Download - Company Brazil Biomass and Renewable Energy

Transcript
Page 1: Company Brazil Biomass and Renewable Energy

BRAZIL BIOMASS R E N E W AB L E E N E R GY

BUSINESS AND EXPORTS BIOMASS

BRAZ I L B IOMASS

BRAZ I L / EUROPE/USA

F ON : + 5 5 ( 4 1 ) 3 3 3 5 - 2 2 84

F AX : +5 5 ( 4 1 ) 3 3 36 - 5 0 0 5

MOB I L E : + 55 ( 4 1 ) 8 8 6 3 0 86 4

5 7 0 , C a n d i d o H a r t m a n n , 2 4 - 2 4 3 – C u r i t i b a P R B r a z i l

E -M a i l : b r a z i l b i om a s s@o n d a . c om . b r UR L : www . i n t e r n a t i o n a l r e n e w a b l e s e n e r g y . c om

Wood Chips Paper and Energy or Pellets and Briquette

Page 2: Company Brazil Biomass and Renewable Energy

BRAZIL BIOMASS RENEWABLE ENERGY

Since 1990 International CMO Business Biomass and 2006 Brazil Biomass and Renewable Energy specializing in the renewable energy and energy efficient biomass. Brazil Biomass and Renewable Energy has a strong business association with network international partners who bring deep and broad experience to the renewable energy sector. In 2006started the project to export wood chips and pellets to the international market.

Brazil Biomass has been a leading brazilian supplier of wood chips to the world pulp and paper industry. As specialists in the sales, marketing and trading of wood chips and biomass, Brazil Biomass team is committed to delivering quality products in the required species and volumes, to international customers. Brazil Biomass expertise includes providing competitive markets for its wood chip suppliers.. Brazil Biomass has been exporting to China and New Zealand

INTERNAINTERNAINTERNAINTERNATIONAL PARTNERSHIP.TIONAL PARTNERSHIP.TIONAL PARTNERSHIP.TIONAL PARTNERSHIP. In Brazil remains an important institutional partnership with the National Network of biomass with EUBIA in Europe and the United States with American Renewable Energy. We maintain a technical exchange with the Renewable Energy and Energy Efficiency Partnership * Accelerating the Deployment of Renewable Energy Technologies: Regional Report from the Renewable Energy and Energy Efficiency Partnership * The World Bank Group - Accelerating Clean Energy Technology Innovation - An Overview of Renewable Energy Industry Canada's National Renewable Energy Laboratory * International Renewable Energy Alliance International Energy Agency Innovative Approaches to the Renewable Electricity System Integration of Global Bioenergy Partnership * German Renewable Energy Federation European Renewable Energy Council - Renewable energy policy in Europe - 20% by 2020 * New Energy Future Coalition Alliances for a New Energy Future * Business Council for Sustainable Energy

Page 3: Company Brazil Biomass and Renewable Energy

BRAZIL BIOMASS AND RENEWABLE ENERGY

BBrraazziill BBiioommaassss

Brazil Biomass has been a leading brazilian supplier of wood chips to the world pulp and paper industry. As specialists in the sales, marketing and trading of wood chips and biomass, Brazil Biomass team is committed to delivering quality products in the required species and volumes, to international customers. Brazil Biomass expertise includes providing competitive markets for its wood chip suppliers. Brazil Biomass has been exporting to China and New Zealand or Turkey and has a highly regarded reputation and excellent customer relationships throughout the pulp and paper industry.

Brazil Biomass society of production, industrialization and export of Wood Chips, Pellets and Briquetting and the development of projects with the use of forest residues plant to be installed in Santa Catharina, Brazil.

Energy solutions based on biomass and bio-fuels cleaner and renewable for large national and international companies, in order to mitigate the impact that their activities have on the environment by reducing emission of greenhouse gases, generating earnings in its financial account of energy and the sale of carbon credits, and provide its energy independence not getting the mercy of the oil market.

The Brazil Biomass and Renewable Energy mission is to production biomass wood chips and cooperate in the development of projects through sustainable solutions to waste management for a renewable energy and energy efficiency by biomass. Biomass boilers and CHP has a large potential to reduce both cost and CO2 emissions compared to gas and fired units.

BBiioommaassss aanndd RReenneewwaabbllee EEnneerrggyy

To combat climate change and to increase the share of renewable energy sources biomass will play an important role. However, it has to be assured that the increase in use of biomass for energy purposes goes hand in hand with the conservation of biodiversity environment, because biomass production may create additional environmental pressures, such as on biodiversity, soil and water resources. The optimisation of all steps from biomass cultivation or collection over transport and processing may contribute to get the maximum greenhouse gas emissions reductions and to reduce emissions affecting air quality.

Biomass energy plays a vital role in meeting local energy demand in many regions of the developing world. Biomass is a primary source of energy for close to 2.4 billion people in developing countries. It is easily available to many of the world’s poor and provides vital and affordable energy for cooking and space heating. Biomass-based industries are a significant source of enterprise development, job creation and income generation in rural areas. Modern biomass energy is widely used in many developing countries as well as in parts of the industrialized world. With proper management backed by adherence to appropriate ecological practices, modern biomass can be a sustainable source of electricity as well as liquid and gaseous fuels. Biomass, therefore, is not only a vital source of energy for many today but is likely to remain an important source of energy in the future subject to its sustainable exploitation.

The purpose of the Brazil Biomass and Renewable Energy Exports Biomass is to provide information on the various options of biomass utilisation for renewable energy production. It aims to facilitate information transfer between producers and users of biomass energy in order to increase the use of biomass energy. Brazil, being a tropical country, has tremendous potential for energy generation. In Brazil, biomass energy is being utilized mainly for domestic, commercial and industrial applications. The administration of the company shall be held and CEO Celso Marcelo de Oliveira Managing Director of International CMO Exports Biomass and Wood Chips and Brazil Biomass and Renewable Energy S.A.

Page 4: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS AANNDD RREENNEEWWAABBLLEE EENNEERRGGYY BRAZIL BIOMASS AND RENEWABLE ENERGY BRAZIL BIOMASS AND RENEWABLE ENERGY BRAZIL BIOMASS AND RENEWABLE ENERGY BRAZIL BIOMASS AND RENEWABLE ENERGY an society of production, industrialization and export of Wood Chips, Pellets and Briquetting and the development of projects with the use of forest residues for co-generation of energy associated with a plant to be installed in Santa Catarina. INTERNATIONAL PARTNERSHIP.INTERNATIONAL PARTNERSHIP.INTERNATIONAL PARTNERSHIP.INTERNATIONAL PARTNERSHIP. In Brazil remains an important institutional partnership with the National Network of biomass in Portugal with the Portuguese Society of Energy, with EUBIA in Europe and the United States with American Renewable Energy. We maintain a technical exchange with the Renewable Energy and Energy Efficiency Partnership * Accelerating the Deployment of Renewable Energy Technologies: Regional Report from the Renewable Energy and Energy Efficiency Partnership * The World Bank Group - Accelerating Clean Energy Technology Innovation Pellet Fuels Institute * * Biomass Heating Fuels : Low Hanging Fruit for Carbon Emissions and Energy Independence * Renewable Energy: Electricity and Biofuels in Latin America and the Caribbean * Natural Resources Canada - An Overview of Renewable Energy Industry Canada's National Renewable Energy Laboratory * International Renewable Energy Alliance International Energy Agency Innovative Approaches to the Renewable Electricity System Integration of Global Bioenergy Partnership * German Renewable Energy Federation European Renewable Energy Council - Renewable energy policy in Europe - 20% by 2020 * New Energy Future Coalition Alliances for a New Energy Future * Business Council for Sustainable Energy EUROPEAN BIOMASS INDUSTRY ASSOCIATION EUROPEAN BIOMASS INDUSTRY ASSOCIATION EUROPEAN BIOMASS INDUSTRY ASSOCIATION EUROPEAN BIOMASS INDUSTRY ASSOCIATION “EUBIA, the European Biomass Industry Association, was established in 1996 as an international non profit association in Brussels, Belgium. It groups together market forces, technology providers, and knowledge centres, all of them active in the field of biomass. I am writing to you on behalf of the European Biomass Industry Association and we would be interested in developing an international partnership with the International Business CMO Biomass. Kind Regards, Eibhilin Manning European Biomass Industry Association Renewable Energy House Brussels Belgium CEBIO PORTUGAL. CEBIO PORTUGAL. CEBIO PORTUGAL. CEBIO PORTUGAL. A CEbio Portugal é membro da AEBIOM – European Biomass Association – organismo com sede em Bruxelas e que congrega diversas organizações congéneres e empresas européias. Conta também já várias parcerias bilaterais e queremos manter uma importante parceria com a sua empresa no Brasil. Centro para a Valorização de Resíduos – CVR – no campus de Azurém da Universidade do Minho. Rita Marques Presidente CEbio PT BRAZIL BIOMASS AND RENEWABLE ENERGYBRAZIL BIOMASS AND RENEWABLE ENERGYBRAZIL BIOMASS AND RENEWABLE ENERGYBRAZIL BIOMASS AND RENEWABLE ENERGY President CEO Dr. President CEO Dr. President CEO Dr. President CEO Dr. Celso Marcelo de Oliveira Brasil Biomassa e Energia Renovável e da Internacional CMO Consultoria e Gestão de Negócios Ltda e da European Energy SL. É Diretor da Câmara Portuguesa de Comércio no Sul do Brasil e membro do Instituto Brasileiro de Direito Empresarial, Direito Bancário, Política e Direito do Consumidor, Direito Tributário e da Academia Brasileira de Direito Tributário, da Câmara Portuguesa de Comércio no Sul do Brasil, American Chamber of Commerce, Confederação Mundial dos Empresários das Comunidades Portuguesa, U.S. Commercial Service, Cexpar Instituto de Comércio Exterior do Paraná, do Centro Internacional de Negócios do Amazonas, Ceará, Minas Gerais, Rio de Janeiro e Santa Catarina e BrazilTradeNet do Ministério das Relações Exteriores. The International Real Estate Federation, Mortgage and Property Consultants International, American Homeowners Association, Council of Institucional Investors, American Home Investment e Elite International United States. Dra. Dra. Dra. Dra. Maria Denise Martins de Oliveira SPE WOOD CHIPS SANTA CATARINASPE WOOD CHIPS SANTA CATARINASPE WOOD CHIPS SANTA CATARINASPE WOOD CHIPS SANTA CATARINA INTERNATIONAL CMO EXPORTS BIOMASS AND WOOD CHIPSINTERNATIONAL CMO EXPORTS BIOMASS AND WOOD CHIPSINTERNATIONAL CMO EXPORTS BIOMASS AND WOOD CHIPSINTERNATIONAL CMO EXPORTS BIOMASS AND WOOD CHIPS BRASIL BIOMASSA E ENERGIA RENOVÁVEL S.A.BRASIL BIOMASSA E ENERGIA RENOVÁVEL S.A.BRASIL BIOMASSA E ENERGIA RENOVÁVEL S.A.BRASIL BIOMASSA E ENERGIA RENOVÁVEL S.A. OCEANWIDE TRADING AND SHIPPING SERVICES GMBHOCEANWIDE TRADING AND SHIPPING SERVICES GMBHOCEANWIDE TRADING AND SHIPPING SERVICES GMBHOCEANWIDE TRADING AND SHIPPING SERVICES GMBH PIERPIERPIERPIER IMPORTAÇÃO E EXPORTAÇÃO LTDA IMPORTAÇÃO E EXPORTAÇÃO LTDA IMPORTAÇÃO E EXPORTAÇÃO LTDA IMPORTAÇÃO E EXPORTAÇÃO LTDA MADEIREIRA TUBARÃO MADEIREIRA TUBARÃO MADEIREIRA TUBARÃO MADEIREIRA TUBARÃO ---- ARMAZÉM ARMAZÉM ARMAZÉM ARMAZÉM MADEIREIRA BRACO DO NORTEMADEIREIRA BRACO DO NORTEMADEIREIRA BRACO DO NORTEMADEIREIRA BRACO DO NORTE REFLORESTA SUL OPERACÕES FLORESTAIS IND. COM. REFLORESTA SUL OPERACÕES FLORESTAIS IND. COM. REFLORESTA SUL OPERACÕES FLORESTAIS IND. COM. REFLORESTA SUL OPERACÕES FLORESTAIS IND. COM. LTDALTDALTDALTDA PONTUAL AGENCIAMENTOS MARÍTIMOS LTDAPONTUAL AGENCIAMENTOS MARÍTIMOS LTDAPONTUAL AGENCIAMENTOS MARÍTIMOS LTDAPONTUAL AGENCIAMENTOS MARÍTIMOS LTDA CBR BOM RETIRO ARMAZÉNS GERAIS LTDACBR BOM RETIRO ARMAZÉNS GERAIS LTDACBR BOM RETIRO ARMAZÉNS GERAIS LTDACBR BOM RETIRO ARMAZÉNS GERAIS LTDA OPL OPERADORA PORTUÁRIA E LOGÍSTICA LTDA OPL OPERADORA PORTUÁRIA E LOGÍSTICA LTDA OPL OPERADORA PORTUÁRIA E LOGÍSTICA LTDA OPL OPERADORA PORTUÁRIA E LOGÍSTICA LTDA WILSONSONS MARÍTIMA LTDAWILSONSONS MARÍTIMA LTDAWILSONSONS MARÍTIMA LTDAWILSONSONS MARÍTIMA LTDA LM BRASIL LOGÍSTICA LTDALM BRASIL LOGÍSTICA LTDALM BRASIL LOGÍSTICA LTDALM BRASIL LOGÍSTICA LTDA FUMIDEX E DEDETIZAÇÃO LTDAFUMIDEX E DEDETIZAÇÃO LTDAFUMIDEX E DEDETIZAÇÃO LTDAFUMIDEX E DEDETIZAÇÃO LTDA CERTIFICADORA INTERNACIONAL ALEX STEWART ARMAZÉNS GERAIS DO BRASIL LTDCERTIFICADORA INTERNACIONAL ALEX STEWART ARMAZÉNS GERAIS DO BRASIL LTDCERTIFICADORA INTERNACIONAL ALEX STEWART ARMAZÉNS GERAIS DO BRASIL LTDCERTIFICADORA INTERNACIONAL ALEX STEWART ARMAZÉNS GERAIS DO BRASIL LTDAAAA

Page 5: Company Brazil Biomass and Renewable Energy

PPAARRTTNNEERR BBUUSSIINNEESSSS IINNTTEERRNNAATTIIOONNAALL

SUMITOMO CORPORATIONSUMITOMO CORPORATIONSUMITOMO CORPORATIONSUMITOMO CORPORATION.... Dear Mr.Oliveira, Thank you very much for your reply. As you can imagine, we believe that Japan is a future big potential market for imported biomass fuel for you in addition to Europe and US. Considering above, we think this market in Japan will be formed gradually and more concretely towards 2010 and in this process each origin’s market price level such as ex-Australia, North America and Brazil will be formed. So we would like to have keen interest in working together with you and to start something strategic with you for the Japanese market as we believe it is good for you to have Japan as well in terms of diversification of the markets and minimization of your sales risks in future.

