Slide 1

Monitoring Barcoding Network and Recording Matthew Shepherd Senior Specialist, Soil Biodiversity, Natural England

Slide 2

Why monitor soils? Soil science has concentrated on agricultural systems, physical and chemical status. Learn from (semi) natural habitats Lessons for managed ecosystems Own interest A quarter of all biodiversity is found in the soil

Slide 3

Why monitor soils? Many monitoring efforts (eg. ECN, RSS) have focussed on chemical or physical parameters yet soil biology does all the work! New advice from UK SIC, Defra SQuID project CS2007 more soil and soil biological parameters than ever before Try to be compatible, representative and affordable

Slide 4

Why monitor soils? CS survey in 1998 and 2007 measured soil biological parameters Measured tRFLP, soil mesofauna

Slide 5

Why monitor soils? ~12.8 quadrillion soil invertebrates present in the top 8 cm of GB soils significant increase in total invertebrate catch in all Broad Habitats except for agricultural areas on mineral soils Due to increase in the catch of mites in 2007 samples small reduction in the number of soil invertebrate broad taxa (0-8cm) recorded different seasonal conditions more work needed Needs linking with habitat and chemistry work

Slide 6

Slide 7

Slide 8

Slide 9

Oribatid data Thanks to Aidan Keith now have loose locaitons secret data!

Slide 10

LTMN Soils Method 1 habitat per NNR for soil assessment 22 so far of ~43 total 8 broadleaved woodlands 5 heathlands 6 calcareous grasslands 6 neutral grasslands 2 dune grasslands 2 blanket bogs 4 raised bogs 5 fens 5 saltmarshes 11 12 13

Slide 11

LTMN Soils Method NE help contribute to fieldwork and Macaulay Scientific Consulting do fieldwork and analysis. Use aerial photos and veg survey data to choose 5 ~similar points. Survey from Sept 16 th to Oct 16 th

Slide 12

Use GPS to locate veg plot markers and lay out 20m by 20m soil plot to SW using compass Each contains 100 2m by 2m sub-plots Same 4 sampled for all plots change next time. LTMN Soils Method

Slide 13

Take plot location photos Sub-plot photos side and above Vegetation survey Soil auger assessment LTMN Soils Method

Slide 14

Cores taken most bulked Wrapped, labelled chilled and sent to Scotland. Different cores are letter coded: C for curface (0-15) A for anderneath (15-30) Physico-chemical properties Bulk density %C, %N Loss On Ignition pH CEC and cations

Slide 15

LTMN Soils Method B for beasties (0-8 cm mesofauna) D for DNA (microbial community) tRFLP, PLFA E for eelworms (nematodes) F for fertiliser (N mineralisation )

Slide 16

Baseline Results Physico-chemical

Slide 17

Slide 18

Baseline Results Biochemical

Slide 19

Baseline Results Soil Function: C storage

Slide 20

Baseline Results - Soil function: decomposition

Slide 21

Baseline results - Soil organism communities: tRFLP

Slide 22

Baseline Results - Soil communities: tRFLP

Slide 23

Baseline results interactions Baseline Results: Overall soil patterns (2011 data)

Slide 24

Baseline Results: implications for future work Size of change detectable varies site to site... pH ~0.4 pH units ~20% change in bulk density tRFLP - 7% change in evenness, 12% change in richness Soil physico-chemical properties change slowly Soil biological properties may be more sensitive indicator... Different habitats have distinct soil communities Soil function indicators and proxies more measures needed?

Slide 25

Continue with baseline comparison over time Include new analyses - earthworms, root biomass, genetic analysis Develop new approaches Metabarcoding project CEH & NHM mesofauna Earthworm DNA? More multivariate analyses Write up plan to present site by site data and full baseline report after 5 years Comparison with CS2007, CS1998 data compare agricultural soils Apply same methodology in experimental work, other monitoring Future analyses and plans

Slide 26

Answering the big questions... Soil resistance and resilience to perturbations Disturbance/fire at Thursley What are the soil communities in our priority habitats? Clear microbial (and other?) communities How do these compare with other habitats? Extend this method to other sites/experiments & compare CS2007 Do soil characters/function lag or lead changes? What will happen to soil carbon in seminatural habitats? Trends in soil biodiversity where are changes seen and why? Wait and see!

Slide 27

But... Most mesofauna samples are still not sorted and identified Anyone interested can borrow NE microscope 5 samples - probably around 500-1000 beasts in total!

