INFORMATION TO USERS
This manuscript has been reproduœd from the microfilm master. UMI films the
text directly from the original or copy submitted. Thus. some thesis and
dissertation copies are in typewriter face, while others may be from any type of
cornputer printer.
The quality of this reproduction is dependent upon the quality of the copy
submitted. Broken w indistinct print, colored or poor quality illustrations and
photographs. print bleedthrough, substandard margins, and improper elignment
can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and
there are missing pages, these will be noted. Also, if unauthorized copyright
material had ta be removed, a note will indicate the deletion.
Oversize materials (e-g., maps, drawings, charts) are reproduœd by sedioning
the original, beginning at the upper left-hand corner and continuing from left to
right in equal sections with small overlaps. Each original is also photographed in
one exposure and is induded in reduced form at the back of the book.
Photographs induded in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6" x 9" black and white photographie
prints are available for any photographs or illustrations appearing in this copy for
an additional charge. Contact UMI directly to order.
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA
800-521 -0600
THE INTER-RELATION OF TGF-fZ, LC3 AND
APOLIPOPROTERY D IN THE FETAL LAMJ3
DUCTUS ARTERIOSUS
Andrea F. Burry
A thesis submitted in conformitiy with the requirements for the Degree of
Master of Science in the Graduate Department of Laboratory Medicine and
Pathobiology at the University of Toronto
O Copyright by Andrea F. Burry, 1998
National Library 1*1 of Canada Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Street 395. rue Wellington OttawaON K1AON4 OttawaON K1AON4 Canada Canada
Your fi& Votre reftirence
Our fi& M f r e r é f . c e
The author has granted a non- L'auteur a accorde une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de
reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otheMrise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
THE INTER-RELATION OF TGF-B, LC3 AND APOLIPOPROTEIN D IN THE
FETAL LAMB DUCTUS ARTERIOSUS
Mastex of Science, 1998
Andrea F. B q
Department of Laboratory Medicine and Pathobiology, Cardiovascular
Sciences Collaborative Program, University of Toronto
Intima1 cushion formation in the fetal ductus arteriosus (DA) is
characterized by the abnormal migration of smooth muscle cells (SMC)
from the media1 layer of the vesse1 wall to the intima, where they
proliferate and produce abundant extracellular matrix (ECM). The
'migratory' SMC phenotype is modulated by elevated synthesis of
hyaluronan (HA) by endothelial cells (EC) and fibronectin (FN) by SMC.
Increased DA EC HA synthesis is regulated by elevated levels of
transforming growth factor431 (TGF-BI). Both the increased synthesis of
TGF-BI by EC and FN by SMC are govemed by post-transcriptional
mechanisms. The specific molecular mechankm regulating TGF-Bl has yet
to be determined. We have however, shown that there is increased
efficiency of translation of FN mRNA related to enhanced ribosome
recruitment as a result of an interaction between a microtubule associated
-RNA binding protein, light chain 3 (LC3) of microtubule associated proteinç
1A and 1B and an AU-rich element (ARE) in the 3' untranslated region
(UTR) of the FN mRNA.
Current Iiterature suggests that TGF-BI stabilizes microtubules by
stimulating synthesis of a factor, which could be a microtubule associated
protein. This thesis therefore investigated whether there was evidence t'or
regulation of TGF-Bl by LC3 and/or reciprocal regulation of LC3 by TGF-RI.
We found that DA EC have a greater amount of LC3 compared to Ao EC and
this can be increased in both DA and Ao EC by the addition of exogenous
TGF-BI. These findings are consistent with the interpretation that TGF-B1
could regulate HA synthesis by a LC3-dependent mechanism. Further
investigation would require extensive characterization of the family of HA
synthase genes whidi have only recently been cloned.
Since LC3 regulates the migratory SMC phenotype by increasing the
translational efficiency of FN mRNA, we addressed whether other SMC
genes associated with ce11 motility might be similarly regulated. Using an
LC3 protein affinity column and incubating it with RNA harvested from
adult rat brain (a rich source of microtubule associated proteins) we found
that one of the bound transcripts encoded the 3'UTR of apolipoprotein (apo)
D, which contains an ARE-like element (UUAUUUCUU). This protein has
been previously described as associated with nerve regeneration and reverse
cholesterol transport but has not been shown to be present or hctionally
important in vascular smooth muscle cells. We found increased
production of apo D in DA compared to Ao SMC as assessed by western
immunoblot. Subsequently, we showed by cornpetitive RNA gel mobility
shift assays with unlabeled ARE-like RNA oligonucleotides, that
recombinant LC3 c m bind the ARE-like element in apo D mRNA, as can a
factor (possibly LCS) in the cytoplasmic extracts. However, the form of LC3
in the cytoplasmic extracts does not appear to access the ARE-like element in
context of the full length apo D 3'UTR, because this binding complex
fornation could not be competed.
SMC apo D might be important in
assays on monolayers and
To address whether the increase in DA
cell migration, we carried out wounding
assessed apo D production by
immunohistochemistry and confocal microscopy. There was increased
perinuclear expression of apo D in the leading edge of the monolayer in
association with migrating smooth muscle cells. Taken together, these
studies suggest that apo D might be important in SMC motility, but the
manner in which it is regulated by native LC3 appears to differ from that
established for FN mRNA.
ACKNOWLEDGMENTS
First and foremost, I would like to express my deepest gratitude to my
supervisor, Dr. Marlene Rabinovitch, for her support and encouragement
over the past bvo years. It has been a privilege to work in the Laboratory of
su& a dedicated and talented Physician-Scientist and to benefit from her
knowledge and experience.
I would also like to thank the mernbers of my advisory committee for
their time spent and suggestions given over the course of my Masters' work:
Dr. Eva Turley, Dr. Liliana Attisano, Dr. Gabrielle Boulianne, Dr. Fred Keeley,
and Dr. Duncan Stewart. 1 would also like to thank Dr. Norman Rosenblum
for his prescence and input at my examination.
1 thank al1 the members of the Rabinovitch lab, for 1 have undoubtedly
"picked al1 of their brains" at one time or another over the past two years. 1
am especially grateful to Dr. Bin Zhou who "taught me everything 1 know"; 1
don't know what 1 would have done without him! His unselfish manner
and constant willingness to help (despite having a million of his own things
to do) is something that 1 will always remember. 1 also thank Claire Coulber,
the "super-technician" and "chef-extraordinare" for al1 of her assistance (and
cookies!) and Dr. Peter Lloyd Jones for his wit as weil as his scientific
expertise. I am also indebted to Joan Jowlabar for al1 the time she spent
preparing applications, making posters and slides, always ensuring that the
"pink dots were inside the box" and Susy Taylor for checking my spelling and
.grammar.
1 would like to thank my parents, Benjamin and Elizabeth Burry for
their love and support during this academic and al1 other endeavors
throughout my life. My achievements are a reflection of their
encouragement and faith in my abililites.
1 also thank Christopher Tan for his unconditional love and "strong
shoulders" upon which 1 have had to lean several times over the past two
(make that three) years. His enthusiasm to research and dedication to science
were constant sources of inspiration for me and they kept me going through
the difficult times.
Finally, 1 thank my housemate and friend Arvind Nanda fer his
excellent advice, for making me laugh and for exposing me to the realities of
rnedicine (and also for keeping his Macintosh computer so that 1 could write
my thesis at home). 1 also thank Linnea Humphrey and Leith Drury for being
two of the most wonderful frienddtraining partners that I could ever hope to
find.
TABLE OF CONTENTS
TABLE OF CONTENTS
LIST OF FIGURES
ABBREWATIONS
INTRODUCTION
Overview
Duchis arteriosus as a mode1 to study neointimal thickeriing
Ductus arteriosus
Vasdar neointima
Intima1 cushion formation
Extracellular matrix-vascular ceU interactions
Transforming growth factor4
TGF-i3 as a regdator of extracellular mat*
TGF-B regulates microtubules
Hyaluronan
Fibronectin
Fibronectin is regulated by microtubule associated protein, LC3
Regdation of genes by AU r i c h elements
Microtubule associated proteins
Apolipoprotein D
Rationale for the studies described in th is thesis
.-- V l l l
.HYPOTHESES AND OBJECTIVES
MATERIALS AND METHODS
. . . V l l l
RESULTS 1
LC3 expression is increased in 100-day fetal lamb DA vs. Ao EC
LC3 expression cm be enhanced by exogenous TGF-B
TGF-f3 is dissociated from LC3 in HT1080 ce&
RESULTS II
The regdation of other genes by LC3
ApoD expresssion k greater in DA SMC compared to Ao SMC
LC3 appears to modulate apoD production
L W and DA SMC extracts bind to the 3'UTR of apoD
ApoD localizes to the perinuclear region of migrating DA SMC
DISCUSSION
FUTURE STUDIES
REFERENCES
LIST OF FIGURES
Figure 1. Anatomic features of ductus artenosus
Figure 2. Sdimatic sumrnary of mechanisms related to DA neointimal formation
Figure 3. FN is regulated at the post-transciprtional level
Figure 4. Basal LC3 expression is higher in DA than AO endothelial cells
Figure 5. LC3 expression is enhanced by exogenouç TGF-B
Figure 6. TGF-B enhances LC3 expression in hurnan fibroblast cells in a dose-
dependent manner
Figure 7. Neutralizing antibodies does not decrease basal LC3 expression in
human fibroblasts
Figure 8. Neither TGF-LI or TGF-8 neutralizing antibodies were able to induce
the expression of LC3 in a human fibrosarcoma cell line, HT1080
Figure 9. RHAMM expression is similar in wild-type and LC3 transfected
HT1080 ceUs
Figue 10. PCR amplification of RNA obtained from protein columns
Figure 11. 3'UTR sequence of rat apo D mRNA
Figure 12. Amplification of apo D 3'UTR using sequence specific primers
Figure 13. Apo D expression is greater in DA SMC compared to Ao SMC
F i g u e 14. Apo D expression is greater in LC3 transfected HTlOSO cells
Figure 15A. DA SMC SlOO extract binds to the ARE-like element in apo D
Figure SB. Recombinant LC3 and a protein in $100 exhact bind to the full
length apo D 3'UTR
Figure 16. Confocal microscopy of apo D in migrating DA SMC
Figure 17. Apo D expression in migrating ceus is present in the perinudear
region 12 hours after wounding and remains high at 48 hours.
LIST OF ABBREWATIONS
A, adenosine
Ao, aorta
Apo D, Apolipoprotein D
ARE, AU-rich element
AUBF, adenosine-uridine binding factor
C, cytosine
CAT, chlorampenicol acetyl transferase
DA, ductus arteriosus
DTT, dithiothreitol
EC, endothelid c e k
ECL, enhanced cherniluminescence
ER, endoplasmic reticulm
FBS, fetal bovine senun
FITC, fluorescein isothiocyanate
FN, fibronection
G, Guanosine
GM-CSF, granulocyte macrophage colony-stimulating factor
GST, glutathione Strançferase
HA, hyaluronan
HDL. high dençity lipoprotein
HRP, Horseradish peroxidase
JC3, Iight Chain 3
LDL, low density lipoprotein
hW, microtubule associated protein
PA, pulmonary artery
PAGE, polyaqlamide gel electrophoresis
PBS, phosphate-buffered saline
PCR, polymeraçe diain reaction
PVDF, polyvinyldifluoride transfer membrane
RHAMM:, receptor for hyaluronan-mediated motility
RT, reverse transcriptase
SDS, sodium dodecyl sulfate
SMC, smooth muscle cells
TBE, Tris-borate EDTA
TGF-O, transforming growth factor4
3'UTR, 3' untranslated region
U, uridine
INTRODUCTION
Light chah 3 (LC3) of microtubule associated proteins 1A and 1 B has
recently been shown by our laboratory to act as a RNA binding protein.
Specifically, it interacts with an AU rich element (ARE) in the 3' untranslated
region (UTR) of the fibronectin (FN) mRNA and increases its translational
efficiency. This thesis investigates the regulation of LC3 by transforming growth
factor (TGF)-B1 in the ductus arteriosus (DA) and aorta (Ao) endothelial cells
(EC), allowing for the possibility that TGF-BI regulates the EC production of
hyaluronan (HA) via an LC3 related mechanism. As well, we addressed the
question of whether LC3 is involved in the regulation of other genes that are
expressed in motile smooth muscle cells (SMC). The following introduction
therefore first describes the DA as a mode1 of neointimai formation,
emphasizing cell-matrix interactions and the role of TGF-El, HA and FN. The
regulation of TGF-81, HA and other genes in DA is then reviewed, followed by a
discussion of TGF-81, with an emphasis on its effects on matrix and
microtubules. Next, the regulation of FN by LC3 will be outlined, followed by an
examination of regulation of other genes via ARE elements. Microtubule
associated proteins and their functions will then be discussed. In view of our
findings, a review of the current knowledge regarding apolipoprotein D is
included.
Ductus Arteriosus as a Mode1 to Study Neointimal Thickening
Ductus Arteriosus
The ductus arteriosus (DA) is a fetal blood vesse1 bridging the aorta (Ao)
and pulmonary artery (PA) that serves to divert the right ventricular output
away from the uninflated lungs and back into the systemic circulation (Figure 1).
Closure of the DA shortly after birth, as blood enters the newly inflated lungs,
ensures a proper transition from pre-natal to post-natal circulation. Failure of
the DA to close results in excess pulmonary blood flow and is associated with
pulmonary hypertension, congestive heart failure, and cardiac hypertrophy
(Cassels and Moore, 1973). The DA starts to close at birth with a strong vascular
constriction that is triggered by the onset of breathing. This constriction is
oxygen-dependent and is regulated by a cytochrome-P450-mediated mechanism
(Coceani et aL, 1988) which involves the production of endothelin (Coceani rt ni.,
1994). This initial muscular constriction is soon followed by a complete
anatomical closure which is dependent upon the formation of preexisting
structures, known as 'intimal cushions', which develop in the fetal DA during
late gestation (Gittenberger-de-Groot et al., 1980) (Gittenberger-de-Groot et d l . ,
1985).
Vascular neointima
While a developmental program governs intimal cushion formation in
the DA, a pathologie process which results in a thickened intima or 'neointima'
.and is also associated with atherosclerosis (Ross, 1986) (Ross, 1993) and
pulrnonary hypertension (Reviewed in Rabhovitch, 1996) occurs in response to
injuries reçulting from angioplasty, venous and prosthetic bypass grafts, and
endarterectomy (Chervu and Moore, 1990) (Ip et al., 1990). In al1 these
Figure 1: Anatomic features of ductus arteriosus
The ductus arteriosus (within green circle), connects the aortic arch and
pulmonary artery and develops intima1 cushions (indicated by arrow) during late
gestation.
pathological situations the neointima is characterized by the abnormal migration
and proliferation of smooth muscle cells (SMC) into the subendothelial space
and the accumulation of extracellular matrix (ECM) components. The restenosis
that follows coronary balloon angioplasty, a procedure by which obstructed
arteries are mechanically dilated with a balloon catheter in order to restore blood
flow (Ohno et al., 1994) (Chang et al., 1995), is characterized by the rapid
production of a neointima within a few months (Liu et al., 1989) (Schwartz et al.,
1992) (Ferrell et al., 1992). Since neointimal formation
problem associated with a wide spectrum of common and
disorders, several models have been developed to shidy its
is a major clinical
uncornmon vascular
pathogenesis, one of
which is the rat carotid balloon injury model. This model has been successful in
elucidating the proliferative characteristics of SMC but has been less helpful in
studying the features of SMC migration or ECM production.
The biochemical and cellular events associated with intimal cushion
formation in the DA are relevant to pathological intimal thickening in that there
is increased expression of growth factors, alterations in ECM production and a
switch of SMC phenotype from a 'contractile' to a 'synthetic and migratory' state.
In this respect, study of the mechanisms involved in intimal cushion formation
in the DA will not only potentially aid in the clinical management of patent DA,
but will also provide insight into the pathologie processes underlying
development of the neointima in abnormal vessels.
Intimal Cushion Formation
Intimal cushion formation begins at the pulmonary end of the vesse1 and
continues toward the aorta (Gittenberger-de-Groot et al., 1985). The nature of
intimal cushion formation has been studied in humans (Gittenberger-de-Groot
et aL, 1980) (Gittenberger-de-Groot et al., 1980) (Silver et al., 1981) and in a
number of animal species, including mouse (Tada and Kishimoto, 1990) (Colbert
et al., 1996), dog (Gittenberger-de-Groot et al., 1985) (Dereeder et al., 1988), rabbit
(Yoder et al., 1978) and lamb (Rabinovitch et al., 1988) (Strengers, 1988)
(Rabinovitch et al., 1989) (Zhu et al., 1993) (Boudreau and Rabinovitch, 1991)
(Boudreau et al., 1991) (Hinek et al., 1991) (Boudreau et al., 1992) (Hinek and
Rabinovitch, 1993). The proceçs is initiated in the intima where it appears that
accumulation of ECM components separates the EC from the interna1 elastic
lamina. Smooth muscle cells from the muscular media of the vesse1 wall then
migrate into this matrix-enriched subendothelial region and contribute to the
formation of the intimal cushion.