Sumitomo CorporationSumitomo CorporationSumitomo CorporationSumitomo Corporation d d d do Brasilo Brasilo Brasilo Brasil ALEX STEWART. ALEX STEWART. ALEX STEWART. ALEX STEWART. Alex Stewart Brazil will make the inspection and certification of eucalyptus wood chips in the world our plant in Santa Catarina giving a full guarantee of our products. We are quality Alex Stewart driven and are approved by, or are members of, the following organisations: BIR: Bureau of International Recycling BMRA: Superintendent Members of the British Metals Recycling Association COMEX: Commodity Exchange in New York IFIA: International Federation of Inspection Agencies IMOA: International Molybdenum Association IPMI: International Precious Metals Institute ISRI: Institute of Scrap Recycling Industries, Inc ITIA: International Tungsten Industry Association LBMA: Associate Member of London Bullion Market Association. Alex Stewart provide highly specialized Collateral Management Agreements and Warrants services in Brazil .

CANADÁ CANADÁ CANADÁ CANADÁ –––– FPInnovations FPInnovations FPInnovations FPInnovations –––– Forest Engineering Research Institute of Canadá Forest Engineering Research Institute of Canadá Forest Engineering Research Institute of Canadá Forest Engineering Research Institute of Canadá ---- Eng. Dr. Ricado Teixeira Eng. Dr. Ricado Teixeira Eng. Dr. Ricado Teixeira Eng. Dr. Ricado Teixeira

USA USA USA USA ––––ACORE ACORE ACORE ACORE ––––American Council on Renewable Energy American Council on Renewable Energy American Council on Renewable Energy American Council on Renewable Energy ---- Prof. Dr. Tom Weirich Prof. Dr. Tom Weirich Prof. Dr. Tom Weirich Prof. Dr. Tom Weirich

USAUSAUSAUSA---- Balcones Fuel Technology Balcones Fuel Technology Balcones Fuel Technology Balcones Fuel Technology ---- Prof. Dr. Randi L. Wolf Prof. Dr. Randi L. Wolf Prof. Dr. Randi L. Wolf Prof. Dr. Randi L. Wolf

UKUKUKUK–––– Skanbio Renewable Energy Skanbio Renewable Energy Skanbio Renewable Energy Skanbio Renewable Energy –––– Inglaterra Inglaterra Inglaterra Inglaterra---- Finlândia Finlândia Finlândia Finlândia ---- Suécia Suécia Suécia Suécia ---- Dr. Keijo Kunttu Dr. Keijo Kunttu Dr. Keijo Kunttu Dr. Keijo Kunttu

UKUKUKUK–––– Energy Net Limited Energy Net Limited Energy Net Limited Energy Net Limited ---- Dr. Rod Cargill Dr. Rod Cargill Dr. Rod Cargill Dr. Rod Cargill

GERMANY GERMANY GERMANY GERMANY –––– Bundesverband Solarwirtschaft Bundesverband Solarwirtschaft Bundesverband Solarwirtschaft Bundesverband Solarwirtschaft –––– Energie Forum Energie Forum Energie Forum Energie Forum ---- Dr. Christian Brenning Dr. Christian Brenning Dr. Christian Brenning Dr. Christian Brenning

AUSTRÁLIA AUSTRÁLIA AUSTRÁLIA AUSTRÁLIA –––– Bio Energy and Sustainable Foresty Consultants Bio Energy and Sustainable Foresty Consultants Bio Energy and Sustainable Foresty Consultants Bio Energy and Sustainable Foresty Consultants ---- Dr. Peter Davies Dr. Peter Davies Dr. Peter Davies Dr. Peter Davies

AUSTRÁLIA AUSTRÁLIA AUSTRÁLIA AUSTRÁLIA –––– Biomass Energy Se Biomass Energy Se Biomass Energy Se Biomass Energy Services rvices rvices rvices –––– Best Energies Australia Pty Best Energies Australia Pty Best Energies Australia Pty Best Energies Australia Pty ---- Dr. Robert Downie Dr. Robert Downie Dr. Robert Downie Dr. Robert Downie

SINGAPURA SINGAPURA SINGAPURA SINGAPURA –––– Inferno Global HQ Inferno Global HQ Inferno Global HQ Inferno Global HQ –––– Biodiesel or Biofuel Biodiesel or Biofuel Biodiesel or Biofuel Biodiesel or Biofuel ---- Dr. Ron Tan Dr. Ron Tan Dr. Ron Tan Dr. Ron Tan

Barroman S. A. Barroman S. A. Barroman S. A. Barroman S. A. – Dario Kirschbaum

Cree IndustriesCree IndustriesCree IndustriesCree Industries - John O. Olsen

Elite International BusinessElite International BusinessElite International BusinessElite International Business - Leo Ickowicz

Globe Trade Import ExportGlobe Trade Import ExportGlobe Trade Import ExportGlobe Trade Import Export Claudia Gale

Energy TradingEnergy TradingEnergy TradingEnergy Trading - Savvas Kassianos

V & P TradingV & P TradingV & P TradingV & P Trading – Cristian Pauliano

Expor Impor Global Maderas Expor Impor Global Maderas Expor Impor Global Maderas Expor Impor Global Maderas ---- Manuel da Foseca

Biorema GmbH Biorema GmbH Biorema GmbH Biorema GmbH –––– Alexander Kunde

BeijieBeijieBeijieBeijieg Import & Export Cog Import & Export Cog Import & Export Cog Import & Export Co - Nanning Liu

Poerful Commercial Trading Liminted Poerful Commercial Trading Liminted Poerful Commercial Trading Liminted Poerful Commercial Trading Liminted – Brella Liang

BBBBiz Pons Trading iz Pons Trading iz Pons Trading iz Pons Trading ---- Kyu-Joo LEE

BFB Thailand Agent BFB Thailand Agent BFB Thailand Agent BFB Thailand Agent –––– Dennis Peacock

South AfricaSouth AfricaSouth AfricaSouth Africa RenewaRenewaRenewaRenewable Energy Engineerble Energy Engineerble Energy Engineerble Energy Engineer Technology CentreTechnology CentreTechnology CentreTechnology Centre

Bruce Manson and Associates Bruce Manson and Associates Bruce Manson and Associates Bruce Manson and Associates –––– Bruce Manson

Page 6: Company Brazil Biomass and Renewable Energy

IINNTTRROODDUUCCTTIIOONN The globalisation of different sides of human practice nowadays sets on the first line the problem of transboundary pollution. Industrial contamination of water, soil, air can be dangerous for the wasted region overcoming the boundaries of on estate. Therefore, the measures for avoiding transboundary pollution will contribute to maintain and create better environmental conditions for a considerable area. One of the main air pollutants is the emission of exhausted gases from the transport and municipal central-heating plants. The use of fossil fuels in these branches pollutes air mainly by sulphur oxides (SOt) and carbon oxides (CO and C02). The distribution of polluting gases is represented in million tons of sulphur oxides and dioxide or nitrogen oxides and carbon were emitted because of combustion of fossil fuels. The share of sulphuroxides emitted by Thermoelectric Power Plants is 85.1 %, by household heating -10.1 %, by the industry - 4.2 % and by transport - 0.64%. Pollution with sulphur oxides contributes to increasing the acid rains and pollution with carbon oxides - for the greenhouse effect. Both have an impact on global climate. One of the ways to decrease their effect is the substitution of fossil fuels by renewable energy sources (RES). The position of the European Union in this direction is maintained by different Associations and among them - The European Biomass Association (AEBIOM). In the White Paper for RES1 the main EU strategies to achieve the goals of Kyoto Agreement are defined. One of them is that the Member States should encourage the increase of RES according to their own potential with the aim of increasing the share of renewable energies to 12 % of the total energy demand of the European Union

Global warming is thought to be caused mainly by the emission of carbon dioxide (CO2), with thermoelectric power plants being responsible for about 7% of global CO2 emissions. Biomass can reduce CO2 emissions from thermoelectric power plants, but for this use, they must be resistant to the mixture of gases produced by the power plants. The ecological efficiency concept, which evaluates by and large the environmental impact, caused by CO2, SO2, NOx and particulate matter (PM) emissions. The combustion gases of the thermoelectric power plants working with natural gas (less pollutant) and diesel (more pollutant) cause problems to the environment, for their components harm the human being life, animals and directly the plants. Brazil Biomass BBrazil Biomass BBrazil Biomass BBrazil Biomass Briquetting:riquetting:riquetting:riquetting: involves application of pressure and high temperature to convert loose solid material into a compact and agglomerate forms by compressing biomass particles in a mould to produce briquettes. Wood and agro wastes are used in the production of briquettes. Brazil Biomass Pelleting:Brazil Biomass Pelleting:Brazil Biomass Pelleting:Brazil Biomass Pelleting: is a technological process by which loose material is subjected to pressure and high temperature (lower than in the briquetting process) thus increasing its density and reducing volume. Pellets are used as an energy fuel and as feed. Brazil Biomass Wood chips Energy Production:Brazil Biomass Wood chips Energy Production:Brazil Biomass Wood chips Energy Production:Brazil Biomass Wood chips Energy Production: is based on the processing of forestry residues (branches, stumps, etc.). Wood chips is combusted in the boiler houses burners.

Page 7: Company Brazil Biomass and Renewable Energy

BBIIOOMMAASSSS AANNDD RREENNEEWWAABBLLEE EENNEERRGGYY

To combat climate change and to increase the share of renewable energy sources biomass will play an important role. However, it has to be assured that the increase in use of biomass for energy purposes goes hand in hand with the conservation of biodiversity environment, because biomass production may create additional environmental pressures, such as on biodiversity, soil and water resources. The optimisation of all steps from biomass cultivation or collection over transport and processing may contribute to get the maximum greenhouse gas emissions reductions and to reduce emissions affecting air quality.

The progress has been made, the 2010 target of 21 % renewable electricity for EU corresponding to 22.1 % for EU15 will not be achieved under current policies and measures. Instead, currently implemented policies will probably result in a share of between 18 % and 19 % in 2010. In total, renewable energy accounted for about 15.2 % of total electricity generation in 2002. It has been identified that the main reason why the target is not being achieved is because the production of electricity from biomass has not been as high as initially foreseen To ensure that biomass will contribute in the planned way to achieve the renewable energy goals for 2010 the European Commission presented an Biomass Action Plan4 in December 2005. This action plan sets out measures to increase the development of biomass energy from wood, wastes and agricultural crops by creating market-based incentives to its use and removing barriers to the development of the market. A variety of studies have proven the available potential of biomass in the European Union as well as in the OECD (Siemons et al. 2004, Thrän et al. 2004, Bauen et al. 2004, EEA 2005). Some data shall be provided in the following to get an idea about what are the most important biomass sources of the future. TheTheTheThe growing demand for fossil fuels in the world: growing demand for fossil fuels in the world: growing demand for fossil fuels in the world: growing demand for fossil fuels in the world: Between 1950 and 2005, the world's consumption of oil grew more than 80%, bringing global demand to 85 million bbl. of oil per day. Despite this incredible growth, the appetite for oil in the world only increases, as developing countries like China and India finally move toward styles of living comparable to those of Europe and the U.S.. Most estimates show incredible double the oil requirement of the between 120 million and 130 million bbl. per day by 2025 or 2030. This requirement can be met if a majority of the additional stock coming from the Middle East, with Saudi Arabia, without taking into account the peak demand in the future the sources tend to run out in the coming years. World consumption of liquid in the event of increases in IEO2007 reference to 118 million barrels per day (239 in quatrilhões BTU) in 2030, as the world continues to experience strong economic growth. Two thirds of the increase in world consumption of liquid in case the reference is designed for use in the transport sector, where there are few competitive alternatives to petroleum. The industry has a 27-percent share of the projected increase, mainly for use in manufacturing chemical and petrochemical product. Coal from Asia in Asia:Coal from Asia in Asia:Coal from Asia in Asia:Coal from Asia in Asia: Coal consumption in emerging economies of Asia designed to be more than doubled, rising from 2118 million tonnes in 2002 to 3715 million tonnes in 2015 and 4435 million tonnes in 2025. The projected increase from 2317 million tonnes from 2002 to 2025 represents 78 percent of the increase in world consumption of coal over the period, despite large increases in consumption of coal designed for emerging Asia. In total energy consumption in the region also is designed to tilt slightly, from 47 percent in 2002 to 44 percent in 2025 demand for coal from Asia: 3715 million tonnes in 2015. Problems of Pollution from coal in the U.S..Problems of Pollution from coal in the U.S..Problems of Pollution from coal in the U.S..Problems of Pollution from coal in the U.S.. Coal is highly polluter in the generation of electricity. With all surprising technological innovations on the last century, one thing has not changed much is confidence in the U.S. from fossil fuels, Over 50% of the electricity generated in the U.S. still comes from coal in the 21 century. U.S. should lift the 280 coal thermoelectric power plants by 2030. China is building the equivalent to a large thermoelectric coal per week. Pollution by particles is one of the most dangerous air pollutants approximately 64 million Americans are affected directly, putting their health at risk.

Page 8: Company Brazil Biomass and Renewable Energy

WWOOOODD BBRRAAZZIILL BBIIOOMMAASSSS

Brazil is the largest country in South America. Approximately 2.3 million square kilometers -- 27 percent of Brazil’s total area of 8.5 million square kilometers -- can be considered "frontier" forest. Brazil's frontier forests comprise 17 percent of the world's remaining frontiers, making it the third highest ranked country in terms of remaining frontier forest. Brazil has the third largest block of remaining frontier forest in the world and ranks first in plant biodiversity among frontier forest nations.

Much of the raw materials Brazil Biomass we use for biomass comes from certified forests. FSC promotes forest sustainability by evaluating the company’s forest management practices considering economic viability, ecological integrity and social justice.

Page 9: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS PPRREEMMIIUUMM WWOOOODD CCHHIIPPSS EEUUCCAALLYYPPTTUUSS

Brazil has tradition and a significant potential on biomass production. The historical importance of biomass energy in Brazil is due to a set of factors, including (i) the size of the country and the availability of land, (ii) the adequacy of its weather, (iii) the availability and the low cost of the working force and, most important, (iv) the domain of biomass-production and biomass-conversion technologies in the agricultural and in the industrial sectors. The accomplishment of these conditions defines a potential biomass. Wood Chip is readily available and cheaper than mains gas and oil. Wood Chip is a renewable energy source. Wood Chip combustion is carbon neutral. Wood Fuel heating systems can be fully automated. Wood Fuel heating systems convert 90% of the fuel into usable heat energy.

Quality management. Cost-efficient production of high quality fuel according to the requirements of the boiler producers. Trouble-free operation (no impurities like metalls, stone, oversized particles etc.). . . . Main objective: satisfied costumers. . . . Complete controll of the production chain from basic material. . . . Self-and foreign controll of the fuels according to the standards of CEN/TC 335. . . . Constant enhancement of the production process. Our Premium Wood Chips Eucalyptus are ideal for the manufacture of particleboard, MDF and paper pulp. We supply hardwood and softwood chips, according to our customers’ requirements. All our wood chips are derived from sustainable harvesting of forest stock. Chipping and debarking is done in the forest or at the mill. We can meet any sizing and quality specification. In order to ensure the highest quality, our wood chips are regularly tested according to ASTM standards for moisture, sizing, bark content, rot, and ash content. Homogeneity of feedstock and consistency of our end product are our highest priorities. With an integrated transportation network of truck, rail and ocean vessel, we are able to deliver our premium wood chips reliably across Brazil and worldwide. Much of the raw materials Brazil Biomass Wood Chips SC we use for biomass from certified forests.