Slide 28

DNA metabarcoding? We need a way to identify very large numbers of invertebrate specimens quickly and cheaply

Slide 29

Barcoding and Metabarcoding Alternative approach is metabarcoding. Mitochondrial DNA passed down female line only no recombination during meiosis Gradual change by mutations at regular rate Differences and similarities should indicate timings of divergence of species. Similar story for ribosomal RNA Sections of these are used as barcodes to characterise spp. COi cytochrome oxidase 1 gene Also 18SRNA Prokaryotes- 16SRNA

Slide 30

Barcode Region for Animals The Mitochondrial Genome CO I Target Region

Slide 31

mosquito-COI: CGCGACAATGATTATTTTCAACTAACCATAAGGATATTGGAACATTATAT TTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACTTCTCTAAGTATTTT AATTCGAGCAGAATTAGGACACCCTGGAGCCTTTATTGGTGATGATCAAA TTTATAATGTTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATA GTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCTCTAAT ACTAGGGGCCCCAGATATGGCTTTCCCTCGAATAAATAATATAAGATTTT GAATATTACCCCCCTCTTTAACTCTTCTAATTTCTAGAAGTATAGTAGAA AATGGAGCTGGAACAGGGTGAACTGTATATCCTCCTCTATCCTCAGGAAT TGCTCATGCAGGAGCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAG CAGGAATTTCTTCAATTTTAGGAGCAGTTAATTTTATTACAACAGTTATT AATATACGAGCACCAGGAATTACTCTTGACCGAATACCGTTATTCGTTTG ATCTGTAGTAATTACAGCAGTATTATTATTACTTTCTTTACCAGTATTAG CTGGAGCTATTACTATACTTTTAACAGATCGAAACTTAAATACATCATTC An actual mosquito barcode - a 650 letter word:

Slide 32

If you can extract, and amplify barcodes from a community cross ref with barcodes for known species Generate spp. List Not quantitative differential amplification Problem not enough spp. barcoded Problem extraction, amplification methods not well developed

Slide 33

Metabarcoding Mass sequencing reduces time and cost Uses CO1 barcode gene

Slide 34

Next-generation sequencers Produce many parallel sequences Limited in the length of sequence reads Error can occur at amplification and sequencing stages leads to noisy results e.g. 454 / Illumina

Slide 35

~120,000 reads in two 1/8 plates (~345 bp/sequence) Step 1: Denoise

Slide 36

These are our molecular OTUs ~2000 reads Step 2: Cluster similar sequences

Slide 37

Spider Anopheles Mosquito Fruit flyEmerald tree python ~2000 reads Step 3: Assign taxonomy

Slide 38

Output: species x site table

Slide 39

Control Swipe Forage harvest Disc plough Agricultural plough Forestry plough Turf stripping Control Which treatments work?

Slide 40

Pitfall trap data The best treatments are the most aggressive ones Standard Metabarcoding (All arthropods)Standard (Spiders, carabids, ants) R 2 =0.76

Slide 41

Pitfall trap data Standard Metabarcoding (All arthropods)Standard (Spiders, carabids, ants) Conclusion: metabarcoding produces useful information for restoration ecology.

Slide 42

NE project to develop method Dave Spurgeon, Rob Griffiths, Daniel Read at CEH 3 sites sampled along transects at differing proximites Old spp. Rich chalk grassland Improved grassland Grassland managed to revert to chalk grassland 2 sets of mesofauna extracted metabarcoding morpho ID & spp. barcoding

Slide 43

Metabarcoding problems with primers will COi work? 18S RNA better but good enough for spp? Morpho ID shows some differences Communities (PCA) similarities are old improved reverting Im IDing samples for NHM Alfried Vogler lots of photos Use for this project and put on BOLD Challenge for NHM in small size Must retain voucher specimen!

Slide 44

Barcoding a specimen leaves a permanent legacy of an ID, and enables comparison to others (checking or defining) Link with location a genetic NBN Many specimens on current databases wrongly IDed Some barcodes are of foreign material Correct group-specific primers should help... Better photos of lots of features.

Slide 45

Issues and Questions Whats stopping you barcoding things you ID? Reagents? Costs? Lack of knowing where to go? Would coordination help Is there a role for NE? Museums? Universities? Biological Record Centres? Biodiversity groups and networks?

Slide 46

Soil Biodiversity Support Groups No soil biodiversity society for UK SES in USA/Canada Help is out there! Facebook page Blogs Us lot! What else? Record centres?

Slide 47

And Recording?