Monitoring Barcoding Network and Recording Matthew Shepherd
Senior Specialist, Soil Biodiversity, Natural England
Slide 2
Why monitor soils? Soil science has concentrated on
agricultural systems, physical and chemical status. Learn from
(semi) natural habitats Lessons for managed ecosystems Own interest
A quarter of all biodiversity is found in the soil
Slide 3
Why monitor soils? Many monitoring efforts (eg. ECN, RSS) have
focussed on chemical or physical parameters yet soil biology does
all the work! New advice from UK SIC, Defra SQuID project CS2007
more soil and soil biological parameters than ever before Try to be
compatible, representative and affordable
Slide 4
Why monitor soils? CS survey in 1998 and 2007 measured soil
biological parameters Measured tRFLP, soil mesofauna
Slide 5
Why monitor soils? ~12.8 quadrillion soil invertebrates present
in the top 8 cm of GB soils significant increase in total
invertebrate catch in all Broad Habitats except for agricultural
areas on mineral soils Due to increase in the catch of mites in
2007 samples small reduction in the number of soil invertebrate
broad taxa (0-8cm) recorded different seasonal conditions more work
needed Needs linking with habitat and chemistry work
Slide 6
Slide 7
Slide 8
Slide 9
Oribatid data Thanks to Aidan Keith now have loose locaitons
secret data!
Slide 10
LTMN Soils Method 1 habitat per NNR for soil assessment 22 so
far of ~43 total 8 broadleaved woodlands 5 heathlands 6 calcareous
grasslands 6 neutral grasslands 2 dune grasslands 2 blanket bogs 4
raised bogs 5 fens 5 saltmarshes 11 12 13
Slide 11
LTMN Soils Method NE help contribute to fieldwork and Macaulay
Scientific Consulting do fieldwork and analysis. Use aerial photos
and veg survey data to choose 5 ~similar points. Survey from Sept
16 th to Oct 16 th
Slide 12
Use GPS to locate veg plot markers and lay out 20m by 20m soil
plot to SW using compass Each contains 100 2m by 2m sub-plots Same
4 sampled for all plots change next time. LTMN Soils Method
Slide 13
Take plot location photos Sub-plot photos side and above
Vegetation survey Soil auger assessment LTMN Soils Method
Slide 14
Cores taken most bulked Wrapped, labelled chilled and sent to
Scotland. Different cores are letter coded: C for curface (0-15) A
for anderneath (15-30) Physico-chemical properties Bulk density %C,
%N Loss On Ignition pH CEC and cations
Slide 15
LTMN Soils Method B for beasties (0-8 cm mesofauna) D for DNA
(microbial community) tRFLP, PLFA E for eelworms (nematodes) F for
fertiliser (N mineralisation )
Baseline Results: implications for future work Size of change
detectable varies site to site... pH ~0.4 pH units ~20% change in
bulk density tRFLP - 7% change in evenness, 12% change in richness
Soil physico-chemical properties change slowly Soil biological
properties may be more sensitive indicator... Different habitats
have distinct soil communities Soil function indicators and proxies
more measures needed?
Slide 25
Continue with baseline comparison over time Include new
analyses - earthworms, root biomass, genetic analysis Develop new
approaches Metabarcoding project CEH & NHM mesofauna Earthworm
DNA? More multivariate analyses Write up plan to present site by
site data and full baseline report after 5 years Comparison with
CS2007, CS1998 data compare agricultural soils Apply same
methodology in experimental work, other monitoring Future analyses
and plans
Slide 26
Answering the big questions... Soil resistance and resilience
to perturbations Disturbance/fire at Thursley What are the soil
communities in our priority habitats? Clear microbial (and other?)
communities How do these compare with other habitats? Extend this
method to other sites/experiments & compare CS2007 Do soil
characters/function lag or lead changes? What will happen to soil
carbon in seminatural habitats? Trends in soil biodiversity where
are changes seen and why? Wait and see!
Slide 27
But... Most mesofauna samples are still not sorted and
identified Anyone interested can borrow NE microscope 5 samples -
probably around 500-1000 beasts in total!
