INFORMATION TO USERS

This manuscript has been reproduœd from the microfilm master. UMI films the

text directly from the original or copy submitted. Thus. some thesis and

dissertation copies are in typewriter face, while others may be from any type of

cornputer printer.

The quality of this reproduction is dependent upon the quality of the copy

submitted. Broken w indistinct print, colored or poor quality illustrations and

photographs. print bleedthrough, substandard margins, and improper elignment

can adversely affect reproduction.

In the unlikely event that the author did not send UMI a complete manuscript and

there are missing pages, these will be noted. Also, if unauthorized copyright

material had ta be removed, a note will indicate the deletion.

Oversize materials (e-g., maps, drawings, charts) are reproduœd by sedioning

the original, beginning at the upper left-hand corner and continuing from left to

right in equal sections with small overlaps. Each original is also photographed in

one exposure and is induded in reduced form at the back of the book.

Photographs induded in the original manuscript have been reproduced

xerographically in this copy. Higher quality 6" x 9" black and white photographie

prints are available for any photographs or illustrations appearing in this copy for

an additional charge. Contact UMI directly to order.

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA

800-521 -0600

THE INTER-RELATION OF TGF-fZ, LC3 AND

APOLIPOPROTERY D IN THE FETAL LAMJ3

DUCTUS ARTERIOSUS

Andrea F. Burry

A thesis submitted in conformitiy with the requirements for the Degree of

Master of Science in the Graduate Department of Laboratory Medicine and

Pathobiology at the University of Toronto

O Copyright by Andrea F. Burry, 1998

National Library 1*1 of Canada Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395. rue Wellington OttawaON K1AON4 OttawaON K1AON4 Canada Canada

Your fi& Votre reftirence

Our fi& M f r e r é f . c e

The author has granted a non- L'auteur a accorde une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de

reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otheMrise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

THE INTER-RELATION OF TGF-B, LC3 AND APOLIPOPROTEIN D IN THE

FETAL LAMB DUCTUS ARTERIOSUS

Mastex of Science, 1998

Andrea F. B q

Department of Laboratory Medicine and Pathobiology, Cardiovascular

Sciences Collaborative Program, University of Toronto

Intima1 cushion formation in the fetal ductus arteriosus (DA) is

characterized by the abnormal migration of smooth muscle cells (SMC)

from the media1 layer of the vesse1 wall to the intima, where they

proliferate and produce abundant extracellular matrix (ECM). The

'migratory' SMC phenotype is modulated by elevated synthesis of

hyaluronan (HA) by endothelial cells (EC) and fibronectin (FN) by SMC.

Increased DA EC HA synthesis is regulated by elevated levels of

transforming growth factor431 (TGF-BI). Both the increased synthesis of

TGF-BI by EC and FN by SMC are govemed by post-transcriptional

mechanisms. The specific molecular mechankm regulating TGF-Bl has yet

to be determined. We have however, shown that there is increased

efficiency of translation of FN mRNA related to enhanced ribosome

recruitment as a result of an interaction between a microtubule associated

-RNA binding protein, light chain 3 (LC3) of microtubule associated proteinç

1A and 1B and an AU-rich element (ARE) in the 3' untranslated region

(UTR) of the FN mRNA.

Current Iiterature suggests that TGF-BI stabilizes microtubules by

stimulating synthesis of a factor, which could be a microtubule associated

protein. This thesis therefore investigated whether there was evidence t'or

regulation of TGF-Bl by LC3 and/or reciprocal regulation of LC3 by TGF-RI.

We found that DA EC have a greater amount of LC3 compared to Ao EC and

this can be increased in both DA and Ao EC by the addition of exogenous

TGF-BI. These findings are consistent with the interpretation that TGF-B1

could regulate HA synthesis by a LC3-dependent mechanism. Further

investigation would require extensive characterization of the family of HA

synthase genes whidi have only recently been cloned.

Since LC3 regulates the migratory SMC phenotype by increasing the

translational efficiency of FN mRNA, we addressed whether other SMC

genes associated with ce11 motility might be similarly regulated. Using an

LC3 protein affinity column and incubating it with RNA harvested from

adult rat brain (a rich source of microtubule associated proteins) we found

that one of the bound transcripts encoded the 3'UTR of apolipoprotein (apo)

D, which contains an ARE-like element (UUAUUUCUU). This protein has

been previously described as associated with nerve regeneration and reverse

cholesterol transport but has not been shown to be present or hctionally

important in vascular smooth muscle cells. We found increased

production of apo D in DA compared to Ao SMC as assessed by western

immunoblot. Subsequently, we showed by cornpetitive RNA gel mobility

shift assays with unlabeled ARE-like RNA oligonucleotides, that

recombinant LC3 c m bind the ARE-like element in apo D mRNA, as can a

factor (possibly LCS) in the cytoplasmic extracts. However, the form of LC3

in the cytoplasmic extracts does not appear to access the ARE-like element in

context of the full length apo D 3'UTR, because this binding complex

fornation could not be competed.

SMC apo D might be important in

assays on monolayers and

To address whether the increase in DA

cell migration, we carried out wounding

assessed apo D production by

immunohistochemistry and confocal microscopy. There was increased

perinuclear expression of apo D in the leading edge of the monolayer in

association with migrating smooth muscle cells. Taken together, these

studies suggest that apo D might be important in SMC motility, but the

manner in which it is regulated by native LC3 appears to differ from that

established for FN mRNA.

ACKNOWLEDGMENTS

First and foremost, I would like to express my deepest gratitude to my

supervisor, Dr. Marlene Rabinovitch, for her support and encouragement

over the past bvo years. It has been a privilege to work in the Laboratory of

su& a dedicated and talented Physician-Scientist and to benefit from her

knowledge and experience.

I would also like to thank the mernbers of my advisory committee for

their time spent and suggestions given over the course of my Masters' work:

Dr. Eva Turley, Dr. Liliana Attisano, Dr. Gabrielle Boulianne, Dr. Fred Keeley,

and Dr. Duncan Stewart. 1 would also like to thank Dr. Norman Rosenblum

for his prescence and input at my examination.

1 thank al1 the members of the Rabinovitch lab, for 1 have undoubtedly

"picked al1 of their brains" at one time or another over the past two years. 1

am especially grateful to Dr. Bin Zhou who "taught me everything 1 know"; 1

don't know what 1 would have done without him! His unselfish manner

and constant willingness to help (despite having a million of his own things

to do) is something that 1 will always remember. 1 also thank Claire Coulber,

the "super-technician" and "chef-extraordinare" for al1 of her assistance (and

cookies!) and Dr. Peter Lloyd Jones for his wit as weil as his scientific

expertise. I am also indebted to Joan Jowlabar for al1 the time she spent

preparing applications, making posters and slides, always ensuring that the

"pink dots were inside the box" and Susy Taylor for checking my spelling and

.grammar.

1 would like to thank my parents, Benjamin and Elizabeth Burry for

their love and support during this academic and al1 other endeavors

throughout my life. My achievements are a reflection of their

encouragement and faith in my abililites.

1 also thank Christopher Tan for his unconditional love and "strong

shoulders" upon which 1 have had to lean several times over the past two

(make that three) years. His enthusiasm to research and dedication to science

were constant sources of inspiration for me and they kept me going through

the difficult times.

Finally, 1 thank my housemate and friend Arvind Nanda fer his

excellent advice, for making me laugh and for exposing me to the realities of

rnedicine (and also for keeping his Macintosh computer so that 1 could write

my thesis at home). 1 also thank Linnea Humphrey and Leith Drury for being

two of the most wonderful frienddtraining partners that I could ever hope to

find.

TABLE OF CONTENTS

TABLE OF CONTENTS

LIST OF FIGURES

ABBREWATIONS

INTRODUCTION

Overview

Duchis arteriosus as a mode1 to study neointimal thickeriing

Ductus arteriosus

Vasdar neointima

Intima1 cushion formation

Extracellular matrix-vascular ceU interactions

Transforming growth factor4

TGF-i3 as a regdator of extracellular mat*

TGF-B regulates microtubules

Hyaluronan

Fibronectin

Fibronectin is regulated by microtubule associated protein, LC3

Regdation of genes by AU r i c h elements

Microtubule associated proteins

Apolipoprotein D

Rationale for the studies described in th is thesis

.-- V l l l

.HYPOTHESES AND OBJECTIVES

MATERIALS AND METHODS

. . . V l l l

RESULTS 1

LC3 expression is increased in 100-day fetal lamb DA vs. Ao EC

LC3 expression cm be enhanced by exogenous TGF-B

TGF-f3 is dissociated from LC3 in HT1080 ce&

RESULTS II

The regdation of other genes by LC3

ApoD expresssion k greater in DA SMC compared to Ao SMC

LC3 appears to modulate apoD production

L W and DA SMC extracts bind to the 3'UTR of apoD

ApoD localizes to the perinuclear region of migrating DA SMC

DISCUSSION

FUTURE STUDIES

REFERENCES

LIST OF FIGURES

Figure 1. Anatomic features of ductus artenosus

Figure 2. Sdimatic sumrnary of mechanisms related to DA neointimal formation

Figure 3. FN is regulated at the post-transciprtional level

Figure 4. Basal LC3 expression is higher in DA than AO endothelial cells

Figure 5. LC3 expression is enhanced by exogenouç TGF-B

Figure 6. TGF-B enhances LC3 expression in hurnan fibroblast cells in a dose-

dependent manner

Figure 7. Neutralizing antibodies does not decrease basal LC3 expression in

human fibroblasts

Figure 8. Neither TGF-LI or TGF-8 neutralizing antibodies were able to induce

the expression of LC3 in a human fibrosarcoma cell line, HT1080

Figure 9. RHAMM expression is similar in wild-type and LC3 transfected

HT1080 ceUs

Figue 10. PCR amplification of RNA obtained from protein columns

Figure 11. 3'UTR sequence of rat apo D mRNA

Figure 12. Amplification of apo D 3'UTR using sequence specific primers

Figure 13. Apo D expression is greater in DA SMC compared to Ao SMC

F i g u e 14. Apo D expression is greater in LC3 transfected HTlOSO cells

Figure 15A. DA SMC SlOO extract binds to the ARE-like element in apo D

Figure SB. Recombinant LC3 and a protein in $100 exhact bind to the full

length apo D 3'UTR

Figure 16. Confocal microscopy of apo D in migrating DA SMC

Figure 17. Apo D expression in migrating ceus is present in the perinudear

region 12 hours after wounding and remains high at 48 hours.

LIST OF ABBREWATIONS

A, adenosine

Ao, aorta

Apo D, Apolipoprotein D

ARE, AU-rich element

AUBF, adenosine-uridine binding factor

C, cytosine

CAT, chlorampenicol acetyl transferase

DA, ductus arteriosus

DTT, dithiothreitol

EC, endothelid c e k

ECL, enhanced cherniluminescence

ER, endoplasmic reticulm

FBS, fetal bovine senun

FITC, fluorescein isothiocyanate

FN, fibronection

G, Guanosine

GM-CSF, granulocyte macrophage colony-stimulating factor

GST, glutathione Strançferase

HA, hyaluronan

HDL. high dençity lipoprotein

HRP, Horseradish peroxidase

JC3, Iight Chain 3

LDL, low density lipoprotein

hW, microtubule associated protein

PA, pulmonary artery

PAGE, polyaqlamide gel electrophoresis

PBS, phosphate-buffered saline

PCR, polymeraçe diain reaction

PVDF, polyvinyldifluoride transfer membrane

RHAMM:, receptor for hyaluronan-mediated motility

RT, reverse transcriptase

SDS, sodium dodecyl sulfate

SMC, smooth muscle cells

TBE, Tris-borate EDTA

TGF-O, transforming growth factor4

3'UTR, 3' untranslated region

U, uridine

INTRODUCTION

Light chah 3 (LC3) of microtubule associated proteins 1A and 1 B has

recently been shown by our laboratory to act as a RNA binding protein.

Specifically, it interacts with an AU rich element (ARE) in the 3' untranslated

region (UTR) of the fibronectin (FN) mRNA and increases its translational

efficiency. This thesis investigates the regulation of LC3 by transforming growth

factor (TGF)-B1 in the ductus arteriosus (DA) and aorta (Ao) endothelial cells

(EC), allowing for the possibility that TGF-BI regulates the EC production of

hyaluronan (HA) via an LC3 related mechanism. As well, we addressed the

question of whether LC3 is involved in the regulation of other genes that are

expressed in motile smooth muscle cells (SMC). The following introduction

therefore first describes the DA as a mode1 of neointimai formation,

emphasizing cell-matrix interactions and the role of TGF-El, HA and FN. The

regulation of TGF-81, HA and other genes in DA is then reviewed, followed by a

discussion of TGF-81, with an emphasis on its effects on matrix and

microtubules. Next, the regulation of FN by LC3 will be outlined, followed by an

examination of regulation of other genes via ARE elements. Microtubule

associated proteins and their functions will then be discussed. In view of our

findings, a review of the current knowledge regarding apolipoprotein D is

included.

Ductus Arteriosus as a Mode1 to Study Neointimal Thickening

Ductus Arteriosus

The ductus arteriosus (DA) is a fetal blood vesse1 bridging the aorta (Ao)

and pulmonary artery (PA) that serves to divert the right ventricular output

away from the uninflated lungs and back into the systemic circulation (Figure 1).

Closure of the DA shortly after birth, as blood enters the newly inflated lungs,

ensures a proper transition from pre-natal to post-natal circulation. Failure of

the DA to close results in excess pulmonary blood flow and is associated with

pulmonary hypertension, congestive heart failure, and cardiac hypertrophy

(Cassels and Moore, 1973). The DA starts to close at birth with a strong vascular

constriction that is triggered by the onset of breathing. This constriction is

oxygen-dependent and is regulated by a cytochrome-P450-mediated mechanism

(Coceani et aL, 1988) which involves the production of endothelin (Coceani rt ni.,

1994). This initial muscular constriction is soon followed by a complete

anatomical closure which is dependent upon the formation of preexisting

structures, known as 'intimal cushions', which develop in the fetal DA during

late gestation (Gittenberger-de-Groot et al., 1980) (Gittenberger-de-Groot et d l . ,

1985).

Vascular neointima

While a developmental program governs intimal cushion formation in

the DA, a pathologie process which results in a thickened intima or 'neointima'

.and is also associated with atherosclerosis (Ross, 1986) (Ross, 1993) and

pulrnonary hypertension (Reviewed in Rabhovitch, 1996) occurs in response to

injuries reçulting from angioplasty, venous and prosthetic bypass grafts, and

endarterectomy (Chervu and Moore, 1990) (Ip et al., 1990). In al1 these

Figure 1: Anatomic features of ductus arteriosus

The ductus arteriosus (within green circle), connects the aortic arch and

pulmonary artery and develops intima1 cushions (indicated by arrow) during late

gestation.

pathological situations the neointima is characterized by the abnormal migration

and proliferation of smooth muscle cells (SMC) into the subendothelial space

and the accumulation of extracellular matrix (ECM) components. The restenosis

that follows coronary balloon angioplasty, a procedure by which obstructed

arteries are mechanically dilated with a balloon catheter in order to restore blood

flow (Ohno et al., 1994) (Chang et al., 1995), is characterized by the rapid

production of a neointima within a few months (Liu et al., 1989) (Schwartz et al.,

1992) (Ferrell et al., 1992). Since neointimal formation

problem associated with a wide spectrum of common and

disorders, several models have been developed to shidy its

is a major clinical

uncornmon vascular

pathogenesis, one of

which is the rat carotid balloon injury model. This model has been successful in

elucidating the proliferative characteristics of SMC but has been less helpful in

studying the features of SMC migration or ECM production.

The biochemical and cellular events associated with intimal cushion

formation in the DA are relevant to pathological intimal thickening in that there

is increased expression of growth factors, alterations in ECM production and a

switch of SMC phenotype from a 'contractile' to a 'synthetic and migratory' state.

In this respect, study of the mechanisms involved in intimal cushion formation

in the DA will not only potentially aid in the clinical management of patent DA,

but will also provide insight into the pathologie processes underlying

development of the neointima in abnormal vessels.

Intimal Cushion Formation

Intimal cushion formation begins at the pulmonary end of the vesse1 and

continues toward the aorta (Gittenberger-de-Groot et al., 1985). The nature of

intimal cushion formation has been studied in humans (Gittenberger-de-Groot

et aL, 1980) (Gittenberger-de-Groot et al., 1980) (Silver et al., 1981) and in a

number of animal species, including mouse (Tada and Kishimoto, 1990) (Colbert

et al., 1996), dog (Gittenberger-de-Groot et al., 1985) (Dereeder et al., 1988), rabbit

(Yoder et al., 1978) and lamb (Rabinovitch et al., 1988) (Strengers, 1988)

(Rabinovitch et al., 1989) (Zhu et al., 1993) (Boudreau and Rabinovitch, 1991)

(Boudreau et al., 1991) (Hinek et al., 1991) (Boudreau et al., 1992) (Hinek and

Rabinovitch, 1993). The proceçs is initiated in the intima where it appears that

accumulation of ECM components separates the EC from the interna1 elastic

lamina. Smooth muscle cells from the muscular media of the vesse1 wall then

migrate into this matrix-enriched subendothelial region and contribute to the

formation of the intimal cushion.

