Download - Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Transcript
Page 1: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins,

remains to be discovered.

This seems highly unlikely.

—F. Crick (1958)

Page 2: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

ContentsContentsBasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA structure in biologyRNA structure in biology

RNA efferencingRNA efferencing

Page 3: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

CellCell

Source: “Molecular Cell Biology” by Lodish et al.

Page 4: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Biology” by Campbell & Reece

Page 5: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Cellular macromoleculesCellular macromolecules

Source: “Molecular Cell Biology” by Lodish et al.

Page 6: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

All nucleotides have a common All nucleotides have a common structurestructure

Source: “Molecular Cell Biology” by Lodish et al.

Page 7: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

There are five principal bases in nucleic There are five principal bases in nucleic acidsacids

A, G, T, C are present in DNAA, G, U, C are present in RNA

Source: “Molecular Cell Biology” by Lodish et al.

Page 8: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Nucleotide subunits are linked togethNucleotide subunits are linked together by phosphodiester bonds er by phosphodiester bonds

Source: “Molecular Cell Biology” by Lodish et al.

Page 9: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Nucleotide terminologyNucleotide terminology

Source: “Molecular Cell Biology” by Lodish et al.

Page 10: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Native DNA is a double helix of Native DNA is a double helix of complementary anti-parallel chains complementary anti-parallel chains

Hydrogen bonding between complementary base pairs (A-T or G-C) holds the two strands together

Source: “Molecular Cell Biology” by Lodish et al.

Page 11: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

DNADNA can undergo reversible strand can undergo reversible strand separationseparation

Source: “Molecular Cell Biology” by Lodish et al.

Page 12: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Biology” by Campbell & Reece

Page 13: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Molecular Cell Biology” by Lodish et al.

Page 14: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

ContentsContents

BasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA 2RNA 2ndnd structure in biology structure in biology

RNA efferencingRNA efferencing

Page 15: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Complementary sequences in RNA molecules Complementary sequences in RNA molecules maintain RNA secondary structure.maintain RNA secondary structure.

Source: “Bioinformatics” by David W. Mount

Page 16: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Features of RNA Secondary StructureFeatures of RNA Secondary Structure

In DNA, G≡CIn DNA, G≡C AA == TT

In RNA, G≡CIn RNA, G≡C AA == UU GG == UU

Page 17: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Features of RNA Secondary StructureFeatures of RNA Secondary Structure

Primary structurePrimary structure

↓↓

Secondary StructureSecondary Structure

↓↓

Tertiary StructureTertiary Structure

Page 18: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Types of single- & double-stranded regions in Types of single- & double-stranded regions in RNA secondary structures.RNA secondary structures.

Source: “Bioinformatics” by David W. Mount

Page 19: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Interaction of RNA secondary structural Interaction of RNA secondary structural elements.elements.

Source: “Bioinformatics” by David W. Mount

Page 20: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Display of base pairs in an RNA secondary Display of base pairs in an RNA secondary structure by a circle plot.structure by a circle plot.

Source: “Bioinformatics” by David W. Mount

Page 21: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

ContentsContentsBasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA structure in biologyRNA structure in biology

RNA efferencingRNA efferencing

Page 22: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

PredictionPrediction

Minimum Free-Energy Method

Sequence Co-variation

Page 23: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Global alignmentL G P S S K Q T G K G S – S R I W D N| | | | | | |L N – I T K S A G K G A I M R L G D A

Local alignment- - - - - - - - T G K G - - - - - - - | | |- - - - - - - - A G K G - - - - - - -

Adapted from “Bioinformatics” by D W Mount

Page 24: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

DOROTHY--------HODGKINDOROTHYCROWFOOTHODGKIN

Dotplot

Adapted from “Introduction to Bioinformatics“ by A M Lesk

Page 25: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Drosophila melanogaster SLIT protein against itself

http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html

Page 26: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

A G C T A G G A | | | | |C A C T A G G C

Dotplot

Page 27: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

5’ A C G U - - - - G C G U 3’

| | | |

3’ U G C G - - - - U G C A 5’

Page 28: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Bioinformatics” by David W. Mount