Extracellular matrix - vascular ce11 interactions
Sequential morphological studies addressing intimal cushion formation
in the human and dog DA revealed that in addition to the matrix proteins
fibronectin (FN) and collagen III (Dereeder et al., 1988), hydrophilic
glycosaminoglycans are the major contributors (Dereeder et al., 1988) (Slomp et
al., 1992) to the expanded subendothelial space (Gittenberger-de-Groo t et al.,
1985). Glycosaminoglycans, specifically hyaluronan (HA), provide the water-
bound and matrix-enriched environment which favors SMC migration. In the
fetal lamb a: 115-days of gestation (term is 145 days) accumulation of
glycosarninoglycans in the DA subendothelial space, irnpaired assembly of elastic
laminae and migration of SMC from the media1 layer into subendothelial space
are evident.
Using primary EC and SMC cultures from the fetal lamb, our laboratory
has investigated the biosynthesis of ECM components and their role in SMC
migration (Boudreau and Rabinovitdi, 1991) (Boudreau et al., 1991) (Hinek et al.,
1991) (Hinek e t al., 1993) (Hinek and Rabinovitch, 1993) (Figure 2). Our
laboratory has shown that there is increased synthesis of glycosaminoglycans,
especially HA, as well as their incorporation into the ECM in DA EC compared to
Ao and PA EC. Synthesis of FN and chondroitin sulfate in DA SMC is also
increased relative to that observed in PA and Ao cells. These DA-specific
differences in ECM production are apparent in 100-day fetal lamb cells, before the
appearance of intimal cushions. The highly synthetic activities of DA EC and
SMC at this early gestation time-point appear to produce the matrix-enriched
environment that facilitates SMC migration into the subendothelial space and
ultimately leads to the formation of the intimal cushions. The changes that
occur in both EC and SMC that lead to intimal cushion formation appear to be
orchestrated by TGF-B.
Transfonning growth factor B
Transfonning growth factor-beta (TCF-S) is a member of the polypeptide
growth factor family that controls embryonic development and tissue
homeostasis. It was originally isolated from human platelets (Assoian et nZ.,
1983), human placenta (Frolik et al., 1983), and bovine kidney (Roberts et fil.,
1983). Three isoforms (TGF-f31, TGF-132, TGF-f33) exist in mammals with 60% to
80% identity (Massague, 1990). They are disulfide-linked homodimeric peptides
with a moiecular weight of 25 kD. In this thesis, 1 will be dealing solely with
TGF-El and 1 will refer to it as TGF-f3.
TGF-B was first described as a factor that was capable of inducing
.anchorage-independent growth of fibroblasts (Roberts et al.,, 1981). The term
'growth factor' is somewhat of a misnomer as it is now known that TGF-B is
capable of either stimulating or inhibiting ce11 growth and/or differentiation
depending on the ce11 type and the surrounding environment. TGF-B plays a
critical role in embryonic development as well as in the repair process following
tissue injury, likely due to its ability to stimulate the production of ECM proteins
and also to increase the expression of receptors that mediate cellular interactions
with ECM (Lyons and Moses, 1990) (Massague, 1990) (Sporn and Roberts, 1992)
(Rizzino, 1988). TGF-B ako elicits changes in ce11 morphology that are associated
with a reorganization of the cytoskeleton which may be related to ceIl motility
(Gagelin et al., 1995) (Eghbali et al., 1991) (Humes et al., 1993) (Serra et al., 1992).
The presence and potential influence of TGF-B as a stimulator of ECM
synthesis (Roberts and Spom, 1989) (Amento and Beck, 1991) has been assessed
during the development of intima1 cushions and closure of the DA (Boudreau et
al., 1992) (Tannenbaum e t al., 1996). Our laboratory has demonstrated by
immunohistochemistry that there is increased TGF-B in DA compared to Ao
tissues from 100-day gestation fetal lambs (Boudreau et al., 1992). The role of
TGF-B in the synthesis of ECM proteins has been studied in cultured EC and SMC
from the fetal lamb DA and it has been shown that the increased synthesis of HA
in DA compared to Ao EC is TGF-B-dependent, since a TGF-IJ neutralizing
antibody reduced synthesis of HA in the cultured DA EC to the levels observed
in Ao EC, but had no effect on its synthesis in the Ao EC. However, unlike O ther
studies showing that TGF-B increases FN expression by enhancing its
transcription and mRNA stability (Dean et al., 1988) (Kahari et al., 1991) (Kahari
et al., 1992), we could not confirm that the enhanced FN synthesis in DA SMC
was mediated by TGF-B. We did however, uncover a post-transcriptional
mechanism which increases FN mRNA translation which will be discussed
below (Boudreau et al., 1992).
Figure 2: Schematic summary of mechanisms related to DA neointimal
formation.
Intima1 cushion formation in the DA involves changes in both the EC and SMC
layers. TGF-8 is upregulated in DA EC, stimulating the accumulation of
glycosaminoglycans (GAGS) such as hyaluronan (HA) and chrondroitin sulfate
in the subendothelium. Chrondroitin sulphate leads to impaired elaç t in
assernbly and the elastin peptides that result may be responsible for the
upregulation of fibronectin (FN). Increased FN production changes the SMC
phenotype from contractile to migratory, facilitating the migration of the SMC
through the elastic laminae into the GAG rich environment, leading to the
formation of intima1 cushions which protrude into the vesse1 lumen. SMC also
increase their expression of a cell surface HA binding protein known a s
RHAMM, the receptor for HA mediated motility.
TGF-B as a regulator of ECM
The influence of TGF-B on vascular remodeling has been studied with
respect to its ability to stimulate matrix synthesis (Amento and Beck, 1991)
(Rasmussen et al., 1995). For example, it has been shown in a number of studies
that exogenous TGF-O induces synthesis of collagen and FN (Ignotz and
Massague, 1986) (Pierce et al., 1989). Cultured Ao SMC isolated from the
pathologie neointima express higher levels of TGF-S mRNA and are stimulated
by TGF-B to produce more proteoglycans compared to SMC isolated from the
normal vessel wall (Rasmussen et al., 1995). TGF-B also stimulates collagen 1 and
IKI synthesis in human vascular SMC (Amento and Beck, 1991) (Villarreal et ni.,
1996). The direct evidence for the participation of TGF-B in the development of
the vascular neointima cornes from in vivo experiments in which infusion of
TGF-B (Kanzaki et al., 1995) or direct transfer of the TGF-B gene (Nabel et al.,
1993) into the vessel wall induced intimal hyperplasia, due mainly to the
production of ECM components, such as proteoglycans, collagens, and FN.
Conversely, TGF-II antibodies suppressed intimal hyperplasia by reducing
accumulation of ECM components (Wolf et al., 1994). Molecular mechanisms
governing TGF-B-induced matrix protein synthesis have been elucidated at the
transcriptional (Kahari et al., 1991) (Marigo et al., 1993), post-transcriptionai
(Kahari e t al., 1991) (Wrana et al., 1991) (Kahari et al., 1992) (Marigo et al., 1993)
and translational levels (Fine and Goldstein, 1993). For example, Kahari et al.
(Kahari et al., 1991) showed that TGF-B increased mRNA levels of type IV
collagen and FN in a time and dose-dependent manner in the human
fibrosarcoma ce11 line HT-1080. In addition, Marigo et al. (Marigo ef al., 1993)
showed that TGF-B stimulated the transcription of elastin in HT1080 and NIH
3T3 cells. Kahari et al. (Kahari et al., 1992) have also shown that TGF-B increases
transcription and stability of elastin mRNA in human skin fibroblasts. They
f o m d that TGF-I3 enhanced steady state levels of elastin mRNA in a dose-
dependent marner. When transcription was blocked, cells that were treated
with TGF-B had mRNA levels six times higher than those of untreated cells after
10 hours of incubation, indicating that TGF-B also increases mRNA stability.
Wrana et al (Wrana et al., 1991) have also shown that TGF-i3 increases both the
transcription and stability of FN mRNA and type 1 collagen mRNA in human
fibroblast cells. Fine and Goldstein (Fine and Goldstein, 1993) have
demonstrated by in vitro translation assay that TGF-P causes a 2-3 fold increase in
type I collagen in human lung fibroblast cultures compared to the in vitro
translation of RNA in unstimulated cells.
TGF-B regulates microhibules
TGF-B elicits changes in ce11 morphology that are associated with a
reorganization of the cytoskeleton which may be related to ce11 motility. One of
the ways in which TGF-B affects the cytoskeleton is through microtubules,
components of the cytoskeleton that are found in almost every cell.
Microtubules are dynamic structures consisting of tubulin and a variety of
microtubule associated proteins (MAP) and play a role in activities such as
mitosis, intracellular vesicle transport and determination of ce11 shape and
motility (Gelfand and Bershadsky, 1991). TGF-f3 has also been shown to increase
the stability of microtubules in NM-3T3 fibroblast cells (Gundersen et al., 1994).
It has been well documented that when fibroblasts in culture are induced to
migrate into a wound, they generate stable microtubules that are oriented in the
direction of migration. Gundersen et al. (Gundersen et al-, 1994) showed that this
does not occur if the cells are maintained in serum-free medium. The serum
factor that is responsible for the induction of the stable microtubules appears to
be TGF-8. They were unable to further determine whether TGF-B stimulates the
formation of stable microtubules through a post-translational mechanism, or
through the increased synthesis of a microtubule stabilizing factor.
Similarily, Gagelin et al. (Gagelin et al., 1995) have shown that TGF-B
causes a rearrangement of the cytoskeleton and induces the formation of
lamellipodia in astrocytes, suggesting an influence of TGF-B on cell migration. It
is therefore likely that TGF-II can orchestrate as complex a process as ce11
migration by regulating both cell shape and production of rnatrix cornponents
such as HA.
Hyaluronan
Hyaluronan is a high molecular weight polysaccharide that is ubiquitously
expressed in ECM. HA has the capacity to bind large amounts of water which
results in expansion of the tissue space and allows for easy movement of cells
into this area (Toole et al., 1984). HA directly promotes migration by
accumulating in the extending laniellae of motile cells (Turley et al., 1991).
Interaction of HA with its ce11 surface receptor, hyaluronan binding protein
(renamed the receptor for hyaluronan-mediated rnotility or RHAMM)
(Hardwick et al., 1992), also promotes ce11 migration in a HA-rich environment
(Turley and Torrance, 1985). For example, DA SMC synthesize greater amounts
of RHAMM than Ao SMC and supplementation of collagen gels with HA
selectiveiy enhances the migration of DA SMC but not Ao SMC. Further,
addition of antibodies against RHAMM selectively inhibits migration of DA
SMC compared to Ao SMC. DA SMC also produce increased amounts of
RHAMM in their lamellipodia at the leading edges of the cells (Boudreau et al.,
1991).
TGF-B is known to stimulate the accumulation of HA (Toole et al., 1989).
TGF-B also induces the transcription, synthesis and membrane expression of
RHAMM (Samuel et al., 1993) (Arnara et al., 1996). Together, these facts point to
an essential role of TGF-% in ce11 migration (Toole et al., 1989), wound healing
(Ellis and Schor, 1996) and neointimal formation. The ability of DA SMC to
migrate in collagen gels was shown to be dependent not only on their expression
of RHAMM but alço on their increased synthesis of EN (Boudreau et al., 1991).
Fibronectin
Severd roles have been attributed to FN in formation of the vascular
neohtirna. This glycoprotein has been shown in primary SMC cultures to
modulate SMC phenotype from contractile to synthetic, associated with the
formation of a widespread rough endoplasmic reticulum, prominent Golgi
apparatus and increased RNA and protein synthesis (Hedin and Thyberg, 1987)
(Hedin et aL, 1988). The RGD (Arg, Gly, Asp) ce11 binduig motif in FN appears to
be important in mediating the phenotypic transformation çince incubation of
cultured SMC with RGD peptides blocks the FN effect and SMC maintain their
contractile phenotype (Hedin et al., 1988). Interaction of FN with its integrin
receptor, agL31, on the surface of vascular EC and SMC in vivo also plays a role
in modulating the synthetic phenotype, thereby elevating synthesis of ECM
components, growth factors, and their receptors (Pauletto et nl., 1994).
Fibronectin has also been implicated in the regulation of SMC migratory
behavior, a prominent feature of neointimal formation. Migration of SMC
during neointimal formation occurs along a FN gradient via interaction of FN
with a5B1 integrins (Thyberget al., 1990). This is supported by the fact that FN
synthesis is increased shortly after vascular injury and is deposited mainly in the
immediate subendothelium where the radially oriented SMC are directed to
migrate (Jones et al., 1997). In three-dimensional collagen gels, our group has
shown that enhanced DA compared to Ao SMC migration is related to elevated
synthesis of FN since RGD peptides or FN antibodies, abrogate the response
(Boudreau et al., 1991) (Boudreau and Rabinovitch, 1991).
Fibronectin is regulated by microtubule associated protein, LC3
It has been shown that the increase in DA SMC FN production is not a
result of increased FN mRNA levels or mRNA stability (Boudreau et al., 1992),
but is due to a post-transcriptional mechanism, namely the enhanced
translational efficiency of FN mRNA in DA verus Ao SMC. Our laboratory has
demonstrated that the mechanism of increased translational efficiency is due to
an interaction of a 15kD RNA binding protein with an AU rich element in the
3'UTR of the FN mRNA (Figure 3). This 15kD protein has been purified and
identified as light chah 3 (LC3) of microtubule associated proteins 1A and 1 B
(Zhou et al., 1997), originally described by Mann and Hammarback (Mann and
Hammarback, 1994).
Regulation of genes by AU n c h elements
The importance of AU-rich elements (ARE) in the 3'UTR in the post-
transcriptional regdation of eukaryotic gene expression was first noted in
experiments investigating the c-fos gene, where it was discovered that removal
of the 67-nt AT-rich sequence in the 3'UTR stabilized the labile mRNA and
conferred a transforming phenotype on cells (Meijlink et al., 1985). Further, an
AU-rich sequence derived from granulocyte-macrophage colony-stimulating
factor (GM-CSF) inserted into the 3'UTR of the LZ-globin mRNA, significnntly
shortens its long half-life (Shaw and Kamen, 1986). Subsequent observations by
Figure 3. FN is regulated at the post-transcriptional level
The post-transcriptional mechanism which underlies the enhanced FN synthesiç
in SMC is the interaction of a 15kD cytoplasmic RNA binding protein
(microtubule associated protein, light chain 3, or LC3) with an AU rich element
in the 3'UTR of FN mRNA.
Caput et al. (Caput et al., 1986) discovered that the ARE sequence, UUAUUUAU,
is present in the 3'UTR of a variety of idammatory mediators and immediate
early response genes such as cytokines and oncogenes as weil as FN. Since then,
the presence of the ARE has been shown to be involved in the high rate of
transcript turnover in a large number of labile mRNAs. For example, c-myc
mRNA is very unstable, having a half life of only 30 minutes or less. Using
deletion consmicts, Jones and Cole (Jones and Cole, 1987) determined that an AU
rich region within exon 3 of the c-myc mRNA was responsible for its high rate
of tumover, since when this region was deleted, its half life was dramatically
increased. Whittemore and Maniatis (Whittemore and Maniatis, 1990)
investigated the AU-rich element in the 3'UTR of the interferon (1NF)-f3 mRNA
by linking the IFN-I2 promoter to the transcription unit of the human growth
hormone (hGH) gene and found that the ARE in the 3'UTR made the usually
stable hGH mRNA very unstable. They concluded that this eiement was
therefore responsible for the rapid decrease in the level of IFN-B mRNA after it
has been virally induced.
In addition to its ability to act as an mRNA destabilizer, other studies have
indicated that the ARE is involved in the modulation of mRNA translational
efficiency. For example, Kruys et al. (Kruys et al., 1987) observed that the ARE
present in the 3'UTR of the human IFN-8 mRNA was suppressing mRNA
translation in both Xenopus oocytes and in a reticulocyte lysate. The
replacement of these sequences with those of Xenoprrs f3-globin mRNA resulted
in the increased translation of the IFN-i3 mRNA by 100-fold in Xenoprls oocvtes
and 10-fold in the reticulocyte lysate, without affecting mRNA stability. Further
studies demonstrated that significant translational inhibition could be achieved
in Xenopus oocytes injected with the IFN-I2 mRNA containing only one copy O C
the octanucleotide, UUAUUUAUU. The level of inhibition was enhanced when
the copy number was increased, such that the presence of three copies affected
the mRNA translation to a level comparable to that of the 3'UTR of natural IFN-
B mRNA (Kruys et al., 1989). More recently, a study by Grafi et al. (Grafi et cd.,
1993) also showed that the ARE in the 3'UTR of human IFN-B mRNA acted as
an inhibitor of translation in a cell-free rabbit reticulocyte lysate by mediathg an
interaction with the poly(A) tail. In addition to IFN-B, the ARES containing the
octanucleotide derived from c-fos and GM-CSF have been shown to have the
same inhibitory effects on mRNA translation (Kniys et al., 1989).