Extracellular matrix - vascular ce11 interactions

Sequential morphological studies addressing intimal cushion formation

in the human and dog DA revealed that in addition to the matrix proteins

fibronectin (FN) and collagen III (Dereeder et al., 1988), hydrophilic

glycosaminoglycans are the major contributors (Dereeder et al., 1988) (Slomp et

al., 1992) to the expanded subendothelial space (Gittenberger-de-Groo t et al.,

1985). Glycosaminoglycans, specifically hyaluronan (HA), provide the water-

bound and matrix-enriched environment which favors SMC migration. In the

fetal lamb a: 115-days of gestation (term is 145 days) accumulation of

glycosarninoglycans in the DA subendothelial space, irnpaired assembly of elastic

laminae and migration of SMC from the media1 layer into subendothelial space

are evident.

Using primary EC and SMC cultures from the fetal lamb, our laboratory

has investigated the biosynthesis of ECM components and their role in SMC

migration (Boudreau and Rabinovitdi, 1991) (Boudreau et al., 1991) (Hinek et al.,

1991) (Hinek e t al., 1993) (Hinek and Rabinovitch, 1993) (Figure 2). Our

laboratory has shown that there is increased synthesis of glycosaminoglycans,

especially HA, as well as their incorporation into the ECM in DA EC compared to

Ao and PA EC. Synthesis of FN and chondroitin sulfate in DA SMC is also

increased relative to that observed in PA and Ao cells. These DA-specific

differences in ECM production are apparent in 100-day fetal lamb cells, before the

appearance of intimal cushions. The highly synthetic activities of DA EC and

SMC at this early gestation time-point appear to produce the matrix-enriched

environment that facilitates SMC migration into the subendothelial space and

ultimately leads to the formation of the intimal cushions. The changes that

occur in both EC and SMC that lead to intimal cushion formation appear to be

orchestrated by TGF-B.

Transfonning growth factor B

Transfonning growth factor-beta (TCF-S) is a member of the polypeptide

growth factor family that controls embryonic development and tissue

homeostasis. It was originally isolated from human platelets (Assoian et nZ.,

1983), human placenta (Frolik et al., 1983), and bovine kidney (Roberts et fil.,

1983). Three isoforms (TGF-f31, TGF-132, TGF-f33) exist in mammals with 60% to

80% identity (Massague, 1990). They are disulfide-linked homodimeric peptides

with a moiecular weight of 25 kD. In this thesis, 1 will be dealing solely with

TGF-El and 1 will refer to it as TGF-f3.

TGF-B was first described as a factor that was capable of inducing

.anchorage-independent growth of fibroblasts (Roberts et al.,, 1981). The term

'growth factor' is somewhat of a misnomer as it is now known that TGF-B is

capable of either stimulating or inhibiting ce11 growth and/or differentiation

depending on the ce11 type and the surrounding environment. TGF-B plays a

critical role in embryonic development as well as in the repair process following

tissue injury, likely due to its ability to stimulate the production of ECM proteins

and also to increase the expression of receptors that mediate cellular interactions

with ECM (Lyons and Moses, 1990) (Massague, 1990) (Sporn and Roberts, 1992)

(Rizzino, 1988). TGF-B ako elicits changes in ce11 morphology that are associated

with a reorganization of the cytoskeleton which may be related to ceIl motility

(Gagelin et al., 1995) (Eghbali et al., 1991) (Humes et al., 1993) (Serra et al., 1992).

The presence and potential influence of TGF-B as a stimulator of ECM

synthesis (Roberts and Spom, 1989) (Amento and Beck, 1991) has been assessed

during the development of intima1 cushions and closure of the DA (Boudreau et

al., 1992) (Tannenbaum e t al., 1996). Our laboratory has demonstrated by

immunohistochemistry that there is increased TGF-B in DA compared to Ao

tissues from 100-day gestation fetal lambs (Boudreau et al., 1992). The role of

TGF-B in the synthesis of ECM proteins has been studied in cultured EC and SMC

from the fetal lamb DA and it has been shown that the increased synthesis of HA

in DA compared to Ao EC is TGF-B-dependent, since a TGF-IJ neutralizing

antibody reduced synthesis of HA in the cultured DA EC to the levels observed

in Ao EC, but had no effect on its synthesis in the Ao EC. However, unlike O ther

studies showing that TGF-B increases FN expression by enhancing its

transcription and mRNA stability (Dean et al., 1988) (Kahari et al., 1991) (Kahari

et al., 1992), we could not confirm that the enhanced FN synthesis in DA SMC

was mediated by TGF-B. We did however, uncover a post-transcriptional

mechanism which increases FN mRNA translation which will be discussed

below (Boudreau et al., 1992).

Figure 2: Schematic summary of mechanisms related to DA neointimal

formation.

Intima1 cushion formation in the DA involves changes in both the EC and SMC

layers. TGF-8 is upregulated in DA EC, stimulating the accumulation of

glycosaminoglycans (GAGS) such as hyaluronan (HA) and chrondroitin sulfate

in the subendothelium. Chrondroitin sulphate leads to impaired elaç t in

assernbly and the elastin peptides that result may be responsible for the

upregulation of fibronectin (FN). Increased FN production changes the SMC

phenotype from contractile to migratory, facilitating the migration of the SMC

through the elastic laminae into the GAG rich environment, leading to the

formation of intima1 cushions which protrude into the vesse1 lumen. SMC also

increase their expression of a cell surface HA binding protein known a s

RHAMM, the receptor for HA mediated motility.

TGF-B as a regulator of ECM

The influence of TGF-B on vascular remodeling has been studied with

respect to its ability to stimulate matrix synthesis (Amento and Beck, 1991)

(Rasmussen et al., 1995). For example, it has been shown in a number of studies

that exogenous TGF-O induces synthesis of collagen and FN (Ignotz and

Massague, 1986) (Pierce et al., 1989). Cultured Ao SMC isolated from the

pathologie neointima express higher levels of TGF-S mRNA and are stimulated

by TGF-B to produce more proteoglycans compared to SMC isolated from the

normal vessel wall (Rasmussen et al., 1995). TGF-B also stimulates collagen 1 and

IKI synthesis in human vascular SMC (Amento and Beck, 1991) (Villarreal et ni.,

1996). The direct evidence for the participation of TGF-B in the development of

the vascular neointima cornes from in vivo experiments in which infusion of

TGF-B (Kanzaki et al., 1995) or direct transfer of the TGF-B gene (Nabel et al.,

1993) into the vessel wall induced intimal hyperplasia, due mainly to the

production of ECM components, such as proteoglycans, collagens, and FN.

Conversely, TGF-II antibodies suppressed intimal hyperplasia by reducing

accumulation of ECM components (Wolf et al., 1994). Molecular mechanisms

governing TGF-B-induced matrix protein synthesis have been elucidated at the

transcriptional (Kahari et al., 1991) (Marigo et al., 1993), post-transcriptionai

(Kahari e t al., 1991) (Wrana et al., 1991) (Kahari et al., 1992) (Marigo et al., 1993)

and translational levels (Fine and Goldstein, 1993). For example, Kahari et al.

(Kahari et al., 1991) showed that TGF-B increased mRNA levels of type IV

collagen and FN in a time and dose-dependent manner in the human

fibrosarcoma ce11 line HT-1080. In addition, Marigo et al. (Marigo ef al., 1993)

showed that TGF-B stimulated the transcription of elastin in HT1080 and NIH

3T3 cells. Kahari et al. (Kahari et al., 1992) have also shown that TGF-B increases

transcription and stability of elastin mRNA in human skin fibroblasts. They

f o m d that TGF-I3 enhanced steady state levels of elastin mRNA in a dose-

dependent marner. When transcription was blocked, cells that were treated

with TGF-B had mRNA levels six times higher than those of untreated cells after

10 hours of incubation, indicating that TGF-B also increases mRNA stability.

Wrana et al (Wrana et al., 1991) have also shown that TGF-i3 increases both the

transcription and stability of FN mRNA and type 1 collagen mRNA in human

fibroblast cells. Fine and Goldstein (Fine and Goldstein, 1993) have

demonstrated by in vitro translation assay that TGF-P causes a 2-3 fold increase in

type I collagen in human lung fibroblast cultures compared to the in vitro

translation of RNA in unstimulated cells.

TGF-B regulates microhibules

TGF-B elicits changes in ce11 morphology that are associated with a

reorganization of the cytoskeleton which may be related to ce11 motility. One of

the ways in which TGF-B affects the cytoskeleton is through microtubules,

components of the cytoskeleton that are found in almost every cell.

Microtubules are dynamic structures consisting of tubulin and a variety of

microtubule associated proteins (MAP) and play a role in activities such as

mitosis, intracellular vesicle transport and determination of ce11 shape and

motility (Gelfand and Bershadsky, 1991). TGF-f3 has also been shown to increase

the stability of microtubules in NM-3T3 fibroblast cells (Gundersen et al., 1994).

It has been well documented that when fibroblasts in culture are induced to

migrate into a wound, they generate stable microtubules that are oriented in the

direction of migration. Gundersen et al. (Gundersen et al-, 1994) showed that this

does not occur if the cells are maintained in serum-free medium. The serum

factor that is responsible for the induction of the stable microtubules appears to

be TGF-8. They were unable to further determine whether TGF-B stimulates the

formation of stable microtubules through a post-translational mechanism, or

through the increased synthesis of a microtubule stabilizing factor.

Similarily, Gagelin et al. (Gagelin et al., 1995) have shown that TGF-B

causes a rearrangement of the cytoskeleton and induces the formation of

lamellipodia in astrocytes, suggesting an influence of TGF-B on cell migration. It

is therefore likely that TGF-II can orchestrate as complex a process as ce11

migration by regulating both cell shape and production of rnatrix cornponents

such as HA.

Hyaluronan

Hyaluronan is a high molecular weight polysaccharide that is ubiquitously

expressed in ECM. HA has the capacity to bind large amounts of water which

results in expansion of the tissue space and allows for easy movement of cells

into this area (Toole et al., 1984). HA directly promotes migration by

accumulating in the extending laniellae of motile cells (Turley et al., 1991).

Interaction of HA with its ce11 surface receptor, hyaluronan binding protein

(renamed the receptor for hyaluronan-mediated rnotility or RHAMM)

(Hardwick et al., 1992), also promotes ce11 migration in a HA-rich environment

(Turley and Torrance, 1985). For example, DA SMC synthesize greater amounts

of RHAMM than Ao SMC and supplementation of collagen gels with HA

selectiveiy enhances the migration of DA SMC but not Ao SMC. Further,

addition of antibodies against RHAMM selectively inhibits migration of DA

SMC compared to Ao SMC. DA SMC also produce increased amounts of

RHAMM in their lamellipodia at the leading edges of the cells (Boudreau et al.,

1991).

TGF-B is known to stimulate the accumulation of HA (Toole et al., 1989).

TGF-B also induces the transcription, synthesis and membrane expression of

RHAMM (Samuel et al., 1993) (Arnara et al., 1996). Together, these facts point to

an essential role of TGF-% in ce11 migration (Toole et al., 1989), wound healing

(Ellis and Schor, 1996) and neointimal formation. The ability of DA SMC to

migrate in collagen gels was shown to be dependent not only on their expression

of RHAMM but alço on their increased synthesis of EN (Boudreau et al., 1991).

Fibronectin

Severd roles have been attributed to FN in formation of the vascular

neohtirna. This glycoprotein has been shown in primary SMC cultures to

modulate SMC phenotype from contractile to synthetic, associated with the

formation of a widespread rough endoplasmic reticulum, prominent Golgi

apparatus and increased RNA and protein synthesis (Hedin and Thyberg, 1987)

(Hedin et aL, 1988). The RGD (Arg, Gly, Asp) ce11 binduig motif in FN appears to

be important in mediating the phenotypic transformation çince incubation of

cultured SMC with RGD peptides blocks the FN effect and SMC maintain their

contractile phenotype (Hedin et al., 1988). Interaction of FN with its integrin

receptor, agL31, on the surface of vascular EC and SMC in vivo also plays a role

in modulating the synthetic phenotype, thereby elevating synthesis of ECM

components, growth factors, and their receptors (Pauletto et nl., 1994).

Fibronectin has also been implicated in the regulation of SMC migratory

behavior, a prominent feature of neointimal formation. Migration of SMC

during neointimal formation occurs along a FN gradient via interaction of FN

with a5B1 integrins (Thyberget al., 1990). This is supported by the fact that FN

synthesis is increased shortly after vascular injury and is deposited mainly in the

immediate subendothelium where the radially oriented SMC are directed to

migrate (Jones et al., 1997). In three-dimensional collagen gels, our group has

shown that enhanced DA compared to Ao SMC migration is related to elevated

synthesis of FN since RGD peptides or FN antibodies, abrogate the response

(Boudreau et al., 1991) (Boudreau and Rabinovitch, 1991).

Fibronectin is regulated by microtubule associated protein, LC3

It has been shown that the increase in DA SMC FN production is not a

result of increased FN mRNA levels or mRNA stability (Boudreau et al., 1992),

but is due to a post-transcriptional mechanism, namely the enhanced

translational efficiency of FN mRNA in DA verus Ao SMC. Our laboratory has

demonstrated that the mechanism of increased translational efficiency is due to

an interaction of a 15kD RNA binding protein with an AU rich element in the

3'UTR of the FN mRNA (Figure 3). This 15kD protein has been purified and

identified as light chah 3 (LC3) of microtubule associated proteins 1A and 1 B

(Zhou et al., 1997), originally described by Mann and Hammarback (Mann and

Hammarback, 1994).

Regulation of genes by AU n c h elements

The importance of AU-rich elements (ARE) in the 3'UTR in the post-

transcriptional regdation of eukaryotic gene expression was first noted in

experiments investigating the c-fos gene, where it was discovered that removal

of the 67-nt AT-rich sequence in the 3'UTR stabilized the labile mRNA and

conferred a transforming phenotype on cells (Meijlink et al., 1985). Further, an

AU-rich sequence derived from granulocyte-macrophage colony-stimulating

factor (GM-CSF) inserted into the 3'UTR of the LZ-globin mRNA, significnntly

shortens its long half-life (Shaw and Kamen, 1986). Subsequent observations by

Figure 3. FN is regulated at the post-transcriptional level

The post-transcriptional mechanism which underlies the enhanced FN synthesiç

in SMC is the interaction of a 15kD cytoplasmic RNA binding protein

(microtubule associated protein, light chain 3, or LC3) with an AU rich element

in the 3'UTR of FN mRNA.

Caput et al. (Caput et al., 1986) discovered that the ARE sequence, UUAUUUAU,

is present in the 3'UTR of a variety of idammatory mediators and immediate

early response genes such as cytokines and oncogenes as weil as FN. Since then,

the presence of the ARE has been shown to be involved in the high rate of

transcript turnover in a large number of labile mRNAs. For example, c-myc

mRNA is very unstable, having a half life of only 30 minutes or less. Using

deletion consmicts, Jones and Cole (Jones and Cole, 1987) determined that an AU

rich region within exon 3 of the c-myc mRNA was responsible for its high rate

of tumover, since when this region was deleted, its half life was dramatically

increased. Whittemore and Maniatis (Whittemore and Maniatis, 1990)

investigated the AU-rich element in the 3'UTR of the interferon (1NF)-f3 mRNA

by linking the IFN-I2 promoter to the transcription unit of the human growth

hormone (hGH) gene and found that the ARE in the 3'UTR made the usually

stable hGH mRNA very unstable. They concluded that this eiement was

therefore responsible for the rapid decrease in the level of IFN-B mRNA after it

has been virally induced.

In addition to its ability to act as an mRNA destabilizer, other studies have

indicated that the ARE is involved in the modulation of mRNA translational

efficiency. For example, Kruys et al. (Kruys et al., 1987) observed that the ARE

present in the 3'UTR of the human IFN-8 mRNA was suppressing mRNA

translation in both Xenopus oocytes and in a reticulocyte lysate. The

replacement of these sequences with those of Xenoprrs f3-globin mRNA resulted

in the increased translation of the IFN-i3 mRNA by 100-fold in Xenoprls oocvtes

and 10-fold in the reticulocyte lysate, without affecting mRNA stability. Further

studies demonstrated that significant translational inhibition could be achieved

in Xenopus oocytes injected with the IFN-I2 mRNA containing only one copy O C

the octanucleotide, UUAUUUAUU. The level of inhibition was enhanced when

the copy number was increased, such that the presence of three copies affected

the mRNA translation to a level comparable to that of the 3'UTR of natural IFN-

B mRNA (Kruys et al., 1989). More recently, a study by Grafi et al. (Grafi et cd.,

1993) also showed that the ARE in the 3'UTR of human IFN-B mRNA acted as

an inhibitor of translation in a cell-free rabbit reticulocyte lysate by mediathg an

interaction with the poly(A) tail. In addition to IFN-B, the ARES containing the

octanucleotide derived from c-fos and GM-CSF have been shown to have the

same inhibitory effects on mRNA translation (Kniys et al., 1989).