Slide 28
DNA metabarcoding? We need a way to identify very large numbers
of invertebrate specimens quickly and cheaply
Slide 29
Barcoding and Metabarcoding Alternative approach is
metabarcoding. Mitochondrial DNA passed down female line only no
recombination during meiosis Gradual change by mutations at regular
rate Differences and similarities should indicate timings of
divergence of species. Similar story for ribosomal RNA Sections of
these are used as barcodes to characterise spp. COi cytochrome
oxidase 1 gene Also 18SRNA Prokaryotes- 16SRNA
Slide 30
Barcode Region for Animals The Mitochondrial Genome CO I Target
Region
Slide 31
mosquito-COI:
CGCGACAATGATTATTTTCAACTAACCATAAGGATATTGGAACATTATAT
TTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACTTCTCTAAGTATTTT
AATTCGAGCAGAATTAGGACACCCTGGAGCCTTTATTGGTGATGATCAAA
TTTATAATGTTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATA
GTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCTCTAAT
ACTAGGGGCCCCAGATATGGCTTTCCCTCGAATAAATAATATAAGATTTT
GAATATTACCCCCCTCTTTAACTCTTCTAATTTCTAGAAGTATAGTAGAA
AATGGAGCTGGAACAGGGTGAACTGTATATCCTCCTCTATCCTCAGGAAT
TGCTCATGCAGGAGCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAG
CAGGAATTTCTTCAATTTTAGGAGCAGTTAATTTTATTACAACAGTTATT
AATATACGAGCACCAGGAATTACTCTTGACCGAATACCGTTATTCGTTTG
ATCTGTAGTAATTACAGCAGTATTATTATTACTTTCTTTACCAGTATTAG
CTGGAGCTATTACTATACTTTTAACAGATCGAAACTTAAATACATCATTC An actual
mosquito barcode - a 650 letter word:
Slide 32
If you can extract, and amplify barcodes from a community cross
ref with barcodes for known species Generate spp. List Not
quantitative differential amplification Problem not enough spp.
barcoded Problem extraction, amplification methods not well
developed
Slide 33
Metabarcoding Mass sequencing reduces time and cost Uses CO1
barcode gene
Slide 34
Next-generation sequencers Produce many parallel sequences
Limited in the length of sequence reads Error can occur at
amplification and sequencing stages leads to noisy results e.g. 454
/ Illumina
Slide 35
~120,000 reads in two 1/8 plates (~345 bp/sequence) Step 1:
Denoise
Slide 36
These are our molecular OTUs ~2000 reads Step 2: Cluster
similar sequences
Slide 37
Spider Anopheles Mosquito Fruit flyEmerald tree python ~2000
reads Step 3: Assign taxonomy
Slide 38
Output: species x site table
Slide 39
Control Swipe Forage harvest Disc plough Agricultural plough
Forestry plough Turf stripping Control Which treatments work?
Slide 40
Pitfall trap data The best treatments are the most aggressive
ones Standard Metabarcoding (All arthropods)Standard (Spiders,
carabids, ants) R 2 =0.76
Slide 41
Pitfall trap data Standard Metabarcoding (All
arthropods)Standard (Spiders, carabids, ants) Conclusion:
metabarcoding produces useful information for restoration
ecology.
Slide 42
NE project to develop method Dave Spurgeon, Rob Griffiths,
Daniel Read at CEH 3 sites sampled along transects at differing
proximites Old spp. Rich chalk grassland Improved grassland
Grassland managed to revert to chalk grassland 2 sets of mesofauna
extracted metabarcoding morpho ID & spp. barcoding
Slide 43
Metabarcoding problems with primers will COi work? 18S RNA
better but good enough for spp? Morpho ID shows some differences
Communities (PCA) similarities are old improved reverting Im IDing
samples for NHM Alfried Vogler lots of photos Use for this project
and put on BOLD Challenge for NHM in small size Must retain voucher
specimen!
Slide 44
Barcoding a specimen leaves a permanent legacy of an ID, and
enables comparison to others (checking or defining) Link with
location a genetic NBN Many specimens on current databases wrongly
IDed Some barcodes are of foreign material Correct group-specific
primers should help... Better photos of lots of features.
Slide 45
Issues and Questions Whats stopping you barcoding things you
ID? Reagents? Costs? Lack of knowing where to go? Would
coordination help Is there a role for NE? Museums? Universities?
Biological Record Centres? Biodiversity groups and networks?
Slide 46
Soil Biodiversity Support Groups No soil biodiversity society
for UK SES in USA/Canada Help is out there! Facebook page Blogs Us
lot! What else? Record centres?