(an interactive presentation by Vicky & Ann)
A1
A3
A2
C3
B2 C2
C1
B3
B1
Basis of Sexual
Reproduction
Sexual
Reproduction in
Animals
Sexual
Reproduction in
Plants
Conjunction is when is a method of reproduction in single-
celled organisms. It involves the transfer of DNA from one
individual to another
It is the reason that the streptococcus bacteria was able to
adapt and resist the former antibiotic used to defend it.
Formerly, their were only a few of these bacteria that had
the genes to defend these antibiotics, but as they got used
more, the gene that fought the antibiotic started to pop up
more often; “adapting” to the new conditions.
Now a days, it is quite hard to find an antibiotic that will
kill this bacteria.
Remember, conjunction is not a form of sexual
reproduction! (even if your textbook says so.)
END
E x a m p l e o f G e n e t i c C o d e
ATGCTACGTACGGCTAATCGGCTAATGCCGTAAT
CGCGATGCATATGCCGCGTAATCGTACGCGGCTA
ATGCCGGCCGTAATGCATGCCGATATGCATGC
Chromosomes are in a cell nucleus, a double-stranded
threadlike structure that carries genetic material.
Diploid means having two sets of chromosomes.
Haploid means having one set of chromosomes. (You can
remember this by thinking of half)
Matching pairs of chromosomes are known as homologous
pairs. A+T, G+C. (you can remember this by thinking “AT”,
then just putting G+C together)
DNA is short for Deoxyribonucleic Acid.
DNA contains information passed down from the parent
cells. They contain your genes.
1. What is the total number of chromosomes
in a human body?
2. What are “matching” pairs of
chromosomes known as?
3. What does diploid mean?
4. What is the full name of the genetic
material that chromosomes carry?
1. The total number of chromosomes in the
human body is 46.
2. They are known as homologous pairs.
3. Diploid means having two sets of
chromosomes.
4. The full name of the genetic material
that chromosomes carry is called
Deoxyribonucleic Acid. (DNA)
Above, we see the process of meiosis
Meiosis is, in cell division, the process that ensures each
gamete is haploid.
Only haploid gametes can combine during fertilization to
form a diploid zygote.
Meiosis ensures that the combination of chromosomes are
different than that of one parent.
because the nucleus is not the same, the gametes can
produce offspring different from their parents.
Crossing over is when single strands of DNA from each
double stranded chromosome cross over and exchange
segments of DNA.
1. What is crossing over?
2. Why can gametes produce different
offspring from their parents?
3. Only ? gametes can combine
during fertilization to form a
diploid zygote.
1. Crossing over is when single strands of
DNA from each double stranded
chromosome cross over and exchange
segments of DNA.
2. Because they have different genetic
information in their nucleus
3. Haploid
A b o v e a r e p i c t u r e s o f s p e r m a n d e g g c e l l s
Animals that reproduce sexually have reproductive organs called gonads.
Male gonads are called testes and female gonads are called ovaries.
Sperm are gametes produced by males, and eggs are gametes produced
by females.
During fertilization, they come together to form a zygote.
in the formation of egg(s), 4 identical nuclei are produced but only one
gets a sufficient amount of cytoplasm, so you end up with one egg.
In the formation of sperm(s), 4 identical nuclei are produced and the
cytoplasm is split equally amongst them, so you end up with 4 sperm(s).
1. Animals that reproduce sexually have
reproductive organs called ? .
2. In the formation of eggs, how many eggs
form after one round of meiosis 1+2?
3. In the formation of sperm, how many
sperm form after one round of meiosis
1+2?
1. Gonads
2. 1 egg
3. 4 sperm
All animals reproduce, it’s a fact
Mating is when two members of a population come together to
combine their gametes for fertilization.
For some animals, there is only one mating season a year. (it is
timed so that when the babies hatch or whatever, it is in
favourable conditions)
But another example is that a fish called the grunion mates at
full or new moons. (when the tides are at their highest point.)
A honey bee only mates once in its entire lifetime!
Fertilization only occurs when a sperm meets an egg of the same
species or of one that is really close.
A moist environment is required so that the sperm and egg do not
dry out. (it also keeps an egg membrane soft so a sperm can
enter it easily)
Fertilization is only the beginning of animal reproduction; the
resulting zygote must develop into an independent individual.
1. What is mating?
2. Fertilization occurs when ? .
3. Why do some animals mate only once each
year?
4. A ? environment is required during
fertilization.
1. Mating is when two members of a
population come together to combine
their gametes for fertilization.
2. Fertilization occurs when a sperm meets
an egg of the same species or of one
that is really close.
3. So that when their offspring arrive, they
arrive in favourable conditions.
4. Moist
Some organisms reproduce externally too!
External fertilization is when the egg and sperm meet outside of the
parent organism.
An example of external fertilization is the sea anemone. Adult anemones
can not move around, so they reproduce sexually by releasing sperm and
eggs into the water. (this method relies on the water currents to bring
the gametes together
Another example would be that female fish usually lay their eggs in
clusters, and then the male sprays them with sperm to fertilize them.
Internal fertilization is when the egg and sperm meet inside one of the
parent organisms.
An example of internal fertilization is human and polar bear
reproduction.