The ARE modulation of mRNA stability and translational efficiency iikely
depends on its interaction with tissue-specific cytoplasmic pro teins (Kruys et al .,
1987) (Kruys et al., 1989) (Han e t al., 1990) (Grafi e t al., 1993) (Kruys et al., 1993)
(Jain ef al., 1997). Malter (Malter, 1989) first identified a binding protein in
lymphocyte cytoplasmic extracts which bound to ARE-containing synthetic
mRNAs on gel mobility shift assays and called it the adenosine-uridine binding
factor (AUBF). Further studies demonstrated that AUBF binds to other ARE-
containing labile mRNAs such as GM-CSF, interleukin (IL)-3, INF-y, c-fos, and C-
myc and functions to stabilize them. It has been determined by this study and
others that the minimal length ARE sequence for binding is
UUAUUUA(U/A)(U/A) (Lagnado et al., 1994) (Zubiaga et al., 1995). Several
cytoplasmic RNA binding proteins that bind to the ARE have been identified
and they seem to fa11 into one of two categories. The first group includes
proteins whose binduig activity correlates with rapid mRNA decay, such as
AUFI, first described to be involved in the degradation of c-myc mRNA (Brewer
and Ross, 1988) (Brewer and Ross, 1989). The second group contains proteins
whose ARE-binding activities are associated with stabilization of labile mRNAs,
as well as enhanced mRNA translation such as Hel-NI, a member of the
embrjonic lethal abnormal vision
(Chung et al., 1996) (Gao and Keene,
(Elav)-like protein family (Gao et al., 1994)
1996) (Ma et al., 1996).
The function of the ARE in the 3'UTR of the FN mRNA was addressed by
our laboratory given that the increased expression of FN in DA SMC appeared to
result from an enhanced translational efficiency. This information, coupled
with the evidence indicating a role for the ARE in mRNA stability and
translation of other genes in a variety of ce11 types made it logical to speculate
that the ARE in the 3'UTR of FN mRNA may also be functionally important in
the modulation of mRNA translation in vascular SMC. The difference in the
ability to translate FN mRNA in DA versus Ao SMC might be due to differences
in cytoplasmic factors which could bind to the ARE in the 3'UTR of FN mRNA.
As such, our laboratory has discovered that LC3, present in greater amounts in
the DA SMC compared to Ao SMC, is responsible for the increased translational
efficiency of FN mRNA, thereby ascribing a novel RNA binding function to
previously described microtubule associated proteins (Zhou et al., 1997).
Microtubule associated proteins
The cytoskeletal network found in al1 eukaryotic cells consists of
microtubules, actin and intermediate filaments. Together, these components
interact to determine ce11 shape, intracellular transport and ceil motility. The
cytoskeleton is very dynamic and this characteristic depends in part on
interactions with MAPs, including high molecular weight proteins like MAP 1A
and 1B and smaller components like tau. MAI'S, although found in many cell
types, have been primarily isolated and characterized from brain and have been
shown to be involved in microtubule assembly and stability as well as acting as
mediators for interactions between microtubules and other ce11 components.
MAFs seem to be regulated by phosphorylation such that
increase or decrease their affinity for microtubules,
microtubule assembiy/depolymerization depending
environment and phase of the ceil cycle (Bnigg and Matus,
Cole, 1984) (Shiina et al., 1992).
phosphorylation can
thereby promo ting
on the ce11 type,
1991) (Lindwall and
MAP 1A and lB are a complex of a heavy-chah and multiple light chain
subunits, LCl, LC2 and LC3. LC1 and LC2 are encoded within the 3' end of the
same open reading frames that encode the MAP 1B and 1A heavy chains
respectively while LC3 is encoded by a separate gene (Hammarback et al., 1991)
(Schoenfeld et al., 1989) (Kuznetsov and Gelfand, 1987) (Mann and Hammarback,
1994). The light chains associate with the amino-terminal microtubule-binding
region of the heavy chains. Although it appears that LC3 is always coexpressed
with either MAP 1A or lB, their developmental expression patterns differ. MAP
1% levels are highest in the embryonic brain, MAP 1A is expressed in greatest
amounts in the adult brain while LC3 Ievels are highest in the first 10 days
following birth (Matus, 1988) (Mann and Hammarback, 1996). It therefore
appears that different mechanisms control expression of these genes. Another
MAP, tau protein, expressed predominantly in neuronal axons, is perhaps best
known for the roie it plays in Alzheimer's Disease, where it becomes abnormally
phosphorylated and self-assembles into paired helical filaments, thereby forming
characteristic neurofibrillary tangles (Biemat et al., 1992).
The importance of MAPs in maintaining cellular structure and function is
perhaps best illustrated by gene alteration studies. For example, Edelmann et al.
(Edelmann et al., 1996) showed that heterozygotes for a mutant form of MAP 1 B
have a slow growth rate, visual and motor system abnormalities and abnormal
neuronal dendritic processes. The homozygous genotype is embryonic le thal.
As well, inhibition of tau by antisense RNA results in inhibition of neurite
outgrowth (Caceres and Koçik, 1990). Conversely, expression of tau in cells that
do not normally produce it causes polymerization of stable microtubules that are
resistant to depolymerizing drugs (Takemura et al., 1992) (Lewis et ai., 1989).
Untü recently when Zhou et al. (Zhou et al., 1997) discovered a role for LC3 in
FN mRNA translation, MAPs were not known to have a role in mRNA
regulation. However, these results are not entirely surprishg given previous
studies suggesting that microtubules play a role in targeting, storage, sorting, and
translation of mRNAs in a variety of cells (Singer, 1992) (Steward and Banker,
1992) (Suprenant, 1993) (Wilhelm and Vale, 1993) (Ferrandon et al., 1994) (St.
Johnston, 1995). Further, signals that direct intracellular localization of rnRNAs
via microtubules are found within the 3'UTR of mRNAs (Macdonald and
Struhl, 1988) (Gottlieb, 1992) (Gravis and Lehman, 1992) (Mowry and Melton,
1992). Interactions between microtubules and mRNA may be mediated by factors
which could recognize both consensus sequences in RNA, as well as bind
microtubules and MAI'S. Several such tram- acting factors that recognize a cis
element in the 3'UTR of mRNA and also bind microtubules have b e m reported,
including a spermatid perinuclear RNA-binding protein (Spnr) in mouse male
germ cells (Schumacher et al., 1995) and a rat testis/brain RNA-binding protein
(Han et al., 1995).
Evidence suggests that cytoskeletal structures, includuig microtubules, are
involved in modulating mRNAs which encode cytoskeletal or cytoplasmic
proteins. In addition, it appears that docking of mRNAs ont0 membrane-bound
polysomes could be facilitated by cytoskeletal structures (Rings et al., 1994). LC3,
which was initially cloned from a rat brain cDNA library, CO-localizes with
microtubules in cultured rat neuronal cells, and CO-precipitates with i ~ z vitro
assembled microtubules (Mann and Hammarback, 1994). The dual function of
LC3 as a RNA-binding protein, as well as a MAI? suggests that microtubules and
MAFs may play a role in the translational regulation of other genes in addition
to FN. As such, Our search to find these other genes as revealed in this thesis led
us to investigate the role of apolipoprotein D in ce11 motility.
Apolipoprotein D
Apolipoprotein (apo) D was first described as a "thin-he polypeptide" due
to its appearance on double immunodiffusion experiments with anti-high
density lipoprotein (HDL antibodies (Alaupovic et al., 1972). It was later isolated,
characterized and named by McConathy and Alaupovic (McConathy and
Alaupovic, 1973) (McConathy and Alaupovic, 1976). They described apo D as a
glycoprotein with a molecular weight of approximately 30kD which was present
in HDL on lipoprotein D or lipoprotein A particles (McConathy and Alaupovic,
1976). Apo D is described as a component of plasma in man (McConathy and
Alaupovic, 1973) (McConathy and Alaupovic, 1976) (Drayna et al., 1986), baboon
(Bojanovski et al., 1980) and other species inchding rabbit, dog, cow and sheep
(Provost et al., 1990). In contrast to other apolipoproteins, the expression of apo
D is unique in that it is found in other organs besides the liver and intestine
(Provost et al., 1990) (Drayna et al., 1986). In fact, apo D levels in the spleen are 59
times higher than that in the liver (Provost et al., 1990). Other organs that have
high levels of apo D include the adrenals, lung, brain and heart. It has also been
demonstrated by in situ hybridization that apo D gene expression is found
mainly in fibroblast like cells, particularly interstitial and connective tissue
fibroblasts, with higher levels being observed near blood vessels (Smith et nl.,
1990) (Provost et al., 1991b). Human apo D was cloned by Drayna et al. (Drayna et
al., 1986) and surprisingly bore no sequence homology to any of the other
apolipoproteins. Instead, it was quite homologous to another farnily of proteins,
the lipocalins
characterized
(fonnerly known as the
by their ability to bind
a2-rnicroglobuIin superfamily), which are
small hydrophobic ligands (Drayna et al.,
1986) (Flower, 1994). Three dimensional analysis of members of this family,
which includes retinol-binding protein, beta-lactoglobulin and insecticyanin
have shown that they conform to an eight stranded beta-barre1 which is suitable
for binding a lipophilic ligand, thereby suggesting a transport role for these
proteins (Flower, 1994) (Flower, 1996)-
Twenty five years after its discovery, studies of apo D have remained
largely descriptive and the role of apo D remains to be elucidated. It has been
suggested that apo D plays a role in reverse cholesterol transport, the process
whereby cholesterol is removed from extrahepatic tissues and brought to the
liver for catabolization (Loh and Tan, 1996). Briefly, cholesterol destined for
removal would be esterified by lecithin:cholesterol acyltransferase (LCAT) and
transferred to lipoproteins (LDL, HDL) by cholesterol ester transfer protein
(CETP) (Francone et al., 1989). The lipoproteins would then transport the
cholesterol to the liver for removal. Apo D is thought to play a role in this
reaction because it complexes with LCAT and CETP (Francone et nl., 1989)
(Fielding and Fielding, 1980).
Of interest also is that apo D is the major protein component isolated in
the fluid of breast cysts in multicystic disease and in fact was formerly referred to
as 'gross cystic disease f h i d protein' (GCDFP)-24 (Balbin et RI., 1990), a
glycoprotein produced b y epithelial cells and shown to have proges terone
binding capabilities (Pearlman et al., 1973). While women with breast cysts have
a 2-4 fold greater risk of developing breast cancer compared to women without
this disorder (Brinton, 1990) (Ciatto et al., 1990), the relationship between breast
cancer and apo D or GCDFP-24, has yet to be determined. Balbin et al. (Balbin et
al., 1990) purified GCDFP-24 by size-exclusion high performance liquid
chromatography (HPLC). They then subjected this protein to tryptic digestion,
purified the peptide fragments by reverse-phase HPLC and determined the
amino acid sequences. AU sequenced peptides matched with regions in the
human apo D sequence. A role was proposed for apo D - in
progesterone/cholesterol transport.
If cholesterol were the preferred ligand for apo D, one would expect that
the addition of exogenous cholesterol would cause an upregulation of apo D.
However, Provost et al. (Provost et al., 1991a) found that cholesterol, when added
to fibroblast cultures did not induce the expression of apo D M A . Similarily,
Lea (Lea, 1988) has shown that GCDFP-24 or apo D is not able to bind large
amounts of cholesterol. Further, Peitsch and Boguski (Peitsch and Boguski, 1990)
have suggested, on the basis of molecular modeling and binding assays, that a
herne-related compound is most likely the preferred ligand for apo D.
There have been other observations and speculations with regards to the
function of apo D. Spreyer et al. (Spreyer et al., 1990) have shown that apo D
mRNA is significantly increased in rat sciatic nerves regenerating after a
denervating crush injury, compared to levels found in non-injured nerves or
those that were prevented from regenerating by ligation. Similarily, in another
study, Boyles et al. (Boyles et al., 1990) showed that three weeks following
denervating crush injury, apo D protein levels were 500-fold greater in
regenerating peripheral nerves from rat, rabbit and marmoset monkey sciatic
nerves compared to levels in the normal nerve. Together, these studies suggest
a role for apo D in nerve repair, perhaps associated with the movement of lipids
required for the synthesis of new membranes.
Rationale for the Studies Descnbed in this Thesis
Based on previous studies by our laboratory and by others, we investigated
two inter-related processes in this thesis. The first addressed the regdation of
LC3 by TGF-B and the second the regulation of other genes by LC3 and their
association with DA intima1 cushion formation. We formulated the following
hypotheses:
HYPOTHESIS 1:
TGF-B regulates the RNA binding protein, LC3
OBJECTIVES 1:
To establish whether an increase in LC3 expression is related to TGF-B
HYPOTHESIS II:
In addition to FN, LC3 binds to mRNA of other genes associated with cell
mo tility
OBJECTTVES II:
To determine whether LC3 binds to other mRNA transcripts and assess whether
these genes are increased in DA vs Ao SMC and related to ce11 motility.
MATERIALS AND lMETHODS
Cell Culture
Fetal Rambouillet lambs were delivered by Caesarian section on day 100 of
a 145-day timed gestation period. DA and Ao were removed en bloc as
previously described (Rabinovitch et al., 1988), and the vessels were separated,
opened, and rinsed in phosphate-buffered saline (PBS) containing 3%
antibio tics/antimycotics (GLBCO, Burlington, Ontario, Canada). Endothelial cells
were hamesied by scraping the luminal surface of the vesse1 with a No. 11 scalpel
blade (Ryan et al., 1978) and maintained in Medium 199 (M199; GIBCO)
containing 20% heat-inactivated fetal bovine serum (FBS, GIBCO) and 1%
antibiotics/antimycotics. Endothelial cells were characierized by a contact-
inhibited "cobblestone" rnorphology and positive staining for factor VI11
(Rabinovitch et al-, 1988) and used at passages 2 or 3. Ductus arteriosus and Ao
SMC were propagated by tissue explant after scraping endothelial layers and
removing the adventia (Ross, 1971). Smooth muscle cells were cultured in Ml99
with 10% FBS and identified morphologically by phase-contrast iight microscopy
[Nikon Diaphot microscope (Nikon)] as having a "hills and valleys" phenotype
and by positive immunofluorescence using an antibody for smooth muscle u-
actin.
Human fibroblast (HF) and human fibrosarcoma ce11 lines (HT1080) were
purchased from American Type Ce11 Culture (ATCC) and cultured with
Minimum Essential Medium (MEM) containing 10% FBS and 1%
penicillin/strep tomycin (GIBCO).
Transfection of HTî080 cells with LC3 (perfonned by Dr. Bin Zhou)
Twenty-four hours prior to transfection, HT1080 cells were plated at a
density of 106/100 mm dish. HT1080 cells were çtably transfected using the
calcium phosphate precipitation method (Sambrook et al.,, 1989). Ten pg of
plasmids pCR3-LC3 or vector pCR2 were used to trançfect each dish for 8 hours.
The cells were then shocked with 10% glycerol for 1 min and fed with fresh
cornplete medium containing the aminoglycoside G418 (200pg/ml, GIBCO). The
media was changed every two days with gradually increasing concentrations of
G418 up to 800 pg/ml. Clones transfected with pCR3-CC3 were selected on the
basis of resistance to G418 (800 pg/ml) by selective trypsinization and screened for
LC3 expression using western immunoblot analysis. The cells transfected from
entire pools of LC3 transfected clones (8) or vector-transfected clones (4) were
s tudied.
TGF-$3 and neutralizing antibody treatments of endothelial cells and fibroblasts
Subconfluent endothelial cells, human fibroblasts (HF) and fibrosarcoma
cells were serum starved for a 24 hour period. Optimal dose of TGF-f3 was
determined by treating HF with increasing doses (O, 0.1, 0.5, 1.0, 5.0 and 10 ng/ml)
of h u m a . TGF-B (R and D Systems, Minneapolis, Minnesota) and assessing LC3
expression by Western immunoblot as described below. It was determined that
5.0 ng/ml resulted in the greatest enhancement of LC3 and as such, this
concentration was used for subsequent experiments. For experiments using
TGF-f3 neutralizing antibodies, cells were serum stawed as above and treated
with chicken IgG (lpg/ml), or neutralizing chicken antibody against TGF-LS
(lpg/rnl and lOpg/ml) or a combination of TGF-f3 (5ng/ml) and neutralzing
antibody (10pg/rnl) (al1 purchased from R and D Systems, Minneapolis,
Minnesota) in serurn-free Ml99 .
Western Immunoblot Analysis
For all Western irnmunoblots, confluent cells (EC, HF, HTlOSOs and SMC)
were hanrested by scraping into 15 ml Falcon tubes and spun at 3000 rpm for 10
minutes. Pelleted cells were resuspended in twice the volume of hypotonic
buffer (25 mM Tris-HC1, pH 7.9, 0.1 mM EDTA) supplemented with proteinase
inhibitors aprotinin, pepstatin and leupeptîn (lmg/ml eadi) and lysed by three
repetitive cycles of freeze-thaw. Sarnples were spun for 30 minutes at 16 000 g at
4 OC and the protein concentration of the supematants were determined using a
standard Bio-Rad protein assay kit followed by spectrophotometry at 595 m.
