(an interactive presentation by Vicky & Ann)

A1

A3

A2

C3

B2 C2

C1

B3

B1

Basis of Sexual

Reproduction

Sexual

Reproduction in

Animals

Sexual

Reproduction in

Plants

Conjunction is when is a method of reproduction in single-

celled organisms. It involves the transfer of DNA from one

individual to another

It is the reason that the streptococcus bacteria was able to

adapt and resist the former antibiotic used to defend it.

Formerly, their were only a few of these bacteria that had

the genes to defend these antibiotics, but as they got used

more, the gene that fought the antibiotic started to pop up

more often; “adapting” to the new conditions.

Now a days, it is quite hard to find an antibiotic that will

kill this bacteria.

Remember, conjunction is not a form of sexual

reproduction! (even if your textbook says so.)

END

E x a m p l e o f G e n e t i c C o d e

ATGCTACGTACGGCTAATCGGCTAATGCCGTAAT

CGCGATGCATATGCCGCGTAATCGTACGCGGCTA

ATGCCGGCCGTAATGCATGCCGATATGCATGC

Chromosomes are in a cell nucleus, a double-stranded

threadlike structure that carries genetic material.

Diploid means having two sets of chromosomes.

Haploid means having one set of chromosomes. (You can

remember this by thinking of half)

Matching pairs of chromosomes are known as homologous

pairs. A+T, G+C. (you can remember this by thinking “AT”,

then just putting G+C together)

DNA is short for Deoxyribonucleic Acid.

DNA contains information passed down from the parent

cells. They contain your genes.

1. What is the total number of chromosomes

in a human body?

2. What are “matching” pairs of

chromosomes known as?

3. What does diploid mean?

4. What is the full name of the genetic

material that chromosomes carry?

1. The total number of chromosomes in the

human body is 46.

2. They are known as homologous pairs.

3. Diploid means having two sets of

chromosomes.

4. The full name of the genetic material

that chromosomes carry is called

Deoxyribonucleic Acid. (DNA)

Above, we see the process of meiosis

Meiosis is, in cell division, the process that ensures each

gamete is haploid.

Only haploid gametes can combine during fertilization to

form a diploid zygote.

Meiosis ensures that the combination of chromosomes are

different than that of one parent.

because the nucleus is not the same, the gametes can

produce offspring different from their parents.

Crossing over is when single strands of DNA from each

double stranded chromosome cross over and exchange

segments of DNA.

1. What is crossing over?

2. Why can gametes produce different

offspring from their parents?

3. Only ? gametes can combine

during fertilization to form a

diploid zygote.

1. Crossing over is when single strands of

DNA from each double stranded

chromosome cross over and exchange

segments of DNA.

2. Because they have different genetic

information in their nucleus

3. Haploid

A b o v e a r e p i c t u r e s o f s p e r m a n d e g g c e l l s

Animals that reproduce sexually have reproductive organs called gonads.

Male gonads are called testes and female gonads are called ovaries.

Sperm are gametes produced by males, and eggs are gametes produced

by females.

During fertilization, they come together to form a zygote.

in the formation of egg(s), 4 identical nuclei are produced but only one

gets a sufficient amount of cytoplasm, so you end up with one egg.

In the formation of sperm(s), 4 identical nuclei are produced and the

cytoplasm is split equally amongst them, so you end up with 4 sperm(s).

1. Animals that reproduce sexually have

reproductive organs called ? .

2. In the formation of eggs, how many eggs

form after one round of meiosis 1+2?

3. In the formation of sperm, how many

sperm form after one round of meiosis

1+2?

1. Gonads

2. 1 egg

3. 4 sperm

All animals reproduce, it’s a fact

Mating is when two members of a population come together to

combine their gametes for fertilization.

For some animals, there is only one mating season a year. (it is

timed so that when the babies hatch or whatever, it is in

favourable conditions)

But another example is that a fish called the grunion mates at

full or new moons. (when the tides are at their highest point.)

A honey bee only mates once in its entire lifetime!

Fertilization only occurs when a sperm meets an egg of the same

species or of one that is really close.

A moist environment is required so that the sperm and egg do not

dry out. (it also keeps an egg membrane soft so a sperm can

enter it easily)

Fertilization is only the beginning of animal reproduction; the

resulting zygote must develop into an independent individual.

1. What is mating?

2. Fertilization occurs when ? .

3. Why do some animals mate only once each

year?

4. A ? environment is required during

fertilization.

1. Mating is when two members of a

population come together to combine

their gametes for fertilization.

2. Fertilization occurs when a sperm meets

an egg of the same species or of one

that is really close.

3. So that when their offspring arrive, they

arrive in favourable conditions.

4. Moist

Some organisms reproduce externally too!

External fertilization is when the egg and sperm meet outside of the

parent organism.

An example of external fertilization is the sea anemone. Adult anemones

can not move around, so they reproduce sexually by releasing sperm and

eggs into the water. (this method relies on the water currents to bring

the gametes together

Another example would be that female fish usually lay their eggs in

clusters, and then the male sprays them with sperm to fertilize them.

Internal fertilization is when the egg and sperm meet inside one of the

parent organisms.

An example of internal fertilization is human and polar bear

reproduction.