Page 29: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Bioinformatics” by David W. Mount

Page 30: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

RNA 2RNA 2ndnd Structure Website Structure Website

http://www.bioinfo.rpi.edu/~zukerm/rna/http://www.bioinfo.rpi.edu/~zukerm/rna/

Page 31: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 32: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 33: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 34: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 35: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

PredictionPrediction

Minimum Free-Energy Method

Sequence Co-variation

Page 36: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Bioinformatics” by David W. Mount

Page 37: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Bioinformatics” by David W. Mount

Page 38: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

RNA 2RNA 2ndnd Structure Website Structure Website

http://www.genebee.msu.su/services/rna2_reduced.htmlhttp://www.genebee.msu.su/services/rna2_reduced.html

Page 39: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC----1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC----2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA

Page 40: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 41: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

1 C1 CGGCGGGGTAGCGGGGTAGAAGCGCAAGCCTGGTAGCGCCTGGTAGCTTCGTCGGGCTCATAATCCTCCGTCGGGCTCATAATCCTCTTCCCCGCCCCGCCC----C----2 G2 GCCC-AGGATAC-AGGATAGGCTCTCCAGTTGGTAGAAGTTGGTAGAGGCAGAGGACTGAAAATCCGCCAGAGGACTGAAAATCCGCCCTCCCGTCCCGGGCACCACACCA3 G3 GCCC-AGGATAC-AGGATAGGCTCTCCAGTTGGTAGAAGTTGGTAGAGGCAGAGGACTGAATATCCGCCAGAGGACTGAATATCCGCCCTCCCGTCCCGGGCACCACACCA

Page 42: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Limitations of Prediction-AssumptionLimitations of Prediction-Assumption

The most likely structure is similar to the The most likely structure is similar to the energetically most stable structure.energetically most stable structure.

The energy associated with any position in The energy associated with any position in the structure is only influenced by local the structure is only influenced by local sequence and structure.sequence and structure.

The structure is assumed to be formed by The structure is assumed to be formed by folding of the chain back on itself in a folding of the chain back on itself in a manner that does not produce any knots.manner that does not produce any knots.

Source: “Bioinformatics” by David W. Mount

Page 43: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

ContentsContents

BasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA structure in biologyRNA structure in biology

RNA efferencingRNA efferencing

Page 44: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

RNA 2RNA 2ndnd structure in Biology structure in Biology

Nuclear RNA splicingNuclear RNA splicing

Group I/II intron splicingGroup I/II intron splicing

RibosomeRibosome

RNA sensorRNA sensor

Page 45: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Processing of eukaryotic mRNA Processing of eukaryotic mRNA

Source: “Molecular Cell Biology” by Lodish et al.

Page 46: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Molecular Cell Biology” by Lodish et al.

Page 47: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Gene VII” by Lewin

Page 48: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Interaction of the RNP motif from U1A Interaction of the RNP motif from U1A protein and RNAprotein and RNA

Figure 11-10

Source: “Molecular Cell Biology” by Lodish et al.

Page 49: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

hnRNP proteins may assist in processinhnRNP proteins may assist in processing and transport of mRNAsg and transport of mRNAs

Figure 11-11

Source: “Molecular Cell Biology” by Lodish et al.

Page 50: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Splicing occurs at short, conserved Splicing occurs at short, conserved sequencessequences

Figure 11-14

Consensus sequences around 5 and 3 splice sites in vertebrate pre-mRNA

Source: “Molecular Cell Biology” by Lodish et al.

Page 51: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Splicing proceeds via two sequential Splicing proceeds via two sequential transesterfication reactionstransesterfication reactions

Figure 11-16

Source: “Molecular Cell Biology” by Lodish et al.

Page 52: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Small nuclear RNAs (snRNAs) assist in Small nuclear RNAs (snRNAs) assist in the splicing reaction the splicing reaction

Figure 11-17

Source: “Molecular Cell Biology” by Lodish et al.

Page 53: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Spliceosomal splicing cycleSpliceosomal splicing cycle

Figure 11-19

Source: “Molecular Cell Biology” by Lodish et al.