The advantagesThe advantagesThe advantagesThe advantages of Brazil Biomass Wood Chip Eucalyptus are: • it is cheap, often as cheap as logs and now cheaper than mains gas; • it is a standardised product with Europe wide quality standards in place; • fully automated, highly efficient boiler systems are available; • it can be made from a wide range of raw materials, often sourced locally.

Page 10: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS PPRREEMMIIUUMM WWOOOODD CCHHIIPPSS EEUUCCAALLYYPPTTUUSS

We have large quantity of eucalyptus wood chip used for paper industry.

Clean woodchips. Private port for private use. Certified by ISPS. Rate of load 8.400 ton/day. Phytosanitary Certificate. Fumigation Certificate. Origin Certificate . Quality Control Certificate Alex Stewart International. Surveyor Certificate. Alex Stewart the largest international company with activities relating to the inspection and analysis. Inspection of Wood Chips Brazil. Supervision of loading, 24hrs per day.

Page 11: Company Brazil Biomass and Renewable Energy

PPrreemmiiuumm SSooffttwwoooodd WWoooodd CChhiippss EEuuccaallyyppttuuss PPaappeerr––MMDDFF PPrroodduuccttiioonn BBrraazziill

Typical AnalysisTypical AnalysisTypical AnalysisTypical Analysis WWoooodd SSppeecciieess :: EEuuccaallyyppttuuss SSaalliiggnnaa aanndd GGrraannddiiss

Place of OriginPlace of OriginPlace of OriginPlace of Origin BBrraazziill

CertificationCertificationCertificationCertification SSGGSS aanndd AAlleexx SStteewwaarrtt tteesstt rreeppoorrtt oorr FFSSCC WWoooodd -- QQuuaalliittyy tteessttss ppeerrffoorrmmeedd bbyy tthhee UUnniivveerrssiittyy ooff AApppplliieedd

SScciieenncceess -- WWoooodd cchhiippss tteesstteedd aaccccoorrddiinngg ttoo tthhee ssttaannddaarrdd CCEENN//TTSS 1199446611::22000055

Specifications for Specifications for Specifications for Specifications for wood chipswood chipswood chipswood chips

TThhee ffuueell ssppeecciiffiiccaattiioonnss aanndd ccllaasssseess ffoorr aallll ssoolliidd bbiiooffuueellss aarree sseett oouutt iinn CCEENN//TTSS 1144996611::22000055,, wwhhiicchh ddeeffiinneess

cceerrttaaiinn ppaarraammeetteerrss aanndd pprrooppeerrttyy ccllaasssseess.. FFuueell qquuaalliittyy iiss sseett oouutt iinn IISS CCEENN TTSS 1144996611::22000055

Standardization ofStandardization ofStandardization ofStandardization of ChipsChipsChipsChips Class P 16 Class P 16 Class P 16 Class P 16 Dimensions Wood Dimensions Wood Dimensions Wood Dimensions Wood chipschipschipschips

CCllaassss PP1166 MMaaiinn ffrraaccttiioonn>> 8800 %% ooff wweeiigghhtt -- 33,,1155 mmmm ≤≤ PP ≤≤ 1166 mmmm -- FFiinnee ffrraaccttiioonn<< 55 %% ooff wweeiigghhtt << 11 mmmm

CCooaarrssee ffrraaccttiioonn<< 11 %% ooff wweeiigghhtt,, mmaaxx.. lleennggtthh ooff ppaarrttiiccllee -- mmaaxx.. 11 %% >> 4455 mmmm,,aallll << 8855 mmmm

CCllaassss PP4455 MMaaiinn ffrraaccttiioonn>> 8800 %% ooff wweeiigghhtt -- 33,,1155 mmmm ≤≤ PP ≤≤ 4455 mmmm -- FFiinnee ffrraaccttiioonn<< 55 %% ooff wweeiigghhtt << 11 mmmm

CCooaarrssee ffrraaccttiioonn<< 11 %% ooff wweeiigghhtt,, mmaaxx.. lleennggtthh ooff ppaarrttiiccllee -- mmaaxx.. 11 %% >> 6633 mmmm

DDDDDDDDiiiiiiiimmmmmmmmeeeeeeeennnnnnnnssssssssiiiiiiiioooooooonnnnnnnnssssssss ooooooooffffffff WWWWWWWWoooooooooooooooodddddddd cccccccchhhhhhhhiiiiiiiippppppppssssssss aaaaaaaaccccccccccccccccoooooooorrrrrrrrddddddddiiiiiiiinnnnnnnngggggggg ttttttttoooooooo CCCCCCCCEEEEEEEENNNNNNNN////////TTTTTTTTSSSSSSSS 1111111144444444999999996666666611111111::::::::22222222000000000000000055555555

Moisture ContentMoisture ContentMoisture ContentMoisture Content 3300%% mmaaxx

CCllaassss MM3300 MMooiissttuurree ((ww--%% ooff ddrryybbaassiiss)) SSuuiittaabbllee MMMMMMMMooooooooiiiiiiiissssssssttttttttuuuuuuuurrrrrrrreeeeeeee ooooooooffffffff wwwwwwwwoooooooooooooooodddddddd cccccccchhhhhhhhiiiiiiiippppppppssssssss aaaaaaaaccccccccccccccccoooooooorrrrrrrrddddddddiiiiiiiinnnnnnnngggggggg ttttttttoooooooo CCCCCCCCEEEEEEEENNNNNNNN////////TTTTTTTTSSSSSSSS 1111111144444444999999996666666611111111::::::::22222222000000000000000055555555

Ash ContentAsh ContentAsh ContentAsh Content 00,,33%% oorr 00,,77%%

CCllaassss AA0077 AAsshh ((ww--%%ooff ddrryy bbaassiiss)) AAAAAAAAsssssssshhhhhhhh ooooooooffffffff wwwwwwwwoooooooooooooooodddddddd cccccccchhhhhhhhiiiiiiiippppppppssssssss aaaaaaaaccccccccccccccccoooooooorrrrrrrrddddddddiiiiiiiinnnnnnnngggggggg ttttttttoooooooo CCCCCCCCEEEEEEEENNNNNNNN////////TTTTTTTTSSSSSSSS 1111111144444444999999996666666611111111::::::::22222222000000000000000055555555

Calorific PowerCalorific PowerCalorific PowerCalorific Power 44..992277 KKccaall//KKgg

Wood ChipsWood ChipsWood ChipsWood Chips 2288..66mmmm -- ((OOvveerrssiizzee)) nnoott mmoorree tthhaann 55..00 %% -- 44..88mmmm -- 2288..66mmmm,, nnoott lleessss tthhaann 9911..00 %% -- 99..55mmmm -- 2222..22mmmm,, nnoott

lleessss tthhaann 5555..00 %% -- 44..88mmmm ((DDuusstt)),, nnoott mmoorree tthhaann 44..00

LigninLigninLigninLignin 2255,,88%%

PHPHPHPH 55,,77%%

Energy OutputEnergy OutputEnergy OutputEnergy Output WWeett BBaassiiss 22,,332244 ttoo 33,,772266 MMWWhh//TToonn -- DDrryy BBaassiiss 55,,222299 ttoo 55,,881111 MMWWhh//TToonn

ExtractivesExtractivesExtractivesExtractives 1111,,00%%

PolvosesPolvosesPolvosesPolvoses 1166,,33%%

CelluloseCelluloseCelluloseCellulose 8866,,44%% PPuullppiinngg ddee KKrraafftt

VolatileVolatileVolatileVolatile 1133%%

VolatilVolatilVolatilVolatile Mattere Mattere Mattere Matter 7700..5555%% ttoo 8844..9966%%

BarkBarkBarkBark MMoorree tthhaann 22..00 %%

Sand Sand Sand Sand MMaaxxiimmuumm 00,,11%%

Fixed CarbonFixed CarbonFixed CarbonFixed Carbon 1122..0066%% ttoo 1144..5522%%

Max. Chip SizeMax. Chip SizeMax. Chip SizeMax. Chip Size NNoo mmoorree tthhaann 55%% sshhaallll bbee 44 iinncchheess oorr llaarrggeerr iinn aannyy ddiimmeennssiioonn

Sizing :Sizing :Sizing :Sizing : 00..33 ccmm –– 44..55 ccmm

Overs:Overs:Overs:Overs: 55%% >> 44..55 ccmm MMaaxxiimmuumm

Fines:Fines:Fines:Fines: 55%% <<00..33 ccmm MMaaxxiimmuumm

Chemical Chemical Chemical Chemical OOxxyyggeenn 4477%% HydrogenHydrogenHydrogenHydrogen 55,,88%% NitrogenNitrogenNitrogenNitrogen 00,,33%%

Sulphur LessSulphur LessSulphur LessSulphur Less 00,,000033%% --

Chlorine LessChlorine LessChlorine LessChlorine Less TThhaann 00,,11%%

CarbonCarbonCarbonCarbon 5522%%

Production Production Production Production 30,000 MT/Month and 360,000 MT/Year with possible to 500,000 MT/Month South Brazil30,000 MT/Month and 360,000 MT/Year with possible to 500,000 MT/Month South Brazil30,000 MT/Month and 360,000 MT/Year with possible to 500,000 MT/Month South Brazil30,000 MT/Month and 360,000 MT/Year with possible to 500,000 MT/Month South Brazil

Page 12: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS PPRREEMMIIUUMM WWOOOODD CCHHIIPPSS EEUUCCAALLYYPPTTUUSS

RRRRRRRREEEEEEEELLLLLLLLAAAAAAAATTTTTTTTÓÓÓÓÓÓÓÓRRRRRRRRIIIIIIIIOOOOOOOO DDDDDDDDEEEEEEEE EEEEEEEENNNNNNNNSSSSSSSSAAAAAAAAIIIIIIIIOOOOOOOO NNNNNNNN°°°°°°°° 999999996666666600000000 111111110000000000000000--------222222220000000099999999 CCCCCCCCLLLLLLLLIIIIIIIIEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE:::::::: BBBBBBBBrrrrrrrraaaaaaaassssssssiiiiiiiillllllll BBBBBBBBiiiiiiiioooooooommmmmmmmaaaaaaaassssssssssssssssaaaaaaaa eeeeeeee EEEEEEEEnnnnnnnneeeeeeeerrrrrrrrggggggggiiiiiiiiaaaaaaaa RRRRRRRReeeeeeeennnnnnnnoooooooovvvvvvvváááááááávvvvvvvveeeeeeeellllllll SSSSSSSS........AAAAAAAA 11111111 MMMMMMMMAAAAAAAATTTTTTTTEEEEEEEERRRRRRRRIIIIIIIIAAAAAAAALLLLLLLL RRaaww EEuuccaallyyppttuuss wwoooodd cchhiippss ((EEuuccaallyyppttuuss ggrraannddiiss aanndd ssaalliiggnnaa)) –– OOrriiggiinn:: BBrraazziill.. RReecceebbiiddoo eemm 3300//0099//22000088 ee iiddeennttiiffiiccaaddoo nnoo llaabboorraattóórriioo ccoommoo LLCCLL 446677//0088.. QQuuaannttiiddaaddee aapprrooxxiimmaaddaa ddoo mmaatteerriiaall:: 440000 gg 22222222 MMMMMMMMÉÉÉÉÉÉÉÉTTTTTTTTOOOOOOOODDDDDDDDOOOOOOOOSSSSSSSS UUUUUUUUTTTTTTTTIIIIIIIILLLLLLLLIIIIIIIIZZZZZZZZAAAAAAAADDDDDDDDOOOOOOOOSSSSSSSS 22222222........11111111 UUmmiiddaaddee,, NNBBRR 88111122//8866 ““AAnnáálliissee IImmeeddiiaattaa –– iitteemm 44..22”” ((CCMMQQ--LLCCLL--PPEE--MM007700)).. EEqquuiippaammeennttooss:: BBaallaannççaa aannaallííttiiccaa,, ccóódd..:: 8833882233.. VVaalliiddaaddee ddaa ccaalliibbrraaççããoo:: jjuull//22000099.. EEssttuuffaa,, ccóódd..:: 44117744.. VVaalliiddaaddee ddaa ccaalliibbrraaççããoo:: jjuull//22000099.. 22222222........22222222 CCiinnzzaa,, NNBBRR 88111122//8866 –– AAnnáálliissee IImmeeddiiaattaa –– iitteemm 44..33”” ((CCMMQQ--LLCCLL--PPEE--001111)).. EEqquuiippaammeennttooss:: BBaallaannççaa aannaallííttiiccaa,, ccóódd..:: 3355558866.. VVaalliiddaaddee ddaa ccaalliibbrraaççããoo:: jjuunn//22000099 MMuuffllaa,, ccóódd..:: 3300880022.. VVaalliiddaaddee ddee ccaalliibbrraaççããoo:: aabbrr//22000099.. 22222222........33333333 CCaarrbboonnoo,, HHiiddrrooggêênniioo ee NNiittrrooggêênniioo,, AASSTTMM DD 55337733--0077 ““SSttaannddaarrdd TTeesstt MMeetthhooddss ffoorr IInnssttrruummeennttaall DDeetteerrmmiinnaattiioonn ooff CCaarrbboonn,, HHyyddrrooggeenn aanndd NNiittrrooggeenn iinn LLaabboorraattoorryy SSaammpplleess ooff CCooaall aanndd CCookkee”” ((CCMMQQ--LLCCLL--PPEE--001177)).. EEqquuiippaammeennttooss:: AAnnaalliissaaddoorr ddee CCaarrbboonnoo,, HHiiddrrooggêênniioo ee NNiittrrooggêênniioo,, ccóódd..:: LLCCLL 000022,, ccaalliibbrraaddoo aanntteess ddaa eexxeeccuuççããoo ddoo eennssaaiioo.. BBaallaannççaa aannaallííttiiccaa,, ccóódd..:: LLCCLL 000033.. VVaalliiddaaddee ddaa ccaalliibbrraaççããoo:: jjaann//22000099.. 22222222........44444444 EEnnxxooffrree ttoottaall,, AASSTTMM DD 44223399--0044aa ““SSttaannddaarrdd TTeesstt MMeetthhooddss ffoorr SSuullffuurr iinn tthhee AAnnaallyyssiiss SSaammppllee ooff CCooaall aanndd CCookkee UUssiinngg HHiigghh TTeemmppeerraattuurree TTuubbee FFuurrnnaaccee CCoommbbuussttiioonn MMeetthhoodd”” –– MMééttooddoo CC ((CCMMQQ--LLCCLL--PPEE--002288)).. EEqquuiippaammeennttooss:: AAnnaalliissaaddoorr ddee eennxxooffrree,, ccóódd..:: 3333880055,, ccaalliibbrraaddoo aanntteess ddaa eexxeeccuuççããoo ddoo eennssaaiioo.. BBaallaannççaa AAMM,, ccóódd..:: 3333551100.. VVaalliiddaaddee ddaa CCaalliibbrraaççããoo:: jjaann//22000099.. 22222222........55555555 PPooddeerr ccaalloorrííffiiccoo,, AASSTTMM DD 55886655--0044 ““SSttaannddaarrdd TTeesstt MMeetthhooddss ffoorr GGrroossss CCaalloorriiffiicc VVaalluuee ooff CCooaall aanndd CCookkee”” ((CCMMQQ--LLCCLL--PPEE--004411)).. EEqquuiippaammeennttooss//IInnssttrruummeennttooss:: CCaalloorríímmeettrroo aaddiiaabbááttiiccoo,, ccóódd..:: 2211335544 BBoommbbaa ccaalloorriimmééttrriiccaa,, ccóódd..:: 88335577.. VVaalliiddaaddee ddaa CCaalliibbrraaççããoo:: jjuull//22000099.. TTeerrmmoorreessiissttêênncciiaa,, ccóódd..:: EE77997711111177330033.. VVaalliiddaaddee ddaa ccaalliibbrraaççããoo:: ffeevv//22001111.. BBaallaannççaa AAnnaallííttiiccaa,, ccóódd..:: 8833882233.. VVaalliiddaaddee ddaa ccaalliibbrraaççããoo:: jjaann//22000099.. 33333333 RRRRRRRREEEEEEEESSSSSSSSUUUUUUUULLLLLLLLTTTTTTTTAAAAAAAADDDDDDDDOOOOOOOOSSSSSSSS NNNNNNNNoooooooo mmmmmmmmaaaaaaaatttttttteeeeeeeerrrrrrrriiiiiiiiaaaaaaaallllllll rrrrrrrreeeeeeeecccccccceeeeeeeebbbbbbbbiiiiiiiiddddddddoooooooo:: 33333333........11111111 UUmmiiddaaddee -- %% mmaassssaa 3311%% ±± 44 NNNNNNNNoooooooo mmmmmmmmaaaaaaaatttttttteeeeeeeerrrrrrrriiiiiiiiaaaaaaaallllllll sssssssseeeeeeeeccccccccoooooooo:: 33333333........22222222 CCiinnzzaa -- %% mmaassssaa 11,,22%% 33333333........33333333 HHiiddrrooggêênniioo -- %% mmaassssaa..66,,11%% ±± 00,,22 33333333........44444444 EEnnxxooffrree ttoottaall -- %% mmaassssaa 00,,001133%% ±± 00,,000033 33333333........55555555 PPooddeerr ccaalloorrííffiiccoo –– KKccaall//kkgg ssuuppeerriioorr 44..553377,,22 ±± 223388,,88 iinnffeerriioorr 44..229988,,44 ±± 223388,,88 SSããoo PPaauulloo,, 1155 ddee OOuuttuubbrroo ddee 22000088