The ARE modulation of mRNA stability and translational efficiency iikely

depends on its interaction with tissue-specific cytoplasmic pro teins (Kruys et al .,

1987) (Kruys et al., 1989) (Han e t al., 1990) (Grafi e t al., 1993) (Kruys et al., 1993)

(Jain ef al., 1997). Malter (Malter, 1989) first identified a binding protein in

lymphocyte cytoplasmic extracts which bound to ARE-containing synthetic

mRNAs on gel mobility shift assays and called it the adenosine-uridine binding

factor (AUBF). Further studies demonstrated that AUBF binds to other ARE-

containing labile mRNAs such as GM-CSF, interleukin (IL)-3, INF-y, c-fos, and C-

myc and functions to stabilize them. It has been determined by this study and

others that the minimal length ARE sequence for binding is

UUAUUUA(U/A)(U/A) (Lagnado et al., 1994) (Zubiaga et al., 1995). Several

cytoplasmic RNA binding proteins that bind to the ARE have been identified

and they seem to fa11 into one of two categories. The first group includes

proteins whose binduig activity correlates with rapid mRNA decay, such as

AUFI, first described to be involved in the degradation of c-myc mRNA (Brewer

and Ross, 1988) (Brewer and Ross, 1989). The second group contains proteins

whose ARE-binding activities are associated with stabilization of labile mRNAs,

as well as enhanced mRNA translation such as Hel-NI, a member of the

embrjonic lethal abnormal vision

(Chung et al., 1996) (Gao and Keene,

(Elav)-like protein family (Gao et al., 1994)

1996) (Ma et al., 1996).

The function of the ARE in the 3'UTR of the FN mRNA was addressed by

our laboratory given that the increased expression of FN in DA SMC appeared to

result from an enhanced translational efficiency. This information, coupled

with the evidence indicating a role for the ARE in mRNA stability and

translation of other genes in a variety of ce11 types made it logical to speculate

that the ARE in the 3'UTR of FN mRNA may also be functionally important in

the modulation of mRNA translation in vascular SMC. The difference in the

ability to translate FN mRNA in DA versus Ao SMC might be due to differences

in cytoplasmic factors which could bind to the ARE in the 3'UTR of FN mRNA.

As such, our laboratory has discovered that LC3, present in greater amounts in

the DA SMC compared to Ao SMC, is responsible for the increased translational

efficiency of FN mRNA, thereby ascribing a novel RNA binding function to

previously described microtubule associated proteins (Zhou et al., 1997).

Microtubule associated proteins

The cytoskeletal network found in al1 eukaryotic cells consists of

microtubules, actin and intermediate filaments. Together, these components

interact to determine ce11 shape, intracellular transport and ceil motility. The

cytoskeleton is very dynamic and this characteristic depends in part on

interactions with MAPs, including high molecular weight proteins like MAP 1A

and 1B and smaller components like tau. MAI'S, although found in many cell

types, have been primarily isolated and characterized from brain and have been

shown to be involved in microtubule assembly and stability as well as acting as

mediators for interactions between microtubules and other ce11 components.

MAFs seem to be regulated by phosphorylation such that

increase or decrease their affinity for microtubules,

microtubule assembiy/depolymerization depending

environment and phase of the ceil cycle (Bnigg and Matus,

Cole, 1984) (Shiina et al., 1992).

phosphorylation can

thereby promo ting

on the ce11 type,

1991) (Lindwall and

MAP 1A and lB are a complex of a heavy-chah and multiple light chain

subunits, LCl, LC2 and LC3. LC1 and LC2 are encoded within the 3' end of the

same open reading frames that encode the MAP 1B and 1A heavy chains

respectively while LC3 is encoded by a separate gene (Hammarback et al., 1991)

(Schoenfeld et al., 1989) (Kuznetsov and Gelfand, 1987) (Mann and Hammarback,

1994). The light chains associate with the amino-terminal microtubule-binding

region of the heavy chains. Although it appears that LC3 is always coexpressed

with either MAP 1A or lB, their developmental expression patterns differ. MAP

1% levels are highest in the embryonic brain, MAP 1A is expressed in greatest

amounts in the adult brain while LC3 Ievels are highest in the first 10 days

following birth (Matus, 1988) (Mann and Hammarback, 1996). It therefore

appears that different mechanisms control expression of these genes. Another

MAP, tau protein, expressed predominantly in neuronal axons, is perhaps best

known for the roie it plays in Alzheimer's Disease, where it becomes abnormally

phosphorylated and self-assembles into paired helical filaments, thereby forming

characteristic neurofibrillary tangles (Biemat et al., 1992).

The importance of MAPs in maintaining cellular structure and function is

perhaps best illustrated by gene alteration studies. For example, Edelmann et al.

(Edelmann et al., 1996) showed that heterozygotes for a mutant form of MAP 1 B

have a slow growth rate, visual and motor system abnormalities and abnormal

neuronal dendritic processes. The homozygous genotype is embryonic le thal.

As well, inhibition of tau by antisense RNA results in inhibition of neurite

outgrowth (Caceres and Koçik, 1990). Conversely, expression of tau in cells that

do not normally produce it causes polymerization of stable microtubules that are

resistant to depolymerizing drugs (Takemura et al., 1992) (Lewis et ai., 1989).

Untü recently when Zhou et al. (Zhou et al., 1997) discovered a role for LC3 in

FN mRNA translation, MAPs were not known to have a role in mRNA

regulation. However, these results are not entirely surprishg given previous

studies suggesting that microtubules play a role in targeting, storage, sorting, and

translation of mRNAs in a variety of cells (Singer, 1992) (Steward and Banker,

1992) (Suprenant, 1993) (Wilhelm and Vale, 1993) (Ferrandon et al., 1994) (St.

Johnston, 1995). Further, signals that direct intracellular localization of rnRNAs

via microtubules are found within the 3'UTR of mRNAs (Macdonald and

Struhl, 1988) (Gottlieb, 1992) (Gravis and Lehman, 1992) (Mowry and Melton,

1992). Interactions between microtubules and mRNA may be mediated by factors

which could recognize both consensus sequences in RNA, as well as bind

microtubules and MAI'S. Several such tram- acting factors that recognize a cis

element in the 3'UTR of mRNA and also bind microtubules have b e m reported,

including a spermatid perinuclear RNA-binding protein (Spnr) in mouse male

germ cells (Schumacher et al., 1995) and a rat testis/brain RNA-binding protein

(Han et al., 1995).

Evidence suggests that cytoskeletal structures, includuig microtubules, are

involved in modulating mRNAs which encode cytoskeletal or cytoplasmic

proteins. In addition, it appears that docking of mRNAs ont0 membrane-bound

polysomes could be facilitated by cytoskeletal structures (Rings et al., 1994). LC3,

which was initially cloned from a rat brain cDNA library, CO-localizes with

microtubules in cultured rat neuronal cells, and CO-precipitates with i ~ z vitro

assembled microtubules (Mann and Hammarback, 1994). The dual function of

LC3 as a RNA-binding protein, as well as a MAI? suggests that microtubules and

MAFs may play a role in the translational regulation of other genes in addition

to FN. As such, Our search to find these other genes as revealed in this thesis led

us to investigate the role of apolipoprotein D in ce11 motility.

Apolipoprotein D

Apolipoprotein (apo) D was first described as a "thin-he polypeptide" due

to its appearance on double immunodiffusion experiments with anti-high

density lipoprotein (HDL antibodies (Alaupovic et al., 1972). It was later isolated,

characterized and named by McConathy and Alaupovic (McConathy and

Alaupovic, 1973) (McConathy and Alaupovic, 1976). They described apo D as a

glycoprotein with a molecular weight of approximately 30kD which was present

in HDL on lipoprotein D or lipoprotein A particles (McConathy and Alaupovic,

1976). Apo D is described as a component of plasma in man (McConathy and

Alaupovic, 1973) (McConathy and Alaupovic, 1976) (Drayna et al., 1986), baboon

(Bojanovski et al., 1980) and other species inchding rabbit, dog, cow and sheep

(Provost et al., 1990). In contrast to other apolipoproteins, the expression of apo

D is unique in that it is found in other organs besides the liver and intestine

(Provost et al., 1990) (Drayna et al., 1986). In fact, apo D levels in the spleen are 59

times higher than that in the liver (Provost et al., 1990). Other organs that have

high levels of apo D include the adrenals, lung, brain and heart. It has also been

demonstrated by in situ hybridization that apo D gene expression is found

mainly in fibroblast like cells, particularly interstitial and connective tissue

fibroblasts, with higher levels being observed near blood vessels (Smith et nl.,

1990) (Provost et al., 1991b). Human apo D was cloned by Drayna et al. (Drayna et

al., 1986) and surprisingly bore no sequence homology to any of the other

apolipoproteins. Instead, it was quite homologous to another farnily of proteins,

the lipocalins

characterized

(fonnerly known as the

by their ability to bind

a2-rnicroglobuIin superfamily), which are

small hydrophobic ligands (Drayna et al.,

1986) (Flower, 1994). Three dimensional analysis of members of this family,

which includes retinol-binding protein, beta-lactoglobulin and insecticyanin

have shown that they conform to an eight stranded beta-barre1 which is suitable

for binding a lipophilic ligand, thereby suggesting a transport role for these

proteins (Flower, 1994) (Flower, 1996)-

Twenty five years after its discovery, studies of apo D have remained

largely descriptive and the role of apo D remains to be elucidated. It has been

suggested that apo D plays a role in reverse cholesterol transport, the process

whereby cholesterol is removed from extrahepatic tissues and brought to the

liver for catabolization (Loh and Tan, 1996). Briefly, cholesterol destined for

removal would be esterified by lecithin:cholesterol acyltransferase (LCAT) and

transferred to lipoproteins (LDL, HDL) by cholesterol ester transfer protein

(CETP) (Francone et al., 1989). The lipoproteins would then transport the

cholesterol to the liver for removal. Apo D is thought to play a role in this

reaction because it complexes with LCAT and CETP (Francone et nl., 1989)

(Fielding and Fielding, 1980).

Of interest also is that apo D is the major protein component isolated in

the fluid of breast cysts in multicystic disease and in fact was formerly referred to

as 'gross cystic disease f h i d protein' (GCDFP)-24 (Balbin et RI., 1990), a

glycoprotein produced b y epithelial cells and shown to have proges terone

binding capabilities (Pearlman et al., 1973). While women with breast cysts have

a 2-4 fold greater risk of developing breast cancer compared to women without

this disorder (Brinton, 1990) (Ciatto et al., 1990), the relationship between breast

cancer and apo D or GCDFP-24, has yet to be determined. Balbin et al. (Balbin et

al., 1990) purified GCDFP-24 by size-exclusion high performance liquid

chromatography (HPLC). They then subjected this protein to tryptic digestion,

purified the peptide fragments by reverse-phase HPLC and determined the

amino acid sequences. AU sequenced peptides matched with regions in the

human apo D sequence. A role was proposed for apo D - in

progesterone/cholesterol transport.

If cholesterol were the preferred ligand for apo D, one would expect that

the addition of exogenous cholesterol would cause an upregulation of apo D.

However, Provost et al. (Provost et al., 1991a) found that cholesterol, when added

to fibroblast cultures did not induce the expression of apo D M A . Similarily,

Lea (Lea, 1988) has shown that GCDFP-24 or apo D is not able to bind large

amounts of cholesterol. Further, Peitsch and Boguski (Peitsch and Boguski, 1990)

have suggested, on the basis of molecular modeling and binding assays, that a

herne-related compound is most likely the preferred ligand for apo D.

There have been other observations and speculations with regards to the

function of apo D. Spreyer et al. (Spreyer et al., 1990) have shown that apo D

mRNA is significantly increased in rat sciatic nerves regenerating after a

denervating crush injury, compared to levels found in non-injured nerves or

those that were prevented from regenerating by ligation. Similarily, in another

study, Boyles et al. (Boyles et al., 1990) showed that three weeks following

denervating crush injury, apo D protein levels were 500-fold greater in

regenerating peripheral nerves from rat, rabbit and marmoset monkey sciatic

nerves compared to levels in the normal nerve. Together, these studies suggest

a role for apo D in nerve repair, perhaps associated with the movement of lipids

required for the synthesis of new membranes.

Rationale for the Studies Descnbed in this Thesis

Based on previous studies by our laboratory and by others, we investigated

two inter-related processes in this thesis. The first addressed the regdation of

LC3 by TGF-B and the second the regulation of other genes by LC3 and their

association with DA intima1 cushion formation. We formulated the following

hypotheses:

HYPOTHESIS 1:

TGF-B regulates the RNA binding protein, LC3

OBJECTIVES 1:

To establish whether an increase in LC3 expression is related to TGF-B

HYPOTHESIS II:

In addition to FN, LC3 binds to mRNA of other genes associated with cell

mo tility

OBJECTTVES II:

To determine whether LC3 binds to other mRNA transcripts and assess whether

these genes are increased in DA vs Ao SMC and related to ce11 motility.

MATERIALS AND lMETHODS

Cell Culture

Fetal Rambouillet lambs were delivered by Caesarian section on day 100 of

a 145-day timed gestation period. DA and Ao were removed en bloc as

previously described (Rabinovitch et al., 1988), and the vessels were separated,

opened, and rinsed in phosphate-buffered saline (PBS) containing 3%

antibio tics/antimycotics (GLBCO, Burlington, Ontario, Canada). Endothelial cells

were hamesied by scraping the luminal surface of the vesse1 with a No. 11 scalpel

blade (Ryan et al., 1978) and maintained in Medium 199 (M199; GIBCO)

containing 20% heat-inactivated fetal bovine serum (FBS, GIBCO) and 1%

antibiotics/antimycotics. Endothelial cells were characierized by a contact-

inhibited "cobblestone" rnorphology and positive staining for factor VI11

(Rabinovitch et al-, 1988) and used at passages 2 or 3. Ductus arteriosus and Ao

SMC were propagated by tissue explant after scraping endothelial layers and

removing the adventia (Ross, 1971). Smooth muscle cells were cultured in Ml99

with 10% FBS and identified morphologically by phase-contrast iight microscopy

[Nikon Diaphot microscope (Nikon)] as having a "hills and valleys" phenotype

and by positive immunofluorescence using an antibody for smooth muscle u-

actin.

Human fibroblast (HF) and human fibrosarcoma ce11 lines (HT1080) were

purchased from American Type Ce11 Culture (ATCC) and cultured with

Minimum Essential Medium (MEM) containing 10% FBS and 1%

penicillin/strep tomycin (GIBCO).

Transfection of HTî080 cells with LC3 (perfonned by Dr. Bin Zhou)

Twenty-four hours prior to transfection, HT1080 cells were plated at a

density of 106/100 mm dish. HT1080 cells were çtably transfected using the

calcium phosphate precipitation method (Sambrook et al.,, 1989). Ten pg of

plasmids pCR3-LC3 or vector pCR2 were used to trançfect each dish for 8 hours.

The cells were then shocked with 10% glycerol for 1 min and fed with fresh

cornplete medium containing the aminoglycoside G418 (200pg/ml, GIBCO). The

media was changed every two days with gradually increasing concentrations of

G418 up to 800 pg/ml. Clones transfected with pCR3-CC3 were selected on the

basis of resistance to G418 (800 pg/ml) by selective trypsinization and screened for

LC3 expression using western immunoblot analysis. The cells transfected from

entire pools of LC3 transfected clones (8) or vector-transfected clones (4) were

s tudied.

TGF-$3 and neutralizing antibody treatments of endothelial cells and fibroblasts

Subconfluent endothelial cells, human fibroblasts (HF) and fibrosarcoma

cells were serum starved for a 24 hour period. Optimal dose of TGF-f3 was

determined by treating HF with increasing doses (O, 0.1, 0.5, 1.0, 5.0 and 10 ng/ml)

of h u m a . TGF-B (R and D Systems, Minneapolis, Minnesota) and assessing LC3

expression by Western immunoblot as described below. It was determined that

5.0 ng/ml resulted in the greatest enhancement of LC3 and as such, this

concentration was used for subsequent experiments. For experiments using

TGF-f3 neutralizing antibodies, cells were serum stawed as above and treated

with chicken IgG (lpg/ml), or neutralizing chicken antibody against TGF-LS

(lpg/rnl and lOpg/ml) or a combination of TGF-f3 (5ng/ml) and neutralzing

antibody (10pg/rnl) (al1 purchased from R and D Systems, Minneapolis,

Minnesota) in serurn-free Ml99 .

Western Immunoblot Analysis

For all Western irnmunoblots, confluent cells (EC, HF, HTlOSOs and SMC)

were hanrested by scraping into 15 ml Falcon tubes and spun at 3000 rpm for 10

minutes. Pelleted cells were resuspended in twice the volume of hypotonic

buffer (25 mM Tris-HC1, pH 7.9, 0.1 mM EDTA) supplemented with proteinase

inhibitors aprotinin, pepstatin and leupeptîn (lmg/ml eadi) and lysed by three

repetitive cycles of freeze-thaw. Sarnples were spun for 30 minutes at 16 000 g at

4 OC and the protein concentration of the supematants were determined using a

standard Bio-Rad protein assay kit followed by spectrophotometry at 595 m.

