www.sciencemag.org/cgi/content/full/science.aam9970/DC1

Supplementary Materials for Plants transfer lipids to sustain colonization by mutualistic mycorrhizal

and parasitic fungi Yina Jiang, Wanxiao Wang, Qiujin Xie, Na Liu, Lixia Liu, Dapeng Wang, Xiaowei

Zhang, Chen Yang, Xiaoya Chen, Dingzhong Tang, Ertao Wang*

*Corresponding author. Email: etwang@sibs.ac.cn

Published 8 June 2017 on Science First Release DOI: 10.1126/science.aam9970

This PDF file includes:

Materials and Methods Figs. S1 to S20 Tables S1 to S3 References

Materials and Methods

Medicago truncatula materials, growth conditions and mycorrhizal infections

The Rhizophagus irregularis (syn. Glomus intraradices) inoculum and M. truncatula

ram2, str, dmi3-1, ram1-2, and della-123 mutants used in this study have been

described previously (20, 21, 31-33). The M. truncatula Acyl-ACP thioesterases B

(FatM; Medtr1g109110) mutant fatm (NF7660) was obtained from the Samuel

Roberts Noble Foundation Tnt1 population

(http://medicago-mutant.noble.org/mutant/database.php). The wild-type background

for ram2, str, and dmi3-1 is Jemalong A17, and for ram1-2, della-123, and fatm is

R108. The genotype of Tnt1 mutant fatm was confirmed by performing PCR on

genomic DNA using the transposon-specific primer Tnt1-F2 together with

gene-specific primers fatm_F and fatm _R listed in Table S3.

M. truncatula seeds were scarified with H2SO4, surface sterilised using 10% (v/v)

bleach for 2-3 min and then germinated on 1% water agar plates. The seedlings were

germinated on water agar plates in room temperature overnight after incubation at 4ºC

in the dark for over 24 h. For routine mycorrhization experiments, seedlings were

transplanted into a mixture of perlite and sand (1:1 v/v) containing an inoculum of

~400 R. irregularis spores per plant. For ‘nurse plant’ experiments, wild-type and

ram2 seedlings were planted together in the same pot separated by a 125 μm nylon

mesh to segregate the two root systems but allow hyphae to spread between them.

Plants were grown in a controlled environment chamber set to a 16 h light /8 h dark

period at 22ºC (photon flux density = 250 μmol m2/s).

Arabidopsis thaliana materials, growth conditions and powdery mildew infections

The Columbia-0 strain (Col-0) of A. thaliana was used as the wild-type genetic

background in all experiments. The A. thaliana kas1 (SAIL_503_E03) and kar1

(SALK_011081) mutants used in this study have been described previously (34, 35).

The A. thaliana Acyl-ACP thioesterases B (FatB; At1g08510) mutants fatb-1

(SALK_020856) and fatb-2 (SALK_032338) were identified from the TAIR database

(http://www.arabidopsis.org/). The genotype of T-DNA mutants were confirmed by

performing PCR on genomic DNA using the transposon-specific primer LBb1.3/BP

together with gene-specific primers LP and RP. Primer sequences are listed in Table

S3. A. thaliana kas1 complementation kas1/KASI seeds were a kind gift of Dr. Xue as

described previously (34).

A. thaliana seeds were surface-sterilized and chilled at 4°C for 3 d, then sown on

plates containing half-strength Murashige and Skoog medium (MS). Seedlings were

transplanted into soil 10 d after germination. For powdery mildew infection, plants

were grown in a growth room with a 9-h-light/15-h-dark photoperiod, light intensity

of 7000 to 8000 lux, and relative humidity of 50-60% at 21-24°C as described

previously (36). For transformation and seed set, the plants were placed in a growth

room at 21-24°C with a long-day photoperiod (16-h-light/8-h-hdark cycle).

Four-week-old plants were inoculated with G. cichoracearum, and the number of

conidiophores per colony was counted at 5 dpi, as described previously (37).

Microscopy

Mycorrhizae-colonized M. truncatula roots were washed and treated with 10% KOH

for 6 minutes at 95ºC, followed by 3 minutes in ink-acetic acid-water (5/5/90, v/v/v)

as described by Vierheilig et al. (38). Root length colonization was quantified using

the grid line intersect method as described by Giovannetti and Mosse (39) and imaged

under an Olympus SZX7 light microscope. Mycorrhizae-colonized roots were also

stained by WGA-AlexaFluor 488 as followed: Harvested roots were placed in 50%

ethanol for more than 4 h and then transferred to 20% (w/v) KOH for 2-3 days,

followed by 0.1 M HCl for 1-2 h at room temperature. After HCl was removed, the

sample was rinsed twice with distilled H2O, and once with PBS buffer (8 g of NaCl,

0.2 g of KCl, 1.44 g of Na2HPO4, and 0.24 g of KH2PO4 dissolved in distilled H2O in

each 1L PBS buffer, pH=7.4), and then immersed in PBS/WGA-AlexaFluor 488

staining solution (0.2 μg/mL) in the dark for 6 hours. Root length colonization was

imaged under an Olympus FV1000 confocal microscope.

A. thaliana trypan blue staining was used to monitor fungal structures and dead plant

cells (40). The samples were observed and photographed with a ZEISS AX10

microscope.

Gene expression analysis

Total RNA was extracted from root tissues using Trizol reagent (Invitrogen) and

treated with DNase I. First-strand cDNAs were generated using the PrimeScript™ 1st

Strand cDNA Synthesis Kit (TaKaRa). Quantitative RT-PCR was performed with the

MyiQ™ real-time PCR detection systems (BIO-RAD) by using the 2×RealStar Green

Fast Mixture (GenStar). The relative expression value was normalized by using M.

truncatula Elongation factor 1 (MtEF-1) in M. truncatula (41) and PP2A (At1g59830)

in A. thaliana (42). Primer sequences for the Real-time PCR are listed in Table S3.

Plasmid construction

For overexpression analysis, the cDNA sequences of MtPK (XM_003592110, 1,731

bp), MtKAS II (XM_003608444, 1,413 bp), MtKAR (XM_003601772, 963 bp),

MtFatM (XM_013614657, 1,137 bp) were amplified by PCR and cloned into

pENTR/SD/D-Topo (Invitrogen). The medium-chain acyl–ACP thioesterase gene

UcFatB from Umbellularia californica (GenBank ID: Q41635.1) was codon

optimized and synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). Each

fragment was then transferred from the entry vectors into pK7WG2R by Gateway LR

reactions (Invitrogen).

A binary vector for STR and STR2 co-overexpression analysis, the cDNA sequences

of STR (XM_003631084, 2,454bp) and STR2 (XM_003612901, 2,184bp) were

amplified by PCR and cloned into pENTR/SD/D-Topo and pDNOR-p4p3

(Invitrogen), respectively. These two fragments were then transferred from the entry

vectors into pK7m34GW2-8m21GW3D (containing 835 bp 35S promoter, ROLD

promoter and GFP fluorescence marker) by Gateway LR reactions.

For RNAi analysis, the RNAi target sequences of MtPK (567 bp), MtKAS II (508 bp),

MtKAR (473 bp), and MtFatM (343bp) regions were amplified by PCR and cloned

into pENTR/SD/D-Topo. Each fragment was then transferred into pK7GWIWGIIR

by Gateway LR reactions.

For promoter-GUS analysis, 5’ flanking genomic sequence regions of MtFatM (1,293

bp), AtKASI (1,869 bp), AtKAR (708 bp), and AtFatB (1,793 bp) were amplified by

PCR and cloned into pENTR/SD/D-Topo. The fragments were then transferred from

the entry vectors into pBGWFS7 by Gateway LR reactions.

For M. truncatula complementation analysis, the 35S promoter of pK7WG2R was

removed by HindIII, SpeI digestion and filled-in by Klenow, resulting in

pK7WG2Rδ35S. A clone containing a 4.6-kb genomic fragment, including 1.9 kb of

the RAM2 promoter and 2.7 kb gDNA, and a clone containing a 3.7-kb genomic

fragment, including 1.3 kb of the MtFATM promoter and 2.4 kb gDNA, and another

clone containing a 5.1-kb genomic fragment, including 2 kb of the STR promoter and

3.1 kb gDNA, was respectively amplified by PCR and cloned into

pENTR/SD/D-Topo. The fragment was then transferred from the entry vectors into

pK7WG2Rδ35S by Gateway LR reactions.