Equal amounts of protein (20 -40 pg) were solubilized by boiling in 30 pl of
reducing Laemmli sample buffer (Laemmli, 1970) for 10 minutes and resolved
on a 14% or 12% polyacrylamide gel for examination of LC3 and apo D expression
respectively. After electrophoresis, proteins were transferred to a nitrocellulose
membrane. Gel was stained with Coomassie Blue to visualize bands and
coruirm equal protein loading. The membrane was blocked for two hours in tris-
buffered saline (TBS) containing 0.5% tween-20 and 5% non-fat dry milk and
incubated with rabbit antisenun to LC-3 (produced either by Dr. J. Hammarback,
Dept. of Neurobiology and Anatomy, The Bowman Gray School of Medicine,
Winston-Salem, NC or our laboratory) or rnouse anti-apo D antiserum
(generated by Dr. Yves Marcel, Ottawa Heart Institute, Ottawa, Ontario, Canada)
ovemight at 4OC. Membrane was then incubated with 1:3000 diluted goat anti-
rabbit horseradish peroxidase conjugated IgG (Bio-Rad Laboratories, Richmond
CA) for LC3 blots and goat anti-mouse horseradish peroxidase conjugated IgG
(Sigma) for apo D blots for 1 hour at room temperature. The blot was developed
using an enhanced cherniluminescence (ECL) kit (Amersham). The intensi ty of
immunoreactive bands were analyzed using NIH image software.
Assessrnent of other genes regulated by LC3:
Preparation of recombinant LC3-glutathione-S-trançferase (GST. fusion pro tein
colzrmn and elution of bound RNA
Recombinant LC3-glutathione-S-tramferase (GST) fusion protein
contained in E. Coli was released by sonication and solubilized in 20% Triton X-
100. Subsequently, the bacterial sonicate was applied to a column of drained and
washed Glutathione Sepharose 4B (Sigma). The sonicate was allowed to flow
through the column and the matrix was washed 3 times with 1 x phosphate
buffered saline (PBS) before use. A control colurnn was generated by dividing
the total volume of the original column into two equal parts and digesting the
contents of one column with a 1:20 dilution of thrombin solution (Sigma)
overnight at room temperature or by constructing a column containing GST
alone. Total RNA was extracted from whole adult rat brain with a kit from
Pharmacia Biotech using the cesium trifluoroacetate (CsTFA) method. The
RNA:protein binding was 2arried out completely at 4°C as follows; both control
and LC3 columns were washed 4 times with RNA binding buffer (10mM TRIS,
pH 7.9, lOOmM KCl, 5mM MgC12, 0.5mM EDTA and 0.2mM D R - al1 solutions
were prepared with diethylpyrocarbonate (DEPQtreated water and autoclaved).
Columns were blocked for one hour in twice the bed volume with RNA binding
buffer as above with the addition of 100 pg/ml of tRNA and 200U/ml of RNase
guard (Pharmacia). Block was allowed to flow through the column. 10 pg of
RNA were diluted 1:10 with RNA binding buffer (with tRNA and RNase guard
at concentrations as above) and incubated on the column for 30 minutes with
gentle agitation every 10 minutes. Columns were washed 4 x in RNA binding
buffer without tRNA and RNase guard. Column contents were eluteci with
l'riz01 reagent (GIBCO-BRL), glutathione sepharose 4B were pelleted and RNA
was purified following manufacturer's instructions.
Reverse transcriptase - polymerase chain reaction (RT-PCR) of bound mRNAs
Al1 of the isolated RNA from the columns was reversed transcribed to
create cDNA. RNA, DEPC water and dT-adaptor (a 35-base oligonucleotide with
17 dT residues plus a unique adaptor sequence) from the 3'RACE (rapid
amplification of cDNA ends) protocol developed by (Frohman et al.,, 1988), was
heated to 70°C for 10 minutes, quenched on ice, added to 5 X RT reaction buffer,
dTT (O.lM), dNTPs (ZOmM), M-MLV reverse transcriptase (200U/yl) and
incubated at 37OC for 1 hour. The enzyme was then inactivated by heating the
mixture to 95OC for 10 minutes.
Polymerase Chain Reaction (PCR) of bound mRNAs
Reverse primer (pN6; Pharmacia) (25pmol), 3' RACE adaptor (25pmol)
and cDNA were mixed in a total of 50 pl of PCR 'cocktail' containing H20, buffer,
dNTPS, Platinum Taq polymerase (GIBCO-BRL) and then overlaid with mineral
oil (Sigma). Using a DNA thermal cycler we carried out 40 cycles of amplification
as follows; initial denaturation cycle for 5 minutes at 94"C, 40 cycles of 94"C, I
minute; 55"C, 2 minutes; 72"C, 1 min, followed by one cycle of 94"C, 1 minute,
55"C, 2 minutes, 7Z°C, 10 minutes. 10 pl of PCR products were run on 1.5'Xl
agarose gels containing ethidium bromide to visualize bands. Unique bands
and/or bands with greater intensity compared to control were cut from the gel
and purified using the QUIAGEN gel purification kit. Purifed gel products were
then subjected to direct cloning using the TA cloning kit (Invitrogen) and/or
subsequent amplification by PCR as above.
Molecular cloning
Ligation reaction:
2 ~ 1 of purified gel product was directly added to a 1 0 ~ 1 Ligation reaction
mixture containing; pCW.1 vector (25ng/@; Invitrogen), ligation buffer and T4
DNA ligase (4.0 Weiss units) and incubated at 14OC overnight.
Transformation:
0.5~1 of B-rnercaptoethanol (Invitrogen) and 2pl of ligated vector was
added to 5 0 ~ 1 of competent cells (Invitrogen) and incubated on ice for 30
minutes. Bactenal cells were then heat shocked for 30 seconds at 42OC and placed
on ice for 2 minutes. 250~1 of SOC medium were added and bacteria were
shaken in a rotary shaker at 225 rpm for 1 hour at 37OC. 50 and 200pl were plated
separately onto agar plates containing 1pg/ml ampicillin and 40 pl of 40mg/mI
X-gal. Liquid was allowed to soak into the agar before plates were inverted and
left for 18-24 hours at 37OC.
Co lony screening:
White colonies from each plate were selected, and grown overnight in
5ml YTA broth (yeast extract (10g/l), Tryptone (16g/l), NaCl (5g/l), ampicillin
(lpg/ml) at 37OC in a rotary shaker at 225rpm. A lpl bacterial sample was added
to 49p1 of PCR cocktail as previously described and subjected to identicai PCR
conditions as above. A 10 pl sample was run on a 1.5% agarose gel containing
ethidiurn bromide to visualize bands. Clones giving positive PCR products were
mini-prepped.
Mini-preps and restriction enzyme digests:
A 0.5ml sample of bacteria was saved and stored in 0.5ml glycerol at -70JC.
DNA was purifed according to the mini-prep protocol supplied with the Qiagen
Mini-Prep kit. DNA was resuspended in 50 pl of lOmM Tris, pH 8.0. EcoRl
digests were performed to confirm the presence of an insert and positive clones
were sequenced (DNA sequencing facility, Biotechnolo,~ Service Centre,
Hospital for Sick Children, Toronto, Ontario, Canada).
In Vitro Transcription and Gel Mobility Shiff Assays:
Preparation of Apo D 3 UTR:
Forward and reverse primers containing Eco RI and BamHl restriction
sites respectively, were synthesized and used to generate the 3' UTR of apo D
using cDNA obtained from the LC3 column. This 205 base pair PCR product,
which appeared as a single band on a 1.5% ethidium bromide stained agarose gel
was excised from the gel and purified using the Qiagen gel extraction kit. The
pure product was then cut with Eco R I and BamHl and ligated into pGEM-42
that had been cut with the same restriction enzymes using similar ligation
conditions as previously described. The ligated product was transformed into
subcloning efficiency DH5a competent cells (GIBCO-BRL) as above. White
colonies were selected,
digests were completed
mini-preps were performed as above, restriction enzyme
to confirm presence of insert and product was sequenced.
In vitro transcription n-
Sense ['L~~-labeled RNA probes for gel mobility shifts assays were prepared
from the above ptasmid constructs as follows. A large scale plasmid preparation
was performed on the apo D containing vector (maxi-prep kit, Qiagen). Plasmids
were linearized with BamH1. RNA was transcribed using a Promega Riboprobe
kit (Promega Corporation, Madison, WI) with SP6 RNA polymerase in the
presence of [ 3 2 ~ ] - ~ for 1 hour at 37 OC. DNA iernplateç were rernoved by
DNase digestion and RNA was punfied by 2 pheno1:chloroform extractions and 1
chloroform/isoamyl alcohol extraction. RNA was precipitated in 0.5 volumes of
7.5M ammonium acetate and 2.5 volumes of 100% ethanol at -70 OC for I hour.
RNA was centrifuged, pellet was washed in 70 % ethanol, air-dried and
resuspended in 30 pl TE buffer and passed through a Boehringer Manneheim G-
25 RNA purification column. The riboprobe was stored at -70 OC.
Gel Mo bility Shiff Assays
For each assay, 10 ug of DA SMC cytosolic extract or 1OOng recombinant
LC3 protein was incubated with 20 000 - 50 000 cpm of full length 3'UTR apo D
RNA probe or a 20 base pair RNA oligonucleotide probe containing the ARE-like
element, UUAUUüCUU (synnthesized b y Biotechnology Centre, University of
Calgary, Calgary, Alberta) in RNA binding buffer containing 2 ug transfer RNA
(Sigma) in a total volume of 30 ul for 30 minutes at room temperature. RNase
T l was added at a concentration of 1 unit/p1 and incubation continued for 15
minutes at 37 OC. The samples were then separated on a 6% native
polyacrylamide gel in 0.3 X Tris-borate-EDTA (TBE) buffer (90 mM TRIS, 90 mM
boric acid, 2 mM EDTA). For cornpetition and specificity studies, increasing
amounts of excess unlabeled AU-rich RNA probes were incubated with the
cytoplasmic extract for 10 mins before adding the labeled RNA transcripts.
Immunofluorescence 2
DA and Ao SMC at passage 2 were plated on 2.2 cm coverslips at a density 5
of 10 cells/well and cultured for 3 days. Cells were fixed with 100% ice cold
methanol for 5 mins at -20°C and dried for 30 mins at room temperature. After
blocking with phosphate-buffered saline (PBS) containing 1% bovine serum
albumin (BSA) for 30 mins at 37 OC cells were probed with a monoclonal mouse
anti-apo D antibody (1:25 dilution) in PBS containing 1% BSA at room
temperature for 1 hou. Following 3 x 5 min washes, cells were incubated with
secondary antibodies: fluorescein-conjugated goat-anti-mouse IgG (dilution at
1:50) for 1 h at room temperature. Cells were washed 3 x 5 min and mounted
with antifade reagent (Molecular Probes Inc., Eugene, OR). Fluorescence
microscopy and/or confocal microscopy was perfonned. For negative controls,
normal mouse IgG was used iwtead of primary antibodies.
Migration 2
DA and Ao SMC at passage 2 were plated on 2.2 cm coverslips at a density 5
of 10 cells/well and cultured until confluency. Half of the cells were then
scraped off using a mbber policeman, washed 3 times with media and allowed to
grow for 12, 24 or 48 hours. Immunofluorescence was then performed as
previously described.
Analysis of Data
Cornparisons of values in DA and Ao cells or in either ce11 type in
response to stimulation with TGF-B or addition of neutralzing antobody to TGF-
f3 was carried out using the Student t test with p values of 4 0 5 considered as
statistically significant.
LC3 expression is increased in 100-day fetal lamb DA vs Ao EC
Previous studies in our laboratory have shown that a post-transcriptional
mechanism (increaced efficiency of mRNA translation) accounts for the
increased expression of FN in the 100-day fetal lamb DA SMC compared to Ao
SMC. This rnechanism involves an interaction of the RNA binding protein,
LC3, with the ARE in the 3'UTR of the FN rnRNA. LC3 appears to be a
requirement for FN expression as FN expression is very low in the fibrosarcoma
cell Line (HT1080) which lacks LC3 (Zhou et al., 1998, manuscript in preparation).
Transfection of LC3 into HT1080 cells or Ao SMC (low expressors of LC3)
significantly increases their FN expression (Zhou et al., 1998) (Zhouet al., 1997).
We were interested in whether LC3 might also be present in EC and whether or
not it might function in a çimilar marner to regulate the post transcriptional
expression of other genes that are critical to the formation of intima1 cushions
such as TGF-B or HA.
Western immunoblots were performed on equal amounts of protein from
cytosolic extracts of cells maintained in 20% serum to examine LC3 expression in
DA and Ao EC. Basal LC3 expression was approximately 40% greater in the DA
EC compared to the Ao EC (Figure 4) as viewed by the intensity of the DA band
and confirmed by drnsitometry (p< 0.05).
LC3 expression can be enhanced by exogenous TGF-B
Trançforrning growth factor 13 is a known regulator of ECM and has also
been shown to elicit changes in cytoskeletal reorganization, which might be
related to motility, by affecting microtubule stability. We therefore investigated
whether LC3 was under the control of TGF-f3 and if this might be a route taken by
Figure 4. Basal LC3 expression is higher in DA than Ao endothelid cells.
The top panel is a representative western immunoblot and the bottom graph
reflects densitometric analyses of cytosolic extracts from 3 different ce11 harvests
of DA and Ao EC. LC3 expression is approximately 40% greater in the DA EC
compared to the Ao EC as viewed by the intensity of the bands and confirmed by
densitometry . A negative control could uiclude pre-incubation of antibody with
antigen and a positive controi could be the recombinant LC?.
*=p< 0.05; Bar = mean f SEM of 3 experiments.
the DA to enhance its LC3 production which would then lead to cytoskeletal
rearrangements resulting in increased motility. We demonstrated that LC3
expression could be enhanced in both the DA and Ao EC by the addition of
exogenous TGF-B. Western immunoblots were used to detect differences
between untreated DA and Ao EC and those treated with 5ng/ml of TGF-f3 for a
period of 24 hours following 24 hours of serum starvation (Figure 5). TGF-D
enhanced LC3 expression above control serum-free conditions in both DA and
Ao EC by 64% and 63% respectively.
A similar effect of TGF-B on LC3 expression was documented in a non-
vascular human fibroblast ce11 line. Human fibroblasts were serurn starved
before being treated with increasuig doses of TGF-B (0-10 @ml). Western
immunoblot analysis demonstrated a dose-dependent enhancernent of LC3 by
TGF-B that was maximal at a TGF-I2 concentration of 5ng/ml, with increased LC3
expression 84% above control serum free conditions (p<O.O5) (Figure 6 ) . LC3
expression was diminished at a TGF-B concentration of lOng/ml, relative to that
obtained with Sng/ml (p<0.05), but was still significantly higher than control
( ~ ~ 0 . 0 5 ) . This result could be a result of receptor saturation or perhaps at higher
concentrations, TGF-B is activating another factor which could bring about the
dowmegdation of LC3 . To determine whether basal levels of LC3 might be related to endogenous
production of TGF-B, studies were carried out using neutralizing antibodies.
Cells were serum starved for 24 hours before being treated with chicken [gG
(lpg/ml) as a control, TGF-II neutralizing antibody (5pg/ml or lOpg/rnl) or a
mixture of TGF-B and neutralizing antibody (5ng/ml:lOpg/rnl) for 24 hours
(Figure 7). Western immunoblot showed that the neutralizing antibody did not
decrease endogenous LC3 expression, nor was it able to neutralize the effect of
exogenously administered TGF-P. In fact there was a significant increase in LC3
TGF-B treatment (5nglml)
Figure 5. LC3 expression is enhanced by exogenous TGF-B
A western immunoblot for LC3 from cytosolic extracts obtained from DA and Ao
EC, serum starved for 24 hours and then either treated with 5ng/ml of human
TGF-Il for 24 hours (+) or maintained in serum free medium for 24 hours (-) is
shown. TGF-B enhanced LC3 expression by 64% and 63% above control serum
free conditions in the DA and Ao EC respectively.
Concentration of TGF-O1 (nglml)
Figure 6. TGF-8 enhances LC3 expression in human fibroblast ceils in a dose-
dependent manner.
The top panel is a representative western imrnunoblot and the bottom graph
reflects densitometric analyses of 3 different cytosolic extracts of human
fibroblast cells, serum stamed for 24 hours before being treated with increasing
doses (0-10 ng/ml) of TGF-B for 24 hours. Western immunoblot analysis
revealed a dose-dependent enhancement of LC3 expression b y TGF-B tha t was
signihcant compared to control at concentrations of 1.0, 5.0 and 10.0 ng/ml, bu t
maximal at 5ng/ml, with increased LC3 expression 84% above control serum free
conditions. LC3 expression was diminished at long/& relative to 5ng/rnl.
* = pc0.05 compared to control; t = p<0.05 compared to 5.0 ng/ml; Bar = mean + SEM of 3 experiments.