Page 13: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS PPRREEMMIIUUMM WWOOOODD CCHHIIPPSS PPIINNUUSS

TThhee wwoooodd cchhiippss,, ppiinnee pprreesseenntt aavveerraaggee hhuummiiddiittyy aarroouunndd 3300%%,, dduuee ttoo tthhee pprroocceessss ooff ppaacckkiinngg.. TThhee aannaallyysseess wweerree ppeerrffoorrmmeedd iinn ttrriipplliiccaattee ffoorr eeaacchh ttrreeaattmmeenntt aanndd ffoolllloowweedd rreeccoommmmeennddaattiioonnss ooff tthhee rruulleess ooff TTAAPPPPII -- TTeecchhnniiccaall AAssssoocciiaattiioonn ooff PPuullpp aanndd PPaappeerr IInndduussttrryy ((TTAAPPPPII,, 11999944)).. OOuurr ccoommppaannyy ddeevveellooppss vviiaabbllee pprroojjeeccttss iinn rreenneewwaabbllee eenneerrggyy.. OOnnee ooff oouurr jjoobbss iiss ttoo pprroodduuccee aanndd eexxppoorrtt wwoooodd cchhiippss ttoo tthhee iinntteerrnnaattiioonnaall mmaarrkkeett.. IItt iiss aa pplleeaassuurree ttoo ggeett iinn ttoouucchh wwiitthh yyoouu ffoorr aa rreecciipprrooccaall ccoollllaabboorraattiioonn iinn tteerrmmss ooff BBiioommaassss ffuueellss aanndd RReenneewwaabbllee EEnneerrggyy.. TThhee aannaallyysseess hhaadd bbeeeenn ddooiinngg aatt tthhee EEnneerrggyy LLaabboorraattoorryy.. FFoorr tthhee ddeetteerrmmiinnaattiioonn ooff tthhee mmooiissttuurree ccoonntteenntt.. TThhee ggrraannuulloommeettrryy wwaass ddeetteerrmmiinneedd bbyy mmeetthhoodd ddeevveellooppeedd iinn tthhee EEnneerrggyy LLaabboorraattoorryy.. AAsshh iinn wwoooodd wwaass ddeetteerrmmiinnaatteedd bbyy TTAAPPPPII TT221111 SSttaannddaarrdd aanndd ggrroossss aanndd nneett ccaalloorriiffiicc vvaalluuee bbyy DDIINN 5511990000 SSttaannddaarrdd.. MMooiissttuurree ccoonntteenntt,, aasshh,, ggrroossss ccaalloorriiffiicc vvaalluuee aanndd nneett ccaalloorriiffiicc vvaalluuee iinn wwoooodd.. MMooiissttuurree ccoonntteenntt 3388%% oorr 4400%% AAsshh wwoooodd 00,,3355 %% GGrroossss ccaalloorriiffiicc vvaalluuee 44884477.. TThhee iiddeeaall mmooiissttuurree ccoonntteenntt iiss eeqquuaall oorr lleesssseerr tthhaatt 3300%% aanndd ggrreeaatteerrss tthhaatt 6600%% aarree uunnddeessiirraabbllee.. TThhee aasshh ccoonntteenntt iiss llooww,, ccoommppaattiibbllee wwiitthh tthhee uussuuaall vvaalluueess ooff tthhee wwoooodd.. TThhee ggrroossss ccaalloorriiffiicc vvaalluuee iiss ccoommppaattiibbllee wwiitthh tthhee vvaalluueess oobbsseerrvveedd ffoorr wwoooodd,, tthhaatt aarree bbeettwweeeenn 44550000 tthhee 55000000 kkccaall//kkgg.. TThhee nneett ccaalloorriiffiicc vvaalluuee mmuusstt bbee ggrreeaatteerr tthhaatt 11220000 kkccaall//kkgg ttoo hhaavvee ssaattiissffaaccttoorryy ppeerrffoorrmmaannccee iinn bbuurrnneerrss wwiitthh ggrraattee.. 9977,,2244%% ooff mmaatteerriiaall hhaavvee cchhiippss ddiimmeennssiioonnss.. MMaatteerriiaallss ffoorr uussee iinn bbuurrnneerrss wwiitthh ggrraattee ssyysstteemm mmuusstt hhaavvee lleesssseerr ppeerrcceennttaaggee 3300%% ooff mmaatteerriiaall wwiitthh ssaawwdduusstt ddiimmeennssiioonnss.. IItt sshhoowwss tthhaatt tthhee mmaatteerriiaall hhaavvee aaddeeqquuaaddeett ddiimmeennssiioonnss ffoorr bbuurrnneerrss ssyysstteemmss wwiitthh ggrraatteess.. TThhee eenneerrggyy cchhaarraacctteerriizzaattiioonn ooff tthhee mmaatteerriiaall sshhoowwss tthhaatt tthhee rreessuullttss ooff tthhee aasshh,, ggrroossss ccaalloorriiffiicc vvaalluuee aanndd ggrraannuulloommeettrryy aarree aaddeeqquuaatteedd.. TThhee mmaatteerriiaall ccaann bbee uusseedd iinn tthhee ggeenneerraattiioonn ooff eenneerrggyy,, iinn ssyysstteemmss ooff bbuurrnneerrss wwiitthh ggrraatteess ((ffiixxeedd oorr mmoobbiillee ssttrreeaamm bbeeddss))

Page 14: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS AANNAALLYYTTIICCAALL AANNDD IINNSSPPEECCTTIIOONN AALLEEXX SSTTEEWWAARRTT BBRRAAZZIILL

Our company Brazil Biomass and Renewable Energy or International CMO Exports Biomass hired to Alex Stewart the largest international company with activities relating to the inspection and analysis. We are quality Alex Stewart driven and are approved by, or are members of, the following organizations: BIR: Bureau of International Recycling BMRA: Superintendent Members of the British Metals Recycling Association COMEX: Commodity Exchange in New York IFIA: International Federation of Inspection Agencies IMOA: International Molybdenum Association IPMI: International Precious Metals Institute ISRI: Institute of Scrap Recycling Industries, Inc ITIA: International Tungsten Industry Association LBMA: Associate Member of London Bullion Market Association. Authorized to undertake the proactive monitoring of gold and silver refiners on the LBMA Good Delivery list. LME: London Metal Exchange MMTA: Minor Metals Traders Association NYMEX: New York Mercantile Exchange TIC: Tantalum-Niobium International Study Centre We have also been accredited by ISOQAR Ltd to the following Quality Management System standards: ISO 9001:2000. Inspection of Wood Chips Brazil. Supervision of loading, 24hrs per day. Visual Inspection of Wood Chips. Final weight determination by Draft. Loading Terminal Imbituba, SC Loading at Shipside. Analysis Wood Chips Eucalyptus Brazil . Analytical Alex Stewart Brazil Service Wood Chips:Analytical Alex Stewart Brazil Service Wood Chips:Analytical Alex Stewart Brazil Service Wood Chips:Analytical Alex Stewart Brazil Service Wood Chips: Moisture Impurities Unsaponifiable matter Density Inspection Service Alex Stewart Brazil:Inspection Service Alex Stewart Brazil:Inspection Service Alex Stewart Brazil:Inspection Service Alex Stewart Brazil: Quality control Quantity verification / ullage survey Supervision of loading and/or discharge Sampling Land tank inspection Ship tank inspection Supervision of transfer to transport Laboratory analysis Wood Chips Certification Wood Chips Consultancy Alex Stewart for Brazil Biomass and International CMO. WWWWood Chips Brazil monitoringood Chips Brazil monitoringood Chips Brazil monitoringood Chips Brazil monitoring - Full technical consultation and advice including storage and transportation logistics from warehouse to ship side, GAFTA or FOSFA approved loading and discharge supervision and inspection for end buyers. Stock monitoring Wood Chips quantity will be logged into a stock book, daily release quantity will be verified against the release note and the stock book. Reports and updates will be sent by email to the relevant parties on the next working day. Warehouse security Wood Chips Brazil– padlocks installed on every door of the warehouse that will be attended by minimum of 1 inspector 24 hours/day. Only authorized personnel shall enter the warehouse.

BBRRAAZZIILL BBIIOOMMAASSSS PPRREEMMIIUUMM WWOOOODD CCHHIIPPSS EEUUCCAALLYYPPTTUUSS NNOORRMMAATTIIVVEE BBIIOOMMAASSSS CCEENN//TTCC 333355 EEUURROOPPEE

CEN/TC 335 biomass standards CEN/TC 335 is the technical committee developing the draft standard to describe all forms of solid biofuels within Europe, including wood chips, wood pellets and briquettes, logs, sawdust and straw bales. CEN/TC 335 allows all relevant properties of the fuel to be described, and includes both normative information that must be provided about the fuel, and informative information that can be included but is not required. As well as the physical and chemical characteristics of the fuel as it is, CEN/TC 335 also provides information on the source of the material. SpecificationsSpecificationsSpecificationsSpecifications. The fuel specifications and classes for all solid biofuels are set out in CEN/TS 14961:2005, which defines certain parameters and property classes. Normative specifications for wood chipsNormative specifications for wood chipsNormative specifications for wood chipsNormative specifications for wood chips: Origin - Particle size (P16/P45/P63/P100) - Moisture content (M20/M30/M40/M55/M65) - Ash content (A0.7/A1.5/A3.0/A6.0/A10.0) Normative specifications for chemically handled wood or used woodNormative specifications for chemically handled wood or used woodNormative specifications for chemically handled wood or used woodNormative specifications for chemically handled wood or used wood: Nitrogen (N0.5/N1.0/N3.0/N3.0+) Informative specifications for wood chips includeInformative specifications for wood chips includeInformative specifications for wood chips includeInformative specifications for wood chips include: Net energy content (lower heating value (LHV)) as MJ/kg or kWh/m3 loose- Bulk density in kg/m3 loose- Chlorine content (Cl0.03/Cl0.07/Cl0.10/Cl0.10+) - Nitrogen (N0.5/N1.0/N3.0/N3.0+) Many other properties may also be specified, including concentrations of many other elements and volatile matter and ash melting behaviour. Fuel quality is set out in IS CEN TS 14961:2005 Solid Biofuels – Fuel Specifications and Classes (available from NSAI: www.standards.ie).

Page 15: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS PPEELLLLEETTSS BBRRAAZZIILL PPEELLLLEETTSS PPIINNUUSS

WWoooodd PPeelllleettss aarree aa ffoorrmm ooff ccoommppaacctteedd bbiioommaassss iinn oorrddeerr ttoo iinnccrreeaassee tthhee ddeennssiittyy ooff tthhee ffuueell aanndd tthhuuss mmaakkiinngg iitt mmoorree eeccoonnoommiicc ttoo ttrraannssppoorrtt oovveerr lloonnggeerr ddiissttaanncceess.. MMoosstt ppeelllleettss aarree mmaaddee ffrroomm ssaawwdduusstt aanndd ggrroouunndd wwoooodd cchhiippss,, wwhhiicchh aarree wwaassttee mmaatteerriiaallss ffrroomm ttrreeeess uusseedd ttoo mmaakkee ffuurrnniittuurree,, lluummbbeerr,, aanndd ootthheerr pprroodduuccttss.. RReessiinnss aanndd bbiinnddeerrss ((lliiggnniinn)) ooccccuurrrriinngg nnaattuurraallllyy iinn tthhee ssaawwdduusstt hhoolldd wwoooodd ppeelllleettss ttooggeetthheerr,, ssoo tthheeyy uussuuaallllyy ccoonnttaaiinn nnoo aaddddiittiivveess.. OOtthheerr mmaatteerriiaallss,, lliikkee ssttrraaww,, ccoorrnn,, nnuutt hhuullllss aanndd ssiimmiillaarr ccaann aallssoo bbee uusseedd ttoo pprroodduuccee ppeelllleettss,, bbuutt tthhoossee aarree lleessss ccoommmmoonn.. PPeelllleettss aarree ccyylliinnddrriiccaall iinn ffoorrmm aanndd tthheeiirr ttyyppiiccaall ddiimmeennssiioonnss aarree 55--66 mmmm iinn ddiiaammeetteerr aanndd 1155--2255 mmmm iinn lleennggtthh.. FFeeaattuurreess:: 11)) RRaaww mmaatteerriiaall:: PPeelllleett ffuueell iiss mmaaddee mmaaiinnllyy ooff ssaawwdduusstt,, sshhaavviinnggss aanndd ffiinneess lleeffttoovveerr aafftteerr pprroocceessssiinngg ttrreeeess ffoorr lluummbbeerr aanndd ootthheerr wwoooodd pprroodduuccttss.. AAtt aa ppeelllleett mmiillll tthhee mmaatteerriiaall iiss ddrriieedd,, ccoommpprreesssseedd,, aanndd ffoorrmmeedd iinnttoo ssmmaallll eerraasseerr--ssiizzeedd bbiittss.. TThheeyy aarree cclleeaann,, pplleeaassaanntt ssmmeelllliinngg aanndd ssmmooootthh ttoo ttoouucchh.. 22)) WWoorrkkiinngg pprriinncciippllee:: AAddooppttss ggeeaarr ttrraannssiittiioonn aanndd mmaakkeess ppeelllleettss.. TThhee eennvviirroonnmmeennttaall bbeenneeffiittss ooff WWoooodd PPeelllleettss:: CCaarrbboonn RReedduuccttiioonn--CCOO22 iiss ttaakkeenn ffrroomm tthhee aattmmoosspphheerree bbyy ttrreeeess dduurriinngg tthheeiirr lliiffee wwhhiicchh iiss rreelleeaasseedd bbaacckk wwhheenn bbuurrnntt oorr dduurriinngg tthhee nnaattuurraall pprroocceessss ooff ddeeccaayy.. EEvveenn aalllloowwiinngg ffoorr tthhee ccaarrbboonn pprroodduucceedd iinn ppllaannttiinngg hhaarrvveessttiinngg ssaawwiinngg aanndd ttrraannssppoorrttaattiioonn ooff ttiimmbbeerr aanndd tthhee mmaannuuffaaccttuurree aanndd ddeelliivveerryy ooff ppeelllleettss,, iitt iiss eessttiimmaatteedd tthhaatt tthhee nneett rreedduuccttiioonn iinn CCOO22 eemmiissssiioonnss iiss 9900%% bbeetttteerr wwhheenn ccoommppaarriinngg tthhee uussee ooff WWoooodd PPeelllleettss ttoo FFoossssiill FFuueellss.. WWoooodd PPeelllleettss aarree cclleeaann.. UUnnlliikkee mmoosstt ootthheerr ffuueellss wwoooodd ppeelllleettss aarree eennvviirroonnmmeenntt cclleeaann,, wwhheenn ssppiilltt tthheeyy ccaann bbee ccoolllleecctteedd aanndd uusseedd aass ffuueell oorr ccoommppoosstt,, wwhheenn bbuurrnntt tthhee aasshh pprroodduucceedd ccaann bbee uusseedd iinn tthhee ggaarrddeenn aass aa ffeerrttiilliizzeerr.. WWoooodd iiss aa rreenneewwaabbllee ffuueell.. NNeevveerr rreemmoovveess ttrreeeess ffaasstteerr ffrroomm tthhee ffoorreesstt tthhaann iitt iiss aaddddeedd ttoo bbyy nnaattuurraall ggrroowwtthh,, mmooddeerrnn ppllaannttaattiioonn mmeetthhooddss mmaakkee iitt ppoossssiibbllee ttoo ppllaanntt aanndd hhaarrvveesstt ffoorreessttss wwiitthhiinn aa 3300 yyeeaarr ccyyccllee..