Equal amounts of protein (20 -40 pg) were solubilized by boiling in 30 pl of

reducing Laemmli sample buffer (Laemmli, 1970) for 10 minutes and resolved

on a 14% or 12% polyacrylamide gel for examination of LC3 and apo D expression

respectively. After electrophoresis, proteins were transferred to a nitrocellulose

membrane. Gel was stained with Coomassie Blue to visualize bands and

coruirm equal protein loading. The membrane was blocked for two hours in tris-

buffered saline (TBS) containing 0.5% tween-20 and 5% non-fat dry milk and

incubated with rabbit antisenun to LC-3 (produced either by Dr. J. Hammarback,

Dept. of Neurobiology and Anatomy, The Bowman Gray School of Medicine,

Winston-Salem, NC or our laboratory) or rnouse anti-apo D antiserum

(generated by Dr. Yves Marcel, Ottawa Heart Institute, Ottawa, Ontario, Canada)

ovemight at 4OC. Membrane was then incubated with 1:3000 diluted goat anti-

rabbit horseradish peroxidase conjugated IgG (Bio-Rad Laboratories, Richmond

CA) for LC3 blots and goat anti-mouse horseradish peroxidase conjugated IgG

(Sigma) for apo D blots for 1 hour at room temperature. The blot was developed

using an enhanced cherniluminescence (ECL) kit (Amersham). The intensi ty of

immunoreactive bands were analyzed using NIH image software.

Assessrnent of other genes regulated by LC3:

Preparation of recombinant LC3-glutathione-S-trançferase (GST. fusion pro tein

colzrmn and elution of bound RNA

Recombinant LC3-glutathione-S-tramferase (GST) fusion protein

contained in E. Coli was released by sonication and solubilized in 20% Triton X-

100. Subsequently, the bacterial sonicate was applied to a column of drained and

washed Glutathione Sepharose 4B (Sigma). The sonicate was allowed to flow

through the column and the matrix was washed 3 times with 1 x phosphate

buffered saline (PBS) before use. A control colurnn was generated by dividing

the total volume of the original column into two equal parts and digesting the

contents of one column with a 1:20 dilution of thrombin solution (Sigma)

overnight at room temperature or by constructing a column containing GST

alone. Total RNA was extracted from whole adult rat brain with a kit from

Pharmacia Biotech using the cesium trifluoroacetate (CsTFA) method. The

RNA:protein binding was 2arried out completely at 4°C as follows; both control

and LC3 columns were washed 4 times with RNA binding buffer (10mM TRIS,

pH 7.9, lOOmM KCl, 5mM MgC12, 0.5mM EDTA and 0.2mM D R - al1 solutions

were prepared with diethylpyrocarbonate (DEPQtreated water and autoclaved).

Columns were blocked for one hour in twice the bed volume with RNA binding

buffer as above with the addition of 100 pg/ml of tRNA and 200U/ml of RNase

guard (Pharmacia). Block was allowed to flow through the column. 10 pg of

RNA were diluted 1:10 with RNA binding buffer (with tRNA and RNase guard

at concentrations as above) and incubated on the column for 30 minutes with

gentle agitation every 10 minutes. Columns were washed 4 x in RNA binding

buffer without tRNA and RNase guard. Column contents were eluteci with

l'riz01 reagent (GIBCO-BRL), glutathione sepharose 4B were pelleted and RNA

was purified following manufacturer's instructions.

Reverse transcriptase - polymerase chain reaction (RT-PCR) of bound mRNAs

Al1 of the isolated RNA from the columns was reversed transcribed to

create cDNA. RNA, DEPC water and dT-adaptor (a 35-base oligonucleotide with

17 dT residues plus a unique adaptor sequence) from the 3'RACE (rapid

amplification of cDNA ends) protocol developed by (Frohman et al.,, 1988), was

heated to 70°C for 10 minutes, quenched on ice, added to 5 X RT reaction buffer,

dTT (O.lM), dNTPs (ZOmM), M-MLV reverse transcriptase (200U/yl) and

incubated at 37OC for 1 hour. The enzyme was then inactivated by heating the

mixture to 95OC for 10 minutes.

Polymerase Chain Reaction (PCR) of bound mRNAs

Reverse primer (pN6; Pharmacia) (25pmol), 3' RACE adaptor (25pmol)

and cDNA were mixed in a total of 50 pl of PCR 'cocktail' containing H20, buffer,

dNTPS, Platinum Taq polymerase (GIBCO-BRL) and then overlaid with mineral

oil (Sigma). Using a DNA thermal cycler we carried out 40 cycles of amplification

as follows; initial denaturation cycle for 5 minutes at 94"C, 40 cycles of 94"C, I

minute; 55"C, 2 minutes; 72"C, 1 min, followed by one cycle of 94"C, 1 minute,

55"C, 2 minutes, 7Z°C, 10 minutes. 10 pl of PCR products were run on 1.5'Xl

agarose gels containing ethidium bromide to visualize bands. Unique bands

and/or bands with greater intensity compared to control were cut from the gel

and purified using the QUIAGEN gel purification kit. Purifed gel products were

then subjected to direct cloning using the TA cloning kit (Invitrogen) and/or

subsequent amplification by PCR as above.

Molecular cloning

Ligation reaction:

2 ~ 1 of purified gel product was directly added to a 1 0 ~ 1 Ligation reaction

mixture containing; pCW.1 vector (25ng/@; Invitrogen), ligation buffer and T4

DNA ligase (4.0 Weiss units) and incubated at 14OC overnight.

Transformation:

0.5~1 of B-rnercaptoethanol (Invitrogen) and 2pl of ligated vector was

added to 5 0 ~ 1 of competent cells (Invitrogen) and incubated on ice for 30

minutes. Bactenal cells were then heat shocked for 30 seconds at 42OC and placed

on ice for 2 minutes. 250~1 of SOC medium were added and bacteria were

shaken in a rotary shaker at 225 rpm for 1 hour at 37OC. 50 and 200pl were plated

separately onto agar plates containing 1pg/ml ampicillin and 40 pl of 40mg/mI

X-gal. Liquid was allowed to soak into the agar before plates were inverted and

left for 18-24 hours at 37OC.

Co lony screening:

White colonies from each plate were selected, and grown overnight in

5ml YTA broth (yeast extract (10g/l), Tryptone (16g/l), NaCl (5g/l), ampicillin

(lpg/ml) at 37OC in a rotary shaker at 225rpm. A lpl bacterial sample was added

to 49p1 of PCR cocktail as previously described and subjected to identicai PCR

conditions as above. A 10 pl sample was run on a 1.5% agarose gel containing

ethidiurn bromide to visualize bands. Clones giving positive PCR products were

mini-prepped.

Mini-preps and restriction enzyme digests:

A 0.5ml sample of bacteria was saved and stored in 0.5ml glycerol at -70JC.

DNA was purifed according to the mini-prep protocol supplied with the Qiagen

Mini-Prep kit. DNA was resuspended in 50 pl of lOmM Tris, pH 8.0. EcoRl

digests were performed to confirm the presence of an insert and positive clones

were sequenced (DNA sequencing facility, Biotechnolo,~ Service Centre,

Hospital for Sick Children, Toronto, Ontario, Canada).

In Vitro Transcription and Gel Mobility Shiff Assays:

Preparation of Apo D 3 UTR:

Forward and reverse primers containing Eco RI and BamHl restriction

sites respectively, were synthesized and used to generate the 3' UTR of apo D

using cDNA obtained from the LC3 column. This 205 base pair PCR product,

which appeared as a single band on a 1.5% ethidium bromide stained agarose gel

was excised from the gel and purified using the Qiagen gel extraction kit. The

pure product was then cut with Eco R I and BamHl and ligated into pGEM-42

that had been cut with the same restriction enzymes using similar ligation

conditions as previously described. The ligated product was transformed into

subcloning efficiency DH5a competent cells (GIBCO-BRL) as above. White

colonies were selected,

digests were completed

mini-preps were performed as above, restriction enzyme

to confirm presence of insert and product was sequenced.

In vitro transcription n-

Sense ['L~~-labeled RNA probes for gel mobility shifts assays were prepared

from the above ptasmid constructs as follows. A large scale plasmid preparation

was performed on the apo D containing vector (maxi-prep kit, Qiagen). Plasmids

were linearized with BamH1. RNA was transcribed using a Promega Riboprobe

kit (Promega Corporation, Madison, WI) with SP6 RNA polymerase in the

presence of [ 3 2 ~ ] - ~ for 1 hour at 37 OC. DNA iernplateç were rernoved by

DNase digestion and RNA was punfied by 2 pheno1:chloroform extractions and 1

chloroform/isoamyl alcohol extraction. RNA was precipitated in 0.5 volumes of

7.5M ammonium acetate and 2.5 volumes of 100% ethanol at -70 OC for I hour.

RNA was centrifuged, pellet was washed in 70 % ethanol, air-dried and

resuspended in 30 pl TE buffer and passed through a Boehringer Manneheim G-

25 RNA purification column. The riboprobe was stored at -70 OC.

Gel Mo bility Shiff Assays

For each assay, 10 ug of DA SMC cytosolic extract or 1OOng recombinant

LC3 protein was incubated with 20 000 - 50 000 cpm of full length 3'UTR apo D

RNA probe or a 20 base pair RNA oligonucleotide probe containing the ARE-like

element, UUAUUüCUU (synnthesized b y Biotechnology Centre, University of

Calgary, Calgary, Alberta) in RNA binding buffer containing 2 ug transfer RNA

(Sigma) in a total volume of 30 ul for 30 minutes at room temperature. RNase

T l was added at a concentration of 1 unit/p1 and incubation continued for 15

minutes at 37 OC. The samples were then separated on a 6% native

polyacrylamide gel in 0.3 X Tris-borate-EDTA (TBE) buffer (90 mM TRIS, 90 mM

boric acid, 2 mM EDTA). For cornpetition and specificity studies, increasing

amounts of excess unlabeled AU-rich RNA probes were incubated with the

cytoplasmic extract for 10 mins before adding the labeled RNA transcripts.

Immunofluorescence 2

DA and Ao SMC at passage 2 were plated on 2.2 cm coverslips at a density 5

of 10 cells/well and cultured for 3 days. Cells were fixed with 100% ice cold

methanol for 5 mins at -20°C and dried for 30 mins at room temperature. After

blocking with phosphate-buffered saline (PBS) containing 1% bovine serum

albumin (BSA) for 30 mins at 37 OC cells were probed with a monoclonal mouse

anti-apo D antibody (1:25 dilution) in PBS containing 1% BSA at room

temperature for 1 hou. Following 3 x 5 min washes, cells were incubated with

secondary antibodies: fluorescein-conjugated goat-anti-mouse IgG (dilution at

1:50) for 1 h at room temperature. Cells were washed 3 x 5 min and mounted

with antifade reagent (Molecular Probes Inc., Eugene, OR). Fluorescence

microscopy and/or confocal microscopy was perfonned. For negative controls,

normal mouse IgG was used iwtead of primary antibodies.

Migration 2

DA and Ao SMC at passage 2 were plated on 2.2 cm coverslips at a density 5

of 10 cells/well and cultured until confluency. Half of the cells were then

scraped off using a mbber policeman, washed 3 times with media and allowed to

grow for 12, 24 or 48 hours. Immunofluorescence was then performed as

previously described.

Analysis of Data

Cornparisons of values in DA and Ao cells or in either ce11 type in

response to stimulation with TGF-B or addition of neutralzing antobody to TGF-

f3 was carried out using the Student t test with p values of 4 0 5 considered as

statistically significant.

LC3 expression is increased in 100-day fetal lamb DA vs Ao EC

Previous studies in our laboratory have shown that a post-transcriptional

mechanism (increaced efficiency of mRNA translation) accounts for the

increased expression of FN in the 100-day fetal lamb DA SMC compared to Ao

SMC. This rnechanism involves an interaction of the RNA binding protein,

LC3, with the ARE in the 3'UTR of the FN rnRNA. LC3 appears to be a

requirement for FN expression as FN expression is very low in the fibrosarcoma

cell Line (HT1080) which lacks LC3 (Zhou et al., 1998, manuscript in preparation).

Transfection of LC3 into HT1080 cells or Ao SMC (low expressors of LC3)

significantly increases their FN expression (Zhou et al., 1998) (Zhouet al., 1997).

We were interested in whether LC3 might also be present in EC and whether or

not it might function in a çimilar marner to regulate the post transcriptional

expression of other genes that are critical to the formation of intima1 cushions

such as TGF-B or HA.

Western immunoblots were performed on equal amounts of protein from

cytosolic extracts of cells maintained in 20% serum to examine LC3 expression in

DA and Ao EC. Basal LC3 expression was approximately 40% greater in the DA

EC compared to the Ao EC (Figure 4) as viewed by the intensity of the DA band

and confirmed by drnsitometry (p< 0.05).

LC3 expression can be enhanced by exogenous TGF-B

Trançforrning growth factor 13 is a known regulator of ECM and has also

been shown to elicit changes in cytoskeletal reorganization, which might be

related to motility, by affecting microtubule stability. We therefore investigated

whether LC3 was under the control of TGF-f3 and if this might be a route taken by

Figure 4. Basal LC3 expression is higher in DA than Ao endothelid cells.

The top panel is a representative western immunoblot and the bottom graph

reflects densitometric analyses of cytosolic extracts from 3 different ce11 harvests

of DA and Ao EC. LC3 expression is approximately 40% greater in the DA EC

compared to the Ao EC as viewed by the intensity of the bands and confirmed by

densitometry . A negative control could uiclude pre-incubation of antibody with

antigen and a positive controi could be the recombinant LC?.

*=p< 0.05; Bar = mean f SEM of 3 experiments.

the DA to enhance its LC3 production which would then lead to cytoskeletal

rearrangements resulting in increased motility. We demonstrated that LC3

expression could be enhanced in both the DA and Ao EC by the addition of

exogenous TGF-B. Western immunoblots were used to detect differences

between untreated DA and Ao EC and those treated with 5ng/ml of TGF-f3 for a

period of 24 hours following 24 hours of serum starvation (Figure 5). TGF-D

enhanced LC3 expression above control serum-free conditions in both DA and

Ao EC by 64% and 63% respectively.

A similar effect of TGF-B on LC3 expression was documented in a non-

vascular human fibroblast ce11 line. Human fibroblasts were serurn starved

before being treated with increasuig doses of TGF-B (0-10 @ml). Western

immunoblot analysis demonstrated a dose-dependent enhancernent of LC3 by

TGF-B that was maximal at a TGF-I2 concentration of 5ng/ml, with increased LC3

expression 84% above control serum free conditions (p<O.O5) (Figure 6 ) . LC3

expression was diminished at a TGF-B concentration of lOng/ml, relative to that

obtained with Sng/ml (p<0.05), but was still significantly higher than control

( ~ ~ 0 . 0 5 ) . This result could be a result of receptor saturation or perhaps at higher

concentrations, TGF-B is activating another factor which could bring about the

dowmegdation of LC3 . To determine whether basal levels of LC3 might be related to endogenous

production of TGF-B, studies were carried out using neutralizing antibodies.

Cells were serum starved for 24 hours before being treated with chicken [gG

(lpg/ml) as a control, TGF-II neutralizing antibody (5pg/ml or lOpg/rnl) or a

mixture of TGF-B and neutralizing antibody (5ng/ml:lOpg/rnl) for 24 hours

(Figure 7). Western immunoblot showed that the neutralizing antibody did not

decrease endogenous LC3 expression, nor was it able to neutralize the effect of

exogenously administered TGF-P. In fact there was a significant increase in LC3

TGF-B treatment (5nglml)

Figure 5. LC3 expression is enhanced by exogenous TGF-B

A western immunoblot for LC3 from cytosolic extracts obtained from DA and Ao

EC, serum starved for 24 hours and then either treated with 5ng/ml of human

TGF-Il for 24 hours (+) or maintained in serum free medium for 24 hours (-) is

shown. TGF-B enhanced LC3 expression by 64% and 63% above control serum

free conditions in the DA and Ao EC respectively.

Concentration of TGF-O1 (nglml)

Figure 6. TGF-8 enhances LC3 expression in human fibroblast ceils in a dose-

dependent manner.

The top panel is a representative western imrnunoblot and the bottom graph

reflects densitometric analyses of 3 different cytosolic extracts of human

fibroblast cells, serum stamed for 24 hours before being treated with increasing

doses (0-10 ng/ml) of TGF-B for 24 hours. Western immunoblot analysis

revealed a dose-dependent enhancement of LC3 expression b y TGF-B tha t was

signihcant compared to control at concentrations of 1.0, 5.0 and 10.0 ng/ml, bu t

maximal at 5ng/ml, with increased LC3 expression 84% above control serum free

conditions. LC3 expression was diminished at long/& relative to 5ng/rnl.

* = pc0.05 compared to control; t = p<0.05 compared to 5.0 ng/ml; Bar = mean + SEM of 3 experiments.