A binary vector for complementation of ram2 (or str) and UcFatB overexpression

analysis was constructed as followed: The 35S promoter of pK7WG2R was removed

by HindIII, SpeI digestion and replaced by a 2.3-kb DNA fragment containing 835 bp

35S promoter, UcFatB cDNA region and 273 bp NOS terminator which was

amplified by one step overlap PCR (YEASEN), resulting in

35S-UcFatB-nos-pK7WG2R. A 4.6-kb genomic fragment of RAM2 (or a 5.1 kb

genomic fragment of STR), as described above, was then transferred from the entry

vectors into 35S-UcFatB-nos-pK7WG2R by Gateway LR reactions.

For A. thaliana complementation analysis, a clone containing a 3.2-kb genomic

fragment, including 0.7 kb of the AtKAR promoter and 2.5 kb gDNA, and a clone

containing a 3.7 kb genomic fragment, including 1.8 kb of the AtFatB promoter and

1.9 kb gDNA was each amplified by PCR and cloned into pENTR/SD/D-Topo. The

fragment was then transferred from the entry vectors into pGWB601 by Gateway LR

reactions.

Primer sequences for plasmid construction are listed in Table S3.

M. truncatula hairy root transformation

The constructs were individually transferred into the A. rhizogenes strain Arqua-1,

which were then used to form chimeric transgenic plants using the transformation

protocol described by Boisson-Dernier et al (43). 3-4 weeks later, untransformed roots

were removed based on root RFP fluorescence and composite plants transferred to

cultivate in the greenhouse in a mixture of perlite and sand (1:1) inoculated with R.

irregularis. The root systems of individual plants were analysed for AM colonization

and gene expression levels were analysed upon given time points.

A. thaliana plant transformation

The constructs were verified by sequencing and transferred into Agrobacterium

tumefaciens GV3101, then transformed into plants using the floral dip method (44).

Transgenic plants were selected on half strength MS medium containing 15 μg/mL

basta, or 50 μg/mL of kanamycin (Sigma-Aldrich). Transformants were transplanted

to soil 15 d after germination, and T3 transgenic homozygous plants were used for

phenotyping.

GUS histochemical staining

Positive transgenic lines harboring promoter-GUS reporter gene construct were

stained in a solution comprised 0.5 mM potassium ferricyanide, 0.5 mM potassium

ferrocyanide, 0.5 mg/mL 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid, 0.1%[v/v]

Triton X-100, and 0.1 M sodium phosphate buffer ( pH 7.0) at 37 ºC for 6 h (45). To

stop this process and to clear the leaves, the samples were washed with 75% ethanol.

GUS-staining patterns were observed and photographed with a Nikon SMZ1270

microscope.

13C-Labeling analysis

Ri T-DNA-transformed roots of carrot (Daucus carota L.) colonized by the AM

fungus R. irregularis were grown, labeled and harvested using the protocol described

by Pfeffer et al (4). Final concentrations of (1,3-13

C) glycerol or (2-13

C) glycerol

(Cambridge Isotope Laboratories, Inc. 13

C = 99%) were 10 mM. Tissues were then

incubated for 6 to 8 weeks before harvest and freeze-dried for extraction. Before

GC-MS analysis, tissues were immersed in 6M HCl at 105ºC for 30 min and the

supernatant was freeze-dried, then Pyridine (Sigma) and BSTFA

(N,O-bis(trimethylsilyl)-trifluoroacetamide) +1 % TMCS (Trimethylchlorosilane)

were added to the residue and derivatized at 70ºC for 1 h. Insoluble particles were

removed from GC-MS samples by centrifugation at 12,000g for 10 min and by

filtration through a 0.22 μm pore filter.

GC-MS analyses were performed on a 6890N Network GC System, fitted with a 5975

Mass Spectrometer Detector (GC-MSD; Agilent, Palo Alto, CA, USA) and equipped

with an HP-5MS capillary column (30 m x 0.25 mm; film thickness 0.25 μm)[5%

Phenyl Methyl Siloxane] was employed. Oven temperature was beginning of 2 min at

100ºC, increasing at 5ºC/min to 260ºC, then held at 260ºC for 10 min. Mass spectra

were measured in the EI scan mode (70 eV) in the m/z (Amu) range of 40-600. Peak

identities were confirmed by the standard solution (ANPEL, Shanghai, China) and

National Institute of Standards and Technology libraries (NIST 14).

The GC-MS data were analysed as described by Liu et al (46). Briefly, a mass

isotopomer distribution vector (MDV) of each fragment of glucose, fatty acids, and

glycerin was determined from the respective mass spectra. The MDV was corrected

according to the natural abundance of all stable isotopes, including 13

C, 29

Si, 30

Si, and

18O. The MDV can be determined for each metabolite fragment containing specific

combinations of carbon atoms of the considered metabolite. For example, an MDV

was determined for each of the major three 6-glucose fragments (Fig. S1A), including

the C1-Glu fragment containing all C-1 carbon atoms, the C2-3-Glu fragment

containing C-2 and C-3 atoms, and the C1-3/4-6-Glu fragment containing C-1 to C-3 (or

C-4 to C-6) atoms. The summed fractional labeling (SFL) of a metabolite fragment

was calculated from the MDV according to SFL=

, in which n represents

the number of carbon atoms in the fragment and mi represents the relative abundance

of different mass isotopomers.

Cutin monomer analysis, FAME extraction and GC-QTOF-MS analysis

For cutin monomer extraction, M. truncatula A17 and str 4-week-seedlings leaves and

roots which grown in sand/perlite (1:1) were harvested and were prepared using the

modified method of Molina et al (47). Briefly, the plant tissue was immersed in

boiling isopropanol and heated for 10 min at 80-85ºC, then shaken gently for ~4 h at

room temperature. The solution was removed and another 5 ml of isopropanol was

added, and shaken again overnight. After remove of isopropanol, the tissue was

re-extracted with CHCl3: MeOH (2:1 v/v) at room temperature by shaking for

approximately 8 h. This step was repeated and shaken overnight. The sample was

extracted successively with MeOH (30 min), H2O (30 min), 2 M NaCl (1 h), H2O (30

min), MeOH (30 min), CHCl3: MeOH (1:2 v/v) (overnight) and CHCl3: MeOH (1:2

v/v) (overnight). All extraction steps were performed in a shaker (80 rpm) at room

temperature. Transmethylation was processed as followed: The residue left after the

extraction with CHCl3: MeOH (1:2 v/v), was washed with methanol and as much of

the supernatant was removed as possible. Then add 1 ml of fresh 5 % (v/v) H2SO4 in

MeOH, 0.5 ml of toluene and 30 μl of standard solution containing 1 mg/ml methyl

nonadecanoate in MeOH. Seal lid, vortex and heat at 80 ºC for 3 h (or more) with

occasional mixing. After cooling, add 2.5 ml of CH2Cl2 (dichlormethane) and 0.75 ml

of 0.9% KCl. Seal lid, vortex and centrifuge of 5-10 min at ~800 g. Remove lower

phase with a glass pipette (avoiding any of the upper) and put in a 2 ml glass vial.

Derivitization was processed as followed: Dry down this organic phase under nitrogen

gas, then re-suspend the fatty acid methyl esters (FAMES) by adding 50 μl of pyridine

and 50 μl of BSTFA+1 % TMCS. Seal lid, vortex and heat at 70 ºC for 1 h. Dry down

the FAMES again under nitrogen gas and resuspend in 100 μl of pyridine before run

on GC-QTOF-MS.