WWWWWWWWoooooooooooooooodddddddd SSSSSSSSppppppppeeeeeeeecccccccciiiiiiiieeeeeeeessssssss PPiinnuuss PPPPPPPPllllllllaaaaaaaacccccccceeeeeeee ooooooooffffffff OOOOOOOOrrrrrrrriiiiiiiiggggggggiiiiiiiinnnnnnnn BBrraazziill QQQQQQQQuuuuuuuuaaaaaaaallllllll iiiiiiiittttttttyyyyyyyy cccccccceeeeeeeerrrrrrrrttttttttiiiiiiiiffffffffiiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn TThhee qquuaalliittyy ooff tthhee wwoooodd ppeelllleettss iiss aann iimmppoorrttaanntt ffaaccttoorr iinn aacchhiieevviinngg ooppttiimmuumm.. DDDDDDDDiiiiiiiimmmmmmmmeeeeeeeennnnnnnnssssssssiiiiiiiioooooooonnnnnnnnssssssss 66 mmmm aanndd 88mmmm WWWWWWWWoooooooooooooooodddddddd--------DDDDDDDDeeeeeeeennnnnnnnssssssssiiiiiiiittttttttyyyyyyyy 00,,5566 GGrr//ccmm33 LLLLLLLLeeeeeeeennnnnnnnggggggggtttttttthhhhhhhh mmiinn.. 8800%% bbeettwweeeenn 55 aanndd 3300 mmmm ((mmaaxx.. 4455 mmmm)) << 44xxdd EEEEEEEEnnnnnnnneeeeeeeerrrrrrrrggggggggyyyyyyyy ccccccccoooooooonnnnnnnntttttttteeeeeeeennnnnnnntttttttt mmiinn 44..663333 kkWWhh//kkgg NNNNNNNNeeeeeeeetttttttt CCCCCCCCaaaaaaaalllllllloooooooorrrrrrrriiiiiiiiffffffffiiiiiiiicccccccc vvaalluuee aass rreecceeiivveedd MMWWhh//tt >> 44,,77 WWWWWWWWaaaaaaaatttttttteeeeeeeerrrrrrrr ccccccccoooooooonnnnnnnntttttttteeeeeeeennnnnnnntttttttt AApppprrooxx.. 77%% DDDDDDDDuuuuuuuusssssssstttttttt ccccccccoooooooonnnnnnnntttttttteeeeeeeennnnnnnntttttttt ((bbeeffoorree ttrraannssppoorrtt)) mmaaxx.. 11 %% AAAAAAAAbbbbbbbbrrrrrrrraaaaaaaassssssssiiiiiiiioooooooonnnnnnnn mmaaxx.. 22..33 %% IIIIIIIImmmmmmmmppppppppuuuuuuuurrrrrrrriiiiiiiittttttttiiiiiiiieeeeeeeessssssss nnoonnee AAAAAAAAsssssssshhhhhhhh ccccccccoooooooonnnnnnnntttttttteeeeeeeennnnnnnntttttttt mmaaxx.. 00..55 %% MMMMMMMMooooooooiiiiiiiissssssssttttttttuuuuuuuurrrrrrrreeeeeeee CCCCCCCCoooooooonnnnnnnntttttttteeeeeeeennnnnnnntttttttt MMMMMMMM WWtt%% <<1100 BBBBBBBBuuuuuuuullllllllkkkkkkkk DDDDDDDDeeeeeeeennnnnnnnssssssssiiiiiiiittttttttyyyyyyyy KKgg//mm33 >> 660000 AAAAAAAAsssssssshhhhhhhh MMMMMMMMeeeeeeeellllllllttttttttiiiiiiiinnnnnnnngggggggg CC >> 11112200 MMMMMMMMeeeeeeeecccccccchhhhhhhhaaaaaaaannnnnnnniiiiiiiiccccccccaaaaaaaallllllll DDDDDDDDuuuuuuuurrrrrrrraaaaaaaabbbbbbbbiiiiiiiilllllllliiiiiiiittttttttyyyyyyyy>> 9977,,55 DDDDDDDDuuuuuuuusssssssstttttttt ccccccccoooooooonnnnnnnntttttttteeeeeeeennnnnnnntttttttt ((bbeeffoorree ttrraannssppoorrtt)) mmaaxx.. 11 %% BBBBBBBBiiiiiiiinnnnnnnnddddddddiiiiiiiinnnnnnnngggggggg aaaaaaaaggggggggeeeeeeeennnnnnnntttttttt PPrroohhiibbiitteedd IIIIIIIImmmmmmmmppppppppuuuuuuuurrrrrrrriiiiiiiittttttttiiiiiiiieeeeeeeessssssss nnoonnee SSSSSSSSppppppppeeeeeeeecccccccciiiiiiiiaaaaaaaallllllll ffffffffeeeeeeeeaaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeeessssssss nnnnnnnnoooooooo aaaaaaaaddddddddddddddddiiiiiiiittttttttiiiiiiiivvvvvvvveeeeeeee HHHHHHHHiiiiiiiigggggggghhhhhhhheeeeeeeerrrrrrrr HHHHHHHHeeeeeeeeaaaaaaaattttttttiiiiiiiinnnnnnnngggggggg VVVVVVVVaaaaaaaalllllllluuuuuuuueeeeeeee BBTTUU//llbb 88779900 NNNNNNNNoooooooonnnnnnnn--------ccccccccoooooooommmmmmmmbbbbbbbbuuuuuuuussssssssttttttttiiiiiiiibbbbbbbblllllllleeeeeeee aasshh 3399 %% FFFFFFFFllllllllaaaaaaaammmmmmmmeeeeeeee tttttttteeeeeeeemmmmmmmmppppppppeeeeeeeerrrrrrrraaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeee 11220000 -- 11440000 EEEEEEEElllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaarrrrrrrryyyyyyyy AAAAAAAAnnnnnnnnaaaaaaaallllllllyyyyyyyyssssssssiiiiiiiissssssss CCCCCCCCaaaaaaaarrrrrrrrbbbbbbbboooooooonnnnnnnn 5533..66 %% -- HHHHHHHHyyyyyyyyddddddddrrrrrrrrooooooooggggggggeeeeeeeennnnnnnn 66..22 %% -- NNNNNNNNiiiiiiiittttttttrrrrrrrrooooooooggggggggeeeeeeeennnnnnnn 11 %%-- SSSSSSSSuuuuuuuullllllllffffffffuuuuuuuurrrrrrrr NNDD ttoo << ..11 %% CCCCCCCChhhhhhhhlllllllloooooooorrrrrrrriiiiiiiiddddddddeeeeeeee NNDD ttoo << ..11 %% OOOOOOOOxxxxxxxxyyyyyyyyggggggggeeeeeeeennnnnnnn 4400..11 %% -- AAsshh AAnnaallyyssiiss –– MMeettaallss SSccaann MMgg//kkgg -- AAAAAAAAlllllllluuuuuuuummmmmmmmiiiiiiiinnnnnnnnuuuuuuuummmmmmmm 1111660000 BBBBBBBBaaaaaaaarrrrrrrriiiiiiiiuuuuuuuummmmmmmm 11116600 CCCCCCCCaaaaaaaaddddddddmmmmmmmmiiiiiiiiuuuuuuuummmmmmmm << 55 CCCCCCCCaaaaaaaallllllllcccccccciiiiiiiiuuuuuuuummmmmmmm 112233000000 CCCCCCCChhhhhhhhrrrrrrrroooooooommmmmmmmiiiiiiiiuuuuuuuummmmmmmm 110000 CCCCCCCCoooooooobbbbbbbbaaaaaaaalllllllltttttttt<< 2200 CCCCCCCCooooooooppppppppppppppppeeeeeeeerrrrrrrr 110000 LLLLLLLLeeeeeeeeaaaaaaaadddddddd<< 5500 MMMMMMMMaaaaaaaaggggggggnnnnnnnneeeeeeeessssssssiiiiiiiiuuuuuuuummmmmmmm 2244880000 MMMMMMMMaaaaaaaannnnnnnnggggggggaaaaaaaannnnnnnneeeeeeeesssssssseeeeeeee 1122770000 NNNNNNNNiiiiiiiicccccccckkkkkkkkeeeeeeeellllllll<< 5500 PPPPPPPPhhhhhhhhoooooooosssssssspppppppphhhhhhhhoooooooorrrrrrrruuuuuuuussssssss 55550000 PPPPPPPPoooooooottttttttaaaaaaaassssssssssssssssiiiiiiiiuuuuuuuummmmmmmm 5544550000 SSSSSSSSiiiiiiiilllllllliiiiiiiiccccccccoooooooonnnnnnnn 6666000000 SSSSSSSSooooooooddddddddiiiiiiiiuuuuuuuummmmmmmm 33660000 SSSSSSSSttttttttrrrrrrrroooooooonnnnnnnnttttttttiiiiiiiiuuuuuuuummmmmmmm 660000 TTTTTTTTiiiiiiiittttttttaaaaaaaannnnnnnniiiiiiiiuuuuuuuummmmmmmm 880000 VVVVVVVVaaaaaaaannnnnnnnaaaaaaaaddddddddiiiiiiiiuuuuuuuummmmmmmm<< 5500 ZZZZZZZZiiiiiiiinnnnnnnncccccccc 11113300 CCCCCCCCaaaaaaaarrrrrrrrbbbbbbbboooooooonnnnnnnnaaaaaaaatttttttteeeeeeee CCCCCCCCOOOOOOOO33333333 ((((((((oooooooonnnnnnnn aaaaaaaasssssssshhhhhhhh)))))))) 2277..77 %% MMMMMMMMoooooooonnnnnnnntttttttthhhhhhhhllllllllyyyyyyyy QQQQQQQQuuuuuuuuaaaaaaaannnnnnnnttttttttiiiiiiiittttttttyyyyyyyy -------- 55555555........000000000000000000000000 ttttttttoooooooonnnnnnnn........

Page 16: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS PPEELLLLEETTSS BBAAGGAASSSSEE SSUUGGAARR CCAANNEE HHiigghh qquuaalliittyy wwoooodd ppeelllleettss aarree ppeelllleettss wwhhiicchh ccaann bbee uusseedd iinn bbootthh ssmmaallll aanndd llaarrggee bbooiilleerrss wwiitthhoouutt pprroobblleemmss aanndd oonnllyy pprroodduuccee aa mmiinniimmuumm ooff aasshh.. TToo mmeeeett tthheessee rreeqquuiirreemmeennttss ppeelllleettss ((ooff 66 mmmm oorr 88 mmmm iinn ddiiaammeetteerr)) sshhoouulldd bbee mmaaddee ffrroomm ppuurree aanndd uunnttrreeaatteedd wwoooodd wwiitthhoouutt bbaarrkk aanndd wwiitthhoouutt uussee ooff aaddddiittiivveess.. TThhee EEuurrooppeeaann tteecchhnniiccaall ssppeecciiffiiccaattiioonn CCEENN//TTSS 1144996611 SSoolliidd bbiiooffuueellss –– FFuueell ssppeecciiffiiccaattiioonnss aanndd ccllaasssseess aallssoo ssttaatteess.. TThhee EEuurrooppeeaann ssppeecciiffiiccaattiioonn CCEENN//TTSS 1144996611 ggiivveess aa lliisstt ooff ssttaannddaarrddss oorr tteecchhnniiccaall ssppeecciiffiiccaattiioonnss ffoorr tthhee ddeetteerrmmiinnaattiioonn ooff cchheemmiiccaall aanndd pphhyyssiiccaall ffuueell pprrooppeerrttiieess.. IInn oorrddeerr ttoo ee..gg.. ccoommppaarree ddiiffffeerreenntt wwoooodd ppeelllleettss ooffffeerreedd oonn tthhee mmaarrkkeett,, iitt iiss iimmppoorrttaanntt tthhaatt ssppeecciiffiieedd vvaalluueess ooff ffuueell pprrooppeerrttiieess aarree ccoommppaarraabbllee.. FFoorr eexxaammppllee,, CCEENN//TTSS 1144996611 ssppeecciiffiieess tthhee mmeetthhoodd ddeessccrriibbeedd iinn CCEENN//TTSS 1144777755 ffoorr ddeetteerrmmiinnaattiioonn ooff aasshh ccoonntteenntt.. BByy tthhiiss mmeetthhoodd tthhee aasshh ccoonntteenntt iiss ddeetteerrmmiinneedd bbyy hheeaattiinngg aa ssaammppllee ttoo 555500°°CC uunnddeerr ssppeecciiffiieedd ccoonnddiittiioonnss,, aanndd tthhee oobbttaaiinneedd rreessuulltt iiss nnoott nneecceessssaarriillyy ccoommppaarraabbllee ttoo rreessuullttss rreeaacchheedd bbyy ootthheerr mmeetthhooddss ((aass ee..gg.. iinntteerrnnaattiioonnaall oorr nnaattiioonnaall ccooaall ssttaannddaarrddss uussiinngg 881155°°CC)).. RReeccoommmmeennddaattiioonnss ffoorr hhiigghh qquuaalliittyy wwoooodd ppeelllleettss bbaaggaassssee ssuuggaarr ccaannee ccff.. CCEENN//TTSS 1144996611.. WWhhaatt iiss aa hhiigghh qquuaalliittyy PPeelllleett BBaaggaassssee SSuuggaarr CCaannee.. MMoorreeoovveerr,, tthhiiss pprroodduucctt wwiillll hhaavvee tthhee ffoolllloowwiinngg aaddddiittiioonnaall aaddvvaannttaaggeess PPeelllleettss BBaaggaassssee SSuuggaarr CCaannee:: TThhee pprroodduucctt iiss ffrroomm 110000%% rreeccyycclleedd oorriiggiinn aanndd iiss eennvviirroonnmmeennttaallllyy ffrriieennddllyy bbeeccaauussee iitt rreedduucceess ddeeffoorreessttaattiioonn.. TThhee pprroodduucctt hhaass aa ccaalloorriiffiicc cchhaarrggee ssiimmiillaarr ttoo ffiirreewwoooodd.. TThhee pprroodduucctt rreeqquuiirreess rreedduucceedd ssttoorraaggee ccaappaacciittyy,, tthhuuss eennaabblliinngg eemmeerrggeennccyy aanndd bbuuffffeerr ssttoocckkss.. IItt iiss aa cclleeaann pprroodduucctt wwiitthhoouutt tthhee ddrraawwbbaacckkss ooff ffiirreewwoooodd.. TThhee pprroodduucctt''ss llooww hhuummiiddiittyy rraaiisseess tteemmppeerraattuurree qquuiicckkllyy aanndd tthhee pprroodduucctt rreelleeaasseess lleessss ssmmookkee,, aasshheess aanndd ssoooott wwhheenn ccoommppaarreedd ttoo ffiirreewwoooodd.. IItt hhaass aa mmoorree hhoommooggeenneeoouuss ccaalloorriiffiicc cchhaarrggee tthhaann ffiirreewwoooodd.. IItt hhaass aa hhiigghheerr ffllaammee tteemmppeerraattuurree.. IItt ccaauusseess lleessss ppoolllluuttiioonn bbeeccaauussee iitt iiss aa rreenneewwaabbllee ffuueell..