Internal fertilization is primarily found in land animals; external

fertilization is most commonly found in air and sea animals.

1. What is external

fertilization?

2. What is internal

fertilization?

3. Give an example of each.

(animal)

1. External fertilization is when the egg

and sperm meet outside of the parent

organism.

2. Internal fertilization is when the egg and

sperm meet inside one of the parent

organisms.

3. Answers may vary. Expected responses

include the sea anemone and fish for

external; humans and polar bears for

internal.(There are many more

possibilities.)

It is considered a mutation for

humans to be hermaphrodites.

The term "hermaphrodite" derives from Hermaphroditus,

the son of Hermes and Aphrodite in Greek mythology, who

was fused with a nymph, Salmacis, resulting in one

individual possessing physical traits of both sexes.

Hermaphrodites are organisms that have both female and

male reproductive organs in each individual. Examples of

this would be flatworms and earthworms.

During mating, each planarian (the name given to non-

parasitic flatworms) injects sperm into a reproductive pore

on the other’s body. Each planarian then lays fertilized

eggs.

Hermaphrodite is used in botany to describe a flower that

has both staminate (male, pollen-producing)

and carpellate (female, ovule-producing) parts.

1. What does the term hermaphrodite

originate from? (state the type of

mythology)

2. What is the definition of

“hermaphrodite”?

3. How can the word hermaphrodite be

used in botany?

1. The word “hermaphrodite” originates from

Greek mythology.

2. Hermaphrodites are organisms that have

both female and male reproductive organs.

3. The term hermaphrodite is used

in botany to describe a flower that has

both staminate (male, pollen-producing)

and carpellate (female, ovule-producing)

parts.

Did you know that seeds are the products

of sexual reproduction in most plants?

A seed is a complete reproductive package that

contains an embryo, a food supply, and a seed

coat. It is also the product of sexual

reproduction in most plants.

Scottish botanist Robert Brown was the first to

classify seed-bearing plants into two major

groups based on seed structure. They are split

into two sections, namely: Angiosperms and

gymnosperms.

Angiosperms are flowering plants.

Gymnosperms are non-flowering plants.

Keep in mind that plants do not fit into those two

categories.

1. What is usually the product of sexual

reproduction in plants, and what does it

contain?

2. What are the two different categories

plants can be categorized into?

3. Give a rough general explanation of what

separates the two categories.

1. Seeds are usually the product of plant sexual

reproduction, and they contain an embryo, a

food supply, and a seed coat.

2. Plants can be classified into gymnospheres, and

angiosperms.

1. The major difference between these two

categories is that angiosperms produce flowers,

and gymnosperms do not.

Angiosperms make great gardens!

Over half of all known plant species are angiosperms.

(flowering plants) Some, such as a sunflower, produce

showy flowers, while others, such as grasses, produce tiny

flowers that are often overlooked.

All flowers have the same function. That is, they all

contain the plant’s reproductive organs. The female

reproductive organ is called the pistil, and the male’s is

called the stamen.

Pollen grains from the anthers (a part of the plant) must

reach the stigma of the pistil before seeds can develop.

In self-pollination, both female and male gametes come

from the same plant. In cross-pollination, gametes from

different species reproduce. This means that the pollen

from one flower is transfered to a flower on a different

plant.

1. What exactly are angiosperms?

2. Give two examples of angiosperms.

3. Name the reproductive organs found in an

angiosperm? State the male organ first,

then the female.

4. How are seeds created/ how do

angiosperms reproduce? What goes on in

the plant?

5. From the information gathered, what can

angiosperms be considered as? HINT: it

starts with an H.

1. Angiosperms are, in the simplest

explanation, flowering plants.

2. Answers may vary. Sunflowers, tulips,

grasses, etc.

3. Stamen, pistil.

4. Pollen grains from the anthers (a part of

the plant) must reach the stigma of the

pistil before seeds can develop.

5. Angiosperms can be considered as

hermaphrodites.

a Ever seen a pinecone?

That’s a seed of a

gymnosperm!

Unlike angiosperms, gymnosperms do not produce

flowers. Instead, most gymnosperms produce seeds

inside cones.

Gymnosperm seeds have a coat that protects them

from dehydration.

In some gymnosperm species, male and female cones

are produced on separate trees. However, in the most

familiar species, the same tree produces both types

of cones.

Like an angiosperm, the seed of a gymnosperm

contains an embryo, a food supply, and a coat that

protects it from drying out. However, the seed is not

contained in a fruit.

1. What differentiates a gymnosperm from an

angiosperm?

2. Are gymnosperm seeds produced on the

same tree, or on separate trees? **tricky,

be careful!

3. Seeds of gymnosperms are similar to seeds

of angiosperms. What do they contain?

1. Unlike angiosperms, gymnosperms do not

produce flowers. Instead, most

gymnosperms produce seeds inside cones.

2. In some gymnosperm species, male and

female cones are produced on separate

trees. However, in the most familiar

species, the same tree produces both types

of cones.

3. Like an angiosperm, the seed of a

gymnosperm contains an embryo, a food

supply, and a coat that protects it from

drying out.

Hopefully you learned at least one thing, and have a HAPPY DAY!