Figure 7. Neutralizing TGF-f3 does not decrease basal LC3 expression in human

fibroblasts,

Hurnan fibroblasts were serum starved for 24 hours before being treated with

chicken IgG ( 1pg/ml) as a control, TGF-8 neutralizing antibody ( lpg/mt and

10pg/ml) or a mixture of TGF-B and neutralizing antibody (5ng/ml:lO~g/ml) for

24 hours. A representative western immunoblot for LC3 is shown on the top

panel and densitometric analysis of 3 different cytosolic extracts is depicted in the

graph below. TGF-B neuhalizing antibody did not decrease the endogenous LC3

expression, nor was it able to neutralize the effect of exogenously administered

TGF-B (stimulatory effect of TGF-f3 demonstrated in figure 6). In fact, the

neutralizing antibody stimulates LC3 expression at a dose of lpg/ml and does not

neutralize the stimulatory effect of TGF-S ai a dose of lOpg/ml.

*=p<0.05; Bar = mean f SEM of 3 experiments.

expression with l ~ g / m l TGF-B neutralizing antibody (p<0.05) which was not

observed with lO&ml, but which also occurred with when this dose was

combined with the stimulating 5ng/ml dose of TGF-B ( ~ ~ 0 . 0 5 ) . This result raised

the possibility that TGFB could be suppressing basal levels of some other factor

which could induce LC3. Ln order to ascertain that the neutralizing antibody was

working, we could have tested its activify in a system that is known to be

regulated by TGF-II Le. the TGF-B enhancement of HA. If the neutralzing

antibody decreased HA production then we could be convinced that it was

workuig in this experiment as well. Alternative approaches could also be taken

to interfere with TGF-B ligation or signalling, Le., the use of dominant negative

receptors or the use of anthense technology.

TGF-B is dissociated from LC3 in HTlOSO c e k

To further address whether endogenous TGF-B might suppress a factor

which is responsible for the expression of LC3 we used a fïbrosarcoma ce11 Iine,

HT1080. These cells produce TGF-B but do not express LC3. If TGF-D was

suppressing an LC3 regulatory factor in the HT1080 cells, we should unmask LC3

expression by neutralizing TGF-B. Alternatively these cells might be non-

responsive to TGF-B. Chicken IgG (lpg/rnl), exopenous TGF-B (5ng/ ml),

neutralizing TGF-8 antibodies (lpg/rnl or 10pg/ml) or a combination of TGF-B

and neutralizing antibody (5ng/ml:lOj.~g/ml) were administered to HT1080 cells

but neither treatment induced LC3 expression (Figure 8). It therefore seems that

TGF-B does not positively or negatively regulate LC3 in HT1080 cells. However,

we cannot negate the possibility that these cells have lost the LC3 gene itself and

so regardless of treatment will not express LC3. To investigate this, we would

start off by comparing LC3 mRNA levels in HT1080 and human fibroblasts. If

they were similar then we would assess whether translation was blocked. If the

LC3 mRNA was not present in HT1080, then southern blot analysis would be

necessary .

Figure 8. Neither TGF-8 or TGF-8 neutralizing antibodies were able to induce

the expression of LC3 in a human fibrosarcoma ce11 Iine (HT1080)

HT1080 cells were treated with chicken IgG ( 1pg/rnl) as a control,

exogenous TGF-B (5ng/ml), neutralizing TGF-G mtibodies (lpg/ml or 10pg/ml)

or a corninbation of TGF-f3 and neutralizing antibody (Sng/ml:lOpg/ml) after a 24

hour serum starvation period. Western immunoblots of triplicate samples

assessed under each condition are show. None of these treatrnents induced LC3

expression, which would appear as a 15kD immunoreactive band. A -60kD band

immunoreactive with the LC3 anitbody has been recognized in both fibroblasts

and FIT1080 cells.

RESULTS II

The regulation of other genes by LC3

To pursue whether LC3 was involved in the regulation of other genes

associated with neointimal formation in the DA and SMC motility in general,

the first logical candidate we considered was RHAMM. First described as a HA

bùiding protein, RHAMM was shown by our laboratory to be involved in the

migration of DA SMC (Boudreau et al., 1991). RIIAMM, however, does not

appear to be regulated by LC3 as we found no difference in RHAMM expression

in wild type HT1080 cells and those that have been stably transfected with LC3

(Figure 9). A good positive control for this experiment would have been to re-

probe this blot for FN, as the trmfected HT1080 cells express more FN than the

wild type cells. Another control would be to test the antibody against the antigen

(positive control), or to pre-incubate antigen with antibody (negative control). It

would also be important to test dierectly for alterations in the synthesis of

RHAMM following metabolic labeling and immunoprecipitation.

We then embarked on a strategy to identify other genes that could be

regulated by LC3 by using LC3 affinity and isolation of rat brain (a rich source of

LC3 and other MAPs) RNA transcripts. The bound transcripts were reverse

transcribed and cDNAs were resolved on ethidium brornide gels.

Figure 10 depicts two examples of PCR products obtained from several

separate RNA extractions and column r u s . Unique bands obtained from the

LC3 column when compared to the control GST column (indicated with arrows)

were sequenced. One of the bound mRNAs, marked on the figure with a star,

encoded 200 nucleotides of the 3'UTR of apolipoprotein (apo) D which contains

an ARE-like element (UUAUUUCUU, underlined). We have called this an

'ARE-like' element because it differs slightly from known ARE elements

R H A M M

Figure 9. RHAMM expression is sirnilar in both wild-type and LC3 transfected

HT1080 cells.

Wild type HT1080 cells, which lack LC3 (-) and those that had been stably

transfected with LC3 (+) were compared for RHAMM expression by western

immunoblot using a RHAMM antibody. The -50 kD band corresponding to

RHAMM appeared similar in both ce11 types. The 30 kD prominent band could

represent a degradation product, or another isoform of RHAMM.

LC3 CTRL

LC3 CTRL

Figure 10. PCR amplification of RNA obtained from protein columns

RNA from the LC3 and control columns was reverse transcribed to create cDNA.

cDNA was amplified by polymerase chah reaction using random primer and

oligo dT and PCR products were resolved on 1.50h agarose gels containing

ethidium bromide to visualize bands. Unique bands from the LC3 column

and/or bands with greater intensity compared to the control (indicated with

arrows) were sequenced. One of the transcripts, indicated on the figure with a

star, encoded apolipoprotein D.

(UUAUUUAUU). For this

of RNA binding vs general

experiment we could also have tested the specificity

RNA binding by testing RNA of several known ARE

genes like c-fios, c-myc or GM-CSF. A good positive control would have been to

run FN mRNA through the column to see if LC3 would bind it in that

environment.

The complete 3'UTR sequence of rat apo D mRNA is shown in Figure 11

(genbank accession X55572; sequenced by Spreyer et al. (Spreyer et a[., 1990). To

sequence the entire apo D 3'UTR from the cDNA pool of the LC3 column,

primers to the published 3'UTR were constructed, one containing an Eco R I

restriction site and the other primer containing a Barn Hl site. These primers

were then used to amphfy a single band corresponding to the correct size of the

3'UTR (205nt) of apo D (Figure 12). This fragment was subsequently cioned into

the pGM4Z vector (Promega).

ApoD expression is greater in DA SMC compared to Ao

As we used adult rat brain tissue as a potential rich source of mRNAs

regulated by LC3 and discovered apo D, we were interested in knowing whether

apo D was present in the fetal DA tissue.

showed that apo D was present in both

By western immunoblot analysis, we

DA and Ao SMC and that there was

approximately 4-fold more present in the DA than in

Human apo D protein, which appeared as a single 30kD

on western immunoblot was used as a positive control.

the Ao. (Figure 13).

immunoreac tive band

643 aggggggtgg gcaaccgctc caggttattt ct tcgcrng 683 gctccctggc cccaccccca ctcctcatca ggaccgagca 723 accccgccag cactagaggg aaagtattgc tatagaagcc 763 aatggagggg actgatggga aggtggccca aacccaagac 802 cccacattgt tactcgccag cccaataata aacattttgc 843 tgatc

Figure 11. 3'UTR of rat apoD mRNA sequence

The 3'UTR of apo D taken from the full length sequence cloned from rat sciatic

nerve by Spreyer et al. (Spreyer et al.,, 1990) is shown. The transcript isola ted by

RT-PCR fo1lowing LC3 immunoaffinity encoded 200 nt of the 205 nt 3' UTR,

which contains an ARE-like element, WAUUUCUU (underlined).

aggggggtgggcaaccgctccagg t tatt t ct t cgctttg gctccctggccccacccccactcctcat~aggaccgagc aaccccgccagcactagagggaaagtattgctatagaag ccaatggaggggactgatgggaaggtggcccaaaccca agaccccacattgttactcgccagcccaataataaacatt ttgctgatc -1

DNA marker

Figure 12. Amplification of apo D 3'UTR using sequence specific primers.

Further experiments were carried out to sequence the entire 3'UTR. Primers to

the 3'UTR were constructed using information from the published apo D

sequence, one containing an Eco RI restriction site and the other primer

containhg a Barn Hl site. These primers were used in a PCR reaction with the

cDNA pool created following LC3 affinity and a single band corresponding to the

correct size of the 3'UTR of apo D was observed (arrow). This fragment was

subsequently cloned into the pGM4Z vector.

Figure 13. Apo D expression is greater in DA SMC compared with Ao SMC

A representative western immunoblot for apo D expression on cytosolic extracts

of DA and Ao SMC from 2 independent experiments with similar results, is

shown. Apo D is present in both DA and Ao SMC but there is approximately

four-fold more in the DA SMC as viewed by the intensity of the bands.

LC3 appears to modulate apo D production

Apo D expression was analyzed in the human fibrosarcoma cell line,

HT1080 which naturally lack LC3. These cells had very little or no apo D evident

by western immunoblotting. However, in cells that have been stably transfected

with LC3, apo D appears as a 30kD imunoreactive band (Figure 14). This

experiment supports a role for LC3 in regulating the expression of apo D in a

manner similar to FN, which Our laboratory has shown is alço increased in LC3

stably transfected ce&.

LC3 and DA SMC extracts bind to the 3'UTR of apoD

To determine whether LC3 rnight be regulating apo D in a manner similar

to FN, i.e. via the ARE-like element, we performed gel mobility shift assays using

recombinant LC3 protein or DA SMC extracts and either the full length

radiolabeled in vitro tramcript of the apo D 3'UTR or a radiolabeled 20 base pair

RNA oligonucleotide that contained the apo D ARE-like element.

UUAULTUCUU. We found that a factor in the DA SMC extract, possibly LC3.

could bind specifically to the radiolabeled RNA oligonucleotide encoding the apo

D ARE-iike element since binding could be competed by preincubation of the DA

SMC extract with an excess of cold RNA oligos (Figure 15 A). Using the full

length apo D 3'UTR we showed that recombinant LC3 protein also binds to the

ARE-like element since it binds to the full length 3'UTR and the cornplex can be

competed with cold RNA oligos of the ARE-like element (Figure 15B). DA SMC

extract also binds to the full length S'UTR, however, binding could not be

competed with cold oligonucleotides (Figure 15B). Since the complexes in

figures 15A and 15B could not be completely competed, perhaps a cold oligo

concentration greater than 500X the radioactive probe cold have been used. Also,

we could have used RNA oligonucleotides with a scrambled ARE-like element

Figure 14. Apo D expression is greater in LC3 transfected HT1080 cells.

Western immunoblot for apo D expression on cytosolic extracts of HT1080 cells,

wild type (LC3-) and stable LC3 transfected (LC3+). Apo D is absen: in the wild

type, but appears at a 30kD immunoreactive band in the LC3 transfected cells.

n

X O

+ 5 3 LU-

c binding corn plex

SI O0 bindir comp bindrng

corn plex

Figure 15 A. DA SMC SI00 extract binds to the ARE-like element in apo D

Gel mobility shift assays were carried out with DA SMC S-100 extracts which

contains LC3 and a 20 base radiolabeled RNA oligonucleotide containing the

ARE-like element. Free probe is shown (FP) followed by SI00 + radiolabeled

oligonucleotide which forms a distinct binding complex. Complex formation is

decreased with 500 fold excess of unlabeled RNA oligonucleotide probe.

Figure 15 B. Binding of recombinant LC3 and a protein in S l O O cytosolic extract

to full length 3'UTR

Recombinant LC3 and DA SMC S-100 extract were irwestigated for their ability to

bind to the full length apo D 3'UTR mRNA. A full length 3'UTR mRNA

trançcript was obtained by in vitro transcription. Lane l(far left)=free probe (FP),

followed by S-100 extract and full length 3'UTR or recombinant LC3 and the full

length 3'UTR. Different binding complexes are seen. The complex with the S-

100 extract cannot be competed by 500 fold excess of cold RNA oligonucleotide ot

the ARE-like element whereas the complex with LC3 can be successfuliy

competed.

or an unrelated sequence to show binding specificity. In addition, a gel shift

using the wild type HT1080 ce11 extract to see if we saw the same complex would

have been useM is determining whether the cytosolic factor was LC3 or not.

Supershîft analysis could be used to document LC3 in the RNA-protein complex,

but unfortunately two different antibodies, one to C-terminal and the other to

the N-terminal did not produce a supershift.

ApoD localizes to the perinudear region of migrating DA SMC

In order to address whether there was a difference in intensity or

distribution of apo D which would suggest a role in ce11 migration,

immunofluorescence was performed on DA SMC migrating through a scratch

wound. Celk were grown to confluency and scraped with a rubber policeman at

12, 24 or 48 hours, staining was performed with an apo D primary antibody and

FITC-conjugated secondary. Figure 16 depicts confocal images of rnigrating DA

SMC 24 hours after wounding. Distinct peruiuclear immunofiuorescent staining

(100X magnification) is seen. Panel A and B depict the same migrating ce11 but,

in panel B the nucleus is stained with propidium iodide. Figure 17 depicts

migrating ceils at different time points. Panel A, O hours; B, 12 hours; C and D, 24

hours; E, 48 hours and panel F depicts cells that are still in the confluent layer.

Apo D expression is not apparent at O hours, but is at 12 hours and remains high

up to 48 hours. The vast majority of cells at the leading edge expressed the

greatest amounts of apo D while virtually al1 the cells still remaining in the

conf luen t layer had very l i t t l e o r no e x p r e s s i o n -

Figure 16. Confocal microscopy of apo D in migrating DA SMC

By confocal microscopy (mapification =100X) localized, perinuclear expression

of apo D can be seen. Panel A and B depict the sarne migrating cell, 24 hours after

injury, but in panel B the nucleus (stained with propidium iodide) is shown.

Figure 17. Apo D expression in migrating DA SMC is increased at 12 hours and

remains high at 48 hours

These confocal images (magnification 100X) depicts DA SMC migrating through

a scratch wound at different time points. Cells in panel A cells were

immunostained at O hours, panel B at 12 hours, panel C and D at 24 hours, panel

E at 48 hours and panel F depicts cells in the confluent layer 24 hours after injury.

The staining is perinuclear and is visible at 12, 24 and 48 hours. The vast

majority of cells at the wound edge expressed the greatest amounts of apo D,

while ceus in the confluent part of the monolayer expressed little or no apo D.

DISCUSSION

Recent studies in Our laboratory have implicated the microtubule

associated protein LC3 as a RNA binding protein involved in the post-

transcriptional regulation of FN, a glycoprotein whose modulation is critical in

the development of the migratory SMC phenotype (Zhou et al., 1997). Motile

SMC thereby migrate from the media into the expanded subendothelial space

where they produce matrix and form an 'intima1 cushion' which eventually

narrows the lumen of the DA in preparation for extrauterine life. As intima1

cushion formation is crucial for the posfmatal dosure of the DA, we investigated

whether LC3 was involved in the post-transcriptional regulation of other genes

such as TGF-f3, that were critical to this process in general or RHAMM, that was

more directly linked to the SMC motile phenotype.

By western imrnunoblot there was more LC3 protein in the DA EC

compared to the Ao, similar to the difference found in the DA vs Ao SMC (Zhou

el al., 1997). Since there is more TGF-B produced by the DA EC compared to the

Ao in early gestation, that also appears to be post-transcriptionally regulated and

given the fact that there is a copy of an ARE in the 3'UTR of the human TGF-f.3

mRNA (Derynck et al., 1985), Our original plan was to determine if LC3 was

binding to the ARE in the TGF-B 3'UTR. If so, this would have provided more

direct evidence linking LC3 with the post-transcriptional regulation of TGF-R.

Attempts to sequence the TGF-i3 3'UTR by PCR, were however, unsuccessfu1

(experimental data not given). At the same time, there was increasing literature

suggesting a role for TGF-B as a regulator of motility and the cytoskeleton

(Koyama et al., 1990) (Basson ef aL, 1992) (Gundersen et al., 1994). Therefore, we

hypothesized that TGF-B might be a regulator of microtubule associated pro teins,

such as LC3 and perhaps TGF-8 increased synthesis of HA in the DA EC by

increasing

Studies in

LC3 especially

vascular EC as

since HA synthase has an ARE (Shyjan et al., 1996).

well as human fibroblast cells cultures supported this

hypothesis since LC3 expression can be upregulated by administration of

exogenous TGF-f3.

Endogenous or basal levels of LC3 in fibroblasts were not susceptible to

neutralization with TGF-f3 antibodies. This suggests that either a different agent

or mechanism is responsible for the endogenous production of LC3 in fibroblasts.