Fatty Acid Methyl Esters (FAMES) were prepared using the modified method of

Browse et al (48) and the acidic catalysts transesterify both free fatty acids and those

bound to triglycerides and phospholipids in plant materials. Briefly, samples were

fully ground in liquid nitrogen, and then transferred into 8ml screw-capped glass

tubes. After addition of 1 mL fresh 5% H2SO4 (v/v in methanol) reagent, the tubes

were heated to 80°C for 1 h. When the samples cooled, 30 μl of methyl

nonadecanoate (1 mg/ml in MeOH), 0.3 mL of hexane and 1 mL of 0.9% NaCl were

added and the FAMES extracted into the hexane by vigorous shaking. After

centrifugation, the sample was taken directly from the hexane phase and was used for

GC-QTOF-MS analysis. When we calculated mole% of fatty acids, we define the sum

of most abundant fatty acids from C12:0 to C18:2 FA (C12:0, C16:0, C16:1, C18:0,

C18:1, C18:2, C18:2 FA) content as 100%.

For the analysis of the cutin monomers and FAME, an Agilent 7200 GC-QTOF-MS

(Agilent, SantaClara, USA) was used (49). GC was performed on a HP-5MS column

(Agilent, 30 m×0.25 mm i.d., 0.25 μm film thickness, 5% phenyl methyl siloxane

stationary phase). GC injection was performed in pulsed split mode (split rate 5:1,

purge flow to split vent 5mL/min). The following GC temperature gradient was used:

100°C for 2 min, 5°C/min to 190°C, 2°C/min to 230°C and hold at 230°C for 5 min,

10°C/min to 260°C. The QTOF Mass spectra were recorded at five scans per second

with a mass-to-charge ratio 40-600 m/z mass acquisition range. Electron energy was

kept at 70 eV, and the QTOF-MS was operated in 2 GHz-EDR mode in order to

extend the linear dynamic range.

Data acquisition and evaluation were carried out with MassHunter Acquisition and

MassHunter Quantitative and Qualitative Analysis (version B07, Agilent Technologies,

CA, USA), respectively. The cutin monomers and FAMES were identified by

comparing their mass spectra with those in the standard solution (ANPEL, Shanghai,

China) and the National Institute of Standards and Technology library (NIST 14).

TAGs extraction and molecular species analysis (LC-HRMS)

Triacylglycerols (TAGs) were prepared using the modified method of Li et al (50).

Samples were homogenised in liquid nitrogen and then transferred into 8 ml

screw-capped glass tubes. After addition of 5 ml of pre-cooled

chloroform-methanol-formic acid (10/10/1, v/v/v), the samples were mixed with a

vortex, then placed in the -20°C overnight. After addition of 2.2 ml of Hajra’s (0.2 M

H3PO4, 1 M KCl) reagent, the TAGs were extracted by vigorous shaking. The tubes

were centrifuged (1000 g for 5 min) and the lower phase was collected and

concentrated under N2, and then redissolved in 0.1 ml acetonitrile-isopropanol-water

(65/35/5, v/v/v) for liquid chromatography-high resolution mass spectrometry

(LC-HRMS) analysis. HRMS data was obtained from a Q-Exactive Orbitrap mass

spectrometer (Thermo Fisher Scientific, Bremen, Germany) coupled to an Acquity

Ultra Performance LC system (Waters, Texas, USA) (51). An Acquity UPLC BEH

C18 column (2.1×50 mm, 1.7 μm) was utilized at 55°C. Acetonitrile-water (60/40, v/v,

10 mM ammonium formate) and isopropanol-acetonitrile (90/10, v/v) were used as

mobile phases A and B, respectively. The elution was performed with a 14 min

gradient with 50% B at the beginning. 50% B was firstly maintained for 1 min, and

then linearly increased from 50% B to 95% B in 7 min. After washing the column for

2 min with 95% B, the buffer was decreased to 50% B immediately and the column

was reconditioned with initial gradient for 4 min. The MS was operated with HESI

ion source in positive mode. The MS scan mode of parallel reaction monitoring (PRM)

was used to realize the verification and quantification of TAGs. The PRM scan used

the following settings: MS2 resolution, 17,500; AGC target, 2e5; max IT, 60 ms;

isolation window, 1.5 m/z; normalised HCD collision energy, 20 eV. The precursor

ions and the product ions used for quantification of the target TAGs (with C16:1

and/or C12:0) were as follows: TAG(C44:2), 764.6763/493.4251/547.4721;

TAG(C48:3), 818.7232/547.4721; TAG(C48:2), 820.7389/549.4877; TAG(C48:1),

822.7545/551.5034; TAG(C50:4), 844.7388/573.4877; TAG(C50:3),

846.7545/575.5034; TAG(C50:2), 848.7702/577.5190; TAG(C50:1),

850.7859/579.5348. When we calculated mole% of TAG, we define the content of

total TAGs (C44:2, C48:3, C48:2, C48:1, C50:4, C50:3, C50:2, C50:1) as 100%.

C44:2 TAG was collected by LC-HRMS, transesterified and run on GC-QTOF-MS,

which showed that C16:1 is most likely C16:1ω5 according to fatty acids of AM

fungus, the standard solution (ANPEL, Shanghai, China) and the National Institute of

Standards and Technology library (NIST 14). C16:1ω5 was further confirmed to be a

mycorrhizal specific component and not present in plant tissue. The identification of

C16:1ω5 was shown as Fig. S20.

R. irregularis sequence data analysis

AM fungus R. irregularis (syn. G. intraradices) ‘high-confidence’ gene models for

genome and transcriptome sequencing data were downloaded (9, 52, 53). All

predicted gene models were functionally annotated and were aligned against the

KEGG database (Kyoto Encyclopedia of Genes and Genomes) (54). KEGG hits were

used to map EC numbers map GO (Gene Ontology) terms.

Supplement figures and tables

Fig. S1. Analysis of metabolism and transport in carrot roots colonization by R.

irregularis. (A) Sketch map of carbon positions in isotope labeling used in this study.

(B-C) Experimental schematic map for (1,3-13

C)glycerol labeling extraradical

mycelium (ERM) (B) and mycorrhized roots (IRM/R) (C). (D-E) Isotope tracer

showed ratios of 13

C2 labeled in C2-3 glucose (C2-3-Glu), C1-2/2-3 glycerol (C1-2/2-3-Gly)

and C2 unit of C16:0 fatty acid (16-FA) when (2-13

C)glycerol supplied to ERM (D)

and IRM/R (E). Values are the mean +/-SE of measurements from three independent

plates. The ratios are determined by GC-MS. **P < 0.01 (Student’s t-test).

Fig. S2. M. truncatula fatty acid biosynthesis genes are required for arbuscule

formation. (A) Time course of relative expression of fatty acid biosynthesis genes

(MtPK, MtKAS II, MtKAR, MtENR I, and MtFatM) at 14, 21, 28, 35 and 42 days post

inoculation with R. irregularis (dpi). (B) The AM colonization levels of plants which

were used for real-time PCR in (A). RLC, root length colonization. (C) Relative gene

expression levels in overexpression of MtPK, MtKAS II, MtKAR, and MtFatM plant

roots at 42 dpi. (D) Relative gene expression levels in MtPK, MtKAS II, and MtFatM

RNAi plant roots at 42 dpi. (MtKAR RNAi plants failed to generate lateral hairy roots

in two repeated experiments). MtKAS II RNAi was associated with weak mycorrhizal

phenotypes, which may be due to genetic redundancy arising from the two other

copies of MtKAS II in the M. truncatula genome (Table S2). These experiments were

repeated three times with similar results. Values are the mean +/- SE of measurements

performed on 8-12 plants. Error bars are standard error. **P < 0.01; ns, not

significantly (Student’s t- test).

Fig. S3. M. truncatula fatty acid biosynthesis gene FatM was required for

arbuscule formation. (A) Root length colonization (RLC) and of wild-type (R108),

fatm, ram2 and fatm/FatM (fatm complemented plants) at 42 dpi. (B) Images of

WGA-AF488 stained arbuscules of wild-type (R108), fatm, and fatm/FatM at 42 dpi.

Left, center, and right panels show confocal laser scanning microscopy images

(WGA-AF488), bright-field images (BF), and an overlay, respectively. The

fluorescent green signal arises from WGA-Alexafluor 488 staining of the fungal cell

wall. (C) Bright field images and (D) corresponding fluorescence microscopy images

of roots colonized with R. irregularis reveal GUS expression in cortical arbuscular

cells. Values are the mean +/- SE of measurements performed on 8-12 plants.

arbuscule (a). Roots were GUS stained for 6 h. Scale bar, 50 μm.