Page 54: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Gene VII” by Lewin

Page 55: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Self-splicing group II introns provide Self-splicing group II introns provide clues to the evolution of snRNPsclues to the evolution of snRNPs

Figure 11-20

Source: “Molecular Cell Biology” by Lodish et al.

Page 56: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

RNA 2RNA 2ndnd structure in Biology structure in Biology

Nuclear RNA splicingNuclear RNA splicing

Group I/II intron splicingGroup I/II intron splicing

RibosomeRibosome

RNA sensorRNA sensor

Page 57: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Self-splicing group I introns were the firSelf-splicing group I introns were the first examples of catalytic RNAst examples of catalytic RNA

Figure 11-51

Source: “Molecular Cell Biology” by Lodish et al.

Page 58: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

A Preorganized Active Site in the Crystal Structure of the TA Preorganized Active Site in the Crystal Structure of the Tetrahymena etrahymena RibRibozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R. ozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R.

Cech*Cech*Science 282, 259~264 (1998)Science 282, 259~264 (1998)

Page 59: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

The ribozyme core is formed by the junThe ribozyme core is formed by the junction of four helicesction of four helices

Page 60: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

The model for P1’s interaction with the ribozyme juThe model for P1’s interaction with the ribozyme juxtaposes the guanosine-binding sitextaposes the guanosine-binding site

Source: “Molecular Cell Biology” by Lodish et al.

Page 61: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Gene VII” by Lewin

Page 62: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Gene VII” by Lewin

Page 63: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

RNA 2RNA 2ndnd structure in Biology structure in Biology

Nuclear RNA splicingNuclear RNA splicing

Group I/II intron splicingGroup I/II intron splicing

RibosomeRibosome

RNA sensorRNA sensor

Page 64: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Gene VII” by Lewin

Page 65: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Gene VII” by Lewin

Page 66: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Source: “Gene VII” by Lewin

Page 67: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

The Structural Basis of Ribosome The Structural Basis of Ribosome Activity in Peptide Bond SynthesisActivity in Peptide Bond Synthesis

Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter B. Moore and Thomas A. SteitzB. Moore and Thomas A. Steitz

Nature (2000) 289, 920~930Nature (2000) 289, 920~930

Page 68: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

The ribosome is a ribozymThe ribosome is a ribozyme.e.

Page 69: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 70: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 71: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 72: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

RNA 2RNA 2ndnd structure in Biology structure in Biology

Nuclear RNA splicingNuclear RNA splicing

Group I/II intron splicingGroup I/II intron splicing

RibosomeRibosome

RNA sensorRNA sensor

Page 73: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Thiamine derivatives bind messengerThiamine derivatives bind messengerRNAs directly to regulate bacterialRNAs directly to regulate bacterial

gene expressiongene expression

Wade Winkler*, Ali Nahvi† & Ronald R. Breaker*Wade Winkler*, Ali Nahvi† & Ronald R. Breaker*

Nature (2002) 419, 952~956.Nature (2002) 419, 952~956.

Page 74: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 75: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 76: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

http://rfam.wustl.edu/http://rfam.wustl.edu/

Page 77: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 78: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 79: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.
Page 80: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Sequence Alignment Scoring versus Structural Alignment Scoring Cell, 109, 137–140, 2002

Page 81: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

http://www.imb-jena.de/RNA.htmlhttp://www.imb-jena.de/RNA.html

Page 82: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

ContentsContentsBasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA structure in biologyRNA structure in biology

RNA efferencingRNA efferencing

Page 83: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

2,431 pairs of sense–antisense transcripts overlapping in the exons of the sense gene by at least 20 bases.NATURE VOL 420 (2002) p563

Page 84: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Science 296:p1263, 2002Science 296:p1263, 2002

A model for the molecular steps in RNA silencing.

Page 85: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Science 296:p1260, 2002Science 296:p1260, 2002

Page 86: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

Science 296:p1260, 2002Science 296:p1260, 2002

Page 87: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.

EMBO Report 2:p986, 2001EMBO Report 2:p986, 2001

Page 88: Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to.