We could not however, exclude TGF-IS as being responsible for the upregulation

of LC3 in DA vs Ao endothelial cells. For example, unpublished studies by

Mason (Mason and Rabinovitch, 1997) in our laboratory have shown that nitric

oxide (NO) is responsible for the upregulation of LC3 in DA but not in Ao SMC.

Culturing endothelial cells from the DA is particularly difficult given the size of

the vesse1 and we anticipate carrying out TGF4 neutralizing antibody studies as

soon as these celts are available. However, the results might also be difficult to

interpret as reflected by the inductive effects of the TGF-B neutralizing antibodies

on LC3 expression in our experiments and on glycosaminoglycan (GAG)

synthesis in experiments carried out by Boudreau et al. (Boudreau et al., 1992). In

examinhg the effect of TGF-B on GAG synthesis in Ao SMC, it was observed chat

while TGF-B upregulated GAG synthesis in Ao SMC, the effect could not be

inhibited by the TGF-B neutralizing antibody. They concluded that TGF-S might

be acting to suppress another cytokine, such as IL-1, which could substitute in

upregulating GAG synthesis. It is possible therefore, that TGF-B is sup p ressing

another factor which might also directly upregulate LC3 e-g. NO. As mentioned

previously, Our laboratory has shown that NO induces LC3 expression in DA

SMC (Maçon and Rabinovitch, 1997) and TGF-13 does suppress NO production in

macrophages (Vodovotz et al., 1993) (Ding et al., 1990) and SMC (Schini et ni.,

1992). Therefore, it can be hypothesized that TGF-f3 naturally suppresses NO so

that when TGF-f3 is itself inhibited by

is able to induce LC3 expression,

the addition of a neutralizing antibody, NO

hence the upregulation with the TGF-8

neutralizing antibody. Of course, since we also have evidence for TGF-B

upregulating LC3, total LC3 expression must depend on the rela-tive

contributions of all factors.

TGF-B is a rnultifunctional protein, capable of stimulating or inhibiting

ce11 growth and/or differentiation depending on

environment which surrounds it. It upregulates

transcriptional (Dean et al., 1989) (Kahari et al., 1991)

the ce11 type and the

FN production at the

(Kahari et al., 1992) and

post-transcriptional levels (Raghow et al., 1987). TGF-B also induces stable

microtubules in 3T3 fibroblasts. Gundersen et al. (Gundersen et al., 1994) have

speculated that TGF-B increases synthesis of a factor that is limiting for stable

microtubule formation. Although the factor was not further described, a logical

candidate would be a MAP. To resolve these questions, hrther work on the

mechanism of LC3 regulation by TGF-f3 would have to be undertaken. If is of

course possible that there might be a reciprocal regulation between LC3 and TGF-

13 i.e. TGF-f3 regulates LC3 and LC3 regulates TGF-IJ. This would be similar to the

rnechanism proposed by Streuli et al (Streuli et al., 1993). They suggested that

TGF-B induces the synthesis of extracellular matrix components and that there is

a negative feedback loop which becomes operational to downregulate expression

of the TGF-f3 gene once a functional basement membrane is present.

Our search for other genes regulated by LC3 led us to apo D and so we

began to explore its role in ce11 motility and vascular disease. Although this is a

novel hypothesis, it is supported by interesting reports in the literature.

Apolipoproteins have been implicated in vascular disease, but their production

by vascular cells has not specifically been addressed. Apo AI, when expressed in

cholesterol-fed transgenic rabbits appears to have a protective effect against the

developrnent of atherosclerosis since the amount of lipid accumulation in the

aorta and the percentage of the aortic surface that was covered by lesions was

significantly less in the transgenic animais compared to conhols (Duverger et ni.,

1996). This is thought to be due to apo AI'S association with HDL, the 'good

diolesterol' and an enhancement of reverse cholesterol transport. Other studies

on apo B (apo B containing lipoproteins, LDL, are the major carriers of

cholesterol in plasma) have shown that its expression in transgenic mice

accelerates the development of atherosclerotic lesions (Da ef al., 1995). More

recently, Boren et al. (Boren et al., 1998) have demonstrated that the liver derived

apo BlOO containing lipoproteins are also secreted by the heart, thereby

suggesting a role for the heart in lipoprotein metabolism. Apo E knockout mice

have been examined and have been shown to be especially prone to the

development of vascular disease (Plump et al., 1992) (Zhang et al., 1992)

(Nakashima et al., 1994) (Reddick et al., 1994). In addition to its function in the

vasculature, apo E is present in the central nervous system and appears to have

an effect in stabilizing the neuronal cytoskeleton (Masliah el al., 1996)

(Weisgraber and Mahley, 1996). Apo E interacts with tau, and presumably

protects the microtubule binding domain of tau from binding to itself and

forming the characteristic neurofibriliary tangles present in Alzheimer's disease

(Roses et al., 1996).

We now have evidence that apo D is produced in the blood vesse1 wall as

it is expressed by both DA and Ao SMC. The greater expression of apo D in DA

SMC compared to Ao SMC correlates with a potential regulation by LC3 since DA

SMC are also higher producers of LC3. Further, when we studied apoD

expression in the LC3-negative human fibrosarcoma ce11 line, HT1080 we found

little or no apo D expression, but in cells that have been stably transfected with

LC3, apo D appears as a 30kD imunoreactive band. This is perhaps the most

direct evidence

ce11 motility .

77

of a functional correlation between LC3 and apo D and its role in

By gel mobility shift assay we established that a factor in the DA SMC

extract, possibly LC3, could bind specifically to a radiolabeled RNA

oligonucleotide encoding the apo D ARE-like element since binding could be

competed by preincubation of the DA SMC extract with an excess of cold RNA

oligonucleotides. Using a radiolabeled in vitro trançcript of the hl1 length apo D

3'UTR, we showed that recombinant LC3 protein also binds to the ARE-like

element since its binds to the full length 3'UTR and can be competed with cold

RNA oligos of the ARFAike element. A factor in the DA SMC extract also forms

a binding complex with the full length 3'UTR, however, this complex camot be

competed with cold ARE-like oligonucleotides. This could be a cytoplasmic

factor other than LC3 that impedes binding of LC3 and binds to another sequnece.

Alternatively it could be a form of LC3 that is different from the recombinant

protein. We know from work in Our laboratory that the form of LC3 in the SMC

extract is phosphorylated. While intuitively , because of charge effects,

phosphorylated LC3 should be impeded from binding, it is possible that an

alternation in the secondary structure could overcome this feature. We

speculate that this phosphorylated form of LC3 binds to two sequences in the

3'UTR. When presented with just the ARE-like element, the form of LC3 in the

cytoplasm binds to it. However, when presented with the full length 3'UTR i t

appears to show preferential binding to another sequence, explaining the lack of

cornpetition with ARE-like RNA oligonucleo tides. Further approaches to be to

substantiate the nature of the other RNA sequence involved could include

scanning the sequence for other RNA binding proteins motifs or digesting the

3'UTR into multiple fragments and performing gel mobility shift assays to

compare binding complex formation. Altematively site-directed mutagenesis of

candidate sequences or linker scanning analysis would be necessary to prove

involvement of sepecific sequences.

We went on to explore a role for apo D in SMC migration.

Immunofluorescent studies localized apo D to the peririuclear region of

migrating cells suggesting that apo D could be involved in the process of

microtubule reorganization related to migration but at this point it is purely

speculative.

FUTURE STUDIES

Studies to be undertaken in the future should further delineate the

relationship between TGF-8 and LC3; is one regu!ating the other or is there a

reciprocal relationship between the two. We would also want to establish how

TGF-B is regulating LC3. We know that exogenous TGF-f3 enhances LC3

expression, but the mechanism, transcriptional, post-transcriptional etc. is

unknown.

We attempted to show whether endogenous TGF-B was regulating LC3 by

using neutralizing antibodies to TGF-B but, the results from these experiments

suggested that endogenous TGF-f3 may be acting as a suppressor of another factor,

which could be a positive regulator of LC3. A candidate for the positive regulator

is nitric oxide (NO). We could test whether by neutralizing TGF-B we are

relieving this suppression and allowing for the NO induction of LC3. When we

neutralize TGF-D we could also prevent the formation of NO with a NO synthase

inhibitor and determine whether the increase in LC3 production is abrogated.

To determine the molecular basis for the upregulation of LC3 by

exogenous TGF-LZ in fibroblasts, we would assess LC3 mRNA levels by northern

blot, mRNA transcription by run-on assay and mRNA stability after treatment

with actinornycin D. If the mechanism is transcriptional, then identification of

cis regdatory elements in the LC3 promoter could be carried out by transfecting

cells with promoter -reporter constructs. The interaction of the cis element with

frans -acting factors could then be assessed by gel mobility shift and supershift

assays with antibodies to candidate molecules which interact with the cis

element.

It is possible that the increase in apo D in cells at the leading edge of the

wound is related to the perturbation itself and not to any increase in the cells'

ability to migrate. Further studies to establish the role of apo D in migration

could involve using apo D anti-sense technology. We codd investigate whether

in these apo D knock-out cells migration is impaired. Conversely apo D

overemressiner cells could be assayed for their potentially enhanced migratory

apo D regulates microtubules we could try to

tubulin in migrating cells and also track their

A u

potential. To determine whether

CO-imrnunoprecipitate apo D and

CO-distribution by immunoelectron microscopy. We could also label apo D with

green fluorescent protein, wound the cells to track its distribution in living

motile cells. To implicate a role for LC3 in the regulation of apo D in normal

ce&, transfection of LC3 into Ao SMC could be carried out to document changes

in apo D and in cell motility.

It would also be of great interest to address the expression of apo D in

abnormal vessels particularly those with neointimal formation, i.e. with

restenosis after angioplasty, in patients with pulmonary hypertension or wi th

atherosclerosis, or post-transplant coronary artery disease. There is an apo D

knock out being created in the Laboratory of Dr. Jan Breslow (personal

communication). It would be interesting to determine whether vascular

malformations, patent ductus or reduced neointimal formation in disease is

characteristic of the phenotype of these animals.

REFERENCES

Alaupovic, P., D. M. Lee and W. J. McConathy. (1972). Studies on the

composition and structure of plasma lipoproteins. Distribution of lipoprotein

families in major density classes of normal human plasma lipoproteins.

Biochim Biophys Acta. 260(4): 689-707.

Amara, F. M., J. Entwistle, T. 1. Kuschak, E. A. Turley and J. A. Wright. (1996).

Transforming growth factor-betal stimulates multiple protein interactions at a

unique cis-element in the 3'-untranslated region of the hyaluronan receptor

RHAMM W A . J Bi01 Chem. 271(25): 15279-84.

Amento, E. P. and L. S. Beck. (1991). TGF-beta and wound healing. Ciba Found

Symp. lU(ll5): 115-23; discussion 123-9.

Assoian, R. K., A. Komoriya, C. A. Meyers, D. M. Miller and M. B. Sporn. (1983).

Transforming growth factor-beta in human platelets. Identification of a major

storage site, purification, and characterization. J Bi01 Chem. 258(11): 7155-60.

Balbin, M., J. M. P. Freije, A. Fueyo, L. M. Sanchez and C. Lopez-0th. (1990).

Apolipoprotein D is the major protein component in cyst Buid from women

with human breast gross cystic disease. Biochem J. 271: 803-807.

Basson, C. T., O. Kocher, M. D. Basson, A. Asis and J. A. Madri. (1992). Differential

modulation of vascular ce11 integrin and extracellular matrix expression in vitro

by TGF-beta 1 correlates with reciprocal effects on ce11 migration. J Ce11 Physiol.

153(1): 118-28.

82

Biemat, J., E. M. Mandelkow, C. Schroter, K. B. Lichtenberg, B. Steiner, B. Berling,

H. Meyer, M. Mercken, A. Vandermeeren, M. Goedert and a. 1. et. (1992). The

switch of tau protein to an Alzheirner-like state includes the phosphorylation of

two serine-proline motifs upstream of the microtubule binding region. Embo J.

ll(4): 1593-7.

Bojanovski, D., P. Alaupovic, W. J. McConathy and J. L. Kelly. (1980). Isolation

and partial characterization of apolipoprotein D and lipoprotein D from baboon

plasma. FEBS Letters. 112(2): 251-254.

Boren, J., M. M. Veniant and S. G. Young. (1998). Apo B100-containing

lipoproteins are secreted by the heart. J Clin Invest. lOl(6): 1197-202.

Boudreau, N., N. Clausell, J. Boyle and M. Rabinovitch. (1992). Transforming

growth factor-beta regulates increased ductus arteriosus endo theiial

glycosaminoglycan synthesis and a post-transcriptional mechanism controls

increased smooth muscle fibronectin, features associated with intima1

proliferation. Lab Invest. 67: 350-9.

Boudreau, N. and M. Rabinovitch. (1991). Developmentally regulated changes in

extracellular matrix in endothelial and smooth muscle cells in the ductus

artenosus may be related to intima1 proliferation. Lab Invest. 64(2): 187-99.

Boudreau, N., E. Turley and M. Rabinovitch. (1991). Fibronectin, hyaluronan,

and a hyaluronan binding protein contribute to increased ductus arteriosus

smooth muscle ce11 migration. Dev Biol. 143: 235-47.

Boyles, J. K., L. M. Notterpek and L. J. Anderson. (1990). Accumulation of

apolipoproteinç in the regenerating and remyelinating mammalian peripheral

nerve. Identification of apolipoprotein D, apolipoprotein A-IV, apolipoprotein E

and apolipoprotein A-1. J Biol Chem. 265(29): 17805-17815.

Brewer, G. and J. Ross. (1988). Poly(A) shortening and degradation of the 3' AtU-

rich sequences of hurnan c-myc mRNA in a cell-free system. Mol Ce11 Biol. 8(4):

1697-708.

Brewer, G. and J. Ross. (1989). Regdation of c-rnyc mRNA stability in vitro by a

labile destabilizer with an essential nucleic acid component. Mol Cell Biol. 9(5):

1996-2006.

Brinton, L. A. (1990). Relationship of benign breast disease to breast cancer. Ann

N Y Acad Su. 586(266): 266-71.

Brugg, B. and A. Matus. (1991). Phosphorylation determines the binding ot

microtubule-associated protein 2 (MAPZ) to microtubules in living cells. J Ce11

Biol. 114(4): 735-43.

Caceres, A. and K. S. Kosik. (1990). Inhibition of neurite polarity by tau antisense

oligonucleotides in primary cerebellar neurons. Nature. 343(6257): 461-3.

Caput, D., B. Beutler, K. Hartog, R. Thayer, S. S. Brown and A. Cerami. (1986).

Identification of a common nucleotide sequence in the 3'-untrawlated region of

mRNA molecules specifying inflammatory mediators. Proc Nat1 Acad Sci U S A.

83(6): 1670-4.

Cassels, D. E. and R. Y. Moore. (1973). Sympathetic innervation of the ductus

arteriosus in relation to pa tency. Chest. 63(5): 727-31.

Chang, M. W., E. Barr, J. Seltzer, Y.-Q. Jiang, G. J. Nabel, E. G. Nabel, M. S.

Parrnacek and J. M. Leiden. (1995). Cytostatic gene therapy for vascular

proliferative disorders with a constitutively active form of the retinoblastoma

gene product. Science. 267: 518-522.

Chervu, A. and W. S. Moore. (1990). An overview of intima1 hyperplasia. Surg

Gynecol Obstet. 171 (5): 433-47.

Chung, S., L. Jiang, S. Cheng and H. Furneaux. (1996). Purification and properties

of HuD, a neuronal RNA-binding protein. J Biol Chem. 271(19): 11518-24.

Ciatto, S., A. Biggeri, Rosselli, Del, Turco, M, D. Bartoli and A. Iosça. (1990). Risk

of breast cancer subsequent to proven gross cystic disease. Eur J Cancer. 26(5): 555-

7.

Coceani, F., C. A. Breen, J. G. Lees, J. R. Falck and P. M. Olley. (1988). Further

evidence implicating a cytochrome P-450-mediated reaction in the contractile

tension of the lamb ductus arteriosus. Circ Res. 62(3): 471-7.

Coceani, F., L. Kelsey and E. Seidlitz. (1994). Occurrence of endothelium-derived

relaxing factor--nitric oxide in the lamb ductus arteriosus. Can J Physiol

Pharmacol. 72(1): 82-8.

85

Colbert, M. C., M. L. Kirby and J. Robbins. (1996). Endogenous retinoic acid

signaling colocalizes with advanced expression

myosin heavy chain isoform during development

Res. 78(5): 790-8.

of the a d d t smooth muscle

of the duchis arteriosus. Circ

Da, P.-H., R. J. Farese, D. F. Johnson, L. M. Flynn, V. Pierotti, D. L. Newland, M. F.

Linton, D. A. Sanan and S. G. Young. (1995). Trançgenic mice expressing high

levels of hurnan apolipoprotein B develop severe atherosclerotic Lesions in

response to a high-fat diet. J Clin Invest. 95(5): 2246-57.

Dean, D. C., R. F. Newby and S. Bourgeois. (1988). Regdation of fibronectin

biosynthesis by dexamethasone, transforming growth factor 13, and CAMP in

human cell lines. J. Cell. Biol. 106: 2159-2170.

