal symbiosis. Proc. Natl. Acad. Sci. U.S.A. 104, 1720–1725 (2007). doi:10.1073/pnas.0608136104 Medline
Top Related