Download - Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

Transcript
Page 1: Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

Top Related

Acinetobacter pakistanensis sp. nov. - PARC · Neighbor-joining phylogenetic tree showing inter-relationship of strain NCCP-644T with the closely related type species of genera Acinetobacter

Acinetobacter pakistanensis sp. nov. - PARC · Neighbor-joining phylogenetic tree showing inter-relationship of strain NCCP-644T with the closely related type species of genera Acinetobacter

Neighbor 2 Neighbor Lead Flip Book

Neighbor 2 Neighbor Lead Flip Book

The Neighbor-joining Method: A New Method for ...matilde/NeighborJoinMethod.pdf · The new, neighbor-joining method and Sattath and Tversky’s method are shown to be generally better

The Neighbor-joining Method: A New Method for ...matilde/NeighborJoinMethod.pdf · The new, neighbor-joining method and Sattath and Tversky’s method are shown to be generally better

bio.research.ucsc.edubio.research.ucsc.edu/people/bernardi/Bernardi/.../1992sharksMPE.pdf · cording to the manufacturer's instructions. In addition, ... 1985). The neighbor-joining

bio.research.ucsc.edubio.research.ucsc.edu/people/bernardi/Bernardi/.../1992sharksMPE.pdf · cording to the manufacturer's instructions. In addition, ... 1985). The neighbor-joining

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

Friday Lunchtime Lecture - Stone Soup: Neighbor Feeding Neighbor

Friday Lunchtime Lecture - Stone Soup: Neighbor Feeding Neighbor

In silico comparative analysis and expression profile of ... · was completed through manual editing. The FASTA multiple sequence alignment was used to infer the neighbor-joining

In silico comparative analysis and expression profile of ... · was completed through manual editing. The FASTA multiple sequence alignment was used to infer the neighbor-joining

Neighbor Joining Algorithms for Inferring …moran/r/PS/dlca_journal_010507.pdfdistance-based reconstruction by the ›(n4) ADDTREE algorithm [34]. Later, Saitou and Nei proposed the

Neighbor Joining Algorithms for Inferring …moran/r/PS/dlca_journal_010507.pdfdistance-based reconstruction by the ›(n4) ADDTREE algorithm [34]. Later, Saitou and Nei proposed the

Languages
Pages
Legal

Copyright © 2022 FDOCUMENTS