Dean, D. C., M. S. Blakeley, R. F. Newby, P. Ghazal, L. Hennighausen and S.

Bourgeois. (1989). Forskolin inducibility and tissue-specific expression of the

fibronectin promoter. Mol. Cell. Biol. 9: 1498-1506.

Dereeder, E. G., N. Girard, R. E. Poelman, J. C. Van Munsteren, D. F. Patterson

and A. C. Gittenberger-de-Groot. (1988). Hyaluronic acid accumulation and

endothelial ce11 detachment in intima1 thicking of the vellsel wall. Am. J. Pathol.

132: 574-585.

Deqmck, R., J. A. Jarrett, E. Y. Chen, D. H. Eaton, J. R. Bell, R. K. Assoian, A. B.

Roberts, M. B. Sporn and D. V. Goeddel. (1985). Human transforming growth

factor-beta complementary DNA sequence and expression in normal and

transfomed cells. Nature. 316(6030): 701-5.

Ding, A., C. F. Nathan, J. Graycar, R. Derynck, D. J. Stuehr and S. Srimal. (1990).

Macrophage deactivating factor and transforming growth factors-beta 1 - beta 2

and -beta 3 inhibit induction of macrophage nitrogen oxide synthesis by IFN-

gamma. J Lmmunol. 145(3): 940-4.

Drayna, D., C. Fielding, J. McLean, B. Baer, G. Castro, E. Chen, W. Henzel, W.

Kohr, L. Rhee, K. Wion and R. Lawn. (1986). Cloning and expression of human

apolipoprotein D cDNA. J Biol Chem. 261(35): 1653546539-

Duverger, N., H. Kruth, F. Emmanuel, J. M. Caillaud, C. Viglietta, G. Castro, A.

Tailleux, C. Fievet, J. C. Fruchart, L. M. Houdebine and P. Denefle. (1996).

Inhibition of atherosclerosis development in cholesterol-fed human

apolipoprotein A-I-transgenic rabbits. Circulation. 94(4): 713-7.

Edelmann, W., M. Z e ~ a s , P. Costello, L. Roback, I. Fischer, J. A. Hammarback, N.

Cowan, P. Davies, B. Wainer and R. Kucheriapati. (1996). Neuronal

abnormalities in microtubule-associated protein I B mutant mice. Proc Natl Acad

Sci U S A. 93(3): 1270-5.

Eghbali, M., R. Tomek, C. Woods and B. Bhambi. (1991). Cardiac fibroblasts are

predisposed to convert into myocyte phenotype: specific effect of transforming

growth factor beta [published erratum appears in Proc Natl Acad Sci U S A 1991

Apr 15;88(8):3510]. Proc Natl Acad Sci U S A. 88(3): 795-9.

Ellis, I. R. and S. L. Schor. (1996). Differential effects of TGF-beta1 on hyaluronan

synthesis by fetal and adult skin fibroblasts: implications for cell migration and

wound healing. Exp Cell Res. 228(2): 326-33.

Ferrandon, D., L. Elphick, C. Nusslein-Volhard and D. St Johnston. (1994).

Staufen protein associates with the 3'UTR of bicod mRNA to f o m particles that

move in a microtubule-dependent marner. Cell. 79: 1221-1232.

Ferrell, M., V. Fuster, H. K. Gold and J. H. Chesebro. (1992). A dilemma for the

1990s: Choosing appropriate experïmental animal models for the prevention of

restenosis. Circulation. 85: 1630-1631.

Fielding, P. E. and C. J. Fielding. (1980). A cholesteryl ester transfer complex in

human plasma. Proc Natl Acad Sci U S A. 77(6): 3327-30.

Fine, A. and R. H. Goldstein. (1993). Regulation of type 1 collagen mRNA

translation b y TGF-beta. Reg Immunol. 5(3-4): 218-24.

Flower, D. R. (1994). The lipocalin protein family: A role in ce11 regulation. FEBS

letters. 354: 7-11.

Flower, D. R. (1996). The lipocalin protein family: Structure and function.

Biochem J. 318: 1-14.

Francone, O. L., A. Gurakar and C. Fielding. (1989). Distribution and functions of

1ecithin:cholesterol acyltransferase and cholesteryl ester transfer protein in

plasma lipoproteins. Evidence for a functional unit containing these activities

together with apolipoproteins A-1 and D that catalyzes the esterification and

transfer of cell-derived cholesterol. J Bi01 diem. 264(12): 7066-7072.

Frohman, M. A., M. K. Dush and G. R. Martin. (1988). Rapid production of full-

length cDNAs from rare transcripts: amplification using a single gene-specific

oligonudeotide primer. Proc Natl Acad Sci U S A. 85(23): 8998-9002.

Frolik, C. A., L. L. Dart, C. A. Meyers, D. M. Smith and M. B. Sporn. (1983).

Purification and initial characterization of a type beta transforming growth factor

from human placenta. Proc Natl Acad Sci U S A. 80(12): 3676-80.

Gagelin, C., M. Pierre, J. M. Gavaret and D. D. TON. (1995). Rapid TGF beta I

effects on actin cytoskeleton of astrocytes: comparison with other factors and

implications for cell motility. Glia. 13(4): 283-93.

Gao, F. B., C . C. Carson, T. Levine and J. D. Keene. (1994). Selection of a subset of

rnRNAs frorn combinatorial 3' untranslated region libraries using neuronal

RNA-binding protein Hel-NI. Proc Nat1 Acad Sci U S A. 91(23): 11207-11.

Gao, F. B. and J. D. Keene. (1996). Hel-Nl/Hel-N2 proteins are bound to poly(A)+

mRNA in granular RNP structures and are implicated in neuronal

differentiation. J Cell Sci. : 579-89.

Gelfand, V. 1. and A. D. Bershadsky. (1991). Microtubule dynamicç: mechanism,

regulation, and function. Annu Rev Ce11 Biol. 7(93): 93-116.

Gittenberger-de-Groot, A. C., A. J. M. Moulaert and J. F. Hitchcock. (1980).

Histology of the persistent arteriosus in cases of congenital rubella. Circulation.

62: 183-186.

Gittenberger-de-Groot, A. C., J. L. M. Strengers, M. Mentink, R. E. Poelmann and

D. F. Patterson. (1985). Histologie studies on normal and persistent ductus

arteriosus in the dog. J. Amer. Coll. Cardiol. 6: 394-404.

Gittenberger-de-Groot, A. C., L. Van Ertbruggen, A. J. M. Moulert and F. Harrink.

(1980). The ductus arteriosus in the preterm infant: Histological and clinical

observations. J. Pediatr. 96: 88-93.

Gottlieb, E. (1992). The 3' untranslated region of localized matemal messenges

contains a consemed motif involved aiRNA localization. Proc. Natl. Acad. Sci.

USA. 89: 7164-7168.

Grafi, G., 1. Sela and G. Galili. (1993). Translational regulation of human beta

interferon rnRNA: association of the 3' AU-rich sequence with the poly(A) tail

reduces translation efficiency in vitro. Mol Cell Biol. 13: 3487-93.

Gravis, E. R. and R. Lehman. (1992). Localization of nanos RNA contols

embronic polarity. Cell. 71: 301-313.

Gundersen, G. G., 1. Kim and C. J. Chapin. (1994). Induction of stable

microtubules in 3T3 fibroblasts by TGF-beta and serum. J Ce11 Sci. 107: 645-59.

Hamrnarback, J. A., R. A. Obar, S. M. Hughes and R. A. Vallee. (1991). MAPlB is

encoded as a polyprotein that is processed to form a complex N-terminal

microtubule-binding domain. Neuron. 7: 129-139-

Han, J., T. Brown and B. Beutler. (1990). Endotoxin-responsive sequences contro

cachectin/tumor necrosis factor biosynthesis at the translational level. J. Exp

Med. 171: 465-475.

Han, J. R., G. K. Yiu and N. O. Hecht. (1995). Testis/brain RNA-binding protein

attaches translationally repressed and transported mRNAs to micro tubules. Froc.

Natl. Acad. Sci. USA. 92: 9550-9554.

Hardwick, C., K. Hoare, R. Owens, H. P. Hohn, M. Hook, D. Moore, V. Cripps, L.

Austen, D. M. Nance and E. A. Turley. (1992). Molecular cloning of a novel

hyaluronan receptor that mediates tumor ce11 motility [published erratum

appears in J Ce11 Bi01 1992 Aug;118(3):753]. J Ce11 Biol. 117(6): 1343-50.

Hedin, U., B. A. Bottger, E. Forsberg, S. Johansson and J. Thyberg. (1988). Diverse

effects of fibronectin and laminin on phenotypic properties of cultured arterial

smooth muscle cells. J Cell Biol. 107(1): 307-19.

Hedin, U. and J. Thyberg. (1987). Plasma fibronectin promotes modulation O C

arterial smooth-muscle cells from contractile to synthetic phenotype.

Differentiation. 33(3): 239-46.

Hinek, A., R. P. Mecham, F. Keeley and M. Rabinovitch. (1991). Impaired elastin

fiber assembly related to reduced 67-kD elastin- binding protein in fetal lamb

ductus arteriosus and in cultured aortic smooth muscle cells treated with

chondroitin sulfate. J Clin Invest. 88(6): 2083-94.

Hinek, A. and M. Rabinovitch. (1993). The ductus arteriosus migratory smooth

muscle cell phenotype processes tropoelastin to a 52-kDa product associated with

impaired assembly of elastic laminae. J. Biol. Chem. 268: 1405-1413.

Hinek, A., M. Rabinovitch, F. Keeley, Y. Okamura-Oho and J. Callahan. (1993).

The 67-kD elastin/laminin-binding protein is related to an enzymatically

inactive, altematively spliced from of i3-galactosidase. J. Clin. Invest. 91: 1198-

1205.

Humes, H. D., T. Nakamura, D. A. Cieslinski, D. Miller, R. V. Emmons and W.

A. Border. (1993). Role of proteoglycans and cytoskeleton in the effects of TGF-

beta 1 on rend proximal tubule cells. Kidney Int 43(3): 575-84.

Ignotz, R. A. and J. Massague. (1986). Transfonning growth factor-beta stimulates

the expression of fibronectin and collagen and their incorporation into the

extracellular matrix. J Bi01 Chem. 261(9): 4337-45.

Ip, J. H., V. Fuster, J. Badimon, M. B. Taubman and J. H. Chesebro. (1990).

Syndromes of accelerated atherosclerosis: role of vascular injury and smooth

muscle cell proMeration. J. Am. Coll. Cardiol. 15: 1667-1687.

Jain, R. G., L. G. Andrews, K. M. McGowan, P. H. Pekala and J. D. Keene. (1997).

Ectopic expression of Hel-NI, an RNA-binding protein, increases glucose

transporter (Glutl) expression in 3T3-L1 adipocytes. Mole. Celt. Biol. 17: 954-962.

Jones, P. L., J. Crack and M. Rabinovitch. (1997). Regulation of tenascin-C, a

vascular smooth muscle cell sunrival factor that interacts with the alpha v beta 3

integrin to promote epidermal growth factor receptor phosphorylation and

growth. J Cell Biol. 139: 279-93.

Jones, T. R. and M. D. Cole. (1987). Kapid cytoplasmic turnover of cmyc mRNA:

requirement of 3' untranslated sequences. Mol. Cell. Biol. 7: 4513-4519.

Kahari, V.-M., D. R. Olsen, R. W. Rhudy, P. Carrillo, Y. Q. Chen and J. Uitto.

(1992). Transforming growth factor4 up-regulates elastin gene expression in

human skin fibroblasts. Evidence for post-transcriptional modulation. Lab.

Invest. 66(5): 580-588.

Kahari, V.-M., J. Peltonen, Y. Q. Chen and J. Uitto. (1991). Differential

modulation of basement membrane gene expression in human fib rosarco ma

HT-1080 cells by trançforming growth factor-BI. Lab. Invest. 64: 807-818.

Kanzaki, T., K. Tamura, K. Takahashi, Y. Saito, B. Akikusa, H. Oohashi, N.

Kasayuki, M. Ueda and N. Morisaki. (1995). In vivo effect of TGF- beta 1.

Enhanced intima1 thickening by administration of TGF- beta 1 in rabbit arteries

injured with a balloon catheter. Arterioscler Thromb Vasc Biol. 15(11): 1951-7.

Koyama, N., T. Koshikawa, N. Morisaki, Y. Saito and S. Yoshida. (1990).

Bifunctional effects of transforming growth factor-beta on migration of cultured

rat aortic smooth muscle cells. Biochem Biophys Res Commun. 169(2): 725-9.

Kniys, V., O. Marinx, G. Shaw, J. Deschamps and G. Huez. (1989). Translational

blockade imposed by cytokine-derived UA-rich sequence. Science. 245: 85-88.

Kruys, V., P. Thompson and B. Beutler. (1993). Extinction of the tumor necrosis

factor locus, and of genes encoding the lipopolysaccharide signaling pathway. J

Exp Med. 177(5): 1383-90.

Kruys, V., M. Wathelet, P. Poupart, R. Contreras, W. Fiers, J. Content and G.

Huez. (1987). The 3' untranslated region of the human interferon4 mRNA has

an inhibitory effect on translation. Proc. Natl. Acad. Su. USA. 84: 6030-6034.

Kuznetsov, S. A. and 17. 1. Gelfand. (1987). 18 kDa microtubule-associated protein:

identification as a new light chain (LC-3) of microtubule-associated protein 1

(MM-1). Febs Lett. 212(1): 145-8.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the

head of bacteriophage T4. Nature (Lond.). 277: 680-685.

Lagnado, C. A., C. Y. Brown and G. J. Goodall. (1994). AUUUA is not sufficient to

promote poly(A) shortening and degradation of an mRNA: the functional

sequence within AU-rich elements may be UUAUUUA(U / A)(U/ A). Mol Ce11

Biol. 14(12): 7984-95.

Lea, O. A. (1988). Binding properties of progesterone-binding Cyst protein, PBCP.

Steroids. 52(4): 337-8.

Lewis, S. A., 1. E. Ivanov, G. H. Lee and N. J. Cowan. (1989). Organization of

microtubules in dendrites and axons is determined by a short hydrophobic zipper

in microtubule-associatèd proteins h W 2 and tau. Nature. 342(6249): 498-505.

Lindwall, G. and R. D. Cole. (1984). Phosphorylation affects the ability of tau

protein to promote microtubule assembly. J Biol Chem. 259(8): 5301-5.

Liu, M. W., G. S. Roubin and S. B. King. (1989). Restenosis after coronary

angioplasty: potential biologic determinants and role of intima1 hyperplasia.

Circulation. 79: 13741387.

Loh, K.-C. and M.-H. Tan. (1996). Reverse cholesterol transport: Its contribution

to cholesterol catabolism in normal and disease States. Can J Cardiol. 12(10): 944-

950.

Lyons, R. M. and H. L. Moses. (1990). Transforming growth factors and the

regulation of cell proliferation. Eur J Biochem. 187(3): 467-73.

Ma, W.+, S. Cheng, C. Campbell, A. Wright and H. Furneaux. (1996). Cloning

and characterization of HuR, a ubiquitously expressed Elav-like protein. J. Bio.

Chem. 271: 8144-8151.

Macdonald, P. M. and G. Struhl. (1988). Cis-acting sequences responsibles for

anterior localization of bicoid mRNA in Drosophila embryos. Nature. 336: 595-

598.

Malter, J. S. (1989). Identification of an AUUUA-specific messenger RNA binding

protein. Science. 246: 664-666.

Mann, S. S. and J. A. Hammarback. (1994). Molecular characterization of light

diain 3. A microhibule binding subunit of MAPlA and MAPIB. J Bi01 Chem.

269(15): 11492-7.

Mann, S. S. and J.A. Hammarback. (1996). Gene localization and developmental

expression of light chah 3: A common subunit of microtubule-associated protein

1A (MAPlA) and MAPIB. J. Neuroscience Res. 43: 535-44.

Marigo, V., D. Volpin and G. M. Bressan. (1993). Regulation of the human elastin

promoter in chick embryo cells. Tissue- specific effect of TGF-beta. Biochim

Biophys Acta. 1172(1-2): 31-6.

Masliah, E., M. Mallory, 1. Veinbergs, A. Miller and W. Samuel. (1996).

Alterations in apolipoprotein E expression during aging and neurodegeneration.

Prog Neurobiol. 50(5-6): 493-503.

Maçon, C. and M. Rabinovtich. (1997). Nitric oxide mediates post-transcriptional

regulation of fibronectin synthesis in ductus arteriosus smooth muscle cells.

Faseb Journal. ll(3): A224 (abstract #1298).

Massague, J. (1990). The transforming growth factor-beta family. Annu Rev Cell

Biol. 6(597): 597-641.

Matus, A. (1988). Microtubule-associated proteins: their potential role in

determining neuronal morphology. Annu Rev Neurosci. ll(29): 29-44.

McConathy, W. J. and P. Alaupovic. (1973). Isolation and partial characterization

of apolipoprotein D: A new protein moiety of the human plasma lipoprotein

system. FEBS ktters. 37(2): 178-182.

McConathy, W. J. and P. Alaupovic. (1976). Studies on the isolation and partial

characterization of apolipoprotein D and lipoprotein D of human plasma.