Figure 7. Neutralizing TGF-f3 does not decrease basal LC3 expression in human
fibroblasts,
Hurnan fibroblasts were serum starved for 24 hours before being treated with
chicken IgG ( 1pg/ml) as a control, TGF-8 neutralizing antibody ( lpg/mt and
10pg/ml) or a mixture of TGF-B and neutralizing antibody (5ng/ml:lO~g/ml) for
24 hours. A representative western immunoblot for LC3 is shown on the top
panel and densitometric analysis of 3 different cytosolic extracts is depicted in the
graph below. TGF-B neuhalizing antibody did not decrease the endogenous LC3
expression, nor was it able to neutralize the effect of exogenously administered
TGF-B (stimulatory effect of TGF-f3 demonstrated in figure 6). In fact, the
neutralizing antibody stimulates LC3 expression at a dose of lpg/ml and does not
neutralize the stimulatory effect of TGF-S ai a dose of lOpg/ml.
*=p<0.05; Bar = mean f SEM of 3 experiments.
expression with l ~ g / m l TGF-B neutralizing antibody (p<0.05) which was not
observed with lO&ml, but which also occurred with when this dose was
combined with the stimulating 5ng/ml dose of TGF-B ( ~ ~ 0 . 0 5 ) . This result raised
the possibility that TGFB could be suppressing basal levels of some other factor
which could induce LC3. Ln order to ascertain that the neutralizing antibody was
working, we could have tested its activify in a system that is known to be
regulated by TGF-II Le. the TGF-B enhancement of HA. If the neutralzing
antibody decreased HA production then we could be convinced that it was
workuig in this experiment as well. Alternative approaches could also be taken
to interfere with TGF-B ligation or signalling, Le., the use of dominant negative
receptors or the use of anthense technology.
TGF-B is dissociated from LC3 in HTlOSO c e k
To further address whether endogenous TGF-B might suppress a factor
which is responsible for the expression of LC3 we used a fïbrosarcoma ce11 Iine,
HT1080. These cells produce TGF-B but do not express LC3. If TGF-D was
suppressing an LC3 regulatory factor in the HT1080 cells, we should unmask LC3
expression by neutralizing TGF-B. Alternatively these cells might be non-
responsive to TGF-B. Chicken IgG (lpg/rnl), exopenous TGF-B (5ng/ ml),
neutralizing TGF-8 antibodies (lpg/rnl or 10pg/ml) or a combination of TGF-B
and neutralizing antibody (5ng/ml:lOj.~g/ml) were administered to HT1080 cells
but neither treatment induced LC3 expression (Figure 8). It therefore seems that
TGF-B does not positively or negatively regulate LC3 in HT1080 cells. However,
we cannot negate the possibility that these cells have lost the LC3 gene itself and
so regardless of treatment will not express LC3. To investigate this, we would
start off by comparing LC3 mRNA levels in HT1080 and human fibroblasts. If
they were similar then we would assess whether translation was blocked. If the
LC3 mRNA was not present in HT1080, then southern blot analysis would be
necessary .
Figure 8. Neither TGF-8 or TGF-8 neutralizing antibodies were able to induce
the expression of LC3 in a human fibrosarcoma ce11 Iine (HT1080)
HT1080 cells were treated with chicken IgG ( 1pg/rnl) as a control,
exogenous TGF-B (5ng/ml), neutralizing TGF-G mtibodies (lpg/ml or 10pg/ml)
or a corninbation of TGF-f3 and neutralizing antibody (Sng/ml:lOpg/ml) after a 24
hour serum starvation period. Western immunoblots of triplicate samples
assessed under each condition are show. None of these treatrnents induced LC3
expression, which would appear as a 15kD immunoreactive band. A -60kD band
immunoreactive with the LC3 anitbody has been recognized in both fibroblasts
and FIT1080 cells.
RESULTS II
The regulation of other genes by LC3
To pursue whether LC3 was involved in the regulation of other genes
associated with neointimal formation in the DA and SMC motility in general,
the first logical candidate we considered was RHAMM. First described as a HA
bùiding protein, RHAMM was shown by our laboratory to be involved in the
migration of DA SMC (Boudreau et al., 1991). RIIAMM, however, does not
appear to be regulated by LC3 as we found no difference in RHAMM expression
in wild type HT1080 cells and those that have been stably transfected with LC3
(Figure 9). A good positive control for this experiment would have been to re-
probe this blot for FN, as the trmfected HT1080 cells express more FN than the
wild type cells. Another control would be to test the antibody against the antigen
(positive control), or to pre-incubate antigen with antibody (negative control). It
would also be important to test dierectly for alterations in the synthesis of
RHAMM following metabolic labeling and immunoprecipitation.
We then embarked on a strategy to identify other genes that could be
regulated by LC3 by using LC3 affinity and isolation of rat brain (a rich source of
LC3 and other MAPs) RNA transcripts. The bound transcripts were reverse
transcribed and cDNAs were resolved on ethidium brornide gels.
Figure 10 depicts two examples of PCR products obtained from several
separate RNA extractions and column r u s . Unique bands obtained from the
LC3 column when compared to the control GST column (indicated with arrows)
were sequenced. One of the bound mRNAs, marked on the figure with a star,
encoded 200 nucleotides of the 3'UTR of apolipoprotein (apo) D which contains
an ARE-like element (UUAUUUCUU, underlined). We have called this an
'ARE-like' element because it differs slightly from known ARE elements
R H A M M
Figure 9. RHAMM expression is sirnilar in both wild-type and LC3 transfected
HT1080 cells.
Wild type HT1080 cells, which lack LC3 (-) and those that had been stably
transfected with LC3 (+) were compared for RHAMM expression by western
immunoblot using a RHAMM antibody. The -50 kD band corresponding to
RHAMM appeared similar in both ce11 types. The 30 kD prominent band could
represent a degradation product, or another isoform of RHAMM.
LC3 CTRL
LC3 CTRL
Figure 10. PCR amplification of RNA obtained from protein columns
RNA from the LC3 and control columns was reverse transcribed to create cDNA.
cDNA was amplified by polymerase chah reaction using random primer and
oligo dT and PCR products were resolved on 1.50h agarose gels containing
ethidium bromide to visualize bands. Unique bands from the LC3 column
and/or bands with greater intensity compared to the control (indicated with
arrows) were sequenced. One of the transcripts, indicated on the figure with a
star, encoded apolipoprotein D.
(UUAUUUAUU). For this
of RNA binding vs general
experiment we could also have tested the specificity
RNA binding by testing RNA of several known ARE
genes like c-fios, c-myc or GM-CSF. A good positive control would have been to
run FN mRNA through the column to see if LC3 would bind it in that
environment.
The complete 3'UTR sequence of rat apo D mRNA is shown in Figure 11
(genbank accession X55572; sequenced by Spreyer et al. (Spreyer et a[., 1990). To
sequence the entire apo D 3'UTR from the cDNA pool of the LC3 column,
primers to the published 3'UTR were constructed, one containing an Eco R I
restriction site and the other primer containing a Barn Hl site. These primers
were then used to amphfy a single band corresponding to the correct size of the
3'UTR (205nt) of apo D (Figure 12). This fragment was subsequently cioned into
the pGM4Z vector (Promega).
ApoD expression is greater in DA SMC compared to Ao
As we used adult rat brain tissue as a potential rich source of mRNAs
regulated by LC3 and discovered apo D, we were interested in knowing whether
apo D was present in the fetal DA tissue.
showed that apo D was present in both
By western immunoblot analysis, we
DA and Ao SMC and that there was
approximately 4-fold more present in the DA than in
Human apo D protein, which appeared as a single 30kD
on western immunoblot was used as a positive control.
the Ao. (Figure 13).
immunoreac tive band
643 aggggggtgg gcaaccgctc caggttattt ct tcgcrng 683 gctccctggc cccaccccca ctcctcatca ggaccgagca 723 accccgccag cactagaggg aaagtattgc tatagaagcc 763 aatggagggg actgatggga aggtggccca aacccaagac 802 cccacattgt tactcgccag cccaataata aacattttgc 843 tgatc
Figure 11. 3'UTR of rat apoD mRNA sequence
The 3'UTR of apo D taken from the full length sequence cloned from rat sciatic
nerve by Spreyer et al. (Spreyer et al.,, 1990) is shown. The transcript isola ted by
RT-PCR fo1lowing LC3 immunoaffinity encoded 200 nt of the 205 nt 3' UTR,
which contains an ARE-like element, WAUUUCUU (underlined).
aggggggtgggcaaccgctccagg t tatt t ct t cgctttg gctccctggccccacccccactcctcat~aggaccgagc aaccccgccagcactagagggaaagtattgctatagaag ccaatggaggggactgatgggaaggtggcccaaaccca agaccccacattgttactcgccagcccaataataaacatt ttgctgatc -1
DNA marker
Figure 12. Amplification of apo D 3'UTR using sequence specific primers.
Further experiments were carried out to sequence the entire 3'UTR. Primers to
the 3'UTR were constructed using information from the published apo D
sequence, one containing an Eco RI restriction site and the other primer
containhg a Barn Hl site. These primers were used in a PCR reaction with the
cDNA pool created following LC3 affinity and a single band corresponding to the
correct size of the 3'UTR of apo D was observed (arrow). This fragment was
subsequently cloned into the pGM4Z vector.
Figure 13. Apo D expression is greater in DA SMC compared with Ao SMC
A representative western immunoblot for apo D expression on cytosolic extracts
of DA and Ao SMC from 2 independent experiments with similar results, is
shown. Apo D is present in both DA and Ao SMC but there is approximately
four-fold more in the DA SMC as viewed by the intensity of the bands.
LC3 appears to modulate apo D production
Apo D expression was analyzed in the human fibrosarcoma cell line,
HT1080 which naturally lack LC3. These cells had very little or no apo D evident
by western immunoblotting. However, in cells that have been stably transfected
with LC3, apo D appears as a 30kD imunoreactive band (Figure 14). This
experiment supports a role for LC3 in regulating the expression of apo D in a
manner similar to FN, which Our laboratory has shown is alço increased in LC3
stably transfected ce&.
LC3 and DA SMC extracts bind to the 3'UTR of apoD
To determine whether LC3 rnight be regulating apo D in a manner similar
to FN, i.e. via the ARE-like element, we performed gel mobility shift assays using
recombinant LC3 protein or DA SMC extracts and either the full length
radiolabeled in vitro tramcript of the apo D 3'UTR or a radiolabeled 20 base pair
RNA oligonucleotide that contained the apo D ARE-like element.
UUAULTUCUU. We found that a factor in the DA SMC extract, possibly LC3.
could bind specifically to the radiolabeled RNA oligonucleotide encoding the apo
D ARE-iike element since binding could be competed by preincubation of the DA
SMC extract with an excess of cold RNA oligos (Figure 15 A). Using the full
length apo D 3'UTR we showed that recombinant LC3 protein also binds to the
ARE-like element since it binds to the full length 3'UTR and the cornplex can be
competed with cold RNA oligos of the ARE-like element (Figure 15B). DA SMC
extract also binds to the full length S'UTR, however, binding could not be
competed with cold oligonucleotides (Figure 15B). Since the complexes in
figures 15A and 15B could not be completely competed, perhaps a cold oligo
concentration greater than 500X the radioactive probe cold have been used. Also,
we could have used RNA oligonucleotides with a scrambled ARE-like element
Figure 14. Apo D expression is greater in LC3 transfected HT1080 cells.
Western immunoblot for apo D expression on cytosolic extracts of HT1080 cells,
wild type (LC3-) and stable LC3 transfected (LC3+). Apo D is absen: in the wild
type, but appears at a 30kD immunoreactive band in the LC3 transfected cells.
n
X O
+ 5 3 LU-
c binding corn plex
SI O0 bindir comp bindrng
corn plex
Figure 15 A. DA SMC SI00 extract binds to the ARE-like element in apo D
Gel mobility shift assays were carried out with DA SMC S-100 extracts which
contains LC3 and a 20 base radiolabeled RNA oligonucleotide containing the
ARE-like element. Free probe is shown (FP) followed by SI00 + radiolabeled
oligonucleotide which forms a distinct binding complex. Complex formation is
decreased with 500 fold excess of unlabeled RNA oligonucleotide probe.
Figure 15 B. Binding of recombinant LC3 and a protein in S l O O cytosolic extract
to full length 3'UTR
Recombinant LC3 and DA SMC S-100 extract were irwestigated for their ability to
bind to the full length apo D 3'UTR mRNA. A full length 3'UTR mRNA
trançcript was obtained by in vitro transcription. Lane l(far left)=free probe (FP),
followed by S-100 extract and full length 3'UTR or recombinant LC3 and the full
length 3'UTR. Different binding complexes are seen. The complex with the S-
100 extract cannot be competed by 500 fold excess of cold RNA oligonucleotide ot
the ARE-like element whereas the complex with LC3 can be successfuliy
competed.
or an unrelated sequence to show binding specificity. In addition, a gel shift
using the wild type HT1080 ce11 extract to see if we saw the same complex would
have been useM is determining whether the cytosolic factor was LC3 or not.
Supershîft analysis could be used to document LC3 in the RNA-protein complex,
but unfortunately two different antibodies, one to C-terminal and the other to
the N-terminal did not produce a supershift.
ApoD localizes to the perinudear region of migrating DA SMC
In order to address whether there was a difference in intensity or
distribution of apo D which would suggest a role in ce11 migration,
immunofluorescence was performed on DA SMC migrating through a scratch
wound. Celk were grown to confluency and scraped with a rubber policeman at
12, 24 or 48 hours, staining was performed with an apo D primary antibody and
FITC-conjugated secondary. Figure 16 depicts confocal images of rnigrating DA
SMC 24 hours after wounding. Distinct peruiuclear immunofiuorescent staining
(100X magnification) is seen. Panel A and B depict the same migrating ce11 but,
in panel B the nucleus is stained with propidium iodide. Figure 17 depicts
migrating ceils at different time points. Panel A, O hours; B, 12 hours; C and D, 24
hours; E, 48 hours and panel F depicts cells that are still in the confluent layer.
Apo D expression is not apparent at O hours, but is at 12 hours and remains high
up to 48 hours. The vast majority of cells at the leading edge expressed the
greatest amounts of apo D while virtually al1 the cells still remaining in the
conf luen t layer had very l i t t l e o r no e x p r e s s i o n -
Figure 16. Confocal microscopy of apo D in migrating DA SMC
By confocal microscopy (mapification =100X) localized, perinuclear expression
of apo D can be seen. Panel A and B depict the sarne migrating cell, 24 hours after
injury, but in panel B the nucleus (stained with propidium iodide) is shown.
Figure 17. Apo D expression in migrating DA SMC is increased at 12 hours and
remains high at 48 hours
These confocal images (magnification 100X) depicts DA SMC migrating through
a scratch wound at different time points. Cells in panel A cells were
immunostained at O hours, panel B at 12 hours, panel C and D at 24 hours, panel
E at 48 hours and panel F depicts cells in the confluent layer 24 hours after injury.
The staining is perinuclear and is visible at 12, 24 and 48 hours. The vast
majority of cells at the wound edge expressed the greatest amounts of apo D,
while ceus in the confluent part of the monolayer expressed little or no apo D.
DISCUSSION
Recent studies in Our laboratory have implicated the microtubule
associated protein LC3 as a RNA binding protein involved in the post-
transcriptional regulation of FN, a glycoprotein whose modulation is critical in
the development of the migratory SMC phenotype (Zhou et al., 1997). Motile
SMC thereby migrate from the media into the expanded subendothelial space
where they produce matrix and form an 'intima1 cushion' which eventually
narrows the lumen of the DA in preparation for extrauterine life. As intima1
cushion formation is crucial for the posfmatal dosure of the DA, we investigated
whether LC3 was involved in the post-transcriptional regulation of other genes
such as TGF-f3, that were critical to this process in general or RHAMM, that was
more directly linked to the SMC motile phenotype.
By western imrnunoblot there was more LC3 protein in the DA EC
compared to the Ao, similar to the difference found in the DA vs Ao SMC (Zhou
el al., 1997). Since there is more TGF-B produced by the DA EC compared to the
Ao in early gestation, that also appears to be post-transcriptionally regulated and
given the fact that there is a copy of an ARE in the 3'UTR of the human TGF-f.3
mRNA (Derynck et al., 1985), Our original plan was to determine if LC3 was
binding to the ARE in the TGF-B 3'UTR. If so, this would have provided more
direct evidence linking LC3 with the post-transcriptional regulation of TGF-R.
Attempts to sequence the TGF-i3 3'UTR by PCR, were however, unsuccessfu1
(experimental data not given). At the same time, there was increasing literature
suggesting a role for TGF-B as a regulator of motility and the cytoskeleton
(Koyama et al., 1990) (Basson ef aL, 1992) (Gundersen et al., 1994). Therefore, we
hypothesized that TGF-B might be a regulator of microtubule associated pro teins,
such as LC3 and perhaps TGF-8 increased synthesis of HA in the DA EC by
increasing
Studies in
LC3 especially
vascular EC as
since HA synthase has an ARE (Shyjan et al., 1996).
well as human fibroblast cells cultures supported this
hypothesis since LC3 expression can be upregulated by administration of
exogenous TGF-f3.
Endogenous or basal levels of LC3 in fibroblasts were not susceptible to
neutralization with TGF-f3 antibodies. This suggests that either a different agent
or mechanism is responsible for the endogenous production of LC3 in fibroblasts.