Fig. S4. The plant-derived lauric acid can be transferred to the AM fungus. (A)

Cartoon of the culture system used for lipid analysis experiments in Fig. 1E and fig.

S4C, D. A 125 μm nylon mesh was used to segregate the root systems but allow

hyphae to spread between them. (B) Root length colonization (RLC) in UcFatB

overexpression and EV roots at 42 dpi. (C) Lauric acid content of UcFatB

overexpression and EV roots at 42 dpi. (D) Fungal TAG (C44:2, C16:1-C16:1-C12:0)

content in IRM/R of UcFatB overexpression and EV roots at 42 dpi. This lipid

species contains two molecules of the fungal marker fatty acid C16:1 and one of

C12:0. These experiments were repeated three times with similar results. Values are

the mean +/- SE of measurements performed on 8-12 plants. *P < 0.01; ns, not

significantly different (Student’s t-test).

Fig. S5. Mycorrhization of ram2 relies on the presence of a nurse plant. (A)

Arbuscule size distribution of ram2 and WT plants grown with a ram2 or WT nurse

plant at 42 dpi. (B) Expression level of PHOSPHATE TRANSPORTER4 (MtPT4) in

WT and ram2 grown as a monoculture or with a WT nurse plant at 42 dpi. PT4 is

expressed specifically in root cortical cells that harbor arbuscules, where it plays an

essential role in phosphate uptake (55). These experiments were repeated three times

with similar results.

Fig. S6. RAM2 is required for plant-derived lauric acid transfer from plant to

AM fungi. (A) Cartoon of the experimental design used to obtain ram2 root

mycorrhization with R.irregularis in the presence of a WT nurse plant in Fig. 2. (B)

Root length colonization (RLC) of WT-EV, WT-UcFatB, ram2-EV and ram2-UcFatB

roots at 42 dpi. (C) Quantity of the fungal TAG (C44:2) in mycorrhizal WT-EV,

WT-UcFatB, ram2-EV and ram2-UcFatB roots at 42 dpi. ram2 plants grew in the

presence of a WT nurse plant. WT plants grew as a monoculture. (D) Lauric acid

(C12:0 FA) content in WT-EV, WT-UcFatB, ram2/RAM2-EV and

ram2/RAM2-UcFatB hairy roots without R. irregularis infection. ram2 was

complemented by RAM2 gene driven by the RAM2 promoter. (E) Root length

colonization (RLC) in WT-EV, WT-UcFatB, ram2/RAM2-EV and

ram2/RAM2-UcFatB roots at 42 dpi. (F) Quantity of the fungal TAG (C44:2) in

mycorrhizal WT-EV, WT-UcFatB, ram2/RAM2-EV and ram2/RAM2-UcFatB roots at

42 dpi. Values are the mean +/- SE of measurements performed on 8-12 plants. *P <

0.01; ns, not significantly different (Student’s t-test).

Fig. S7. Relative gene expression levels of STR and STR2 in EV and transgenic

STR-STR2 plant hairy roots used in Fig. 3A and 3B. The relative expression was

normalized by using MtEF-1. These experiments were repeated three times with

similar results. Error bars are standard error.

Fig. S8. Cutin analyzes. (A) Relative gene expression levels and (B) Cutin analyzes

of total load in Arabidopsis wild-type (Col-0), empty vector (T3-EV), and STR-STR2

co-overexpression transgenitic T3 line (T3-6, T3-7, T3-36) leaves. The relative

expression was normalized by using PP2A. The data were obtained from three

biological replicates and are presented as means +/- SE. (B) Each value is the mean

SE of measurements performed on 15-20 plants. FW, fresh weight. *P < 0.01; ns, not

significantly different (Student’s t-test).

Fig. S9. Cutin analyses of A17 (WT) and str. Cutin total load (A, C) and monomer

load (B, D) were analyzed from WT and str 4-week-seedlings leaves (A, B) and roots

(C, D) grown in sand/perlite (1:1). These experiments were repeated three times with

similar results. Values are the mean +/- SE of measurements performed on 8-12 plants.

ns, not significantly different from WT (P>0.05, Student’s t-test).

Fig. S10. Mycorrhization of str relies on the presence of a nurse plant. (A)

Quantification of R. irregularis colonization in str and wild-type (WT) grown with a

str or WT nurse plant at 42 dpi. The “tester” labeled by red color, grown with “nurse”

plants. (B) Images of WGA-AF488 stained arbuscules of wild-type (WT), str and str

grown with a nurse (str/WT) at 42 dpi. Up and down panels show confocal laser

scanning microscopy images, and an overlay with light-field images, respectively. The

fluorescent green signal arises from WGA-Alexafluor 488 staining of the fungal cell

wall. Scale bar, 30 μm. (C) Expression level of MtPT4 in WT and str grown as a

monoculture or with a nurse WT plant at 42 dpi. These experiments were repeated

three times with similar results. Values are the mean +/-SE of measurements from

three independent plates and 8-12 plants of each genotype were analyzed. *P < 0.01;

ns not significantly different from WT (P>0.05, Student’s t-test).

Fig. S11. STR mediates plant-derived fatty acids transfer from plant to AM

fungus. (A) Cartoon of the experimental design used to obtain str root mycorrhization

with R.irregularis in the presence of a WT nurse plant in Fig. 3D. (B) Root length

colonization (RLC) of WT-EV, WT-UcFatB, str-EV and str-UcFatB hairy roots at 42

dpi. (C) Quantity of the fungal TAG (C44:2) in mycorrhizal WT-EV, WT-UcFatB,

str-EV and str-UcFatB roots at 42 dpi. str plants grew in the presence of a WT nurse

plant. WT plants grew as a monoculture. (D) Lauric acid (C12:0 FA) content in

WT-EV, WT-UcFatB, str/STR-EV and str/STR-UcFatB hairy roots without R.

irregularis infection. str was complemented by STR gene driven by the STR promoter.

(E) Root length colonization in WT-EV, str/STR-EV, WT-UcFatB and

str/STR-UcFatB at 42 dpi. (F) Quantity of the fungal TAG (C44:2) in mycorrhizal

WT-EV, WT-UcFatB, str/STR-EV and str/STR-UcFatB roots at 42 dpi. These

experiments were repeated three times with similar results. Values are the mean +/-SE

of measurements from three independent plates and 8-12 plants of each genotype

were analyzed. *P < 0.05; **P < 0.01; ns, not significantly different (Student’s t-test).

Fig. S12. Expression patterns of Arabidopsis KASI, KAR and FatB during

powdery mildew infections. (A) The expression of AtKASI, AtKAR and AtFatB after

6 h, 12 h, 18 h, 24 h, 2 d, 3 d, 4 d, and 5 d of powdery mildew (Erysiphe orontii)

infection according to microarray data in the Arabidopsis Information Resource

(TAIR). Relative expression was normalized with mock control. (B) Promoter:

reporter gene (GUS) studies reveal the expression of AtKASI, AtKAR and AtFatB at 8

dpi with/without G. cichoracearum infection (+/-). Leaves were GUS stained for 6 h.

Fig. S13. UcFatB overexpression in Arabidopsis. (A) Relative gene expression

levels of UcFatB in the rosette leaves (21-day old plant) of WT, EV and UcFatB

overexpression lines (three independent lines 16, 20, and 22). The relative expression

was normalized by using PP2A. The data were obtained from three biological

replicates and are presented as means +/- SE. (B) Quantitative analysis of

conidiophore formation per colony on 4-week-old wild-type (WT), empty vector (EV)

and transgenic UcFatB lines at 5 dpi. The bars represent means and SE from one

experiment (n = 30). The experiment was repeated twice with similar results. *P <

0.01; ns, not significantly different from WT (P>0.05, Student’s t-test).