Brazil Bagasse Sugar Cane Brazil Bagasse Sugar Cane Brazil Bagasse Sugar Cane Brazil Bagasse Sugar Cane QQQQQQQQuuuuuuuuaaaaaaaallllllll iiiiiiiittttttttyyyyyyyy cccccccceeeeeeeerrrrrrrrttttttttiiiiiiiiffffffffiiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn AAuussttrriiaann RReesseeaarrcchh CCeennttrree ffoorr CChheemmiissttrryy && TTeecchhnnoollooggyy TThhee qquuaalliittyy ooff tthhee ppeelllleettss iiss aann iimmppoorrttaanntt ffaaccttoorr iinn aacchhiieevviinngg ooppttiimmuumm ooppeerraattiioonn ooff tthhee hheeaattiinngg ssyysstteemm.. TToo ccllaassssiiffyy tthhee bbaaggaassssee--ppeelllleettss ssiimmiillaarr ttoo wwoooodd ppeelllleettss wwee ccaann uussee tthhee EEuurrooppeeaann ccllaassssiiffiiccaattiioonn aaccccoorrddiinngg ttoo CCEENN TTSS 1144996611 aanndd pprroovviiddee aa ddeeccllaarraattiioonn ssiimmiillaarr ttoo tthhoossee ffoorr wwoooodd ppeelllleettss.. AAnnaallyyssiiss aaccccoorrddiinngg ttoo ddeetteerrmmiinnaattiioonnss aaccccoorrddiinngg ttoo tthhee ppaarraammeetteerrss ssppeecciiffiieedd iinn DDIINNpplluuss aanndd ÖÖNNOORRMM MM 77113355 iinncclluuddiinngg pphhyyssiiccaall pprrooppeerrttiieess lliikkee rreessiissttaannccee ttoo aabbrraassiioonn,, ccaalloorriiffiicc vvaalluuee,, mmooiissttuurree ccoonntteenntt,, aasshh ccoonntteenntt,, ccoonntteenntt ooff cchhlloorriinnee,, ssuullpphhuurr,, nniittrrooggeenn,, mmaajjoorr aasshh ffoorrmmiinngg eelleemmeennttss,, ssccrreeeenniinngg ffoorr hheeaavvyy eelleemmeennttss ssaammppllee pprreeppaarraattiioonn iiss iinncclluuddeedd.. AAnnaallyyssiiss ccaarrrriieedd oouutt aaccccoorrddiinngg ttoo EEuurrooppeeaann ssttaannddaarrddss ffoorr ssoolliidd bbiiooffuueellss.. TThhee aannaallyysseess PPeelllleettss BBaaggaassssee SSuuggaarr CCaannee BBrraazziill hhaadd bbeeeenn ddooiinngg aatt tthhee EEnneerrggyy LLaabboorraattoorryy UUFFPPRR.. DDDDDDDDiiiiiiiiaaaaaaaammmmmmmmeeeeeeeetttttttteeeeeeeerrrrrrrr 66 mmmm -------- DDDDDDDDeeeeeeeennnnnnnnssssssssiiiiiiiittttttttyyyyyyyy 00,,6600 GGrr//ccmm33 PPPPPPPPoooooooowwwwwwwweeeeeeeerrrrrrrr CCCCCCCCaaaaaaaalllllllloooooooorrrrrrrriiiiiiiiffffffff PPCCII == 88..110000 xx CC ++ 2288..770000 ((HH22 –– OO22)) -- 660000 xx HH22OO ((eemm kkccaall//kkgg)) -------- PPCCSS == 44..778800 kkccaall//kkgg AAAAAAAAsssssssshhhhhhhh CCCCCCCCoooooooonnnnnnnntttttttteeeeeeeennnnnnnntttttttt MMaaxx 22,,55%% -------- MMMMMMMMooooooooiiiiiiiissssssssttttttttuuuuuuuurrrrrrrreeeeeeee MMaaxx.. 88..00%% CCCCCCCChhhhhhhheeeeeeeemmmmmmmmiiiiiiiiccccccccaaaaaaaallllllll CCCCCCCCoooooooommmmmmmmppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff BBBBBBBBaaaaaaaaggggggggaaaaaaaasssssssssssssssseeeeeeee ((((((((EEEEEEEEnnnnnnnneeeeeeeellllllll IIIIIIIItttttttt)))))))) FFiixxeedd CCaarrbboonn:: 1166..66%% -- CCaarrbboonn:: 1144,,0077 %% -- HHyyddrrooggeenn:: 66,,77 %%-- NNiittrrooggeenn:: 00..9988 %% -- SSuullpphhuurr:: 00,,1111 %% -- VVoollaattiillee MMaatttteerr:: 6655,,55 %% AAAAAAAAsssssssshhhhhhhheeeeeeeessssssss CCCCCCCCoooooooommmmmmmmppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiioooooooonnnnnnnn((((((((EEEEEEEEnnnnnnnneeeeeeeellllllll IIIIIIIItttttttt)))))))):::::::: CCaaOO:: 1188,,3377 %% -- MMggOO:: 44,,6666 %% -- NNaa22OO:: 11,,1133 %% -- KK22OO 1199,,3355 %% -- SSiiOO22 3344,,5500 %% -- TTii22OO 11,,44 %% -- CCll 44 %% DDDDDDDDuuuuuuuusssssssstttttttt ccccccccoooooooonnnnnnnntttttttteeeeeeeennnnnnnntttttttt ((((((((bbbbbbbbeeeeeeeeffffffffoooooooorrrrrrrreeeeeeee ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppppoooooooorrrrrrrrtttttttt)))))))) mmaaxx.. 11 %% -------- AAAAAAAAbbbbbbbbrrrrrrrraaaaaaaassssssssiiiiiiiioooooooonnnnnnnn mmaaxx.. 22..33 %% -------- BBBBBBBBiiiiiiiinnnnnnnnddddddddiiiiiiiinnnnnnnngggggggg aaaaaaaaggggggggeeeeeeeennnnnnnntttttttt PPrroohhiibbiitteedd -------- IIIIIIIImmmmmmmmppppppppuuuuuuuurrrrrrrriiiiiiiittttttttiiiiiiiieeeeeeeessssssss NNoonnee SSSSSSSSppppppppeeeeeeeecccccccciiiiiiiiaaaaaaaallllllll ffffffffeeeeeeeeaaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeeessssssss NNoo aaddddiittiivvee MMMMMMMMoooooooonnnnnnnntttttttthhhhhhhhllllllllyyyyyyyy QQQQQQQQuuuuuuuuaaaaaaaannnnnnnnttttttttiiiiiiiittttttttyyyyyyyy 22222222000000000000000099999999 -------- 44444444........000000000000000000000000 ttttttttoooooooonnnnnnnn........

Page 17: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS CCEERRTTIIFFIICCAATTIIOONN PPRREEMMIIUUMM WWOOOODD PPEELLLLEETTSS

LLaabboorraattoorriioo BBiioommaassssee AArreeaa IInnggeeggnneerriiaa AAggrraarriiaa DDiippaarrttiimmeennttoo SS..AA..SS..CC UUnniivveerrssiittàà PPoolliitteeccnniiccaa ddeellllee MMaarrcchhee PPaarraammeettrroo UUnniittàà RRiissuullttaattoo MMeettooddoollooggiiaa CCOODDIICCEE CCAAMMPPIIOONNEE EE000000000011110088 CCEERRTTIIFFIICCAATTOO AANNAALLIISSII NN°° 778899 MMAATTEERRIIAALLEE PPeelllleett BBrraazziill IIDDEENNTTIIFFIICCAATTIIVVOO oorriiggiinnee:: BBrraassiillee RRIICCHHIIEEDDEENNTTEE FFMMRR UUmmiiddiittàà %% 77,,77 pprrCCEENN//TTSS 1144777744 PPootteerree ccaalloorriiffiiccoo nneettttoo kkccaall//kkgg 44115533 pprrCCEENN//TTSS 1144991188 PPootteerree ccaalloorriiffiiccoo nneettttoo kkJJ//kkgg 1177338844 pprrCCEENN//TTSS 1144991188 PPootteerree ccaalloorriiffiiccoo iinnffeerriioorree kkccaall//kkgg 44555500 pprrCCEENN//TTSS 1144991188 PPootteerree ccaalloorriiffiiccoo iinnffeerriioorree kkJJ//kkgg 1199004466 pprrCCEENN//TTSS 1144991188 CCAARRBBOONNIIOO %% 5511,,4466 pprrCCEENN//TTSS 1155110044 IIDDRROOGGEENNOO %% 66,,3355 pprrCCEENN//TTSS 1155110044 AAZZOOTTOO %% 00,,5566 pprrCCEENN//TTSS 1155110044 OOSSSSIIGGEENNOO %% 4411,,4433 PPeerr ccaallccoolloo ((pprrCCEENN//TTSS 1155110044)) OOsssseerrvvaazziioonnii :: AAnnaalliissii rriiffeerriittaa aall ccaammppiioonnee ccoommee rriicceevvuuttoo -- AAnnaalliissii rriiffeerriittaa aall ccaammppiioonnee sseeccccoo -- AAnnaalliissii ddeellllaa ssoossttaannzzaa mmiinneerraallee PPRREELLIIEEVVOO EEFFFFEETTTTUUAATTOO DDAA CCOONNDDIIZZIIOONNII CCAAMMPPIIOONNEE PPEESSOO PPEERRIIOODDOO PPRROOVVEE ddaall 0099//0011//22000088 aall DDAATTAA RREEPPOORRTT 1188//0011//22000088 CCeenneerrii %% 00,,33 pprrCCEENN//TTSS 1144777755 PPootteerree ccaalloorriiffiiccoo ssuuppeerriioorree kkccaall//kkgg 44887722 pprrCCEENN//TTSS 1144991188 PPootteerree ccaalloorriiffiiccoo ssuuppeerriioorree kkJJ//kkgg 2200339922 pprrCCEENN//TTSS 1144991188 DDootttt.. GGiiuusseeppppee TToossccaannoo LLaabboorraattoorriioo BBiioommaassssee AArreeaa IInnggeeggnneerriiaa AAggrraarriiaa -- DDiippaarrttiimmeennttoo SS..AA..SS..CC-- UUnniivveerrssiittàà PPoolliitteeccnniiccaa ddeellllee MMaarrcchhee -- NNoottee IIll rreessppoonnssaabbiillee ddeell llaabboorraattoorriioo -- DDootttt.. GGiiuusseeppppee TToossccaannoo -- LLaabboorraattoorriioo BBiioommaassssee -- UUnniivveerrssiittàà PPoolliitteeccnniiccaa ddeellllee MMaarrcchhee -- BBiiaanncchhee 6600113311 AANNCCOONNAA --

BBeessuucchheerraannsscchhrriifftt:: PPoossttaannsscchhrriifftt:: LLeehhrrggeebbiieett ffüürr KKookkeerreeiiwweesseenn .. RRWWTTHH AAaacchheenn .. 5522005566 AAaacchheenn WWüüllllnneerrssttrr.. 22 RRaauumm BBee 112288 AAnnaallyysseenneerrggeebbnniissssee:: PPeelllleettss BBrraazziilliiaann SSuussttaaiinnaabbllee BBiiooeenneerrggyy SSeehhrr ggeeeehhrrtteerr HHeerrrr AAhhaauuss,, aannbbeeii eerrhhaalltteenn SSiiee ddiiee AAnnaallyysseenneerrggeebbnniissssee ddeerr iinn AAuuffttrraagg ggeeggeebbeenneenn PPrroobbeenn:: BBrraazziilliiaann SSuussttaaiinnaabbllee BBiiooeenneerrggyy –– DDiiee AAnnaallyysseenn wwuurrddeenn ggeemmääßß ddeerr iinn DDIINN 5511773311 aauuffggeelliisstteetteenn NNoorrmmeenn dduurrcchhggeeffüühhrrtt.. MMiitt ffrreeuunnddlliicchheenn GGrrüüßßeenn,, EEiinnhheeiitt DDIINN PPlluuss GGrreennzzwweerrttee WWaasssseerrggeehhaallttaann ...... [[GGeeww..--%%]] <<1122 <<1100 <<1100 1100,,66 AAsscchheeggeehhaallttwwff............ [[GGeeww..--%%]] <<11,,55 <<00,,55 <<00,,55 00,,6677 HHeeiizzwweerrtt HHuu,, wwff .......... [[kkJJ//kkgg]] 1177..55--1199..55 >>1188..000000 >>1188..000000 1188..663300 SSttiicckkssttooffffwwff...................... [[GGeeww..--%%]] <<00,,3300 <<00,,3300 <<00,,3300 00,,1122 SScchhwweeffeellwwff...................... [[GGeeww..--%%]] <<00,,0088 <<00,,0044 <<00,,0044 <<00,,0011 CChhlloorrwwff.................................. [[GGeeww..--%%]] <<00,,0033 <<00,,0022 <<00,,0022 AArrsseennwwff [[mmgg//kkgg]] 00,,88 CCaaddmmiiuummwwff [[mmgg//kkgg]] 00,,55 CChhrroommwwff [[mmgg//kkgg]] 88 KKuuppffeerrwwff [[mmgg//kkgg]] 55 QQuueecckkssiillbbeerrwwff [[mmgg//kkgg]] 00,,0055 BBlleeiiwwff [[mmgg//kkgg]] 1100 ZZiinnkkwwff [[mmgg//kkgg]] 110000 EEOOXXwwff [[mmgg//kkgg]] 33 AAbbrriieebbaann.............................. [[GGeeww..--%%]] -- <<22,,33 <<22,,33 11,,88 DDiicchhtteerroohh ............................[[kkgg//ddmm³³]] 11,,00--11,,44 >>11,,1122 >>11,,1122 11,,2211 DDuurrcchhmmeesssseerraann........[[mmmm]] 44--1100 44--1100 44--1100 66,,44 DDrr..--IInngg.. CChhrriissttiiaann WWiirrttggeenn OObbeerriinnggeenniieeuurr

Page 18: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS BBRRIIQQUUEETTTTIINNGG BBRRAAZZIILL DDDDDDDDoooooooonnnnnnnn’’’’’’’’tttttttt wwwwwwwwaaaaaaaasssssssstttttttteeeeeeee nnnnnnnnaaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeee rrrrrrrreeeeeeeessssssssoooooooouuuuuuuurrrrrrrrcccccccceeeeeeeessssssss!!!!!!!! IItt iiss kknnoowwnn aallll oovveerr tthhee wwoorrlldd tthhaatt bbuusshheess aanndd ffoorreessttss aarree eexxttrreemmeellyy iimmppoorrttaanntt ffoorr tthhee eeccoollooggiiccaall bbaallaannccee ooff oouurr ppllaanneett.. SSuucchh eeccoollooggiiccaall aawwaarreenneessss hhaass lleedd ttoo tthhee sseeaarrcchh ooff nneeww aanndd bbeetttteerr ffoorrmmss ooff bbrriinnggiinngg ttooggeetthheerr hhuummaann ddeevveellooppmmeenntt..