We could not however, exclude TGF-IS as being responsible for the upregulation
of LC3 in DA vs Ao endothelial cells. For example, unpublished studies by
Mason (Mason and Rabinovitch, 1997) in our laboratory have shown that nitric
oxide (NO) is responsible for the upregulation of LC3 in DA but not in Ao SMC.
Culturing endothelial cells from the DA is particularly difficult given the size of
the vesse1 and we anticipate carrying out TGF4 neutralizing antibody studies as
soon as these celts are available. However, the results might also be difficult to
interpret as reflected by the inductive effects of the TGF-B neutralizing antibodies
on LC3 expression in our experiments and on glycosaminoglycan (GAG)
synthesis in experiments carried out by Boudreau et al. (Boudreau et al., 1992). In
examinhg the effect of TGF-B on GAG synthesis in Ao SMC, it was observed chat
while TGF-B upregulated GAG synthesis in Ao SMC, the effect could not be
inhibited by the TGF-B neutralizing antibody. They concluded that TGF-S might
be acting to suppress another cytokine, such as IL-1, which could substitute in
upregulating GAG synthesis. It is possible therefore, that TGF-B is sup p ressing
another factor which might also directly upregulate LC3 e-g. NO. As mentioned
previously, Our laboratory has shown that NO induces LC3 expression in DA
SMC (Maçon and Rabinovitch, 1997) and TGF-13 does suppress NO production in
macrophages (Vodovotz et al., 1993) (Ding et al., 1990) and SMC (Schini et ni.,
1992). Therefore, it can be hypothesized that TGF-f3 naturally suppresses NO so
that when TGF-f3 is itself inhibited by
is able to induce LC3 expression,
the addition of a neutralizing antibody, NO
hence the upregulation with the TGF-8
neutralizing antibody. Of course, since we also have evidence for TGF-B
upregulating LC3, total LC3 expression must depend on the rela-tive
contributions of all factors.
TGF-B is a rnultifunctional protein, capable of stimulating or inhibiting
ce11 growth and/or differentiation depending on
environment which surrounds it. It upregulates
transcriptional (Dean et al., 1989) (Kahari et al., 1991)
the ce11 type and the
FN production at the
(Kahari et al., 1992) and
post-transcriptional levels (Raghow et al., 1987). TGF-B also induces stable
microtubules in 3T3 fibroblasts. Gundersen et al. (Gundersen et al., 1994) have
speculated that TGF-B increases synthesis of a factor that is limiting for stable
microtubule formation. Although the factor was not further described, a logical
candidate would be a MAP. To resolve these questions, hrther work on the
mechanism of LC3 regulation by TGF-f3 would have to be undertaken. If is of
course possible that there might be a reciprocal regulation between LC3 and TGF-
13 i.e. TGF-f3 regulates LC3 and LC3 regulates TGF-IJ. This would be similar to the
rnechanism proposed by Streuli et al (Streuli et al., 1993). They suggested that
TGF-B induces the synthesis of extracellular matrix components and that there is
a negative feedback loop which becomes operational to downregulate expression
of the TGF-f3 gene once a functional basement membrane is present.
Our search for other genes regulated by LC3 led us to apo D and so we
began to explore its role in ce11 motility and vascular disease. Although this is a
novel hypothesis, it is supported by interesting reports in the literature.
Apolipoproteins have been implicated in vascular disease, but their production
by vascular cells has not specifically been addressed. Apo AI, when expressed in
cholesterol-fed transgenic rabbits appears to have a protective effect against the
developrnent of atherosclerosis since the amount of lipid accumulation in the
aorta and the percentage of the aortic surface that was covered by lesions was
significantly less in the transgenic animais compared to conhols (Duverger et ni.,
1996). This is thought to be due to apo AI'S association with HDL, the 'good
diolesterol' and an enhancement of reverse cholesterol transport. Other studies
on apo B (apo B containing lipoproteins, LDL, are the major carriers of
cholesterol in plasma) have shown that its expression in transgenic mice
accelerates the development of atherosclerotic lesions (Da ef al., 1995). More
recently, Boren et al. (Boren et al., 1998) have demonstrated that the liver derived
apo BlOO containing lipoproteins are also secreted by the heart, thereby
suggesting a role for the heart in lipoprotein metabolism. Apo E knockout mice
have been examined and have been shown to be especially prone to the
development of vascular disease (Plump et al., 1992) (Zhang et al., 1992)
(Nakashima et al., 1994) (Reddick et al., 1994). In addition to its function in the
vasculature, apo E is present in the central nervous system and appears to have
an effect in stabilizing the neuronal cytoskeleton (Masliah el al., 1996)
(Weisgraber and Mahley, 1996). Apo E interacts with tau, and presumably
protects the microtubule binding domain of tau from binding to itself and
forming the characteristic neurofibriliary tangles present in Alzheimer's disease
(Roses et al., 1996).
We now have evidence that apo D is produced in the blood vesse1 wall as
it is expressed by both DA and Ao SMC. The greater expression of apo D in DA
SMC compared to Ao SMC correlates with a potential regulation by LC3 since DA
SMC are also higher producers of LC3. Further, when we studied apoD
expression in the LC3-negative human fibrosarcoma ce11 line, HT1080 we found
little or no apo D expression, but in cells that have been stably transfected with
LC3, apo D appears as a 30kD imunoreactive band. This is perhaps the most
direct evidence
ce11 motility .
77
of a functional correlation between LC3 and apo D and its role in
By gel mobility shift assay we established that a factor in the DA SMC
extract, possibly LC3, could bind specifically to a radiolabeled RNA
oligonucleotide encoding the apo D ARE-like element since binding could be
competed by preincubation of the DA SMC extract with an excess of cold RNA
oligonucleotides. Using a radiolabeled in vitro trançcript of the hl1 length apo D
3'UTR, we showed that recombinant LC3 protein also binds to the ARE-like
element since its binds to the full length 3'UTR and can be competed with cold
RNA oligos of the ARFAike element. A factor in the DA SMC extract also forms
a binding complex with the full length 3'UTR, however, this complex camot be
competed with cold ARE-like oligonucleotides. This could be a cytoplasmic
factor other than LC3 that impedes binding of LC3 and binds to another sequnece.
Alternatively it could be a form of LC3 that is different from the recombinant
protein. We know from work in Our laboratory that the form of LC3 in the SMC
extract is phosphorylated. While intuitively , because of charge effects,
phosphorylated LC3 should be impeded from binding, it is possible that an
alternation in the secondary structure could overcome this feature. We
speculate that this phosphorylated form of LC3 binds to two sequences in the
3'UTR. When presented with just the ARE-like element, the form of LC3 in the
cytoplasm binds to it. However, when presented with the full length 3'UTR i t
appears to show preferential binding to another sequence, explaining the lack of
cornpetition with ARE-like RNA oligonucleo tides. Further approaches to be to
substantiate the nature of the other RNA sequence involved could include
scanning the sequence for other RNA binding proteins motifs or digesting the
3'UTR into multiple fragments and performing gel mobility shift assays to
compare binding complex formation. Altematively site-directed mutagenesis of
candidate sequences or linker scanning analysis would be necessary to prove
involvement of sepecific sequences.
We went on to explore a role for apo D in SMC migration.
Immunofluorescent studies localized apo D to the peririuclear region of
migrating cells suggesting that apo D could be involved in the process of
microtubule reorganization related to migration but at this point it is purely
speculative.
FUTURE STUDIES
Studies to be undertaken in the future should further delineate the
relationship between TGF-8 and LC3; is one regu!ating the other or is there a
reciprocal relationship between the two. We would also want to establish how
TGF-B is regulating LC3. We know that exogenous TGF-f3 enhances LC3
expression, but the mechanism, transcriptional, post-transcriptional etc. is
unknown.
We attempted to show whether endogenous TGF-B was regulating LC3 by
using neutralizing antibodies to TGF-B but, the results from these experiments
suggested that endogenous TGF-f3 may be acting as a suppressor of another factor,
which could be a positive regulator of LC3. A candidate for the positive regulator
is nitric oxide (NO). We could test whether by neutralizing TGF-B we are
relieving this suppression and allowing for the NO induction of LC3. When we
neutralize TGF-D we could also prevent the formation of NO with a NO synthase
inhibitor and determine whether the increase in LC3 production is abrogated.
To determine the molecular basis for the upregulation of LC3 by
exogenous TGF-LZ in fibroblasts, we would assess LC3 mRNA levels by northern
blot, mRNA transcription by run-on assay and mRNA stability after treatment
with actinornycin D. If the mechanism is transcriptional, then identification of
cis regdatory elements in the LC3 promoter could be carried out by transfecting
cells with promoter -reporter constructs. The interaction of the cis element with
frans -acting factors could then be assessed by gel mobility shift and supershift
assays with antibodies to candidate molecules which interact with the cis
element.
It is possible that the increase in apo D in cells at the leading edge of the
wound is related to the perturbation itself and not to any increase in the cells'
ability to migrate. Further studies to establish the role of apo D in migration
could involve using apo D anti-sense technology. We codd investigate whether
in these apo D knock-out cells migration is impaired. Conversely apo D
overemressiner cells could be assayed for their potentially enhanced migratory
apo D regulates microtubules we could try to
tubulin in migrating cells and also track their
A u
potential. To determine whether
CO-imrnunoprecipitate apo D and
CO-distribution by immunoelectron microscopy. We could also label apo D with
green fluorescent protein, wound the cells to track its distribution in living
motile cells. To implicate a role for LC3 in the regulation of apo D in normal
ce&, transfection of LC3 into Ao SMC could be carried out to document changes
in apo D and in cell motility.
It would also be of great interest to address the expression of apo D in
abnormal vessels particularly those with neointimal formation, i.e. with
restenosis after angioplasty, in patients with pulmonary hypertension or wi th
atherosclerosis, or post-transplant coronary artery disease. There is an apo D
knock out being created in the Laboratory of Dr. Jan Breslow (personal
communication). It would be interesting to determine whether vascular
malformations, patent ductus or reduced neointimal formation in disease is
characteristic of the phenotype of these animals.
REFERENCES
Alaupovic, P., D. M. Lee and W. J. McConathy. (1972). Studies on the
composition and structure of plasma lipoproteins. Distribution of lipoprotein
families in major density classes of normal human plasma lipoproteins.
Biochim Biophys Acta. 260(4): 689-707.
Amara, F. M., J. Entwistle, T. 1. Kuschak, E. A. Turley and J. A. Wright. (1996).
Transforming growth factor-betal stimulates multiple protein interactions at a
unique cis-element in the 3'-untranslated region of the hyaluronan receptor
RHAMM W A . J Bi01 Chem. 271(25): 15279-84.
Amento, E. P. and L. S. Beck. (1991). TGF-beta and wound healing. Ciba Found
Symp. lU(ll5): 115-23; discussion 123-9.
Assoian, R. K., A. Komoriya, C. A. Meyers, D. M. Miller and M. B. Sporn. (1983).
Transforming growth factor-beta in human platelets. Identification of a major
storage site, purification, and characterization. J Bi01 Chem. 258(11): 7155-60.
Balbin, M., J. M. P. Freije, A. Fueyo, L. M. Sanchez and C. Lopez-0th. (1990).
Apolipoprotein D is the major protein component in cyst Buid from women
with human breast gross cystic disease. Biochem J. 271: 803-807.
Basson, C. T., O. Kocher, M. D. Basson, A. Asis and J. A. Madri. (1992). Differential
modulation of vascular ce11 integrin and extracellular matrix expression in vitro
by TGF-beta 1 correlates with reciprocal effects on ce11 migration. J Ce11 Physiol.
153(1): 118-28.
82
Biemat, J., E. M. Mandelkow, C. Schroter, K. B. Lichtenberg, B. Steiner, B. Berling,
H. Meyer, M. Mercken, A. Vandermeeren, M. Goedert and a. 1. et. (1992). The
switch of tau protein to an Alzheirner-like state includes the phosphorylation of
two serine-proline motifs upstream of the microtubule binding region. Embo J.
ll(4): 1593-7.
Bojanovski, D., P. Alaupovic, W. J. McConathy and J. L. Kelly. (1980). Isolation
and partial characterization of apolipoprotein D and lipoprotein D from baboon
plasma. FEBS Letters. 112(2): 251-254.
Boren, J., M. M. Veniant and S. G. Young. (1998). Apo B100-containing
lipoproteins are secreted by the heart. J Clin Invest. lOl(6): 1197-202.
Boudreau, N., N. Clausell, J. Boyle and M. Rabinovitch. (1992). Transforming
growth factor-beta regulates increased ductus arteriosus endo theiial
glycosaminoglycan synthesis and a post-transcriptional mechanism controls
increased smooth muscle fibronectin, features associated with intima1
proliferation. Lab Invest. 67: 350-9.
Boudreau, N. and M. Rabinovitch. (1991). Developmentally regulated changes in
extracellular matrix in endothelial and smooth muscle cells in the ductus
artenosus may be related to intima1 proliferation. Lab Invest. 64(2): 187-99.
Boudreau, N., E. Turley and M. Rabinovitch. (1991). Fibronectin, hyaluronan,
and a hyaluronan binding protein contribute to increased ductus arteriosus
smooth muscle ce11 migration. Dev Biol. 143: 235-47.
Boyles, J. K., L. M. Notterpek and L. J. Anderson. (1990). Accumulation of
apolipoproteinç in the regenerating and remyelinating mammalian peripheral
nerve. Identification of apolipoprotein D, apolipoprotein A-IV, apolipoprotein E
and apolipoprotein A-1. J Biol Chem. 265(29): 17805-17815.
Brewer, G. and J. Ross. (1988). Poly(A) shortening and degradation of the 3' AtU-
rich sequences of hurnan c-myc mRNA in a cell-free system. Mol Ce11 Biol. 8(4):
1697-708.
Brewer, G. and J. Ross. (1989). Regdation of c-rnyc mRNA stability in vitro by a
labile destabilizer with an essential nucleic acid component. Mol Cell Biol. 9(5):
1996-2006.
Brinton, L. A. (1990). Relationship of benign breast disease to breast cancer. Ann
N Y Acad Su. 586(266): 266-71.
Brugg, B. and A. Matus. (1991). Phosphorylation determines the binding ot
microtubule-associated protein 2 (MAPZ) to microtubules in living cells. J Ce11
Biol. 114(4): 735-43.
Caceres, A. and K. S. Kosik. (1990). Inhibition of neurite polarity by tau antisense
oligonucleotides in primary cerebellar neurons. Nature. 343(6257): 461-3.
Caput, D., B. Beutler, K. Hartog, R. Thayer, S. S. Brown and A. Cerami. (1986).
Identification of a common nucleotide sequence in the 3'-untrawlated region of
mRNA molecules specifying inflammatory mediators. Proc Nat1 Acad Sci U S A.
83(6): 1670-4.
Cassels, D. E. and R. Y. Moore. (1973). Sympathetic innervation of the ductus
arteriosus in relation to pa tency. Chest. 63(5): 727-31.
Chang, M. W., E. Barr, J. Seltzer, Y.-Q. Jiang, G. J. Nabel, E. G. Nabel, M. S.
Parrnacek and J. M. Leiden. (1995). Cytostatic gene therapy for vascular
proliferative disorders with a constitutively active form of the retinoblastoma
gene product. Science. 267: 518-522.
Chervu, A. and W. S. Moore. (1990). An overview of intima1 hyperplasia. Surg
Gynecol Obstet. 171 (5): 433-47.
Chung, S., L. Jiang, S. Cheng and H. Furneaux. (1996). Purification and properties
of HuD, a neuronal RNA-binding protein. J Biol Chem. 271(19): 11518-24.
Ciatto, S., A. Biggeri, Rosselli, Del, Turco, M, D. Bartoli and A. Iosça. (1990). Risk
of breast cancer subsequent to proven gross cystic disease. Eur J Cancer. 26(5): 555-
7.
Coceani, F., C. A. Breen, J. G. Lees, J. R. Falck and P. M. Olley. (1988). Further
evidence implicating a cytochrome P-450-mediated reaction in the contractile
tension of the lamb ductus arteriosus. Circ Res. 62(3): 471-7.
Coceani, F., L. Kelsey and E. Seidlitz. (1994). Occurrence of endothelium-derived
relaxing factor--nitric oxide in the lamb ductus arteriosus. Can J Physiol
Pharmacol. 72(1): 82-8.
85
Colbert, M. C., M. L. Kirby and J. Robbins. (1996). Endogenous retinoic acid
signaling colocalizes with advanced expression
myosin heavy chain isoform during development
Res. 78(5): 790-8.
of the a d d t smooth muscle
of the duchis arteriosus. Circ
Da, P.-H., R. J. Farese, D. F. Johnson, L. M. Flynn, V. Pierotti, D. L. Newland, M. F.
Linton, D. A. Sanan and S. G. Young. (1995). Trançgenic mice expressing high
levels of hurnan apolipoprotein B develop severe atherosclerotic Lesions in
response to a high-fat diet. J Clin Invest. 95(5): 2246-57.
Dean, D. C., R. F. Newby and S. Bourgeois. (1988). Regdation of fibronectin
biosynthesis by dexamethasone, transforming growth factor 13, and CAMP in
human cell lines. J. Cell. Biol. 106: 2159-2170.