Fig. S14. Identification of fatty acid biosynthesis gene mutants in Arabidopsis. (A)

Schematic representation of Arabidopsis fatty acid biosynthesis gene AtKASI, AtKAR,

and AtFatB. T-DNA insertion sites are indicated by triangles. Black boxes, lines, and

white boxes indicate the exons, introns, and 5’/3’-UTR regions, respectively. (B)

qRT-PCR analysis on fatty acid biosynthesis gene expression levels in the rosette

leaves (21 DAG) of wild-type and mutants, respectively. The relative expression is

calculated by comparison with that of the wild type (set as 1.0). The data were from

three biological replicates and are presented as means +/- SE. (C) Four-week-old

wild-type (Col-0), kas1 (SAIL_503_E03), kar1 (SALK_011081), fatb-1

(SALK_020856), and fatb-2 (SALK_032338) plants were inoculated with G.

cichoracearum. The photographs were taken at 8 dpi. Scale bar, 1 cm. (D) The

photographs were taken for representative leaves showed in (C) at 8 dpi. Scale bar,

0.2 cm.

Fig. S15. Complementation test. KASI, KAR and FatB complement disease

phenotype to G. cichoracearum in kas1, kar and fatb-1 mutants. Trypan blue

staining of the four-week-old Col-0, kas1/KASI, kar/KAR, and fatb/FatB (candidate

genes were driven by its own promoter) leaves inoculated at 8 dpi shown to visualize

fungal structures and plant cell death. Scale bar, 50 μm.

Fig. S16. A new model shows that host plants synthesize fatty acid and transfer

to AM fungus by STR/STR2 transporter. 2-MAG, 2-monoacylglycerols.

Fig. S17. Distribution of enzymes involved in the fatty acid degradation pathway

(map 00071) of R. irregularis fungi genome and transcriptome sequencing data

analysed by KEGG.

Fig. S18. Distribution of enzymes involved in the fatty acid elongation pathway

(map 00062, n>16) of R. irregularis fungi genome and transcriptome sequencing

data analysed by KEGG.

Fig. S19. The expression of fatty acid synthesis genes were down regulated in the

M. truncatula symbiotic signalling pathway gene mutants. (A) Relative expression

of M. truncatula lipid biosynthesis genes (PK, KAS II, KAR, and FatM), RAM2, STR,

STR2, PT4 in R108, ram1-2 and della-123 at 42 dpi. (B) Relative expression of M.

truncatula lipid biosynthesis genes (PK, KAS II, KAR, and FatM), RAM2, STR, STR2,

PT4 in A17, dmi3-1and str at 42 dpi. These experiments were repeated three times

with similar results. Error bars are standard error.

Fig. S20. GC-QTOF-MS analysis of C16:1. (A) Gas chromatography results of fatty

acid methyl esters (FAMES) from AM fungi, M. truncatula mycorrhizal roots, and

non mycorrhizal roots. (B) Mass spectra of C16:1 FAME from AM fungi, and

mycorrhizal roots. (C) Mass spectra information of C16:1ω5 (11-Hexadecenoic acid,

methyl ester) in National Institute of Standards and Technology library (NIST 14).

Mass spectra of C16:1 from AM fungi and mycorrhizal roots was matched with mass

spectra of C16:1ω5 (11-Hexadecenoic acid), when the mass spectra was searched

against NIST 14. Note that C16:1ω5 is only present in mycorrhizal colonized roots

and AM fungi, but not in plant root without mycorrhizal infection.

Table S1. M. truncatula lipid biosynthetic enzyme coding genes information in MtGEA.

Gene

name

No GO term Medicago GeneChip

ID

Expression levels Description Blast2n

vs Mt genome 4.0

CDS

Root Myc (R.

irregularis) 6wk

Root Myc (F.

mosseae) 6wk

Root non-Myc

(control) 6wk

MtPK Plastidic pyruvate kinase beta

subunit 1

Mtr.38606.1.S1_at 2512.36 2276.85 914.615 Medtr1g099360.1

MtMCAT Malonyl CoA-ACP

transacylase

Mtr.37706.1.S1_at 3314.71 2450.16 1214.45 Medtr3g031380.1

MtKAS II Ketoacyl-ACP synthase II Mtr.20497.1.S1_s_at 1561.89 1007.67 438.349 Medtr4g096690.1

Mtr.12585.1.S1_at 1156.58 950.305 545.184 Medtr1g103020.1

MtKAR Ketoacyl-ACP reductase Msa.958.1.S1_at 3279.42 2413.29 1099.32 Medtr3g085740.1

MtENR I Enoyl-ACP reductase I Mtr.43890.1.S1_at 2497.44 2036.28 703.586 Medtr4g074950.1

MtHAD Hydroxyacyl-ACP dehydrase Mtr.41225.1.S1_at 1969.59 1423.25 810.025 Medtr2g008620.1

MtFatM Acyl-ACP thioesterases B Mtr.35910.1.S1_at 839.211 530.99 8.19741 Medtr1g109110.1

RAM 2 Glycerol-3-phosphate

acyltransferase

Mtr.11226.1.S1_a/

Mtr.36944.1.S1_at

1472.96

4314.89

634.044

2828.87

11.7647

79.2391

Medtr1g040500.1

Table S2. Fatty acid biosynthesis genes are induced by Ustilago maydis

Accession

No.

Description Probe Set Mean Expression Value

4 dpi 8 dpi

Non-

infected Infected

Non-

infected Infected

CF013098 Enoyl-ACP reductase Zm.4508.1.A1_at 60.2 227.27 74.93 242.67

CD441565 Enoyl-ACP reductase Zm.2736.1.S1_at 291.6 792.67 187.93 829.1

CF635461 Hydroxyacyl-ACP dehydrase Zm.11729.1.A1_at 90.07 413.13 64.93 446.87

AW066696 Myristoyl -ACP thioesterases Zm.1069.1.A1_at 184.17 657.1 171.37 663.33

CD568857 Myristoyl -ACP thioesterases Zm.4074.1.S1_at NO NO 19.6 135.43

Table S3. Primer sequences

Gene name Primer sequences

qRT-PCR Primers

MtPK forward 5’-CACCAAGGGTCCTGAGGTTA-3’

reverse 5’-ACTTCGCATTTCACGGAATC-3’

MtKASII forward 5’-GGGATAAAGACCGTGATGGAT-3’

reverse 5’-ACACACCGGCATCTACAAGAC-3’

MtKAR forward 5’-TCCAAGGAGATTGAGGCACT-3’

reverse 5’-CCTCCTGCCACTGAGACTTC-3’

MtENRI forward 5’-GTATTACCTGATGGTTCGTTAATGG-3’

reverse 5’-AAGAGAGTGGACAAGGATGTCTATG-3’

MtFatM forward 5’-TTGAGCAAAGGCCAATAAGGT-3’

reverse 5’-CTATGTAGAAAATGGACATGTAGTGA-3’

RAM2 forward 5’-TTGGTGATGAAAAGCCTGAT-3’

reverse 5’-AAGATTATGGGTTTTGGAAGTTTG-3’

STR forward 5’-TTCCAATGATGCAGTCCCA-3’

reverse 5’-TGGTTATGACTGCAAATGTGAG-3’

STR2 forward 5’-GCAAGTGGGAGTCTTAAAGGA-3’

reverse 5’-GCCCTAATCTGAAATCAGCAG-3’

MtPT4 forward 5’-GACACGAGGCGCTTTCATAGCAGC-3’

reverse 5’-GTCATCGCAGCTGGAACAGCACCG-3’

MtEF-1 forward 5’-CTTTGCTTGGTGCTGTTTAGATGG-3’

reverse 5’-ATTCCAAAGGCGGCTGCATA-3’

AtKASI forward 5’-TCGCAAAACACACATCACACAC-3’

reverse 5’-GTGATTGACGATTTGATGGTAAG-3’

AtKAR forward 5’-GTCAGTTCTATTCGTGAAATCG-3’

reverse 5’-TAAAGATCGACCCAGTGGAGA-3’

AtFatB forward 5’-AATCATGTTAAGACTGCTGGATTGC-3’

reverse 5’-ATACCATTCTTTCCAGACTGACTGA-3’