Internal fertilization is primarily found in land animals; external
fertilization is most commonly found in air and sea animals.
1. What is external
fertilization?
2. What is internal
fertilization?
3. Give an example of each.
(animal)
1. External fertilization is when the egg
and sperm meet outside of the parent
organism.
2. Internal fertilization is when the egg and
sperm meet inside one of the parent
organisms.
3. Answers may vary. Expected responses
include the sea anemone and fish for
external; humans and polar bears for
internal.(There are many more
possibilities.)
It is considered a mutation for
humans to be hermaphrodites.
The term "hermaphrodite" derives from Hermaphroditus,
the son of Hermes and Aphrodite in Greek mythology, who
was fused with a nymph, Salmacis, resulting in one
individual possessing physical traits of both sexes.
Hermaphrodites are organisms that have both female and
male reproductive organs in each individual. Examples of
this would be flatworms and earthworms.
During mating, each planarian (the name given to non-
parasitic flatworms) injects sperm into a reproductive pore
on the other’s body. Each planarian then lays fertilized
eggs.
Hermaphrodite is used in botany to describe a flower that
has both staminate (male, pollen-producing)
and carpellate (female, ovule-producing) parts.
1. What does the term hermaphrodite
originate from? (state the type of
mythology)
2. What is the definition of
“hermaphrodite”?
3. How can the word hermaphrodite be
used in botany?
1. The word “hermaphrodite” originates from
Greek mythology.
2. Hermaphrodites are organisms that have
both female and male reproductive organs.
3. The term hermaphrodite is used
in botany to describe a flower that has
both staminate (male, pollen-producing)
and carpellate (female, ovule-producing)
parts.
Did you know that seeds are the products
of sexual reproduction in most plants?
A seed is a complete reproductive package that
contains an embryo, a food supply, and a seed
coat. It is also the product of sexual
reproduction in most plants.
Scottish botanist Robert Brown was the first to
classify seed-bearing plants into two major
groups based on seed structure. They are split
into two sections, namely: Angiosperms and
gymnosperms.
Angiosperms are flowering plants.
Gymnosperms are non-flowering plants.
Keep in mind that plants do not fit into those two
categories.
1. What is usually the product of sexual
reproduction in plants, and what does it
contain?
2. What are the two different categories
plants can be categorized into?
3. Give a rough general explanation of what
separates the two categories.
1. Seeds are usually the product of plant sexual
reproduction, and they contain an embryo, a
food supply, and a seed coat.
2. Plants can be classified into gymnospheres, and
angiosperms.
1. The major difference between these two
categories is that angiosperms produce flowers,
and gymnosperms do not.
Angiosperms make great gardens!
Over half of all known plant species are angiosperms.
(flowering plants) Some, such as a sunflower, produce
showy flowers, while others, such as grasses, produce tiny
flowers that are often overlooked.
All flowers have the same function. That is, they all
contain the plant’s reproductive organs. The female
reproductive organ is called the pistil, and the male’s is
called the stamen.
Pollen grains from the anthers (a part of the plant) must
reach the stigma of the pistil before seeds can develop.
In self-pollination, both female and male gametes come
from the same plant. In cross-pollination, gametes from
different species reproduce. This means that the pollen
from one flower is transfered to a flower on a different
plant.
1. What exactly are angiosperms?
2. Give two examples of angiosperms.
3. Name the reproductive organs found in an
angiosperm? State the male organ first,
then the female.
4. How are seeds created/ how do
angiosperms reproduce? What goes on in
the plant?
5. From the information gathered, what can
angiosperms be considered as? HINT: it
starts with an H.
1. Angiosperms are, in the simplest
explanation, flowering plants.
2. Answers may vary. Sunflowers, tulips,
grasses, etc.
3. Stamen, pistil.
4. Pollen grains from the anthers (a part of
the plant) must reach the stigma of the
pistil before seeds can develop.
5. Angiosperms can be considered as
hermaphrodites.
a Ever seen a pinecone?
That’s a seed of a
gymnosperm!
Unlike angiosperms, gymnosperms do not produce
flowers. Instead, most gymnosperms produce seeds
inside cones.
Gymnosperm seeds have a coat that protects them
from dehydration.
In some gymnosperm species, male and female cones
are produced on separate trees. However, in the most
familiar species, the same tree produces both types
of cones.
Like an angiosperm, the seed of a gymnosperm
contains an embryo, a food supply, and a coat that
protects it from drying out. However, the seed is not
contained in a fruit.
1. What differentiates a gymnosperm from an
angiosperm?
2. Are gymnosperm seeds produced on the
same tree, or on separate trees? **tricky,
be careful!
3. Seeds of gymnosperms are similar to seeds
of angiosperms. What do they contain?
1. Unlike angiosperms, gymnosperms do not
produce flowers. Instead, most
gymnosperms produce seeds inside cones.
2. In some gymnosperm species, male and
female cones are produced on separate
trees. However, in the most familiar
species, the same tree produces both types
of cones.
3. Like an angiosperm, the seed of a
gymnosperm contains an embryo, a food
supply, and a coat that protects it from
drying out.
Hopefully you learned at least one thing, and have a HAPPY DAY!
Top Related