Dean, D. C., M. S. Blakeley, R. F. Newby, P. Ghazal, L. Hennighausen and S.
Bourgeois. (1989). Forskolin inducibility and tissue-specific expression of the
fibronectin promoter. Mol. Cell. Biol. 9: 1498-1506.
Dereeder, E. G., N. Girard, R. E. Poelman, J. C. Van Munsteren, D. F. Patterson
and A. C. Gittenberger-de-Groot. (1988). Hyaluronic acid accumulation and
endothelial ce11 detachment in intima1 thicking of the vellsel wall. Am. J. Pathol.
132: 574-585.
Deqmck, R., J. A. Jarrett, E. Y. Chen, D. H. Eaton, J. R. Bell, R. K. Assoian, A. B.
Roberts, M. B. Sporn and D. V. Goeddel. (1985). Human transforming growth
factor-beta complementary DNA sequence and expression in normal and
transfomed cells. Nature. 316(6030): 701-5.
Ding, A., C. F. Nathan, J. Graycar, R. Derynck, D. J. Stuehr and S. Srimal. (1990).
Macrophage deactivating factor and transforming growth factors-beta 1 - beta 2
and -beta 3 inhibit induction of macrophage nitrogen oxide synthesis by IFN-
gamma. J Lmmunol. 145(3): 940-4.
Drayna, D., C. Fielding, J. McLean, B. Baer, G. Castro, E. Chen, W. Henzel, W.
Kohr, L. Rhee, K. Wion and R. Lawn. (1986). Cloning and expression of human
apolipoprotein D cDNA. J Biol Chem. 261(35): 1653546539-
Duverger, N., H. Kruth, F. Emmanuel, J. M. Caillaud, C. Viglietta, G. Castro, A.
Tailleux, C. Fievet, J. C. Fruchart, L. M. Houdebine and P. Denefle. (1996).
Inhibition of atherosclerosis development in cholesterol-fed human
apolipoprotein A-I-transgenic rabbits. Circulation. 94(4): 713-7.
Edelmann, W., M. Z e ~ a s , P. Costello, L. Roback, I. Fischer, J. A. Hammarback, N.
Cowan, P. Davies, B. Wainer and R. Kucheriapati. (1996). Neuronal
abnormalities in microtubule-associated protein I B mutant mice. Proc Natl Acad
Sci U S A. 93(3): 1270-5.
Eghbali, M., R. Tomek, C. Woods and B. Bhambi. (1991). Cardiac fibroblasts are
predisposed to convert into myocyte phenotype: specific effect of transforming
growth factor beta [published erratum appears in Proc Natl Acad Sci U S A 1991
Apr 15;88(8):3510]. Proc Natl Acad Sci U S A. 88(3): 795-9.
Ellis, I. R. and S. L. Schor. (1996). Differential effects of TGF-beta1 on hyaluronan
synthesis by fetal and adult skin fibroblasts: implications for cell migration and
wound healing. Exp Cell Res. 228(2): 326-33.
Ferrandon, D., L. Elphick, C. Nusslein-Volhard and D. St Johnston. (1994).
Staufen protein associates with the 3'UTR of bicod mRNA to f o m particles that
move in a microtubule-dependent marner. Cell. 79: 1221-1232.
Ferrell, M., V. Fuster, H. K. Gold and J. H. Chesebro. (1992). A dilemma for the
1990s: Choosing appropriate experïmental animal models for the prevention of
restenosis. Circulation. 85: 1630-1631.
Fielding, P. E. and C. J. Fielding. (1980). A cholesteryl ester transfer complex in
human plasma. Proc Natl Acad Sci U S A. 77(6): 3327-30.
Fine, A. and R. H. Goldstein. (1993). Regulation of type 1 collagen mRNA
translation b y TGF-beta. Reg Immunol. 5(3-4): 218-24.
Flower, D. R. (1994). The lipocalin protein family: A role in ce11 regulation. FEBS
letters. 354: 7-11.
Flower, D. R. (1996). The lipocalin protein family: Structure and function.
Biochem J. 318: 1-14.
Francone, O. L., A. Gurakar and C. Fielding. (1989). Distribution and functions of
1ecithin:cholesterol acyltransferase and cholesteryl ester transfer protein in
plasma lipoproteins. Evidence for a functional unit containing these activities
together with apolipoproteins A-1 and D that catalyzes the esterification and
transfer of cell-derived cholesterol. J Bi01 diem. 264(12): 7066-7072.
Frohman, M. A., M. K. Dush and G. R. Martin. (1988). Rapid production of full-
length cDNAs from rare transcripts: amplification using a single gene-specific
oligonudeotide primer. Proc Natl Acad Sci U S A. 85(23): 8998-9002.
Frolik, C. A., L. L. Dart, C. A. Meyers, D. M. Smith and M. B. Sporn. (1983).
Purification and initial characterization of a type beta transforming growth factor
from human placenta. Proc Natl Acad Sci U S A. 80(12): 3676-80.
Gagelin, C., M. Pierre, J. M. Gavaret and D. D. TON. (1995). Rapid TGF beta I
effects on actin cytoskeleton of astrocytes: comparison with other factors and
implications for cell motility. Glia. 13(4): 283-93.
Gao, F. B., C . C. Carson, T. Levine and J. D. Keene. (1994). Selection of a subset of
rnRNAs frorn combinatorial 3' untranslated region libraries using neuronal
RNA-binding protein Hel-NI. Proc Nat1 Acad Sci U S A. 91(23): 11207-11.
Gao, F. B. and J. D. Keene. (1996). Hel-Nl/Hel-N2 proteins are bound to poly(A)+
mRNA in granular RNP structures and are implicated in neuronal
differentiation. J Cell Sci. : 579-89.
Gelfand, V. 1. and A. D. Bershadsky. (1991). Microtubule dynamicç: mechanism,
regulation, and function. Annu Rev Ce11 Biol. 7(93): 93-116.
Gittenberger-de-Groot, A. C., A. J. M. Moulaert and J. F. Hitchcock. (1980).
Histology of the persistent arteriosus in cases of congenital rubella. Circulation.
62: 183-186.
Gittenberger-de-Groot, A. C., J. L. M. Strengers, M. Mentink, R. E. Poelmann and
D. F. Patterson. (1985). Histologie studies on normal and persistent ductus
arteriosus in the dog. J. Amer. Coll. Cardiol. 6: 394-404.
Gittenberger-de-Groot, A. C., L. Van Ertbruggen, A. J. M. Moulert and F. Harrink.
(1980). The ductus arteriosus in the preterm infant: Histological and clinical
observations. J. Pediatr. 96: 88-93.
Gottlieb, E. (1992). The 3' untranslated region of localized matemal messenges
contains a consemed motif involved aiRNA localization. Proc. Natl. Acad. Sci.
USA. 89: 7164-7168.
Grafi, G., 1. Sela and G. Galili. (1993). Translational regulation of human beta
interferon rnRNA: association of the 3' AU-rich sequence with the poly(A) tail
reduces translation efficiency in vitro. Mol Cell Biol. 13: 3487-93.
Gravis, E. R. and R. Lehman. (1992). Localization of nanos RNA contols
embronic polarity. Cell. 71: 301-313.
Gundersen, G. G., 1. Kim and C. J. Chapin. (1994). Induction of stable
microtubules in 3T3 fibroblasts by TGF-beta and serum. J Ce11 Sci. 107: 645-59.
Hamrnarback, J. A., R. A. Obar, S. M. Hughes and R. A. Vallee. (1991). MAPlB is
encoded as a polyprotein that is processed to form a complex N-terminal
microtubule-binding domain. Neuron. 7: 129-139-
Han, J., T. Brown and B. Beutler. (1990). Endotoxin-responsive sequences contro
cachectin/tumor necrosis factor biosynthesis at the translational level. J. Exp
Med. 171: 465-475.
Han, J. R., G. K. Yiu and N. O. Hecht. (1995). Testis/brain RNA-binding protein
attaches translationally repressed and transported mRNAs to micro tubules. Froc.
Natl. Acad. Sci. USA. 92: 9550-9554.
Hardwick, C., K. Hoare, R. Owens, H. P. Hohn, M. Hook, D. Moore, V. Cripps, L.
Austen, D. M. Nance and E. A. Turley. (1992). Molecular cloning of a novel
hyaluronan receptor that mediates tumor ce11 motility [published erratum
appears in J Ce11 Bi01 1992 Aug;118(3):753]. J Ce11 Biol. 117(6): 1343-50.
Hedin, U., B. A. Bottger, E. Forsberg, S. Johansson and J. Thyberg. (1988). Diverse
effects of fibronectin and laminin on phenotypic properties of cultured arterial
smooth muscle cells. J Cell Biol. 107(1): 307-19.
Hedin, U. and J. Thyberg. (1987). Plasma fibronectin promotes modulation O C
arterial smooth-muscle cells from contractile to synthetic phenotype.
Differentiation. 33(3): 239-46.
Hinek, A., R. P. Mecham, F. Keeley and M. Rabinovitch. (1991). Impaired elastin
fiber assembly related to reduced 67-kD elastin- binding protein in fetal lamb
ductus arteriosus and in cultured aortic smooth muscle cells treated with
chondroitin sulfate. J Clin Invest. 88(6): 2083-94.
Hinek, A. and M. Rabinovitch. (1993). The ductus arteriosus migratory smooth
muscle cell phenotype processes tropoelastin to a 52-kDa product associated with
impaired assembly of elastic laminae. J. Biol. Chem. 268: 1405-1413.
Hinek, A., M. Rabinovitch, F. Keeley, Y. Okamura-Oho and J. Callahan. (1993).
The 67-kD elastin/laminin-binding protein is related to an enzymatically
inactive, altematively spliced from of i3-galactosidase. J. Clin. Invest. 91: 1198-
1205.
Humes, H. D., T. Nakamura, D. A. Cieslinski, D. Miller, R. V. Emmons and W.
A. Border. (1993). Role of proteoglycans and cytoskeleton in the effects of TGF-
beta 1 on rend proximal tubule cells. Kidney Int 43(3): 575-84.
Ignotz, R. A. and J. Massague. (1986). Transfonning growth factor-beta stimulates
the expression of fibronectin and collagen and their incorporation into the
extracellular matrix. J Bi01 Chem. 261(9): 4337-45.
Ip, J. H., V. Fuster, J. Badimon, M. B. Taubman and J. H. Chesebro. (1990).
Syndromes of accelerated atherosclerosis: role of vascular injury and smooth
muscle cell proMeration. J. Am. Coll. Cardiol. 15: 1667-1687.
Jain, R. G., L. G. Andrews, K. M. McGowan, P. H. Pekala and J. D. Keene. (1997).
Ectopic expression of Hel-NI, an RNA-binding protein, increases glucose
transporter (Glutl) expression in 3T3-L1 adipocytes. Mole. Celt. Biol. 17: 954-962.
Jones, P. L., J. Crack and M. Rabinovitch. (1997). Regulation of tenascin-C, a
vascular smooth muscle cell sunrival factor that interacts with the alpha v beta 3
integrin to promote epidermal growth factor receptor phosphorylation and
growth. J Cell Biol. 139: 279-93.
Jones, T. R. and M. D. Cole. (1987). Kapid cytoplasmic turnover of cmyc mRNA:
requirement of 3' untranslated sequences. Mol. Cell. Biol. 7: 4513-4519.
Kahari, V.-M., D. R. Olsen, R. W. Rhudy, P. Carrillo, Y. Q. Chen and J. Uitto.
(1992). Transforming growth factor4 up-regulates elastin gene expression in
human skin fibroblasts. Evidence for post-transcriptional modulation. Lab.
Invest. 66(5): 580-588.
Kahari, V.-M., J. Peltonen, Y. Q. Chen and J. Uitto. (1991). Differential
modulation of basement membrane gene expression in human fib rosarco ma
HT-1080 cells by trançforming growth factor-BI. Lab. Invest. 64: 807-818.
Kanzaki, T., K. Tamura, K. Takahashi, Y. Saito, B. Akikusa, H. Oohashi, N.
Kasayuki, M. Ueda and N. Morisaki. (1995). In vivo effect of TGF- beta 1.
Enhanced intima1 thickening by administration of TGF- beta 1 in rabbit arteries
injured with a balloon catheter. Arterioscler Thromb Vasc Biol. 15(11): 1951-7.
Koyama, N., T. Koshikawa, N. Morisaki, Y. Saito and S. Yoshida. (1990).
Bifunctional effects of transforming growth factor-beta on migration of cultured
rat aortic smooth muscle cells. Biochem Biophys Res Commun. 169(2): 725-9.
Kniys, V., O. Marinx, G. Shaw, J. Deschamps and G. Huez. (1989). Translational
blockade imposed by cytokine-derived UA-rich sequence. Science. 245: 85-88.
Kruys, V., P. Thompson and B. Beutler. (1993). Extinction of the tumor necrosis
factor locus, and of genes encoding the lipopolysaccharide signaling pathway. J
Exp Med. 177(5): 1383-90.
Kruys, V., M. Wathelet, P. Poupart, R. Contreras, W. Fiers, J. Content and G.
Huez. (1987). The 3' untranslated region of the human interferon4 mRNA has
an inhibitory effect on translation. Proc. Natl. Acad. Su. USA. 84: 6030-6034.
Kuznetsov, S. A. and 17. 1. Gelfand. (1987). 18 kDa microtubule-associated protein:
identification as a new light chain (LC-3) of microtubule-associated protein 1
(MM-1). Febs Lett. 212(1): 145-8.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature (Lond.). 277: 680-685.
Lagnado, C. A., C. Y. Brown and G. J. Goodall. (1994). AUUUA is not sufficient to
promote poly(A) shortening and degradation of an mRNA: the functional
sequence within AU-rich elements may be UUAUUUA(U / A)(U/ A). Mol Ce11
Biol. 14(12): 7984-95.
Lea, O. A. (1988). Binding properties of progesterone-binding Cyst protein, PBCP.
Steroids. 52(4): 337-8.
Lewis, S. A., 1. E. Ivanov, G. H. Lee and N. J. Cowan. (1989). Organization of
microtubules in dendrites and axons is determined by a short hydrophobic zipper
in microtubule-associatèd proteins h W 2 and tau. Nature. 342(6249): 498-505.
Lindwall, G. and R. D. Cole. (1984). Phosphorylation affects the ability of tau
protein to promote microtubule assembly. J Biol Chem. 259(8): 5301-5.
Liu, M. W., G. S. Roubin and S. B. King. (1989). Restenosis after coronary
angioplasty: potential biologic determinants and role of intima1 hyperplasia.
Circulation. 79: 13741387.
Loh, K.-C. and M.-H. Tan. (1996). Reverse cholesterol transport: Its contribution
to cholesterol catabolism in normal and disease States. Can J Cardiol. 12(10): 944-
950.
Lyons, R. M. and H. L. Moses. (1990). Transforming growth factors and the
regulation of cell proliferation. Eur J Biochem. 187(3): 467-73.
Ma, W.+, S. Cheng, C. Campbell, A. Wright and H. Furneaux. (1996). Cloning
and characterization of HuR, a ubiquitously expressed Elav-like protein. J. Bio.
Chem. 271: 8144-8151.
Macdonald, P. M. and G. Struhl. (1988). Cis-acting sequences responsibles for
anterior localization of bicoid mRNA in Drosophila embryos. Nature. 336: 595-
598.
Malter, J. S. (1989). Identification of an AUUUA-specific messenger RNA binding
protein. Science. 246: 664-666.
Mann, S. S. and J. A. Hammarback. (1994). Molecular characterization of light
diain 3. A microhibule binding subunit of MAPlA and MAPIB. J Bi01 Chem.
269(15): 11492-7.
Mann, S. S. and J.A. Hammarback. (1996). Gene localization and developmental
expression of light chah 3: A common subunit of microtubule-associated protein
1A (MAPlA) and MAPIB. J. Neuroscience Res. 43: 535-44.
Marigo, V., D. Volpin and G. M. Bressan. (1993). Regulation of the human elastin
promoter in chick embryo cells. Tissue- specific effect of TGF-beta. Biochim
Biophys Acta. 1172(1-2): 31-6.
Masliah, E., M. Mallory, 1. Veinbergs, A. Miller and W. Samuel. (1996).
Alterations in apolipoprotein E expression during aging and neurodegeneration.
Prog Neurobiol. 50(5-6): 493-503.
Maçon, C. and M. Rabinovtich. (1997). Nitric oxide mediates post-transcriptional
regulation of fibronectin synthesis in ductus arteriosus smooth muscle cells.
Faseb Journal. ll(3): A224 (abstract #1298).
Massague, J. (1990). The transforming growth factor-beta family. Annu Rev Cell
Biol. 6(597): 597-641.
Matus, A. (1988). Microtubule-associated proteins: their potential role in
determining neuronal morphology. Annu Rev Neurosci. ll(29): 29-44.
McConathy, W. J. and P. Alaupovic. (1973). Isolation and partial characterization
of apolipoprotein D: A new protein moiety of the human plasma lipoprotein
system. FEBS ktters. 37(2): 178-182.