AtPP2A forward 5’-GTCCTGGCGTGTGCGTTATATG-3’

reverse 5’-GGCACCAGATCCGTCCTAGTTG-3’

cDNA primers

MtPK forward 5’-ATGTCTCAGGTTCGATCCATTCAAAC-3’

reverse 5’-TTAATTTGTGGCAGCTACTGTTCGG-3’

MtKASII forward 5’-ATGCAATCACTTCAGCATCAACTAC-3’

reverse 5’-TCAGGGTCTGAAAGCGGAAAAAGCC-3’

MtKAR forward 5’-ATGGCTTCTCTTACCGGATCC-3’

reverse 5’-TTACATCACCATACCTCCATCAATG-3’

MtFatM forward 5’-ATGGCTGTTACTAATTTTACATGTTCA-3’

reverse 5’-CTATGTAGAAAATGGACATGTAGTGA-3’

STR forward 5’-ATGGCAAGGCTCGAGAGGGATG-3’

reverse 5’-TCATTTTCTTTCATTTTTGGAG-3’

STR2 forward 5’-ATGAAAACACAAGGTCTTGAAC-3’

reverse 5’-CTAGGACCTTTGATTTTTTGATG-3’

UcFatB forward 5’- ATGGCAACTACCTCATTGGCAT-3’

reverse 5’- TTAAACCCTTGGTTCAGCAGGA -3’

RNAi primers

MtPK forward 5’-CACCAAGGGTCCTGAGGTTA-3’

reverse 5’-AAAAGCGGAACCTCCTCAAT-3’

MtKASII forward 5’-ACATCGACGGGAAGAATGAC-3’

reverse 5’-TCACGGTCTTTATCCCAAGG-3’

MtKAR forward 5’-GATTGTTACCGGAGCTTCCA-3’

reverse 5’-TCAGGCCAATTACTCCTGCT-3’

MtFatM forward 5’-TTGGTTGATCCTCATCGTCA-3’

reverse 5’-TCATCACCCATGTGCTTGTT-3’

Complementation primers

MtRAM2 forward 5’-ATTGCCGGTGGGATAAACAC-3’

reverse 5’-TTAGCAACCCATTACTTTGTTG-3’

MtFatM forward 5’-AGACCACAACTGTTTGCTGCCTC-3’

reverse 5’-CTATGTAGAAAATGGACATGTAGT-3’

STR forward 5’-CTTTGATTTATATCCCCGTAGTGG-3’

reverse 5’-TCATTTTCTTTCATTTTTGGAG-3’

AtKAR forward 5’- GATTGAGGAACCAGGCACAT -3’

reverse 5’-CTAGATAGCAATACCTCCATCAA-3’

AtFatB forward 5’- CCATGAACCTGGTCCTCAAT -3’

reverse 5’-TTACGGTGCAGTTCCCCAAGTTG-3’

Promotor primers

MtFatM forward 5’-AGACCACAACTGTTTGCTGCCTC-3’

reverse 5’-TGTTCTGTTCCTTTTTTTATTTTTTCA-3’

AtKASI forward 5’-AAAACTCGGGTGGTGAACAA-3’

reverse 5’-GGTGGATCCAGAAATTGAGAGA-3’

AtKAR forward 5’-GATTGAGGAACCAGGCACAT-3’

reverse 5’-GGCGAATCTGTTGTTAAAGTGA-3’

AtFatB forward 5’-CCATGAACCTGGTCCTCAAT-3’

reverse 5’-GACGAGGAGATGAAGCGTTCAA-3’

Tnt 1 mutant primers

Tnt1-F2 5’-TCTTGTTAATTACCGTATCTCGGTGCTACA-3’

fatm_F forward 5’-ATGATTTTGTGTCACTGTCC-3’

fatm_R reverse 5’-CTATGTAGAAAATGGACAT-3’

T-DNA mutant primers

LBb1.3/BP 5’-ATTTTGCCGATTTCGGAAC-3’

kas1-LP forward 5’-AAACAATTGGGACAAAATGTTG-3’

kas1-RP reverse 5’-TCTGACCACCGAATCGAGTAG-3’

kar1-LP forward 5’-GCAAATTGAATGCTCGAAGAG-3’

kar1-RP reverse 5’-GCGATAGTGAAAGAGGTGACG-3’

fatb1-LP forward 5’-CGTGCTTGTTTAGCTGGAAAC-3’

fatb1-RP reverse 5’-TTTTTGGTCTCATGGGTTAGC-3’

fatb2-LP forward 5’-CTAGAATTTCCAATCACGGGG-3’

fatb2-RP reverse 5’-AAACACCAACAACAACTTGGG-3’

Other primers

35S-promotor forward 5’-AGATTAGCCTTTTCAATTTCAG-3’

reverse 5’-CGTGTTCTCTCCAAATGAAATG-3’

NOS-terminator forward 5’-GAGCTCGAATTTCCCCGATC-3’

reverse 5’-CCCGATCTAGTAACATAGAT-3’

References and Notes 1. S. Smith, D. Read, Mycorrhizal Symbiosis (Academic Press, 2008).

2. P. Bonfante, A. Genre, Mechanisms underlying beneficial plant-fungus interactions in mycorrhizal symbiosis. Nat. Commun. 1, 48 (2010). doi:10.1038/ncomms1046 Medline

3. S. E. Smith, F. A. Smith, Roles of arbuscular mycorrhizas in plant nutrition and growth: New paradigms from cellular to ecosystem scales. Annu. Rev. Plant Biol. 62, 227–250 (2011). doi:10.1146/annurev-arplant-042110-103846 Medline

4. P. E. Pfeffer, D. D. Douds Jr., G. Becard, Y. Shachar-Hill, Carbon uptake and the metabolism and transport of lipids in an arbuscular mycorrhiza. Plant Physiol. 120, 587–598 (1999). doi:10.1104/pp.120.2.587 Medline

5. B. Bago, P. E. Pfeffer, Y. Shachar-Hill, Carbon metabolism and transport in arbuscular mycorrhizas. Plant Physiol. 124, 949–958 (2000). doi:10.1104/pp.124.3.949 Medline

6. M. Trépanier, G. Bécard, P. Moutoglis, C. Willemot, S. Gagné, T. J. Avis, J.-A. Rioux, Dependence of arbuscular-mycorrhizal fungi on their plant host for palmitic acid synthesis. Appl. Environ. Microbiol. 71, 5341–5347 (2005). doi:10.1128/AEM.71.9.5341-5347.2005 Medline

7. B. Bago, W. Zipfel, R. M. Williams, J. Jun, R. Arreola, P. J. Lammers, P. E. Pfeffer, Y. Shachar-Hill, Translocation and utilization of fungal storage lipid in the arbuscular mycorrhizal symbiosis. Plant Physiol. 128, 108–124 (2002). doi:10.1104/pp.010466 Medline

8. O. Tehlivets, K. Scheuringer, S. D. Kohlwein, Fatty acid synthesis and elongation in yeast. Biochim. Biophys. Acta 1771, 255–270 (2007). doi:10.1016/j.bbalip.2006.07.004 Medline

9. K. Lin, E. Limpens, Z. Zhang, S. Ivanov, D. G. O. Saunders, D. Mu, E. Pang, H. Cao, H. Cha, T. Lin, Q. Zhou, Y. Shang, Y. Li, T. Sharma, R. van Velzen, N. de Ruijter, D. K. Aanen, J. Win, S. Kamoun, T. Bisseling, R. Geurts, S. Huang, Single nucleus genome sequencing reveals high similarity among nuclei of an endomycorrhizal fungus. PLOS Genet. 10, e1004078 (2014). doi:10.1371/journal.pgen.1004078 Medline

10. V. Wewer, M. Brands, P. Dörmann, Fatty acid synthesis and lipid metabolism in the obligate biotrophic fungus Rhizophagus irregularis during mycorrhization of Lotus japonicus. Plant J. 79, 398–412 (2014). doi:10.1111/tpj.12566 Medline

11. V. Vijayakumar, G. Liebisch, B. Buer, L. Xue, N. Gerlach, S. Blau, J. Schmitz, M. Bucher, Integrated multi-omics analysis supports role of lysophosphatidylcholine and related glycerophospholipids in the Lotus japonicas–Glomus intraradices mycorrhizal symbiosis. Plant Cell Environ. 39, 393–415 (2016). doi:10.1111/pce.12624 Medline