Biochemistry. 15(3): 515-520.

Meijlink, F., T. Curran, A. D. Miller and 1. M. Verma. (1985). Removal of a 67-

base-pair sequence in the noncoding region of protooncogene fos converts it to a

transforming gene. Proc Natl Acad Sci U S A. 82(15): 4987-91.

Mowry, K. L. and D. A. Melton. (1992). Vegetal messenger RNA localization

directed by a 340-nt RNA sequence element in Xenopus oocytes. Science. 255: 991-

994.

Nabel, E. G., L. Shum, V. J. Pompili, 2. Y. Yang, H. San, H. B. Shu, S. Liptay, L.

Gold, D. Gordon, R. Derynck and a. 1. et. (1993). Direct transfer of transforming

growth factor beta 1 gene into arteries stimulates fibrocellular hyperplasia. Proc

Natl Acad Sci U S A. 90(22): 10759-63.

Nakashima, Y., A. S. Plump, E. W. Raines, J. L. Breslow and R. Ross. (1994).

ApoE-deficient mice develop lesions of al1 phases of atherosclerosis throughout

the arterial tree. Arterioscler Thromb. 14(1): 133-40.

Ohno, T., D. Gordon, H. San, V. J. Pompili, M. J. Imperiale, G. J. Nabel and E. G.

Nabel. (1994). Gene therapy for vascular smooth muscle ce11 proliferation after

arterial injury. Science. 265: 781-784.

Pauletto, P., A. Chiavegato, L. Giuriato, M. Scatena, E. Faggin, A. Grisenti, R.

Sarzani, M. V. Paci, P. D. Fulgeri, A. Rappelli and a. 1. et. (1994). Hyperplastic

growth of aortic smooth muscle cells in renovascular hypertensive rabbits is

characterized by the expansion of an immature ceU phenotype. Circ Res. 74(5):

774-88.

Pearlman, W. H., J. L. Gueriguian and M. E. Sawyer. (1973). A specific

progesterone-binding component of human breast cyst fluid. J Biol Chem.

248(16): 5736-41.

Peitsch, M. C. and M. S. Boguski. (1990). 1s apolipoprotein D a mammalian biliri-

binding protein? New Biol. 2(2): 197-206.

Pierce, G. F., T. A. Mustoe, J. Lingelbach, V. R. Masakowski, G. L. Griffin, R. M.

Senior and T. F. Deuel. (1989). Platelet-derived growth factor and transforming

growth factor-beta enhance tissue repair activities by unique mechanisms. J Ce1 1

Biol. 109(1): 429-40.

Plurnp, A. S., J. D. Smith, T. Hayek, S. K. Aalto, A. Walsh, J. G. Verstuyft, E. M.

Rubin and J. L. Breslow. (1992). Severe hypercholesterolemia and atherosclerosis

in apolipoprotein E- deficient mice created by homologous recombination in ES

cells. Cell. 71(2): 343-53.

Provost, P. R., Y. L. Marcel, R. W. Milne, P. K. Weech and E. Rassart. (1991a).

apolipoprotein D transcription occurs specifically in nonproliferating quiescent

and senescent fibroblast cultures. FEBS Letters. 290(1/2): 139-141.

Provost, P. R., L. Villeneuve, P. K. Weech, R. W. Milne, Y. L. Marcel and E.

Rassart. (1991b). Localization of the major sites of rabbit apolipoprotein D gene

transcription by in situ hybridization. J Lipid Res. 32: 1959-1970.

Provost, P. R., P. K. Weech, N. M. Tremblay, Y. L. Marcel and E. Rassart. (1990).

Molecuiar characterization and differential mRNA tissue distribution of rabbi t

apolipoprotein D. J Lipid Res. 31: 2057-2065.

Rabinovitch, M. (1996). Cell-extracellular matrix interactions in the ductus

arteriosus and perinatal pulmonary circulation. Semin Perinatol. 20(6): 531-41.

Rabinovitch, M., S. Beharry, B. T. and G. Jackowski. (1988). Qualitative and

quantitative differences in protein synthesis comparing fetal iamb ductus

arteriosus endothelium and smooth muscle with cells from adjacent vascular

sites. Dev. Biol. 130: 250-258.

Rabinovitch, M., N. Boudreau, G. Vella, F. Coceani and P. M. Olley. (1989).

Oxygen-related prostaglandin synthesis in ductus arteriosus and O ther vascula r

cells [published erratum appears in Pediatr Res 1992 Sep;32(3):285]. Pediatr Res.

26(4): 330-5.

Raghow, R., A. E. Postlethwaite, O. J. Keski, H. L. Moses and A. H. Kang. (1987).

Transforming growth factor-beta increases steady state levels of type 1 procollagen

and fibronectin messenger RNAs posttranscriptionally in cultured human

dermal fibroblasts. J C h Inves t. 79(4): 1285-8.

Rasmussen, L. M., Y. G. Wolf and E. Ruoslahti. (1995). Vascular smooth muscle

cells from injured rat aortas display elevated matrix production associated with

transforming growth factor-beta activity. Am J Pathol. 147(4): 1041-8.

Reddick, R. L., S. H. Zhang and N. Maeda. (1994). Atherosclerosis in rnice lacking

apo E. Evaluation of lesional development and progression [published erratum

appears in Arterioscler Thromb 1994 May;14(5):839]. Arterioscler Thromb. 14(2):

141-7.

Rings, E. H., S. D. Krasinski, B. E. van, A. F. Moorman, J. Dekker, R. K.

Montgomery, R. J. Grand and H. A. Buller. (1994). Restriction of lactase gene

expression along the proximal-to-distal axis of rat small intestine occurs during

postnatal development [see comrnents]. Gastroenterology. 106(5): 1223-32.

Rizzino, A. (1988). Transforming growth factor-beta: multiple effects on ceIl

differentiation and extracellular matrices. Dev Bioi. 130(2): 41 1-22.

Roberts, A. B., M. A. Anzano, L. C . Lamb, J. M. Smith and M. B. Sporn. (1981).

New class of transforming growth factors potentiated by epidermal growth factor:

isolation from non-neoplastic tissues. Proc Natl Acad Sci U S A. 78(9): 5339-43.

Roberts, A. B., M. A. Anzano, C . A. Meyers, J. Wideman, R. Blacher, Y. C. Pan, S.

Stein, S. R. Lehrman, J. M. Smith, L. C. Lamb and a. 1. et. (1983). Purification and

properties of a type beta transforming growth factor from bovine kidney.

Roberts, A. B. and M. B. Spom. (1989). Regdation of endothelial cell growth,

architecture, and matrix synthesis by TGF-beta. Am Rev Respir Dis. 140(4): 1126-8.

Roses, A. D., G. Einstein, J. Gilbert, M. Goedert, S. H. Han, D. Huang, C. Hulette,

E. Masliah, V. M. Pericak, A. M. Saunders, D. E. Schmechel, W. J. Strittrnatter, K.

H. Weisgraber and P. T. Xi. (1996). Morphological, biochemical, and genetic

support for an apolipoprotein E effect on microtubular metabolism. Ann N Y

Acad Sci. 777(146): 146-57.

Ross, R. (1971). The smooth muscle ce11 II: Growth of smooth muscle in culture

and formation of elastic fibres. J. Cell Biol. 50: 172-179.

Ross, R. (1986). The pathogenesis of atherosclerosis--an update. N Engl J Med.

314(8): 488-500.

Ross, R. (1993). The pathogenesis of atherosclerosis: a perspective for the 1990s.

Nature. 362(6423): 801-9.

Ryan, U. S., E. Clements, D. Habliston and J. W. Ryan. (1978). Isolation and

culture of pulmonary artery endothelial cells. Tissue Cell. 10: 535-554.

Sambrook, J., E. F. Frisch and T. Maniatis. (1989). In Molecular Cloning: A

Laboratory Manual. Cold Spring Harbor Laboratory, New York. vol 3: 33-37.

Samuel, S. K., R. A. Hurta, M. A. Spearman, J. A. Wright, E. A. Turley and A. H.

Greenberg. (1993). TGF-beta 1 stimulation of ce11 locomotion utilizes the

hyaluronan receptor RHAMM and hyaluronan. J Cell Biol. 123(3): 749-58.

Schini, V. B., W. Durante, E. Elizondo, B. T. Scott, D. C. Junquero, A. 1. Schafer

and P. M. Vanhoutte. (1992). The induction of nitric oxide synthase activity is

inhibited by TGF- beta 1, PDGFAB and PDGFBB in vascular smooth muscle cells.

Eur J Pharmacol. 216(3): 379-83.

Schoenfeld, T. A., L. McKerracher, R. Obar and R. B. Vallee. (1989). MAP 1A and

MAP 1B are structurally related microtubule associated proteins with distinct

developmental patterns in the CNS. J Neurosci. 9(5): 1712-30.

Schumacher, J. M., K. Lee, S. Edelhoff and R. E. Braun. (1995). Spnr, a murine

RNA-binding protein that is localized to cytopasmic microtubules. J. Ce11 Biol.

129: 1023-1032.

Schwartz, R. S., D. R. Holmes and E. J. Topol. (1992). The restenosis paradign

revisited: An alternative proposa1 for cellular mechanisms. J. Am. Coll. Cardiol.

20: 1284-1293.

Serra, R., M. F. Verderame and H. C . Isom. (1992). Transforming growth factor

beta 1 partially suppresses the transformed phenotype of ras-transformed

hepatocytes. Cell Growth Differ. 3(10): 693-704.

Shaw, G. and R. Kamen. (1986). A conserved AU sequence from the 3'

untranslated region of GM-CSF mRNA mediates selective mRNA degradation.

Cell. 46(5): 659-67.

Shüna, N., T. Moriguchi, K. Ohta, Y. Gotoh and E. Nishida. (1992). Regulation of

a major microtubule-associated protein by MPF and MAP kinase. Embo J. ll(11):

39 77-84.

Shyjan, A. M., P. Heldin, E. C. Butcher, T. Yoshino and M. J. Briskin. (1996).

Functional cloning of the cDNA for a human hyaluronan synthase. J Bi01 Chem.

271(38): 23395-9.

Silver, M. M., M. D. Freedom, M. D. Silvr and P. M. Olley. (1981). The

morphology of the human newbom duchis arteriosus. Hum. Pathol. 12: 1123-

1136.

Singer, R. H. (1992). The cytoskeleton and mRNA localization. Curr. Opin. Ce11

Biol. 3: 719-721.

Slomp, J., J. C. van Munsteren, R. E. Poelmann, E. G. de Reeder, A. J. Bogers and

A. C. Gittenberger-de-Groot. (1992). Formation of intimal cusions in the ductus

arteriosus a s a mode1 for vascular intima1 thickening. A n

immunohistochemical study of changes in extracellular matrix components.

Atherosclerosis. 93: 25-39.

Smith, K. M., R. M. Lawn and J. N. Wilcox. (1990). Cellular localization of

apolipoprotein D and 1ecithin:cholesterol acyltransferase mRNA in rhesus

monkey tissues by in situ hybridization. J Lipid Res. 31: 995-1004.

Spom, M. B. and A. B. Roberts. (1992). Transforming growth factor-beta: recent

progress and new challenges. J CeU Biol. 119(5): 1017-21.

Spreyer, P., H. Schaal, G. Kuhn, T. Rothe, A. Unterbeck, K. Olek and H. W.

Muller. (1990). Regeneration-associated high level expression of apolipoprotein

D mRNA in endoneurial fibroblasts of peripheral nerve. EMBO J. 9(8): 2479-2484.

St Johnston, D. (1995). The intracellular localization of messenger MAS. Cell. 81:

161-170.

Steward, 0. and G. A. Banker. (1992). Getting the message from the gene to the

synapse: sorting and intracellular transport of RNA in neurons. Trends

Neurosci. 15: 180-186.

Strengers, J. L. M. (1988). Closure of the ductus arteriosus in the rabbits: with

reference to the closing process in the monkey and lamb. In Fetal and postnatal

behavior of the ductus arteriosus. : 109.

Streuli, C. H., C. Schmidhauser, M. Kobrin, M. J. Bissel1 and R. Derynck. (1993).

Extracellular matrix regulates expression of the TGF-beta 1 gene. J Cell Biol. 120:

253-60.

Suprenant, K. A. (1993). Microtubules, ribosomes, and RNA: evidence for

cytoplasmic localization and translational regulation. Cell Motil. Cytoskeieton.

25: 1-9.

Tada, T. and H. Kishimoto. (1990). Ultrastructural and histological studies on

closure of the mouse ductus arteriosus. Acta Anat (Basel). 139(4): 326-34.

Takemura, R., S. Okabe, T. Umeyama, Y. Kanai, N. J. Cowan and N. Hirokawa.

(1992). Increased microtubule stability and alpha tubulin acetylation in cells

transfected with microtubule-associated proteins MAPlB, MAP2 or tau. J Ce11

Sci.103: 953-64.

Tamenbaum, J. E., N. S. Waleh, F. Mauray, L. Gold, E. A. Perkett and R. 1.

Clyman. (1996). Transforming growth factor-beta protein and messenger RNA

expression is increased in the closing ductus arteriosus. Pediatr Res. 39(3): 427-34.

Thyberg, J., U. Hedin, M. Sjolund, L. Palmberg and B. A. Bottger. (1990).

Regulation of differentiated properties and proliferation of arterial srnooth

muscle cells. Arteriosderosis. lO(6): 966-90.

Toole, B. P., R. L. Goldberg, G. Chi-Rosso, C. B. Underhill and R. W. Orkin. (1984).

Hyaluronate-ce11 interactions. In The role of the extracellular matrix in

development. Treistad R. l., editor, Wiley. : 43-66.

Toole, B. P., S. 1. Munaim, S. Welles and C. B. Knudson. (1989). Hyaluronate-ce11

interactions and growth factor regulation of hyaluronate synthesis during Iimb

development. Ciba Found Symp. 143(138): 138-45; discussion 145-9 281-5.

Turley, E. A., L. Austen, K. Vandelight and C. Clary. (1991). Hyaluronan and a

cell-associated hyaluronan binding protein regulate the locomotion of ras-

transformed cells. J. Cell Biol. 112: 1041-1047.

Turley, E. A. and J. Torrance. (1985). Localization of hyaluronate and

hyaluronate-binding protein on motile and non-motile fibroblasts. Exp Ce11 Res.

161(1): 17-28.

Villarreal, F. J., A. A. Lee, W. H. Dillmann and F. J. Giordano. (1996).

Adenovirus-mediated overexpression of human transforming gro wth facto r-

beta 1 in rat cardiac fibroblasts, myocytes and smooth muscle cells. J Mol Ce11

Cardiol. 28(4): 735-42.

Vodovotz, Y., C. Bogdan, J. Paik, Q. W. Xie and C. Nathan. (1993). Mechanisms of

suppression of macrophage nitric oxide release by transforming growth factor

beta. J Exp Med. 178(2): 605-13.

Weisgraber, K. H. and R. W. Mahley. (1996). Human apolipoprotein E: the

Alzheimer's disease comection. Faseb J. lO(13): 1485-94.

Whittemore, L. A. and T. Maniatis. (1990). Postinduction turnoff of beta-

interferon gene expression. Mol Cell Biol. 10(4): 1329-37.

Wilhelm, J. and R. Vale. (1993). RNA on the move: the mRNA localization

pathway. J Ce11 Biol. 123: 269-274.

Wolf, Y. G., L. M. Rasmussen and E. Ruoslahti. (1994). Antibodies against

trariçforming growth factor-beta 1 suppress intima1 hyperplasia in a rat model. J

Clin Invest. 93(3): 1172-8.

Wrana, J. L., C. M. Overall and J. Sodek. (1991). Regdation of the expression of a

secreted acidic protein rich in cysteine (SPARC) in human fibroblasts by

transforming growth factor beta. Comparison of transcriptional and post-

transcriptional control with fibronectin and type 1 collagen. Eur J Biochem.

197(2): 519-28.

Yoder, M. J., F. G. Baumann, N. M. Grover-Johowon, 1. Brick and A. M.

Imparato. (1978). A morphological study of early cellular changes in the closure

of the rabbit ductus arteriosus. Anat. Rec. 192: 19-39.

Zhang, S. H., R. L. Reddick, J. A. Piedrahita and N. Maeda. (1992). Spontaneous

hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E.

Science. 258(5081): 468-71.

Zhou, B., N. Boudreau, C. Coulber, J. Hammarback and M. Rabinovitch. (1997).

Microtubule-associated protein 1 light chain 3 is a fibronectin mRNA- binding

protein linked to mRNA translation in lamb vascular smooth muscle cells. J

C h Invest. 100: 3070-82.

Zhu, L., E. Dagher, D. J. Johnson, H. D. Bedell, F. W. Keeley, H. M. Kagan and M.

Rabinovitch. (1993). A developmentaily regulated program restricting

insolubilization of elastin and formation of laminae in the fetal lamb ductus

arteriosus. Lab Invest. 68(3): 321-31.

Zubiaga, A. M., J. G. Belasco and M. E. Greenberg. (1995). The nonarner

UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA

degradation. Mol. Cell. Biol. 15(4): 2219-2230.