McConathy, W. J. and P. Alaupovic. (1976). Studies on the isolation and partial
characterization of apolipoprotein D and lipoprotein D of human plasma.
Biochemistry. 15(3): 515-520.
Meijlink, F., T. Curran, A. D. Miller and 1. M. Verma. (1985). Removal of a 67-
base-pair sequence in the noncoding region of protooncogene fos converts it to a
transforming gene. Proc Natl Acad Sci U S A. 82(15): 4987-91.
Mowry, K. L. and D. A. Melton. (1992). Vegetal messenger RNA localization
directed by a 340-nt RNA sequence element in Xenopus oocytes. Science. 255: 991-
994.
Nabel, E. G., L. Shum, V. J. Pompili, 2. Y. Yang, H. San, H. B. Shu, S. Liptay, L.
Gold, D. Gordon, R. Derynck and a. 1. et. (1993). Direct transfer of transforming
growth factor beta 1 gene into arteries stimulates fibrocellular hyperplasia. Proc
Natl Acad Sci U S A. 90(22): 10759-63.
Nakashima, Y., A. S. Plump, E. W. Raines, J. L. Breslow and R. Ross. (1994).
ApoE-deficient mice develop lesions of al1 phases of atherosclerosis throughout
the arterial tree. Arterioscler Thromb. 14(1): 133-40.
Ohno, T., D. Gordon, H. San, V. J. Pompili, M. J. Imperiale, G. J. Nabel and E. G.
Nabel. (1994). Gene therapy for vascular smooth muscle ce11 proliferation after
arterial injury. Science. 265: 781-784.
Pauletto, P., A. Chiavegato, L. Giuriato, M. Scatena, E. Faggin, A. Grisenti, R.
Sarzani, M. V. Paci, P. D. Fulgeri, A. Rappelli and a. 1. et. (1994). Hyperplastic
growth of aortic smooth muscle cells in renovascular hypertensive rabbits is
characterized by the expansion of an immature ceU phenotype. Circ Res. 74(5):
774-88.
Pearlman, W. H., J. L. Gueriguian and M. E. Sawyer. (1973). A specific
progesterone-binding component of human breast cyst fluid. J Biol Chem.
248(16): 5736-41.
Peitsch, M. C. and M. S. Boguski. (1990). 1s apolipoprotein D a mammalian biliri-
binding protein? New Biol. 2(2): 197-206.
Pierce, G. F., T. A. Mustoe, J. Lingelbach, V. R. Masakowski, G. L. Griffin, R. M.
Senior and T. F. Deuel. (1989). Platelet-derived growth factor and transforming
growth factor-beta enhance tissue repair activities by unique mechanisms. J Ce1 1
Biol. 109(1): 429-40.
Plurnp, A. S., J. D. Smith, T. Hayek, S. K. Aalto, A. Walsh, J. G. Verstuyft, E. M.
Rubin and J. L. Breslow. (1992). Severe hypercholesterolemia and atherosclerosis
in apolipoprotein E- deficient mice created by homologous recombination in ES
cells. Cell. 71(2): 343-53.
Provost, P. R., Y. L. Marcel, R. W. Milne, P. K. Weech and E. Rassart. (1991a).
apolipoprotein D transcription occurs specifically in nonproliferating quiescent
and senescent fibroblast cultures. FEBS Letters. 290(1/2): 139-141.
Provost, P. R., L. Villeneuve, P. K. Weech, R. W. Milne, Y. L. Marcel and E.
Rassart. (1991b). Localization of the major sites of rabbit apolipoprotein D gene
transcription by in situ hybridization. J Lipid Res. 32: 1959-1970.
Provost, P. R., P. K. Weech, N. M. Tremblay, Y. L. Marcel and E. Rassart. (1990).
Molecuiar characterization and differential mRNA tissue distribution of rabbi t
apolipoprotein D. J Lipid Res. 31: 2057-2065.
Rabinovitch, M. (1996). Cell-extracellular matrix interactions in the ductus
arteriosus and perinatal pulmonary circulation. Semin Perinatol. 20(6): 531-41.
Rabinovitch, M., S. Beharry, B. T. and G. Jackowski. (1988). Qualitative and
quantitative differences in protein synthesis comparing fetal iamb ductus
arteriosus endothelium and smooth muscle with cells from adjacent vascular
sites. Dev. Biol. 130: 250-258.
Rabinovitch, M., N. Boudreau, G. Vella, F. Coceani and P. M. Olley. (1989).
Oxygen-related prostaglandin synthesis in ductus arteriosus and O ther vascula r
cells [published erratum appears in Pediatr Res 1992 Sep;32(3):285]. Pediatr Res.
26(4): 330-5.
Raghow, R., A. E. Postlethwaite, O. J. Keski, H. L. Moses and A. H. Kang. (1987).
Transforming growth factor-beta increases steady state levels of type 1 procollagen
and fibronectin messenger RNAs posttranscriptionally in cultured human
dermal fibroblasts. J C h Inves t. 79(4): 1285-8.
Rasmussen, L. M., Y. G. Wolf and E. Ruoslahti. (1995). Vascular smooth muscle
cells from injured rat aortas display elevated matrix production associated with
transforming growth factor-beta activity. Am J Pathol. 147(4): 1041-8.
Reddick, R. L., S. H. Zhang and N. Maeda. (1994). Atherosclerosis in rnice lacking
apo E. Evaluation of lesional development and progression [published erratum
appears in Arterioscler Thromb 1994 May;14(5):839]. Arterioscler Thromb. 14(2):
141-7.
Rings, E. H., S. D. Krasinski, B. E. van, A. F. Moorman, J. Dekker, R. K.
Montgomery, R. J. Grand and H. A. Buller. (1994). Restriction of lactase gene
expression along the proximal-to-distal axis of rat small intestine occurs during
postnatal development [see comrnents]. Gastroenterology. 106(5): 1223-32.
Rizzino, A. (1988). Transforming growth factor-beta: multiple effects on ceIl
differentiation and extracellular matrices. Dev Bioi. 130(2): 41 1-22.
Roberts, A. B., M. A. Anzano, L. C . Lamb, J. M. Smith and M. B. Sporn. (1981).
New class of transforming growth factors potentiated by epidermal growth factor:
isolation from non-neoplastic tissues. Proc Natl Acad Sci U S A. 78(9): 5339-43.
Roberts, A. B., M. A. Anzano, C . A. Meyers, J. Wideman, R. Blacher, Y. C. Pan, S.
Stein, S. R. Lehrman, J. M. Smith, L. C. Lamb and a. 1. et. (1983). Purification and
properties of a type beta transforming growth factor from bovine kidney.
Roberts, A. B. and M. B. Spom. (1989). Regdation of endothelial cell growth,
architecture, and matrix synthesis by TGF-beta. Am Rev Respir Dis. 140(4): 1126-8.
Roses, A. D., G. Einstein, J. Gilbert, M. Goedert, S. H. Han, D. Huang, C. Hulette,
E. Masliah, V. M. Pericak, A. M. Saunders, D. E. Schmechel, W. J. Strittrnatter, K.
H. Weisgraber and P. T. Xi. (1996). Morphological, biochemical, and genetic
support for an apolipoprotein E effect on microtubular metabolism. Ann N Y
Acad Sci. 777(146): 146-57.
Ross, R. (1971). The smooth muscle ce11 II: Growth of smooth muscle in culture
and formation of elastic fibres. J. Cell Biol. 50: 172-179.
Ross, R. (1986). The pathogenesis of atherosclerosis--an update. N Engl J Med.
314(8): 488-500.
Ross, R. (1993). The pathogenesis of atherosclerosis: a perspective for the 1990s.
Nature. 362(6423): 801-9.
Ryan, U. S., E. Clements, D. Habliston and J. W. Ryan. (1978). Isolation and
culture of pulmonary artery endothelial cells. Tissue Cell. 10: 535-554.
Sambrook, J., E. F. Frisch and T. Maniatis. (1989). In Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory, New York. vol 3: 33-37.
Samuel, S. K., R. A. Hurta, M. A. Spearman, J. A. Wright, E. A. Turley and A. H.
Greenberg. (1993). TGF-beta 1 stimulation of ce11 locomotion utilizes the
hyaluronan receptor RHAMM and hyaluronan. J Cell Biol. 123(3): 749-58.
Schini, V. B., W. Durante, E. Elizondo, B. T. Scott, D. C. Junquero, A. 1. Schafer
and P. M. Vanhoutte. (1992). The induction of nitric oxide synthase activity is
inhibited by TGF- beta 1, PDGFAB and PDGFBB in vascular smooth muscle cells.
Eur J Pharmacol. 216(3): 379-83.
Schoenfeld, T. A., L. McKerracher, R. Obar and R. B. Vallee. (1989). MAP 1A and
MAP 1B are structurally related microtubule associated proteins with distinct
developmental patterns in the CNS. J Neurosci. 9(5): 1712-30.
Schumacher, J. M., K. Lee, S. Edelhoff and R. E. Braun. (1995). Spnr, a murine
RNA-binding protein that is localized to cytopasmic microtubules. J. Ce11 Biol.
129: 1023-1032.
Schwartz, R. S., D. R. Holmes and E. J. Topol. (1992). The restenosis paradign
revisited: An alternative proposa1 for cellular mechanisms. J. Am. Coll. Cardiol.
20: 1284-1293.
Serra, R., M. F. Verderame and H. C . Isom. (1992). Transforming growth factor
beta 1 partially suppresses the transformed phenotype of ras-transformed
hepatocytes. Cell Growth Differ. 3(10): 693-704.
Shaw, G. and R. Kamen. (1986). A conserved AU sequence from the 3'
untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell. 46(5): 659-67.
Shüna, N., T. Moriguchi, K. Ohta, Y. Gotoh and E. Nishida. (1992). Regulation of
a major microtubule-associated protein by MPF and MAP kinase. Embo J. ll(11):
39 77-84.
Shyjan, A. M., P. Heldin, E. C. Butcher, T. Yoshino and M. J. Briskin. (1996).
Functional cloning of the cDNA for a human hyaluronan synthase. J Bi01 Chem.
271(38): 23395-9.
Silver, M. M., M. D. Freedom, M. D. Silvr and P. M. Olley. (1981). The
morphology of the human newbom duchis arteriosus. Hum. Pathol. 12: 1123-
1136.
Singer, R. H. (1992). The cytoskeleton and mRNA localization. Curr. Opin. Ce11
Biol. 3: 719-721.
Slomp, J., J. C. van Munsteren, R. E. Poelmann, E. G. de Reeder, A. J. Bogers and
A. C. Gittenberger-de-Groot. (1992). Formation of intimal cusions in the ductus
arteriosus a s a mode1 for vascular intima1 thickening. A n
immunohistochemical study of changes in extracellular matrix components.
Atherosclerosis. 93: 25-39.
Smith, K. M., R. M. Lawn and J. N. Wilcox. (1990). Cellular localization of
apolipoprotein D and 1ecithin:cholesterol acyltransferase mRNA in rhesus
monkey tissues by in situ hybridization. J Lipid Res. 31: 995-1004.
Spom, M. B. and A. B. Roberts. (1992). Transforming growth factor-beta: recent
progress and new challenges. J CeU Biol. 119(5): 1017-21.
Spreyer, P., H. Schaal, G. Kuhn, T. Rothe, A. Unterbeck, K. Olek and H. W.
Muller. (1990). Regeneration-associated high level expression of apolipoprotein
D mRNA in endoneurial fibroblasts of peripheral nerve. EMBO J. 9(8): 2479-2484.
St Johnston, D. (1995). The intracellular localization of messenger MAS. Cell. 81:
161-170.
Steward, 0. and G. A. Banker. (1992). Getting the message from the gene to the
synapse: sorting and intracellular transport of RNA in neurons. Trends
Neurosci. 15: 180-186.
Strengers, J. L. M. (1988). Closure of the ductus arteriosus in the rabbits: with
reference to the closing process in the monkey and lamb. In Fetal and postnatal
behavior of the ductus arteriosus. : 109.
Streuli, C. H., C. Schmidhauser, M. Kobrin, M. J. Bissel1 and R. Derynck. (1993).
Extracellular matrix regulates expression of the TGF-beta 1 gene. J Cell Biol. 120:
253-60.
Suprenant, K. A. (1993). Microtubules, ribosomes, and RNA: evidence for
cytoplasmic localization and translational regulation. Cell Motil. Cytoskeieton.
25: 1-9.
Tada, T. and H. Kishimoto. (1990). Ultrastructural and histological studies on
closure of the mouse ductus arteriosus. Acta Anat (Basel). 139(4): 326-34.
Takemura, R., S. Okabe, T. Umeyama, Y. Kanai, N. J. Cowan and N. Hirokawa.
(1992). Increased microtubule stability and alpha tubulin acetylation in cells
transfected with microtubule-associated proteins MAPlB, MAP2 or tau. J Ce11
Sci.103: 953-64.
Tamenbaum, J. E., N. S. Waleh, F. Mauray, L. Gold, E. A. Perkett and R. 1.
Clyman. (1996). Transforming growth factor-beta protein and messenger RNA
expression is increased in the closing ductus arteriosus. Pediatr Res. 39(3): 427-34.
Thyberg, J., U. Hedin, M. Sjolund, L. Palmberg and B. A. Bottger. (1990).
Regulation of differentiated properties and proliferation of arterial srnooth
muscle cells. Arteriosderosis. lO(6): 966-90.
Toole, B. P., R. L. Goldberg, G. Chi-Rosso, C. B. Underhill and R. W. Orkin. (1984).
Hyaluronate-ce11 interactions. In The role of the extracellular matrix in
development. Treistad R. l., editor, Wiley. : 43-66.
Toole, B. P., S. 1. Munaim, S. Welles and C. B. Knudson. (1989). Hyaluronate-ce11
interactions and growth factor regulation of hyaluronate synthesis during Iimb
development. Ciba Found Symp. 143(138): 138-45; discussion 145-9 281-5.
Turley, E. A., L. Austen, K. Vandelight and C. Clary. (1991). Hyaluronan and a
cell-associated hyaluronan binding protein regulate the locomotion of ras-
transformed cells. J. Cell Biol. 112: 1041-1047.
Turley, E. A. and J. Torrance. (1985). Localization of hyaluronate and
hyaluronate-binding protein on motile and non-motile fibroblasts. Exp Ce11 Res.
161(1): 17-28.
Villarreal, F. J., A. A. Lee, W. H. Dillmann and F. J. Giordano. (1996).
Adenovirus-mediated overexpression of human transforming gro wth facto r-
beta 1 in rat cardiac fibroblasts, myocytes and smooth muscle cells. J Mol Ce11
Cardiol. 28(4): 735-42.
Vodovotz, Y., C. Bogdan, J. Paik, Q. W. Xie and C. Nathan. (1993). Mechanisms of
suppression of macrophage nitric oxide release by transforming growth factor
beta. J Exp Med. 178(2): 605-13.
Weisgraber, K. H. and R. W. Mahley. (1996). Human apolipoprotein E: the
Alzheimer's disease comection. Faseb J. lO(13): 1485-94.
Whittemore, L. A. and T. Maniatis. (1990). Postinduction turnoff of beta-
interferon gene expression. Mol Cell Biol. 10(4): 1329-37.
Wilhelm, J. and R. Vale. (1993). RNA on the move: the mRNA localization
pathway. J Ce11 Biol. 123: 269-274.
Wolf, Y. G., L. M. Rasmussen and E. Ruoslahti. (1994). Antibodies against
trariçforming growth factor-beta 1 suppress intima1 hyperplasia in a rat model. J
Clin Invest. 93(3): 1172-8.
Wrana, J. L., C. M. Overall and J. Sodek. (1991). Regdation of the expression of a
secreted acidic protein rich in cysteine (SPARC) in human fibroblasts by
transforming growth factor beta. Comparison of transcriptional and post-
transcriptional control with fibronectin and type 1 collagen. Eur J Biochem.
197(2): 519-28.
Yoder, M. J., F. G. Baumann, N. M. Grover-Johowon, 1. Brick and A. M.
Imparato. (1978). A morphological study of early cellular changes in the closure
of the rabbit ductus arteriosus. Anat. Rec. 192: 19-39.
Zhang, S. H., R. L. Reddick, J. A. Piedrahita and N. Maeda. (1992). Spontaneous
hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E.
Science. 258(5081): 468-71.
Zhou, B., N. Boudreau, C. Coulber, J. Hammarback and M. Rabinovitch. (1997).
Microtubule-associated protein 1 light chain 3 is a fibronectin mRNA- binding
protein linked to mRNA translation in lamb vascular smooth muscle cells. J
C h Invest. 100: 3070-82.
Zhu, L., E. Dagher, D. J. Johnson, H. D. Bedell, F. W. Keeley, H. M. Kagan and M.
Rabinovitch. (1993). A developmentaily regulated program restricting
insolubilization of elastin and formation of laminae in the fetal lamb ductus
arteriosus. Lab Invest. 68(3): 321-31.
Zubiaga, A. M., J. G. Belasco and M. E. Greenberg. (1995). The nonarner
UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA
degradation. Mol. Cell. Biol. 15(4): 2219-2230.
Top Related