12. H. Wada, D. Shintani, J. Ohlrogge, Why do mitochondria synthesize fatty acids? Evidence for involvement in lipoic acid production. Proc. Natl. Acad. Sci. U.S.A. 94, 1591–1596 (1997). doi:10.1073/pnas.94.4.1591 Medline

13. J. Niklas, K. Schneider, E. Heinzle, Metabolic flux analysis in eukaryotes. Curr. Opin. Biotechnol. 21, 63–69 (2010). doi:10.1016/j.copbio.2010.01.011 Medline

14. V. A. Benedito, I. Torres-Jerez, J. D. Murray, A. Andriankaja, S. Allen, K. Kakar, M. Wandrey, J. Verdier, H. Zuber, T. Ott, S. Moreau, A. Niebel, T. Frickey, G. Weiller, J. He, X. Dai, P. X. Zhao, Y. Tang, M. K. Udvardi, A gene expression atlas of the model legume Medicago truncatula. Plant J. 55, 504–513 (2008). doi:10.1111/j.1365-313X.2008.03519.x Medline

15. C. Hogekamp, D. Arndt, P. A. Pereira, J. D. Becker, N. Hohnjec, H. Küster, Laser microdissection unravels cell-type-specific transcription in arbuscular mycorrhizal roots, including CAAT-box transcription factor gene expression correlating with fungal contact and spread. Plant Physiol. 157, 2023–2043 (2011). doi:10.1104/pp.111.186635 Medline

16. A. Bravo, M. Brands, V. Wewer, P. Dörmann, M. J. Harrison, Arbuscular mycorrhiza-specific enzymes FatM and RAM2 fine-tune lipid biosynthesis to promote development of arbuscular mycorrhiza. New Phytol. 214, 1631–1645 (2017). doi:10.1111/nph.14533 Medline

17. T. A. Voelker, A. C. Worrell, L. Anderson, J. Bleibaum, C. Fan, D. J. Hawkins, S. E. Radke, H. M. Davies, Fatty acid biosynthesis redirected to medium chains in transgenic oilseed plants. Science 257, 72–74 (1992). doi:10.1126/science.1621095 Medline

18. W. L. Yang, M. Pollard, Y. Li-Beisson, F. Beisson, M. Feig, J. Ohlrogge, A distinct type of glycerol-3-phosphate acyltransferase with sn-2 preference and phosphatase activity producing 2-monoacylglycerol. Proc. Natl. Acad. Sci. U.S.A. 107, 12040 (2010).

19. W. Yang, J. P. Simpson, Y. Li-Beisson, F. Beisson, M. Pollard, J. B. Ohlrogge, A land-plant-specific glycerol-3-phosphate acyltransferase family in Arabidopsis: Substrate specificity, sn-2 preference, and evolution. Plant Physiol. 160, 638–652 (2012). doi:10.1104/pp.112.201996 Medline

20. E. Wang, S. Schornack, J. F. Marsh, E. Gobbato, B. Schwessinger, P. Eastmond, M. Schultze, S. Kamoun, G. E. D. Oldroyd, A common signaling process that promotes mycorrhizal and oomycete colonization of plants. Curr. Biol. 22, 2242–2246 (2012). doi:10.1016/j.cub.2012.09.043 Medline

21. Q. Zhang, L. A. Blaylock, M. J. Harrison, Two Medicago truncatula half-ABC transporters are essential for arbuscule development in arbuscular mycorrhizal symbiosis. Plant Cell 22, 1483–1497 (2010). doi:10.1105/tpc.110.074955 Medline

22. C. Gutjahr, D. Radovanovic, J. Geoffroy, Q. Zhang, H. Siegler, M. Chiapello, L. Casieri, K. An, G. An, E. Guiderdoni, C. S. Kumar, V. Sundaresan, M. J. Harrison, U. Paszkowski, The half-size ABC transporters STR1 and STR2 are indispensable for mycorrhizal arbuscule formation in rice. Plant J. 69, 906–920 (2012). doi:10.1111/j.1365-313X.2011.04842.x Medline

23. T. H. Yeats, J. K. Rose, The formation and function of plant cuticles. Plant Physiol. 163, 5–20 (2013). doi:10.1104/pp.113.222737 Medline

24. G. Doehlemann, R. Wahl, R. J. Horst, L. M. Voll, B. Usadel, F. Poree, M. Stitt, J. Pons-Kühnemann, U. Sonnewald, R. Kahmann, J. Kämper, Reprogramming a maize plant: Transcriptional and metabolic changes induced by the fungal biotroph Ustilago maydis. Plant J. 56, 181–195 (2008). doi:10.1111/j.1365-313X.2008.03590.x Medline

25. J. T. Ascencio-Ibáñez, R. Sozzani, T.-J. Lee, T.-M. Chu, R. D. Wolfinger, R. Cella, L. Hanley-Bowdoin, Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. Plant Physiol. 148, 436–454 (2008). doi:10.1104/pp.108.121038 Medline

26. L. Adam, S. C. Somerville, Genetic characterization of five powdery mildew disease resistance loci in Arabidopsis thaliana. Plant J. 9, 341–356 (1996). doi:10.1046/j.1365-313X.1996.09030341.x Medline

27. D. Tang, J. Ade, C. A. Frye, R. W. Innes, Regulation of plant defense responses in Arabidopsis by EDR2, a PH and START domain-containing protein. Plant J. 44, 245–257 (2005). doi:10.1111/j.1365-313X.2005.02523.x Medline

28. C. Vannini, A. Carpentieri, A. Salvioli, M. Novero, M. Marsoni, L. Testa, M. C. de Pinto, A. Amoresano, F. Ortolani, M. Bracale, P. Bonfante, An interdomain network: The endobacterium of a mycorrhizal fungus promotes antioxidative responses in both fungal and plant hosts. New Phytol. 211, 265–275 (2016). doi:10.1111/nph.13895 Medline

29. E. Gobbato, J. F. Marsh, T. Vernié, E. Wang, F. Maillet, J. Kim, J. B. Miller, J. Sun, S. A. Bano, P. Ratet, K. S. Mysore, J. Dénarié, M. Schultze, G. E. D. Oldroyd, A GRAS-type transcription factor with a specific function in mycorrhizal signaling. Curr. Biol. 22, 2236–2241 (2012). doi:10.1016/j.cub.2012.09.044 Medline

30. L. H. Luginbuehl, G. N. Menard, S. Kurup, H. Van Erp, G. V. Radhakrishnan, A. Breakspear, G. E. D. Oldroyd, P. J. Eastmond, Fatty acids in arbuscular mycorrhizal fungi are synthesized by the host plant. Science 10.1126/science.aan0081 (2017).

31. E. Gobbato, E. Wang, G. Higgins, S. A. Bano, C. Henry, M. Schultze, G. E. D. Oldroyd, RAM1 and RAM2 function and expression during arbuscular mycorrhizal symbiosis and Aphanomyces euteiches colonization. Plant Signal. Behav. 8, e26049 (2013). doi:10.4161/psb.26049 Medline

32. C. Chen, M. Gao, J. Liu, H. Zhu, Fungal symbiosis in rice requires an ortholog of a legume common symbiosis gene encoding a Ca2+/calmodulin-dependent protein kinase. Plant Physiol. 145, 1619–1628 (2007). doi:10.1104/pp.107.109876 Medline

33. Y. Jin, H. Liu, D. Luo, N. Yu, W. Dong, C. Wang, X. Zhang, H. Dai, J. Yang, E. Wang, DELLA proteins are common components of symbiotic rhizobial and mycorrhizal signalling pathways. Nat. Commun. 7, 12433 (2016). doi:10.1038/ncomms12433 Medline

34. G. Z. Wu, H. W. Xue, Arabidopsis β-ketoacyl-[acyl carrier protein] synthase I is crucial for fatty acid synthesis and plays a role in chloroplast division and embryo development. Plant Cell 22, 3726–3744 (2010). doi:10.1105/tpc.110.075564 Medline