BBBBBBBBeeeeeeee eeeeeeeeccccccccoooooooollllllllooooooooggggggggiiiiiiiiccccccccaaaaaaaallllllllllllllllyyyyyyyy ssssssssoooooooouuuuuuuunnnnnnnndddddddd bbbbbbbbyyyyyyyy uuuuuuuussssssssiiiiiiiinnnnnnnngggggggg BBBBBBBBrrrrrrrriiiiiiiiqqqqqqqquuuuuuuueeeeeeeetttttttttttttttteeeeeeeessssssss........ AAmmoonngg pprroodduuccttss wwhhiicchh gguuaarraanntteeee tthhiiss bbaallaannccee ooff nnaattuurree aanndd ddeevveellooppmmeenntt aarree BBrriiqquueetttteess,, ffuueell mmaaddee ffrroomm ccoommppaacctteedd wwoooodd sshhaavviinnggss aanndd ssaawwdduusstt,, wwiitthhoouutt aannyy cchheemmiiccaall ssuubbssttaannccee.. IItt iiss aann eexxcceelllleenntt ssuubbssttiittuuttee ffoorr ffiirreewwoooodd,, ooiill,, ccooaall aanndd ggaass.. SSuuiittaabbllee ffoorr iinndduussttrriiaall bbooiilleerrss,, oovveennss,, ggrreeeennhhoouusseess,, ffuurrnnaacceess,, ffiirreeppllaacceess aanndd bbaarrbbeeccuueess,, iitt iiss aann iinndduussttrriiaall pprroodduucctt aavvaaiillaabbllee aallll yyeeaarr rroouunndd,, iinn ddiiffffeerreenntt mmeeaassuurreess aanndd ddiiaammeetteerrss..

SSSSSSSSoooooooommmmmmmmeeeeeeee MMMMMMMMaaaaaaaaiiiiiiiinnnnnnnn AAAAAAAAddddddddvvvvvvvvaaaaaaaannnnnnnnttttttttaaaaaaaaggggggggeeeeeeeessssssss BBBBBBBBrrrrrrrriiiiiiiiqqqqqqqquuuuuuuueeeeeeeettttttttttttttttiiiiiiiinnnnnnnngggggggg BBBBBBBBrrrrrrrraaaaaaaazzzzzzzziiiiiiii llllllll BBBBBBBBiiiiiiiioooooooommmmmmmmaaaaaaaassssssssssssssss BBeetttteerr aappppeeaarreennccee,, ggrreeaatteerr hhyyggiieennee,, eexxcceelllleenntt ffoorr uussee iinn nnoouurriisshhiinngg iinndduussttrriieess aanndd ffeeeeddiinngg eessttaabblliisshhmmeennttss.. LLeessss nneeeedd ffoorr ssttoorraaggee ssppaaccee bbeeccaauussee iitt iiss aann iinndduussttrriiaall pprroodduucctt aavvaaiillaabbllee aallll yyeeaarr rroouunndd.. LLoowweerr eexxppeennsseess oonn ffuurrnnaaccee mmaaiinntteennaannccee aanndd ggrraattee rreeppaaiirr.. EEaassyy hhaannddlliinngg,, ssttoorraaggee aanndd ccoonnttrrooll bbeeccaauussee iitt iiss ssoolldd ppeerr ttoonneess aanndd nnoott iinn ccuubbiicc mmeetteerrss.. HHiigghh bbuurrnniinngg eeffffiicciieennccyy aanndd hheeaattiinngg vvaalluuee.. TThheerrmmaall rreegguullaarriittyy.. MMaannuuffaaccttuurreedd wwiitthhoouutt cchheemmiiccaall pprroodduuccttss.. NNaattuurraall nnoonn--ttooxxiicc pprroodduucctt.. LLooww mmooiissttuurree ccoonntteenntt.. FFeeww rreessiidduueess ffrroomm bbuurrnniinngg,, nnoo ssmmeellll,, lliittttllee ssmmookkee pprroodduuccttiioonn.. AAnn eeccoollooggiiccaallllyy ssoouunndd pprroodduucctt ffoorr eenneerrggyy pprroodduuccttiioonn wwiitthhoouutt ccaauussiinngg ddeeffoorreessttaattiioonn.. CCoonnvveenniieenntt ppaacckkaaggiinngg aalllloowwss ffoorr eeaassiieerr hhaannddlliinngg aanndd ssttoorraaggee.. FFeewweerr ppeerrssoonnnneell aarree rreeqquuiirreedd ffoorr hhaannddlliinngg aass ccoommppaarreedd wwiitthh ffiirreewwoooodd.. HHiigghh ffllaammee tteemmppeerraattuurree.. AAlllloowwss ffoorr uussee ttooggeetthheerr wwiitthh ffiirreewwoooodd oorr ootthheerr bbiioommaassss,, eevveenn wwhheenn wweett.. FFaasstt tteemmppeerraattuurree rreessppoonnssee aanndd ggrreeaatteerr ssttaabbiilliittyy..

AAAAAAAAddddddddvvvvvvvvaaaaaaaannnnnnnnttttttttaaaaaaaaggggggggeeeeeeeessssssss ooooooooffffffff BBBBBBBBrrrrrrrriiiiiiiiqqqqqqqquuuuuuuueeeeeeeetttttttttttttttteeeeeeeessssssss BBBBBBBBrrrrrrrraaaaaaaazzzzzzzziiiiiiiillllllll BBBBBBBBiiiiiiiioooooooommmmmmmmaaaaaaaassssssssssssssss oooooooovvvvvvvveeeeeeeerrrrrrrr tttttttthhhhhhhheeeeeeee FFFFFFFFiiiiiiiirrrrrrrreeeeeeeewwwwwwwwoooooooooooooooodddddddd HHiigghheerr hheeaattiinngg vvaalluuee:: BBrriiqquueetttteess:: ffrroomm 44,,880000 kkccaall//kkgg ttoo 44,,990000 kkccaall//kkgg XX FFiirreewwoooodd:: ffrroomm 11,,770000 kkccaall//kkgg ttoo 22,,550000 kkccaall//kkgg LLoowweerr mmooiissttuurree ccoonntteenntt BBrriiqquueetttteess:: ffrroomm1100%% ttoo 1122%% FFiirreewwoooodd:: ffrroomm 2255%% ttoo 4455%% PPPPPPPPaaaaaaaacccccccckkkkkkkkiiiiiiiinnnnnnnngggggggg 2255 ttoo 4400 kkgg rraaffffiiaa bbaaggss.. SSiizzee aanndd qquuaannttiittyy ccaann bbee aaddaapptteedd ttoo mmeeeett ccuussttoommeerr’’ss nneeeeddss.. PPaacckkiinngg ccaann aallssoo bbee iinn bbiigg bbaaggss wwhhiicchh hhoolldd aapppprrooxxiimmaatteellyy 660000 kkiillooss.. TThhee pprroodduucctt ccaann bbee ssuupppplliieedd iinn bbuullkk ,, eeiitthheerr iinn ccyylliinnddeerr oorr ddiisskk--sshhaappee.. AAllssoo ssuupppplliieedd oonn ppaalllleettss.. BBrriiqquueetttteess rreeqquuiirree lleessss ssttoorraaggee ssppaaccee tthhaann ffiirreewwoooodd ((9900 mm33 ooff ffiirreewwoooodd ttaakkee uupp aarroouunndd 2255mm33 ooff ssppaaccee,, wwhhiicchh iiss eeqquuiivvaalleenntt ttoo aapppprrooxxiimmaatteellyy 1155 ttoonneess ooff bbrriiqquueetttteess))..

CCCCCCCCoooooooommmmmmmmppppppppaaaaaaaarrrrrrrraaaaaaaattttttttiiiiiiiivvvvvvvveeeeeeee ttttttttaaaaaaaabbbbbbbblllllllleeeeeeee bbbbbbbbeeeeeeeettttttttwwwwwwwweeeeeeeeeeeeeeeennnnnnnn ddddddddiiiiiiiiffffffffffffffffeeeeeeeerrrrrrrreeeeeeeennnnnnnntttttttt bbbbbbbbiiiiiiiioooooooommmmmmmmaaaaaaaassssssssssssssss bbbbbbbbrrrrrrrriiiiiiiiqqqqqqqquuuuuuuueeeeeeeetttttttttttttttteeeeeeeessssssss aaaaaaaannnnnnnndddddddd ffffffff iiiiiiiirrrrrrrreeeeeeeewwwwwwwwoooooooooooooooodddddddd

MMMMMMMMaaaaaaaatttttttteeeeeeeerrrrrrrriiiiiiiiaaaaaaaallllllll RRiiccee hhuusskk CCoottttoonn ((rreessiidduueess))

WWoooodd sshhaavviinnggss aanndd PPiinnuuss ssaawwdduusstt

WWoooodd sshhaavviinnggss aanndd nnoobbllee hhaarrddwwoooodd ssaawwdduusstt

WWoooodd sshhaavviinnggss aanndd eeuuccaallyyppttuuss ssaawwdduusstt CCoommmmeerrcciiaall FFiirreewwoooodd

HHHHHHHHeeeeeeeeaaaaaaaattttttttiiiiiiiinnnnnnnngggggggg vvvvvvvvaaaaaaaalllllllluuuuuuuueeeeeeee 33880000 44330000 44440000 44880000 44550000 11770000~~22550000

BBBBBBBBuuuuuuuullllllllkkkkkkkk wwwwwwwweeeeeeeeiiiiiiiigggggggghhhhhhhhtttttttt ((((((((mmmmmmmm³³³³³³³³)))))))) 665500~~770000 665500~~770000 770000~~775500 770000~~886600 770000~~778800 335500~~440000

SSSSSSSSppppppppeeeeeeeecccccccciiiiiiiiffffffffiiiiiiiicccccccc wwwwwwwweeeeeeeeiiiiiiiigggggggghhhhhhhhtttttttt ((((((((tttttttt)))))))) 11..11 11..11 11..1177 11..22 11..1188 00..66

MMMMMMMMooooooooiiiiiiiissssssssttttttttuuuuuuuurrrrrrrreeeeeeee ((((((((%%%%%%%%)))))))) 1111 1122 99 1122 1111 2255~~4455

BBRRIIQQUUEETTTTIINNGG EEUUCCAALLYYPPTTUUSS BBRRAAZZIILL BBIIOOMMAASSSS SSCC

Page 19: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS BBRRIIQQUUEETTTTIINNGG

BBRRIIQQUUEETTTTIINNGG EEUUCCAALLYYPPTTUUSS BBRRAAZZIILL BBIIOOMMAASSSS TTTTTTTTeeeeeeeecccccccchhhhhhhhnnnnnnnniiiiiiiiccccccccaaaaaaaallllllll CCCCCCCChhhhhhhhaaaaaaaarrrrrrrraaaaaaaacccccccctttttttteeeeeeeerrrrrrrriiiiiiiissssssssttttttttiiiiiiiiccccccccssssssss:::::::: OOuurr pprroodduucctt iiss mmaannuuffaaccttuurreedd bbyy mmeeaannss ooff aa ccoommppaaccttiinngg pprroocceessss aanndd pprreesseennttss

tthhee ffoolllloowwiinngg tteecchhnniiccaall iinnffoorrmmaattiioonn::

CCCCCCCChhhhhhhhaaaaaaaarrrrrrrraaaaaaaacccccccctttttttteeeeeeeerrrrrrrriiiiiiiissssssssttttttttiiiiiiiicccccccc VVVVVVVVaaaaaaaalllllllluuuuuuuueeeeeeee

DDDDDDDDiiiiiiiiaaaaaaaammmmmmmmeeeeeeeetttttttteeeeeeeerrrrrrrr 8855mmmm

AAAAAAAAsssssssshhhhhhhh ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 00,,6699%%

VVVVVVVVoooooooollllllllaaaaaaaattttttttiiiiiiiilllllllleeeeeeee MMMMMMMMaaaaaaaatttttttteeeeeeeerrrrrrrriiiiiiiiaaaaaaaallllllll ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 8844,,9911%%

FFFFFFFFiiiiiiiixxxxxxxxeeeeeeeedddddddd CCCCCCCCaaaaaaaarrrrrrrrbbbbbbbboooooooonnnnnnnn ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 1144,,1144%%

MMMMMMMMooooooooiiiiiiiissssssssttttttttuuuuuuuurrrrrrrreeeeeeee 0088,,6699%%((aapppprrooxxiimmaatteellyy))

DDDDDDDDeeeeeeeennnnnnnnssssssssiiiiiiiittttttttyyyyyyyy 11,,222266 ttoonn//mm33

CCCCCCCCaaaaaaaalllllllloooooooorrrrrrrriiiiiiiiffffffffiiiiiiiicccccccc VVVVVVVVaaaaaaaalllllllluuuuuuuueeeeeeee ((((((((PPPPPPPPCCCCCCCCSSSSSSSS)))))))) –––––––– DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee 44..551155,,0044 KKccaall

CCCCCCCCaaaaaaaarrrrrrrrbbbbbbbboooooooonnnnnnnn 4477,,5511%%

HHHHHHHHyyyyyyyyddddddddrrrrrrrrooooooooggggggggeeeeeeeennnnnnnn 0066,,1100%%

NNNNNNNNiiiiiiiittttttttrrrrrrrrooooooooggggggggeeeeeeeennnnnnnn 0000,,5500%%

MMMMMMMMoooooooonnnnnnnntttttttthhhhhhhhllllllllyyyyyyyy QQQQQQQQuuuuuuuuaaaaaaaannnnnnnnttttttttiiiiiiiittttttttyyyyyyyy 22222222000000000000000099999999 -------- 55..000000 ttoonn.. TThhee aannaallyysseess BBrriiqquueettttiinngg hhaadd bbeeeenn ddooiinngg aatt tthhee EEnneerrggyy LLaabboorraattoorryy UUFFPPRR//BBrraazziill..

