Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

1
Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

TAGS:

description

Figure S2.- Neighbor-joining tree of OBAP proteins from different species. - PowerPoint PPT Presentation

Transcript of Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

Page 1: Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

ETERNUS DX80 S2, DX90 S2, DX410 S2 and DX440 S2 · The default IP address of the ETERNUS Manager GUI • Initial Setup ETERNUS DX80 S2, DX90 S2, DX410 S2 and DX440 S2

ETERNUS DX80 S2, DX90 S2, DX410 S2 and DX440 S2 · The default IP address of the ETERNUS Manager GUI • Initial Setup ETERNUS DX80 S2, DX90 S2, DX410 S2 and DX440 S2

Phylogenetic Trees Tutorial 5. Agenda How to construct a tree using Neighbor Joining algorithm Phylogeny.fr tool Cool story of the day: Horizontal gene.

Phylogenetic Trees Tutorial 5. Agenda How to construct a tree using Neighbor Joining algorithm Phylogeny.fr tool Cool story of the day: Horizontal gene.

BNFO 602 Phylogenetics Usman Roshan. Summary of last time Models of evolution Distance based tree reconstruction –Neighbor joining –UPGMA.

BNFO 602 Phylogenetics Usman Roshan. Summary of last time Models of evolution Distance based tree reconstruction –Neighbor joining –UPGMA.

Figure S2 - Neighbor joining phylogenetic analysis of the ......Figure S2 - Neighbor joining phylogenetic analysis of the NRT1/PTR family. The tree was rooted using an A. thaliana

Figure S2 - Neighbor joining phylogenetic analysis of the ......Figure S2 - Neighbor joining phylogenetic analysis of the NRT1/PTR family. The tree was rooted using an A. thaliana

Phylogeny, Taxonomy, and Biogeography of the Oriental ...Evolution of Trimeresurus 1149 Fig. 1. Neighbor-joining (NJ) tree derived from Kimura’s (1980) two parameter distance matrix

Phylogeny, Taxonomy, and Biogeography of the Oriental ...Evolution of Trimeresurus 1149 Fig. 1. Neighbor-joining (NJ) tree derived from Kimura’s (1980) two parameter distance matrix

The Only Good Neighbor is a Dead Neighbor

The Only Good Neighbor is a Dead Neighbor

Large-scale neighbor-joining with NINJA · 2016. 5. 8. · Large-scale neighbor-joining with NINJA Travis J. Wheeler twheeler@cs.arizona.edu Department of Computer Science The University

Large-scale neighbor-joining with NINJA · 2016. 5. 8. · Large-scale neighbor-joining with NINJA Travis J. Wheeler [email protected] Department of Computer Science The University

Supplementary Figure S1 | Phylogenetic relationship of the ...€¦ · phylogenetic tree was constructed using the neighbor-joining algorithm, with the Jukes-Cantor parameter correction

Supplementary Figure S1 | Phylogenetic relationship of the ...€¦ · phylogenetic tree was constructed using the neighbor-joining algorithm, with the Jukes-Cantor parameter correction

Squares: Supporting Interactive Performance Analysis for ...€¦ · reduction and neighbor joining trees (similarity trees with branches emanating radially) to arrange instances

Squares: Supporting Interactive Performance Analysis for ...€¦ · reduction and neighbor joining trees (similarity trees with branches emanating radially) to arrange instances

Supplementary Fig. S1. 16S RNA Neighbor-joining (NJ) tree of Brevibacterium metallicus sp. nov. NM2E3 T (in bold) and related species of genus Brevibacterium.

Supplementary Fig. S1. 16S RNA Neighbor-joining (NJ) tree of Brevibacterium metallicus sp. nov. NM2E3 T (in bold) and related species of genus Brevibacterium.

The Neighbor Joining Tree-Reconstruction Technique Lecture 13 ©Shlomo Moran & Ilan Gronau.

The Neighbor Joining Tree-Reconstruction Technique Lecture 13 ©Shlomo Moran & Ilan Gronau.

Phylogenetic Trees Tutorial 6. Measuring distance Bottom-up algorithm (Neighbor Joining) –Distance based algorithm –Relative distance based Phylogenetic.

Phylogenetic Trees Tutorial 6. Measuring distance Bottom-up algorithm (Neighbor Joining) –Distance based algorithm –Relative distance based Phylogenetic.

In silico comparative analysis and expression profile of ... · was completed through manual editing. The FASTA multiple sequence alignment was used to infer the neighbor-joining

In silico comparative analysis and expression profile of ... · was completed through manual editing. The FASTA multiple sequence alignment was used to infer the neighbor-joining

Author version - microbialbiofilms.files.wordpress.com · with the neighbor-joining algorithm by using the CLC Sequencer Viewer 7.6. The tree was resampled with 1000 bootstrap replications

Author version - microbialbiofilms.files.wordpress.com · with the neighbor-joining algorithm by using the CLC Sequencer Viewer 7.6. The tree was resampled with 1000 bootstrap replications

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

CMSC423: Bioinformatic Algorithms, Databases and Tools ... · • What is the running time of the neighbor-joining algorithm, given k sequences of length L? • What is the parsimony

CMSC423: Bioinformatic Algorithms, Databases and Tools ... · • What is the running time of the neighbor-joining algorithm, given k sequences of length L? • What is the parsimony

Rubidibacter lacunae strain KORDI 51-2T...Rubidibacter lacunae strain KORDI 51-2T 198 Standards in Genomic Sciences Figure 1.Neighbor-joining tree showing the phylogenetic position

Rubidibacter lacunae strain KORDI 51-2T...Rubidibacter lacunae strain KORDI 51-2T 198 Standards in Genomic Sciences Figure 1.Neighbor-joining tree showing the phylogenetic position

Neighbor Joining Algorithms for Inferring …moran/r/PS/dlca_journal_010507.pdfdistance-based reconstruction by the ›(n4) ADDTREE algorithm [34]. Later, Saitou and Nei proposed the

Neighbor Joining Algorithms for Inferring …moran/r/PS/dlca_journal_010507.pdfdistance-based reconstruction by the ›(n4) ADDTREE algorithm [34]. Later, Saitou and Nei proposed the

FOCUSFOCUS ONON FAITH€¦ · 10.11.2018  · Love thy Neighbor: thy homeless neighbor, thy gay neighbor, thy Muslim neighbor, thy black neighbor, thy immigrant neighbor, thy Jewish

FOCUSFOCUS ONON FAITH€¦ · 10.11.2018  · Love thy Neighbor: thy homeless neighbor, thy gay neighbor, thy Muslim neighbor, thy black neighbor, thy immigrant neighbor, thy Jewish

WHY NEIGHBOR-JOINING WORKS · 2017. 3. 7. · WHY NEIGHBOR-JOINING WORKS 3 This means that if the distance estimates are at most half the minimal edge length of the tree away from

WHY NEIGHBOR-JOINING WORKS · 2017. 3. 7. · WHY NEIGHBOR-JOINING WORKS 3 This means that if the distance estimates are at most half the minimal edge length of the tree away from