35. Y. Li-Beisson, B. Shorrosh, F. Beisson, M. X. Andersson, V. Arondel, P. D. Bates, S. Baud, D. Bird, A. Debono, T. P. Durrett, R. B. Franke, I. A. Graham, K. Katayama, A. A. Kelly, T. Larson, J. E. Markham, M. Miquel, I. Molina, I. Nishida, O. Rowland, L. Samuels, K. M. Schmid, H. Wada, R. Welti, C. Xu, R. Zallot, J. Ohlrogge, Acyl-lipid metabolism. Arabidopsis Book 11, e0161 (2013). doi:10.1199/tab.0161 Medline

36. G. Wu, S. Liu, Y. Zhao, W. Wang, Z. Kong, D. Tang, ENHANCED DISEASE RESISTANCE4 associates with CLATHRIN HEAVY CHAIN2 and modulates plant

immunity by regulating relocation of EDR1 in Arabidopsis. Plant Cell 27, 857–873 (2015). doi:10.1105/tpc.114.134668 Medline

37. Y. Wang, M. T. Nishimura, T. Zhao, D. Tang, ATG2, an autophagy-related protein, negatively affects powdery mildew resistance and mildew-induced cell death in Arabidopsis. Plant J. 68, 74–87 (2011). doi:10.1111/j.1365-313X.2011.04669.x Medline

38. H. Vierheilig, A. P. Coughlan, U. Wyss, Y. Piche, Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl. Environ. Microbiol. 64, 5004–5007 (1998). Medline

39. M. Giovannetti, B. Mosse, An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots. New Phytol. 84, 489–500 (1980). doi:10.1111/j.1469-8137.1980.tb04556.x

40. C. A. Frye, R. W. Innes, An Arabidopsis mutant with enhanced resistance to powdery mildew. Plant Cell 10, 947–956 (1998). doi:10.1105/tpc.10.6.947 Medline

41. S. K. Gomez, H. Javot, P. Deewatthanawong, I. Torres-Jerez, Y. Tang, E. B. Blancaflor, M. K. Udvardi, M. J. Harrison, Medicago truncatula and Glomus intraradices gene expression in cortical cells harboring arbuscules in the arbuscular mycorrhizal symbiosis. BMC Plant Biol. 9, 10 (2009). doi:10.1186/1471-2229-9-10 Medline

42. T. Czechowski, M. Stitt, T. Altmann, M. K. Udvardi, W. R. Scheible, Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 139, 5–17 (2005). doi:10.1104/pp.105.063743 Medline

43. A. Boisson-Dernier, M. Chabaud, F. Garcia, G. Bécard, C. Rosenberg, D. G. Barker, Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations. Mol. Plant Microbe Interact. 14, 695–700 (2001). doi:10.1094/MPMI.2001.14.6.695 Medline

44. S. J. Clough, A. F. Bent, Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743 (1998). doi:10.1046/j.1365-313x.1998.00343.x Medline

45. F. Rook, N. Gerrits, A. Kortstee, M. van Kampen, M. Borrias, P. Weisbeek, S. Smeekens, Sucrose-specific signalling represses translation of the Arabidopsis ATB2 bZIP transcription factor gene. Plant J. 15, 253–263 (1998). doi:10.1046/j.1365-313X.1998.00205.x Medline

46. L. Liu, L. Zhang, W. Tang, Y. Gu, Q. Hua, S. Yang, W. Jiang, C. Yang, Phosphoketolase pathway for xylose catabolism in Clostridium acetobutylicum revealed by 13C metabolic flux analysis. J. Bacteriol. 194, 5413–5422 (2012). doi:10.1128/JB.00713-12 Medline

47. I. Molina, G. Bonaventure, J. Ohlrogge, M. Pollard, The lipid polyester composition of Arabidopsis thaliana and Brassica napus seeds. Phytochemistry 67, 2597–2610 (2006). doi:10.1016/j.phytochem.2006.09.011 Medline

48. J. Browse, P. J. McCourt, C. R. Somerville, Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue. Anal. Biochem. 152, 141–145 (1986). doi:10.1016/0003-2697(86)90132-6 Medline

49. T. Mairinger, M. Steiger, J. Nocon, D. Mattanovich, G. Koellensperger, S. Hann, Gas chromatography-quadrupole time-of-flight mass spectrometry-based determination of isotopologue and tandem mass isotopomer fractions of primary metabolites for 13C-metabolic flux analysis. Anal. Chem. 87, 11792–11802 (2015). doi:10.1021/acs.analchem.5b03173 Medline

50. J. Li, M. Hoene, X. Zhao, S. Chen, H. Wei, H.-U. Häring, X. Lin, Z. Zeng, C. Weigert, R. Lehmann, G. Xu, Stable isotope-assisted lipidomics combined with nontargeted isotopomer filtering, a tool to unravel the complex dynamics of lipid metabolism. Anal. Chem. 85, 4651–4657 (2013). doi:10.1021/ac400293y Medline

51. H. Blasco, P. Corcia, P.-F. Pradat, C. Bocca, P. H. Gordon, C. Veyrat-Durebex, S. Mavel, L. Nadal-Desbarats, C. Moreau, D. Devos, C. R. Andres, P. Emond, Metabolomics in cerebrospinal fluid of patients with amyotrophic lateral sclerosis: An untargeted approach via high-resolution mass spectrometry. J. Proteome Res. 12, 3746–3754 (2013). doi:10.1021/pr400376e Medline

52. E. Tisserant, M. Malbreil, A. Kuo, A. Kohler, A. Symeonidi, R. Balestrini, P. Charron, N. Duensing, N. Frei dit Frey, V. Gianinazzi-Pearson, L. B. Gilbert, Y. Handa, J. R. Herr, M. Hijri, R. Koul, M. Kawaguchi, F. Krajinski, P. J. Lammers, F. G. Masclaux, C. Murat, E. Morin, S. Ndikumana, M. Pagni, D. Petitpierre, N. Requena, P. Rosikiewicz, R. Riley, K. Saito, H. San Clemente, H. Shapiro, D. van Tuinen, G. Bécard, P. Bonfante, U. Paszkowski, Y. Y. Shachar-Hill, G. A. Tuskan, J. P. W. Young, I. R. Sanders, B. Henrissat, S. A. Rensing, I. V. Grigoriev, N. Corradi, C. Roux, F. Martin, Genome of an arbuscular mycorrhizal fungus provides insight into the oldest plant symbiosis. Proc. Natl. Acad. Sci. U.S.A. 110, 20117–20122 (2013). doi:10.1073/pnas.1313452110 Medline

53. E. Tisserant, A. Kohler, P. Dozolme-Seddas, R. Balestrini, K. Benabdellah, A. Colard, D. Croll, C. Da Silva, S. K. Gomez, R. Koul, N. Ferrol, V. Fiorilli, D. Formey, P. Franken, N. Helber, M. Hijri, L. Lanfranco, E. Lindquist, Y. Liu, M. Malbreil, E. Morin, J. Poulain, H. Shapiro, D. van Tuinen, A. Waschke, C. Azcón-Aguilar, G. Bécard, P. Bonfante, M. J. Harrison, H. Küster, P. Lammers, U. Paszkowski, N. Requena, S. A. Rensing, C. Roux, I. R. Sanders, Y. Shachar-Hill, G. Tuskan, J. P. W. Young, V. Gianinazzi-Pearson, F. Martin, The transcriptome of the arbuscular mycorrhizal fungus Glomus intraradices (DAOM 197198) reveals functional tradeoffs in an obligate symbiont. New Phytol. 193, 755–769 (2012). doi:10.1111/j.1469-8137.2011.03948.x Medline

54. H. Ogata, S. Goto, K. Sato, W. Fujibuchi, H. Bono, M. Kanehisa, KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 27, 29–34 (1999). doi:10.1093/nar/27.1.29 Medline

55. H. Javot, R. V. Penmetsa, N. Terzaghi, D. R. Cook, M. J. Harrison, A Medicago truncatula phosphate transporter indispensable for the arbuscular mycorrhizal symbiosis. Proc. Natl. Acad. Sci. U.S.A. 104, 1720–1725 (2007). doi:10.1073/pnas.0608136104 Medline