BBRRIIQQUUEETTTTIINNGG PPIINNUUSS BBRRAAZZIILL BBIIOOMMAASSSS DDDDDDDDiiiiiiiiaaaaaaaammmmmmmmeeeeeeeetttttttteeeeeeeerrrrrrrr 8855mmmm

AAAAAAAAsssssssshhhhhhhh ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 00,,4499%%

VVVVVVVVoooooooollllllllaaaaaaaattttttttiiiiiiiilllllllleeeeeeee MMMMMMMMaaaaaaaatttttttteeeeeeeerrrrrrrriiiiiiiiaaaaaaaallllllll ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 8844,,9911%%

FFFFFFFFiiiiiiiixxxxxxxxeeeeeeeedddddddd CCCCCCCCaaaaaaaarrrrrrrrbbbbbbbboooooooonnnnnnnn ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 1144,,1144%%

MMMMMMMMooooooooiiiiiiiissssssssttttttttuuuuuuuurrrrrrrreeeeeeee 0088,,0000%%((aapppprrooxxiimmaatteellyy))

DDDDDDDDeeeeeeeennnnnnnnssssssssiiiiiiiittttttttyyyyyyyy 11,,330044 ttoonn//mm33

CCCCCCCCaaaaaaaalllllllloooooooorrrrrrrriiiiiiiiffffffffiiiiiiiicccccccc VVVVVVVVaaaaaaaalllllllluuuuuuuueeeeeeee ((((((((PPPPPPPPCCCCCCCCSSSSSSSS)))))))) –––––––– DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee 44..779955,,0044 KKccaall

CCCCCCCCaaaaaaaarrrrrrrrbbbbbbbboooooooonnnnnnnn 4477,,5511%%

HHHHHHHHyyyyyyyyddddddddrrrrrrrrooooooooggggggggeeeeeeeennnnnnnn 0066,,1100%%

NNNNNNNNiiiiiiiittttttttrrrrrrrrooooooooggggggggeeeeeeeennnnnnnn 0000,,5500%%

MMMMMMMMoooooooonnnnnnnntttttttthhhhhhhhllllllllyyyyyyyy QQQQQQQQuuuuuuuuaaaaaaaannnnnnnnttttttttiiiiiiiittttttttyyyyyyyy 22222222000000000000000099999999 -------- 55..000000 ttoonn.. TThhee aannaallyysseess BBrriiqquueettttiinngg hhaadd bbeeeenn ddooiinngg aatt tthhee EEnneerrggyy LLaabboorraattoorryy UUFFPPRR//BBrraazziill..

BBRRIIQQUUEETTTTIINNGG BBAAGGAASSSSEE SSUUGGAARR CCAANNEE DDDDDDDDiiiiiiiiaaaaaaaammmmmmmmeeeeeeeetttttttteeeeeeeerrrrrrrr 8855mmmm

AAAAAAAAsssssssshhhhhhhh ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 11,,5500%%

VVVVVVVVoooooooollllllllaaaaaaaattttttttiiiiiiiilllllllleeeeeeee MMMMMMMMaaaaaaaatttttttteeeeeeeerrrrrrrriiiiiiiiaaaaaaaallllllll ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 8899,,9911%%

FFFFFFFFiiiiiiiixxxxxxxxeeeeeeeedddddddd CCCCCCCCaaaaaaaarrrrrrrrbbbbbbbboooooooonnnnnnnn ((((((((DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee)))))))) 1166,,1144%%

MMMMMMMMooooooooiiiiiiiissssssssttttttttuuuuuuuurrrrrrrreeeeeeee 0099,,0000%%((aapppprrooxxiimmaatteellyy))

DDDDDDDDeeeeeeeennnnnnnnssssssssiiiiiiiittttttttyyyyyyyy 11,,222266 ttoonn//mm33

CCCCCCCCaaaaaaaalllllllloooooooorrrrrrrriiiiiiiiffffffffiiiiiiiicccccccc VVVVVVVVaaaaaaaalllllllluuuuuuuueeeeeeee ((((((((PPPPPPPPCCCCCCCCSSSSSSSS)))))))) –––––––– DDDDDDDDrrrrrrrryyyyyyyy BBBBBBBBaaaaaaaasssssssseeeeeeee 44..778800,,0044 KKccaall

CCCCCCCCaaaaaaaarrrrrrrrbbbbbbbboooooooonnnnnnnn 4477,,5511%%

HHHHHHHHyyyyyyyyddddddddrrrrrrrrooooooooggggggggeeeeeeeennnnnnnn 0066,,1100%%

NNNNNNNNiiiiiiiittttttttrrrrrrrrooooooooggggggggeeeeeeeennnnnnnn 0000,,5500%%

MMMMMMMMoooooooonnnnnnnntttttttthhhhhhhhllllllllyyyyyyyy QQQQQQQQuuuuuuuuaaaaaaaannnnnnnnttttttttiiiiiiiittttttttyyyyyyyy 22222222000000000000000099999999 -------- 44..000000 ttoonn.. TThhee aannaallyysseess BBrriiqquueettttiinngg hhaadd bbeeeenn ddooiinngg aatt tthhee EEnneerrggyy LLaabboorraattoorryy UUFFPPRR//BBrraazziill aanndd UUSSAA..

Page 20: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS PPOORRTT IIMMBBIITTUUBBAA,, SSAANNTTAA CCAATTAARRIINNAA

OOuurr ccoommppaannyy ooppeerraatteess ddiirreeccttllyy iinn tthhee ppoorrtt ooff IImmbbiittuubbaa,, SSaannttaa CCaattaarriinnaa.. TThhee PPoorrtt hhaass ssttrruuccttuurree ffoorr tthhee eexxppoorrtt ooff wwoooodd cchhiippss.. WWee pprreesseenntt ssoommee pphhoottooss ooff PPoorrttoo.. TThhee PPoorrtt ooff IImmbbiittuubbaa iiss llooccaatteedd iinn ccooaassttaall ssoouutthheerrnn ssttaattee ooff SSaannttaa CCaattaarriinnaa ttoo aabboouutt 9900 kkmm ffrroomm tthhee ccaappiittaall FFlloorriiaannooppoolliiss.. IInn aaddddiittiioonn,, wwiitthh ttwwoo hhiittss ppaavveedd,, oonnee nnoorrtthh aanndd oonnee ssoouutthh,, tthhee ppoorrtt ooff IImmbbiittuubbaa iiss ccoonnnneecctteedd ttoo tthhee BBRR--110011,, oonnee ooff tthhee mmoosstt iimmppoorrttaanntt hhiigghhwwaayyss ooff tthhee ccoouunnttrryy,, aalllloowwiinngg tthhee ddiissppllaacceemmeenntt aacccceessssiibbllee ttoo aallll rreeggiioonnss ooff BBrraazziill aanndd tthhee MMeerrccoossuurr ccoouunnttrriieess .. TThhee ccuurrrreenntt ddrraafftt ooff tthhee ppoorrtt iiss 99..6633 mmeetteerrss wwiitthh ttiiddee aavveerraaggee ooff 00..5500 mmeetteerrss,, eennoouugghh ttoo rreecceeiivvee vveesssseellss ooff ooiill aanndd ootthheerr ccaarrggooeess bbeettwweeeenn 3355,,000000 ttoo 4400,,000000 ttoonneess ccoonnssiiddeerriinngg aa ttiiddee ooff 11 mmeetteerr,, tthhee ddrraafftt ooff PPoorrtt iiss 1100..1133........

Page 21: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS CCAARRBBOONN CCRREEDDIITT BBIIOOMMAASSSS BBRRAAZZIILL Much of the raw materials we use for biomass comes from forests certified. Sustainable forestry practices and care management plans for economic viability, ecological integrity and social justice. We use 100% of forest production capacity, both for the production of wood chips or the use of forest residues in the form of biomass. The general aim is to reduce emissions of the greenhouse effect of gases through the establishment of sustainable forest plantations of eucalyptus for industrial purposes and co-generation of energy. Unlike fossil fuels or non-renewable, energy forests provide a great service environment in that it enables the recycling of CO2. In other words, from the photosynthesis, forests absorb the existing CO2 in the atmosphere, store the carbon in biomass and become a source of renewable energy. The Biomass Project also has a component for reducing emissions of methane (CH4). The replacement of the array of non-renewable fossil fuels by the burning of renewable biomass reduces the amount of greenhouse gases from human activities emitted into the atmosphere. Within the carbon market, the planting of forests energy may have benefits in two ways, through carbon sequestration done on plant growth and reduce emissions through the replacement of the energy matrix of fossil fuels by biomass. Our goal is the use of forest residues, which replace the emissions of methane from forest residues and reduce carbon emissions from fossil fuel combustion in the replacement of polluting energy matrix. The sequestration of carbon from forest plantings energy, is eligible within the Clean Development Mechanism - CDM, as activity of Forest / Forestry - A / R (the original English Aforestation / Reforestation), in the case of forests of eucalyptus and pine. The methodology AR-AM0005 was approved by the panel of methodologies of the UN Framework Convention for Climate Change. The use of the entire production chain from the tree, even a part for commerce and energy potential of biomass of forest residues in the co-generation of energy is a practice widely accepted within the CDM and markets volunteers, taking an important role in reducing emissions from fossil fuels recognized and accepted around the world. Reference Design for Reduced Emissions from the Use of Waste PowReference Design for Reduced Emissions from the Use of Waste PowReference Design for Reduced Emissions from the Use of Waste PowReference Design for Reduced Emissions from the Use of Waste Power Plant of the Forestry Production of Wood Chips and er Plant of the Forestry Production of Wood Chips and er Plant of the Forestry Production of Wood Chips and er Plant of the Forestry Production of Wood Chips and biomassbiomassbiomassbiomass. The first project of business that will generate the carbon credit involves the plant where Wood Chips used throughout the production chain for international business. Biomass in the form of wood is provided by owners of the region. The biomass wastes that would be stored in batteries in the open, Decomposing and generating methane will be used for industrial process. With the project the wood chips are avoiding the generation of methane. Project: Generating renewable energy source, in addition to avoiding the generation of methane. Reducing emissions (energy): 50,586 TCO2 - Reducing emissions (methane): 247,501 tCO2 Period of obtaining credits: 21 years (3 periods of 7 years) Value tonne of carbon: € 15 - Estimates of Revenue with carbon credits: U.S. $ 12072523.00 Reference Design for Reduced Emissions from Power Generation by Use of Forestry and Waste Biomass Power Plant by Reference Design for Reduced Emissions from Power Generation by Use of Forestry and Waste Biomass Power Plant by Reference Design for Reduced Emissions from Power Generation by Use of Forestry and Waste Biomass Power Plant by Reference Design for Reduced Emissions from Power Generation by Use of Forestry and Waste Biomass Power Plant by the cogeneration of Energythe cogeneration of Energythe cogeneration of Energythe cogeneration of Energy. The second project of business we are offering to the market and will be developed by a co-generation Power Plant Power with the use of forest residues and for the generation of electricity. Results in higher project for commercial use of biomass co-generation of energy in Brazil and one of the largest in the world, contributing substantially to sustainable development locally, both in view of mitigation of environmental problems as the current generation of municipal revenue. We have the approval of the Carbon Fund of the World Bank, resulting in perspective as a model for generating correct and monitored by certificates of carbon credits. Description of Project: The project consists of replacing the use of waste biomass to renewable (splinter of wood, sawdust, etc.). To generate steam and power. Project: Generating renewable energy source, in addition to avoiding the generation of methane arising from the storage of waste batteries in the open forest. Project: Replacing the consumption of 11,300 tonnes of fossil fuel and biomass to generate energy. Reducing emissions: 32,700 TCO2 - Amount of ton of carbon: € $ 15 The mill will operate providing electricity and heat from the same fuel, biomass, from the waste of our plant. In addition to supplying much of the energy consumption in the region, the Mill will strengthen the economy adding value to a product before it was discarded and would undermine the environment. We use the example of Tractebel Energy that sells carbon credits of the Office of Co-generation Lages, enterprise certified as Clean Development by the United Nations. The plant generates energy from waste from the logging industry in the region, avoiding the emission of methane gas would be released with the decomposition of wood and cause the increase of greenhouse effect with the consequent increase in the destruction of the ozone layer. With that attitude more the company strengthens its commitment to environmental preservation.

Page 22: Company Brazil Biomass and Renewable Energy

BBRRAAZZIILL BBIIOOMMAASSSS World energy problems.World energy problems.World energy problems.World energy problems. Consumption of energy dependent on fossil fuels (coal, oil, natural gas). Finite reserves of fossil fuels and high prices. The increase in consumption will continue (United States, China and India). Serious environmental and economic consequences from the use of fossil fuels and emission of greenhouse gases. Kyoto Protocol signed in 1997.Kyoto Protocol signed in 1997.Kyoto Protocol signed in 1997.Kyoto Protocol signed in 1997. Objectives of reducing greenhouse gas emissions. Adoption of common policies to reduce CO2 emissions Biomass - Renewable Energy. The content of carbon emitted during combustion of biomass was previously captured the atmosphere in a short time period - balance = zero balance. Strategic options Strategic options Strategic options Strategic options of Brazil Biomass and International:of Brazil Biomass and International:of Brazil Biomass and International:of Brazil Biomass and International: Solutions for the supply of fuel from renewable sources, the international market or the national market for co-generation of energy. Conversion of liabilities of carbon emissions in assets with economic recovery emissions avoided. Processing of forest biomass for sale to international customers. Installation of energy crops for production of biomass for commercial purposes and co-generation of energy. Minimizing the costs of disposal of waste from logging operations and its use as a product. Valuation of property and renewable energy products. Options used by Brazil Biomass and International.Options used by Brazil Biomass and International.Options used by Brazil Biomass and International.Options used by Brazil Biomass and International. Operation in the forest in the area of production and total recovery of wood and forest residues and the valuation policy of social and environmental responsibility. Experimentation, import and adaptation of technologies. Wood chips production of paper and forest biomass. Different types of biomass for different types of technologies. A product of high quality, certified in Brazil and Europe and used as an industrial source and a product in the form of biomass with the use of forest residues for the burning and the generation of energy. Innovation and integration of technology and operations to optimize the management models of different types of forest residues. Biomass Energy Plants in Brazil and the International :Biomass Energy Plants in Brazil and the International :Biomass Energy Plants in Brazil and the International :Biomass Energy Plants in Brazil and the International : Since inception, the Brazil Biomass and International BMC identified bottlenecks in the future commercial supply of biomass waste originated from forest and there is a demand and widespread use: Looking for international companies, increasing from Wood chips and biomass and that hardly can be satisfied with waste from forestry operations (tendency to grinding of wood and for increasing prices). Localization assent bit of forest residues. Advantages of Energy crops:Advantages of Energy crops:Advantages of Energy crops:Advantages of Energy crops: Energy crops with lower overall costs of production. Stabilization of prices and the pressure on timber and other forest products which currently derive raw material for other industrial sectors. Increased demand for biomass could be met with new areas of crops on a large scale. Objectives for 2009 and the Biomass Brazil International:Objectives for 2009 and the Biomass Brazil International:Objectives for 2009 and the Biomass Brazil International:Objectives for 2009 and the Biomass Brazil International: The process with new industrial production units in Rio de Janeiro, Northeast, Sao Paulo, Rio Grande do Sul and Parana. Produce and export to international customers 100,000 tones per month of paper Wood chips and pine and eucalyptus of 100,000 tones per month of forest biomass with the waste to the plants for co-generation of energy. Capture new energy markets. Start the conversion of consumption of fossil higher price associated with the production of industrial steam.